DNS-szekvencia meghatározás

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "DNS-szekvencia meghatározás"

Átírás

1 DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1

2 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer (szabad 3 OH) dntp (datp, dctp, dgtp, dttp) új szál primer templát 5 1-2

3 Sanger, didezoxi láncterminációs módszer didezoxi származék + jelölés: pl. α32pdatp + jelölés: pl. α32pdatp + jelölés: pl. α32pdatp poliakrilamid gélelektroforézis 3-3

4 Poliakrilamid gélelektroforézis - PAGE AA Hagyományos szekvenáló készülék bisaa PAGE: a gél kialakítása polimerizációval, keresztkötések bisakrilamid segítségével, a két komponens aránya (AA, bis-aa), koncentrációja határozza meg a gél felbontó képességét. Egyszálú DNS elválasztás szekvenálás DNS, RNS elválasztás (etídium bromiddal festés) fehérje elválasztás denaturáló fehérje gél: SDS PAGE 2D PAGE poliszacharidok elválasztása DNS szekvenálás Denaturáló gél, urea, egyszálú, jelölt DNS felbontó képesség 1 bázis! (kb bázis hosszúságú tartományban). Szekvenáló automaták: fluoreszcens festékekkel a detektálás (leolvasás) automatizálható (lásd később) Bioinformatika: részszekvenciák összeszerelése, kiértékelése, génkeresés lásd Bioinformatika kurzus 3-4

5 Szekvenáló gélről készült autoradiogram és egy részlete. Az egy DNS mintához tartozó reakciók a filmre rajzolt vonalakkal utólag lettek bejelölve (A, C, G, T reakciók) 3-5

6 ACGT a aa cc t ct a t a 3-6

7 NEMRADIOAKTÍV JELÖLÉS Fluoreszcens jelölés fluoreszcein12- dutp 3-7

8 Négyféle, különböző hullámhosszon fluoreszkáló ddntp származék alkalmazásával, ugyanabban a reakcióban is meghatározható, hogy milyen bázisra végződik egy adott hosszúságú DNS-szál. 3-8

9 Automata detektálás az elválasztás során, automatizált DNS-szekvenáló készülék. Az informatka és a robotika fejlődése révén lehetővé vált nagy mennyiségű DNS-szekvencia meghatározása. Szekvenáló gyárak, genomprojektek. Bioinformatika. 3-9

10 PRIMER szekvenálási reakció, 500 bp inszert, ismeretlen szekvencia Szekvenálási stratégia: - meghatározás átfedő szakaszokban - mindkét irányban (szálon) - klónozás jelentősége, inszert orientáció ismerete Genom szekvenálás shot gun klónozás (random) és szekvenálás 6-10 x es lefedettség, 3-10

11 3-11

12 3-12

13 GENOM SZEKVENÁLÁS A random tördelt fragmentek klónozása, sok millió klón szekvenálása, az adatok feldolgozása, a szekvencia összeszerelése automatikus. 12x es lefedettség minden egyes bázisra. Ha egy olvasásban egy ponton hiba van, még 11 másik szekvencia megmutatja a konszenzus, korrekt szekvenciát. Nincs szükség és lehetőség az egyedi olvasások hibáinak javítására. 3-13

14 PRC Polimeráz láncreakció polymerase chain reaction Kary Mullis

15 A PCR reakció összetevői A PCR ciklus 1) templát DNS 2) datp, dctp, dgtp, dttp (dntp-k) 3) hőstabil DNS polimeráz (Taq polimeráz) 4) 2 db oligonukleotid primer 1. denaturáció 94 oc A két primer által meghatározot DNS szakasz in vitro megsokszorozása egymást követő ciklusokban. DNS szálak szétválasztása 2. annealing oc a primerek kötődése 3. extension 72 oc az új szálak szintézise ismétlés 30-35x 5 GACACCATCGAATCACGCAAAACCTTTCGCGGTATGGCA N --CAATTCAGGGTGGTGAATGTGAATGTCAGTAACGTTATACG 3 3 CTGTGGTAGCTTAGTGCGTTTTGGAAAGCGCCATACCGT N --GTTAAGTCCCACCACTTACACTTACAGTCATTGCAATATGC 5 denaturáció és annealing 5 GACACCATCGAATCACGCAAAACCTTTCGCGGTATGGCA N --CAATTCAGGGTGGTGAATGTGAATGTCAGTAACGTTATACG 3 ACAGTCATTGCAATATGC 5 5 GACACCATCGAATCAC 3 CTGTGGTAGCTTAGTGCGTTTTGGAAAGCGCCATACCGT N --GTTAAGTCCCACCACTTACACTTACAGTCATTGCAATATGC 5 felső primer: alsó primer: 5 GACACCATCGAATCAC 3 16-mer, 5 CGTATAACGTTACTGACA 3 18-mer, Tm= 54,3 C Tm= 54,2 C 3-15

16 3-16

17 3-17

18 3-18

19 3-19

20 3-20

21 3-21

22 3-22

23 3-23

24 3-24

25 2 (8) 3-25

26 2 (8) 3-26

27 8 (22) 3-27

28 22 (52) 3-28

29 3-29

30 3-30

31 3-31

32 3-32

33 A PCR program perc 94 C 30 mp 94 C 30 mp 56 C a hőmérséklet a primerek szekvenciájától függ 40 mp 72 C az idő a termék hosszától függ (60 nt/sec) 32x GO TO 2. end (Részletesebb leírás a gyakorlatos jegyzetben.) Primer tervezés 1. A két primer olvadáspontja (Tm) lehetőleg azonos legyen Tm = 4x(G+C) + 2x(A+T)* Ta= Tm ± (2-5 C) C 2. erős másodlagos szerkezetek ne legyenek 3. termék bp között primer hajtű (hairpin) primer dimer *pontatlan megközelítés, csak annak szemléltetésére jó, hogy magasabb GC tartalom, vagy több nukleotid magasabb Tm értéket eredményez. Valós számítások különböző programokkal: 3-33

34 PCR alkalmazások 1) Klónozás - előny: géntár készítés nélkül; hátrány: max bp, nehezen!) 2) diagnózis, mutációk kimutatása 3) heterológ v. degenerált primerekkel rokon, homológ szekvenciák klónozása 4) génsebészet restrikciós helyek bevitele 5) mutáció, más szekvencia bevitele 6) régi szövetmintákből DNS felsokszorozása, szekvenálása (csont, mag honfoglalás kori leletek, neandervölgyi ember) 7) azonosítás kevés mintából: Romanovok, bűnüldözés, katasztrófáknál azonosítás, szülők azonosítása 8) genetikai térképezésnél DNS markerek RAPD, random amplified polymorfic DNA 9) Hibridizáció helyett DNS-szakasz azonosítás 10) mrns kimutatás, génexpresszió mérés, RT-PCR, real time PCR mennyiségi összehasonlításokhoz 3-34

35 Egyedi azonosítás: mikroszatellita vagy simple sequence repeat (SSR) nem kódoló régiók vizsgálata monoton, ismétlődő szekvenciák, két oldalukon egyedi szekvenciákkal, nem kódol, minden mutáció rögzül, populáción belül is sok eltérés, apai és anyai allél sok, hasonló szakasz vizsgálatával lehetséges a teljesen egyedi azonosítás 3-35

36 3-36

37

38 lambda PstI 100 bp ladder Molekuláris biológia gyakorlat elválasztás agaróz gélen hallgatói minták rosszabb felbontás, mint a poliakrilamid gélen Részletesebb leírás a gyakorlatos jegyzetben. 800 bp 700 bp 600 bp 500 bp 400 bp 3-38

A GENOM MEGISMERÉSÉNEK MÓDSZEREI

A GENOM MEGISMERÉSÉNEK MÓDSZEREI A GENOM MEGISMERÉSÉNEK MÓDSZEREI 20 GENETIKA ALAPOK 3-1 Jóslatok és a valóság a molekuláris biológiában. Mennyire látható előre a tudomány fejlődése? 1968 Simone de Beauvoir "Minden ember halandó" 1-2

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi

Részletesebben

Új temékek az UD-GenoMed Kft. kínálatában!

Új temékek az UD-GenoMed Kft. kínálatában! Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai

Részletesebben

Könyvtárak, szekvenálás, mutagenezis

Könyvtárak, szekvenálás, mutagenezis Könyvtárak, szekvenálás, mutagenezis GÉNKÖNYVTÁRAK GENOMIÁLIS KÖNYVTÁR (könyvtár rendelésre: pl. Stratagene) vektor: -fág (helyettesítő), kozmid, YAC, PAC, BAC méret: N = ln(1-p)/ln[1-(i/g)] klónok száma

Részletesebben

5. Molekuláris biológiai technikák

5. Molekuláris biológiai technikák 5. Molekuláris biológiai technikák DNS szaporítás kémcsőben és élőben. Klónozás, PCR, cdna, RT-PCR, realtime-rt-pcr, Northern-, Southernblotting, génexpresszió, FISH 5. Molekuláris szintű biológiai technikák

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

ADATBÁNYÁSZAT I. ÉS OMICS

ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT

Részletesebben

Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze

Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze László Éva Babeş-Bolyai Tudományegyetem, Kolozsvár A polimeráz láncreakció (PCR) napjaink molekuláris biológiai (genetikai) kutatásának nélkülözhetetlen

Részletesebben

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel Gyakorlat helye: BIOMI Kft. Gödöllő, Szent-Györgyi A. u. 4. (Nemzeti Agrárkutatási és Innovációs Központ épülete volt

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

Növényi minták GMO-tartalmának kvalitatív meghatározása

Növényi minták GMO-tartalmának kvalitatív meghatározása Növényi minták GMO-tartalmának kvalitatív meghatározása Uri Csilla 1 Prokisch József 1 Sándor Erzsébet 2 Győri Zoltán 1 Debreceni Egyetem Agrártudományi Centrum, Mezőgazdaságtudományi Kar, 1 Élelmiszertudományi,

Részletesebben

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR)

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR) Genomika (A genom, génállomány vizsgálata) Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel DNS szekvenálási eljárások DNS ujjlenyomat (VNTR) DNS chipek statikus és dinamikus információk vizsgálata

Részletesebben

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6 Agilent 2100 Bioanalyzer mikrokapilláris gélelektroforézis rendszer G2943CA 2100 Bioanalyzer system forgalmazó: Kromat Kft. 1112 Budapest Péterhegyi u. 98. t:36 (1) 248-2110 www.kromat.hu bio@kromat.hu

Részletesebben

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód)

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2.1 Nukleotidok, nukleinsavak Információátadás (örökítőanyag) Információs egység

Részletesebben

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Szántó-Egész Réka 1, Mohr Anita 1, Sipos Rita 1, Dallmann Klára 1, Ujhelyi Gabriella 2, Koppányné Szabó Erika

Részletesebben

Nukleinsavak. Szerkezet, szintézis, funkció

Nukleinsavak. Szerkezet, szintézis, funkció Nukleinsavak Szerkezet, szintézis, funkció Nukleinsavak, nukleotidok, nukleozidok 1869-ben Miescher a sejtmagból egy savas természetű, lúgban oldódó foszfortartalmú anyagot izolált, amit később, eredetére

Részletesebben

A PCR TECHNIKA ÉS ALKALMAZÁSI TERÜLETEI

A PCR TECHNIKA ÉS ALKALMAZÁSI TERÜLETEI Polimeráz láncreakció A PCR TECHNIKA ÉS ALKALMAZÁSI TERÜLETEI Tetszõleges DNS-szakaszról (templát) rövid idõ alatt korlátlan számú másolatot készíthetünk két iniciáló oligonukleotid (primer) és a DNS-polimeráz

Részletesebben

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A NÖVÉNYGENETIKA Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 A citológia és a genetika társtudománya Citogenetika A kromoszómák eredetét, szerkezetét, genetikai funkcióját,

Részletesebben

A géntechnológiát megalapozó felfedezések

A géntechnológiát megalapozó felfedezések 2010. december BIOTECHNOLÓGIA Rova tvezető: Dr. Heszky László akadémikus A géntechnológia genetikai alapjai c. I. fejezet 1-5. részében azokat a tudományos eredményeket mutattuk be, melyek bizonyítják,

Részletesebben

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Rohonczy Kata, Zoller Linda, Fodor Andrea, Tabajdiné, dr. Pintér Vera FoodMicro Kft. Célkitűzés Élelmiszerekben és takarmányokban

Részletesebben

Népegészségügyi genomika

Népegészségügyi genomika Népegészségügyi genomika Népegészségügyi genomika Tartalom 1. A genom szerkezete... 1 1. A genom szerkzet... 1 1.1. Bevezetés a humán genom... 1 1.2. A genetika rövid története... 1 2. A DNS szerkezete...

Részletesebben

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika DNS munka a gyakorlatban 2012.10.12. Természetvédelmi genetika Munka fázisok DNS kivonás elektroforézis (fakultatív lépés) PCR Elektroforézis Szekvenálás Szekvencia elemzés faji azonosítás; variabilitás,

Részletesebben

A DNS replikációban kulcsszerepet játszó PCNA fehérje variánsok előállítása és rekombináns DNS technológia segítségével való kifejezése

A DNS replikációban kulcsszerepet játszó PCNA fehérje variánsok előállítása és rekombináns DNS technológia segítségével való kifejezése A DNS replikációban kulcsszerepet játszó PCNA fehérje variánsok előállítása és rekombináns DNS technológia segítségével való kifejezése PCNA (Proliferating Cell Nuclear Antigen) Csiszár Mónika, Kós Tamás,

Részletesebben

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott

Részletesebben

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!!

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!! Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció 1859 1865 1869 1952 Hershey & Chase 1953!!! 1879 1903 1951 1950 1944 1928 1911 1 1. DNS szerkezete Mi az örökítő anyag? Friedrich Miescher

Részletesebben

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia Fehérje expressziós rendszerek Gyógyszerészi Biotechnológia Expressziós rendszerek Cél: rekombináns fehérjék előállítása nagy tisztaságban és nagy mennyiségben kísérleti ill. gyakorlati (therapia) felhasználásokra

Részletesebben

Szervrendszerek szintje. Szervek szintje. Atomok szintje. Sejtek szintje. Szöveti szint. Molekulák szintje

Szervrendszerek szintje. Szervek szintje. Atomok szintje. Sejtek szintje. Szöveti szint. Molekulák szintje Egyed szintje Ökoszisztéma Szervrendszerek szintje Szervek szintje Szöveti szint Sejtek szintje Atomok szintje Molekulák szintje TARTALOM: 1. Molekuláris biológiai/genetikai technikák 2. A genomika technikái

Részletesebben

Molekuláris biológiai technikák

Molekuláris biológiai technikák Molekuláris biológiai technikák Wunderlich Lívius A Molekuláris biológiai technikák jegyzet igyekszik átfogó képet adni a jövő tudományának, a molekuláris biológiának a módszertanáról. A technikák elméleti

Részletesebben

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G.

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G. 1955: 46 emberi kromoszóma van 1961: mrns 1975: DNS szekvenálás 1982: gén-bank adatbázisok 1983: R (polymerase chain reaction) Mérföldkövek 1 J. D. Watson F. H.. rick 2008 1953 2003 Watson genomja DNS

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

genetikai variációk, szerepük k a mindennapi transzfúziológiai ziológiai gyakorlatban

genetikai variációk, szerepük k a mindennapi transzfúziológiai ziológiai gyakorlatban A vércsoport v rendszereket érintő genetikai variációk, szerepük k a mindennapi transzfúziológiai ziológiai gyakorlatban Tordai Attila OVSZK Molekuláris Diagnosztikai Labor Transzfúzi ziólógiai szinten

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

Genetika. Tartárgyi adatlap: tantárgy adatai

Genetika. Tartárgyi adatlap: tantárgy adatai Genetika Előadás a I. éves Génsebészet szakos hallgatók számára Tartárgyi adatlap: tantárgy adatai 2.1. Tantárgy címe Genetika 2.2. Előadás felelőse Dr. Mara Gyöngyvér, docens 2.3. Egyéb oktatási tevékenységek

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

PÉCSI TUDOMÁNYEGYETEM. Természetes és mesterséges agrobaktérium rezisztencia vizsgálata szőlőben. Galambos Anikó

PÉCSI TUDOMÁNYEGYETEM. Természetes és mesterséges agrobaktérium rezisztencia vizsgálata szőlőben. Galambos Anikó PÉCSI TUDOMÁNYEGYETEM Biológiai Doktori Iskola Genetika program Természetes és mesterséges agrobaktérium rezisztencia vizsgálata szőlőben PhD értekezés tézisei Galambos Anikó Témavezető: Dr. Putnoky Péter

Részletesebben

DNS-számítógép. Balló Gábor

DNS-számítógép. Balló Gábor DNS-számítógép Balló Gábor Bevezetés A nukleinsavak az élő szervezetek egyik legfontosabb alkotórészei. Ezekben tárolódnak ugyanis az öröklődéshez, és a fehérjeszintézishez szükséges információk. Bár a

Részletesebben

MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék. Atomoktól a csillagokig, Budapest, február 23.

MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék. Atomoktól a csillagokig, Budapest, február 23. MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék Atomoktól a csillagokig, Budapest, 2017. február 23. Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája

Részletesebben

I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika

I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika A genomika főbb területei Strukturális (szerkezeti ) genomika Funkcionális (működési) genomika Transzkriptomika Proteomika Integratív

Részletesebben

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód)

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2.1 Nukleotidok, nukleinsavak Információátadás (örökítőanyag) Információs egység

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel Gyakorlat helye: BIOMI Kft. Gödöllő, Szent-Györgyi A. u. 4. (Mezőgazdasági Biotechnológiai Kutatóközpont épülete)

Részletesebben

2011. január április 10. IPK Gatersleben (Németország) május 17. Kruppa Klaudia

2011. január április 10. IPK Gatersleben (Németország) május 17. Kruppa Klaudia 2011. január 10. 2011. április 10. IPK Gatersleben (Németország) Gatersleben (G-life) Country State District Town Administration Germany Saxony-Anhalt Salzlandkreis Seeland Basic statistics Area 16.00

Részletesebben

A genetikai lelet értelmezése monogénes betegségekben

A genetikai lelet értelmezése monogénes betegségekben A genetikai lelet értelmezése monogénes betegségekben Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika A ~20 ezer fehérje-kódoló gén a 23 pár kromoszómán A kromoszómán található bázisok száma: 250M

Részletesebben

3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció

3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció 3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció A vírus genetikai anyagának vizsgálata (direkt víruskimutatási módszer) biztosítja a legrészletesebb és legspecifikusabb információkat a kimutatott

Részletesebben

DR. KOVÁCS ANDRÁS egyetemi tanár, az MTA doktora TÉMAVEZETŐ: Dr. Czeglédi Levente Ph.D. FAJAZONOSÍTÁS ÉLELMISZEREKBŐL PCR SSCP METODIKA FEJLESZTÉSÉVEL

DR. KOVÁCS ANDRÁS egyetemi tanár, az MTA doktora TÉMAVEZETŐ: Dr. Czeglédi Levente Ph.D. FAJAZONOSÍTÁS ÉLELMISZEREKBŐL PCR SSCP METODIKA FEJLESZTÉSÉVEL DEBRECENI EGYETEM Mezőgazdaság-, Élelmiszertudományi és Környezetgazdálkodási Kar ÁLLATTENYÉSZTÉSI TUDOMÁNYOK DOKTORI ISKOLA Doktori Iskola vezető: DR. KOVÁCS ANDRÁS egyetemi tanár, az MTA doktora TÉMAVEZETŐ:

Részletesebben

Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben

Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben Dr. Kovács Tamás, Kovács Árpád László Kármentesítés Aktuális Kérdései 2013 Budapest, 2013.03.21-22 Bioremediáció során

Részletesebben

BEVEZETÉS CÉLKITŰZÉS

BEVEZETÉS CÉLKITŰZÉS BEVEZETÉS A molekuláris biológiai és genetikai módszerek gyors fejlődése egyre inkább tért hódít a növénynemesítés különböző területein, így a kukoricanemesítésben is. A növényi fenotípusos jellemzők és

Részletesebben

cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system

cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test, v2.0 MPX v2.0 96 Tests P/N: 05969492 190 cobas TaqScreen MPX Control Kit,

Részletesebben

A BIOTECHNOLÓGIA ALKALMAZÁSI LEHETŐSÉGEI A GYÓGYSZERKUTATÁSBAN

A BIOTECHNOLÓGIA ALKALMAZÁSI LEHETŐSÉGEI A GYÓGYSZERKUTATÁSBAN Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 A BIOTECHNOLÓGIA

Részletesebben

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.)

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.) Genomika Új korszak, paradigmaváltás, forradalom: a teljes genomok ismeretében a biológia adatokban gazdag tudománnyá válik. Új kutatási módszerek, új szemlélet. Hajtóerõk: Genomszekvenálási projektek

Részletesebben

GENOMIKA Fogalmak genom genetika genomika szerkezetét összehasonlít funkcióit A genomika főbb területei (1) Strukturális (szerkezeti) genomika (2)

GENOMIKA Fogalmak genom genetika genomika szerkezetét összehasonlít funkcióit A genomika főbb területei (1) Strukturális (szerkezeti) genomika (2) GENOMIKA Fogalmak A genom az élőlényekben, illetve azok egyetlen sejtjében található öröklési anyag (DNS) teljes állománya. A genetika a tulajdonságok öröklésével, egyes gének szerkezetével és működésével

Részletesebben

Géntechnológia és fehérjemérnökség

Géntechnológia és fehérjemérnökség Géntechnológia és fehérjemérnökség elektronikus-jegyzet szerzők: Az ELTE Biokémiai Tanszék Munkaközössége Alexa Anita (12. és 13. fejezet), Fodor Krisztián (3. és 9. fejezet), Garai Ágnes (4. és 5. fejezet),

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

DNS KLÓNOZÁS: Egy DNS molekula megsokszorozása. In vivo-különféle gazdasejtekben

DNS KLÓNOZÁS: Egy DNS molekula megsokszorozása. In vivo-különféle gazdasejtekben DNS KLÓNOZÁS DNS KLÓNOZÁS: Egy DNS molekula megsokszorozása In vitro-pcr In vivo-különféle gazdasejtekben POLIMERÁZ LÁNCREAKCIÓ (PCR) PCR A POLIMERÁZ LÁNC REAKCIÓ DNS MOLEKULÁK MEGSOKSZOROZÁSÁRA (AMPLIFIKÁLÁSÁRA)

Részletesebben

A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában. Derzsy Napok, Sárvár, 2011 Június 2-3.

A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában. Derzsy Napok, Sárvár, 2011 Június 2-3. A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában Pénzes Zoltán PhD, Soós Pál PhD, Nógrády Noémi PhD, Varga Mária, Jorge Chacón PhD, Zolnai Anna PhD, Nagy Zoltán

Részletesebben

Evolúcióbiológia. Biológus B.Sc tavaszi félév

Evolúcióbiológia. Biológus B.Sc tavaszi félév Evolúcióbiológia Biológus B.Sc. 2011. tavaszi félév A biológiában minden csak az evolúció fényében válik érthetővé Theodosius Dobzhansky : Nothing in biology makes sense except in the light of evolution.

Részletesebben

DNS KLÓNOZÁS: Egy DNS molekula. In vivo-különféle gazdasejtekben

DNS KLÓNOZÁS: Egy DNS molekula. In vivo-különféle gazdasejtekben DNS KLÓNOZÁS DNS KLÓNOZÁS: Egy DNS molekula megsokszorozása In vitro-pcr In vivo-különféle gazdasejtekben POLIMERÁZ LÁNCREAKCIÓ (PCR) PCR A POLIMERÁZ LÁNC REAKCIÓ DNS MOLEKULÁK MEGSOKSZOROZÁSÁRA (AMPLIFIKÁLÁSÁRA)

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

Génkifejeződési vizsgálatok. Kocsy Gábor

Génkifejeződési vizsgálatok. Kocsy Gábor Génkifejeződési vizsgálatok MTA Mezőgazdasági Kutatóintézete Növényi Molekuláris Biológia Osztály A génkifejeződés A sejtmag géneket tartalmaz; (fehérjéket, RNSeket kódoló); A gének átíródnak mrns; Pre-mRNS

Részletesebben

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi

Részletesebben

A növény inváziójában szerepet játszó bakteriális gének

A növény inváziójában szerepet játszó bakteriális gének A növény inváziójában szerepet játszó bakteriális gének merisztéma korai szimbiotikus zóna késői szimbiotikus zóna öregedési zóna gyökér keresztmetszet NODULÁCIÓ növényi jel Rhizobium meliloti rhizobium

Részletesebben

Molekuláris biológiai vizsgálatok

Molekuláris biológiai vizsgálatok Molekuláris biológiai vizsgálatok Készítette: Dr. Polgár Beáta Dr. Schneider György 2015 Tartalomjegyzék Általános bevezető 1. Hibridizációs módszerek Szilárd fázisú hibridizáció 1.1. Southern blot 1.2.

Részletesebben

I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.

Részletesebben

cobas TaqScreen MPX Test for use on the cobas s 201 system

cobas TaqScreen MPX Test for use on the cobas s 201 system cobas TaqScreen MPX Test for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test MPX 96 Tests P/N: 04584244 190 cobas TaqScreen MPX Control Kit MPX CTL 6 Sets P/N: 04626290

Részletesebben

Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai probléma vizsgálata genetikai módszerekkel

Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai probléma vizsgálata genetikai módszerekkel Földtan, őslénytan, flóra, fauna, természetvédelem www.mecsek.gportal.hu 2013.07.01. Szerkesztő: Fazekas Imre E-mail: fazekas.hu@gmail.com Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai

Részletesebben

Molekuláris biológiai diagnosztika alkalmazása

Molekuláris biológiai diagnosztika alkalmazása Molekuláris biológiai diagnosztika alkalmazása (HIV, HCV, HBV szabad vírus mennyiség meghatározás) a napi rutin diagnosztikában Reichenberger Anna Mária, Dr. Sárvári Csilla Dr. Ujhelyi Eszter Fıvárosi

Részletesebben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben esirna mirtron BEVEZETÉS TÉMAKÖRÖK Ősi RNS világ RNS-ek tradicionális szerepben bevezetés BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek

Részletesebben

CIÓ A GENETIKAI INFORMÁCI A DNS REPLIKÁCI

CIÓ A GENETIKAI INFORMÁCI A DNS REPLIKÁCI A GENETIKAI INFORMÁCI CIÓ TÁROLÁSA ÉS S KIFEJEZŐDÉSE A DNS SZERKEZETE Két antiparalel (ellentétes lefutású) polinukleotid láncból álló kettős helix A két lánc egy képzeletbeli közös tengely körül van feltekeredve,

Részletesebben

ÚJ GENERÁCIÓS SZEKVENÁLÁS

ÚJ GENERÁCIÓS SZEKVENÁLÁS VÍZMIKROBIOLÓGUSOK XI. ORSZÁGOS KONFERENCIÁJA - 2012 ÚJ GENERÁCIÓS SZEKVENÁLÁS LEHETŐSÉG, VAGY NEHÉZSÉG? MÁRIALIGETI KÁROLY EÖTVÖS LORÁND TUDOMÁNYEGYETEM, BUDAPEST 1953 JAMES D. WATSON, FRANCIS CRICK:

Részletesebben

UV-sugárzást elnyelő vegyületek vizsgálata GC-MS módszerrel és kimutatásuk környezeti vízmintákban

UV-sugárzást elnyelő vegyületek vizsgálata GC-MS módszerrel és kimutatásuk környezeti vízmintákban UV-sugárzást elnyelő vegyületek vizsgálata GC-MS módszerrel és kimutatásuk környezeti vízmintákban Készítette: Kovács Tamás Környezettudomány szakos hallgató Témavezető: Zsigrainé Dr. Vasanits Anikó adjunktus

Részletesebben

cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system

cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test, v2.0 MPX v2.0 96 Tests P/N: 05969492 190 cobas TaqScreen MPX Control Kit,

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

A tárgy címe: Bioinformatika

A tárgy címe: Bioinformatika A tárgy címe: Bioinformatika Kötelezően választható tárgy IV. és V. évfolyamos biológus hallgatók számára; heti 2+3 óra Előkövetelmény: Biokémia főkollégium; genetika főkollégium; alapszintű számítógépes

Részletesebben

DOKTORI ÉRTEKEZÉS. Molekuláris biológiai módszerek fejlesztése gluténmentesség ellenırzésére. Némedi Erzsébet

DOKTORI ÉRTEKEZÉS. Molekuláris biológiai módszerek fejlesztése gluténmentesség ellenırzésére. Némedi Erzsébet DOKTORI ÉRTEKEZÉS Molekuláris biológiai módszerek fejlesztése gluténmentesség ellenırzésére Némedi Erzsébet Központi Élelmiszer-tudományi Kutatóintézet Budapest 2009 TARTALOMJEGYZÉK JELÖLÉSEK ÉS RÖVIDÍTÉSEK

Részletesebben

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45

Részletesebben

MIKROSZATELLITEK ADAPTÁLÁSA ÉS IZOLÁLÁSA PULYKA ÉS LÚD ÁLLOMÁNYOK VIZSGÁLATÁHOZ

MIKROSZATELLITEK ADAPTÁLÁSA ÉS IZOLÁLÁSA PULYKA ÉS LÚD ÁLLOMÁNYOK VIZSGÁLATÁHOZ Szent István Egyetem MIKROSZATELLITEK ADAPTÁLÁSA ÉS IZOLÁLÁSA PULYKA ÉS LÚD ÁLLOMÁNYOK VIZSGÁLATÁHOZ Doktori (PhD) értekezés Kurjákné Korom Edit Gödöllő 2013 A doktori iskola megnevezése: Állattenyésztés-tudományi

Részletesebben

PÉCSI TUDOMÁNYEGYETEM. Agrobacterium rezisztencia térképezése szőlőben. Kuczmog Anett

PÉCSI TUDOMÁNYEGYETEM. Agrobacterium rezisztencia térképezése szőlőben. Kuczmog Anett PÉCSI TUDOMÁNYEGYETEM Biológia Doktori Iskola Genetika program Agrobacterium rezisztencia térképezése szőlőben PhD értekezés Kuczmog Anett Témavezető: Dr. Putnoky Péter egyetemi tanár PÉCS, 2012. 1. BEVEZETÉS

Részletesebben

NANOTECHNOLOGIA 6. előadás

NANOTECHNOLOGIA 6. előadás NANOTECHNOLOGIA 6. előadás A plazmid: Ha meg akarjuk ismerni egy fehérje működését, akkor sokat kell belőle előállítanunk. Ezt akár úgy is megtehetjük, hogy a kívánt géndarabot egy baktérumba ültetjük

Részletesebben

A Legionella jelenlétének kimutatása

A Legionella jelenlétének kimutatása A Legionella jelenlétének kimutatása Diagnosztikai lehetőségek Kari András Budapest 2016. 04.07. Legionella nemzetség: aerob coccoid-pálca Gram (gyengén festődik) kataláz +, oxidáz +, hippurátot hidrulizálja

Részletesebben

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan fehérjét (FC-1 killer toxint) választ ki a tápközegbe, amely elpusztítja az opportunista patogén Cryptococcus neoformans-t.

Részletesebben

A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish.

A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish. OTKA K67808 zárójelentés 2012. A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish. A fluoreszcens in situ hibridizáció (FISH) olyan technikai fejlettséget ért

Részletesebben

Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 424 A PROLAKTIN RECEPTOR GÉN HATÁSA A MANGALICÁK ALOMMÉRETÉRE Gajdócsi

Részletesebben

A Telomerase-specific Doxorubicin-releasing Molecular Beacon for Cancer Theranostics

A Telomerase-specific Doxorubicin-releasing Molecular Beacon for Cancer Theranostics A Telomerase-specific Doxorubicin-releasing Molecular Beacon for Cancer Theranostics Yi Ma, Zhaohui Wang, Min Zhang, Zhihao Han, Dan Chen, Qiuyun Zhu, Weidong Gao, Zhiyu Qian, and Yueqing Gu Angew. Chem.

Részletesebben

B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK

B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK Korom Edit, Pinke Orsolya, Veress Gyula, Kovács Balázs, Szabó Gyula, Varga László Mezőgazdasági Biotechnológiai Kutatóközpont,

Részletesebben

cobas 4800 CT/NG Test

cobas 4800 CT/NG Test cobas 4800 CT/NG Test IN VITRO DIAGNOSZTIKAI CÉLRA. cobas 4800 System Sample Preparation Kit c4800 SMPL PREP 960 Tests P/N: 05235804190 240 Tests P/N: 05235782190 cobas 4800 CT/NG Amplification/Detection

Részletesebben

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban 11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban HIV fertőzés kimutatása - (fiktív) esettanulmány 35 éves nő, HIV fertőzöttség gyanúja. Két partner az elmúlt időszakban. Fertőzött-e

Részletesebben

Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben

Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben Duleba Mónika Környezettudományi Doktori Iskola I.

Részletesebben

Tartalomjegyzék TARTALOMJEGYZÉK

Tartalomjegyzék TARTALOMJEGYZÉK Tartalomjegyzék TARTALOMJEGYZÉK Tartalomjegyzék... 1 Rövidítések jegyzéke... 3 Ábrák és táblázatok jegyzéke... 5 Ábrák... 5 Táblázatok... 5 Bevezetés... 6 Irodalmi háttér... 8 Komplex öröklõdésû jellegek

Részletesebben

Igazságügyi genetika alapjai

Igazságügyi genetika alapjai Nyomok - Death Valley, CA 2007 / 10 / 11 Igazságügyi genetika alapjai Molekuláris orvostudomány - molekuláris bűnjelek genetikai analízise Pádár Zsolt Igazságügyi genetika vannak az ÉLET dolgai és vannak

Részletesebben

SALMONELLA SSP. GYORS, MOLEKULÁRIS BIOLÓGIAI MÓDSZEREKKEL TÖRTÉNŐ DETEKTÁLÁSA

SALMONELLA SSP. GYORS, MOLEKULÁRIS BIOLÓGIAI MÓDSZEREKKEL TÖRTÉNŐ DETEKTÁLÁSA SALMONELLA SSP. GYORS, MOLEKULÁRIS BIOLÓGIAI MÓDSZEREKKEL TÖRTÉNŐ DETEKTÁLÁSA Nyirő-Fekete B., Tabajdi-Bajza N., Kovácsné Kis É., Pocklán E., Zoller L., Micsinai A., Gasparikné Reichardt J. Hungalimentaria

Részletesebben

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése Kereskedelmi forgalomban kapható készülékek 1 Fogalmak

Részletesebben

HEMATOLÓGIAI ÉS IMMUNOLÓGIAI BETEGSÉGEK ÖRÖKLETES TÉNYEZŐINEK VIZSGÁLATA. dr. Tordai Attila

HEMATOLÓGIAI ÉS IMMUNOLÓGIAI BETEGSÉGEK ÖRÖKLETES TÉNYEZŐINEK VIZSGÁLATA. dr. Tordai Attila Akadémiai doktori értekezés HEMATOLÓGIAI ÉS IMMUNOLÓGIAI BETEGSÉGEK ÖRÖKLETES TÉNYEZŐINEK VIZSGÁLATA dr. Tordai Attila Országos Gyógyintézeti Központ, Hematológiai és Immunológiai Intézet Budapest, 2005.

Részletesebben

A polimeráz láncreakció (PCR) és gyógyszerkutatási alkalmazásai

A polimeráz láncreakció (PCR) és gyógyszerkutatási alkalmazásai 1. A PCR sikertörténete Magyar Kémiai Folyóirat - Összefoglaló közlemények 153 A polimeráz láncreakció (PCR) és gyógyszerkutatási alkalmazásai DEZSŐ Péter * és NAGY József Richter Gedeon Rt., Gyömrői út

Részletesebben

Gyakorlati bioinformatika

Gyakorlati bioinformatika Gyakorlati bioinformatika Szekvenciaillesztés PhD kurzus 2. Szekvenciaillesztés Bagossi Péter Fajtái: - egyszer ill. többszörös illesztés - globális ill. lokális illesztés Alkalmazása: - adatbázisokban

Részletesebben

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Fehérjét kódol? Tulajdonságai? -Hol lokalizálódik? -Oldható? -3D szerkezete? -Accession #? -Annotációja elérhető? Már benne

Részletesebben

1. AZ ORSZÁGOS KÉPZÉSI JEGYZÉKBEN SZEREPLŐ ADATOK

1. AZ ORSZÁGOS KÉPZÉSI JEGYZÉKBEN SZEREPLŐ ADATOK A 41. sorszámú Immunhisztokémiai, hisztokémiai és molekuláris biológiai szakasszisztens megnevezésű szakképesítés ráépülés szakmai és vizsgakövetelménye 1. AZ ORSZÁGOS KÉPZÉSI JEGYZÉKBEN SZEREPLŐ ADATOK

Részletesebben

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Dr. Nagy Bálint az MTA doktora fokozat megszerzéséhez a fenti címen nyújtott be a

Részletesebben