ADATBÁNYÁSZAT I. ÉS OMICS

Save this PDF as:
 WORD  PNG  TXT  JPG

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "ADATBÁNYÁSZAT I. ÉS OMICS"

Átírás

1 Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP C-13/1/KONV ADATBÁNYÁSZAT I. ÉS OMICS 1. előadás PÉCSI TUDOMÁNYEGYETEM ÁLTALÁNOS ORVOSTUDOMÁNYI KAR GYÓGYSZERÉSZI BIOTECHNOLÓGIA TANSZÉK

2 A TÉMA HÁTTERE ÉS JELENTŐSÉGE A biotechnológia gyógyszerészeti jelentősége drasztikusan emelkedett az elmúlt években A biotechnológia lehetőséget nyújt egyre pontosabban ható, akár személyre szabott gyógyszerek előállítására A gyógyszergyárak bevételei is növekvő mértékben a biotechnológiai módszerekkel előállított biofarmáciai termékekre alapozódnak

3 TRANSZLÁCIÓS KUTATÁSOK A BIOTECHNOLÓGIÁTÓL A BIOGYÓGYSZEREKIG TÁMOP C-13/1/KONV A biotechnológia lehetőséget teremt, hogy megismerjük a betegségek molekuláris mechanizmusát célzott biomolekulákat állítsunk elő

4 A KÉMIAI ÉS A BIOLÓGIA GYÓGYSZEREK KÖZÖTTI KÜLÖNBSÉGEK TÁMOP C-13/1/KONV Kémiai gyógyszerek: kémiailag szintetizált kismolekulák Biológiai gyógyszerek: biológiai szervezetek által előállított, általában nagymolekulák

5 ADATBÁNYÁSZAT AVAGY DATA MINING MINDEN SIKERES GYÓGYSZER HÁTTERÉBEN

6 AZ ADATBÁNYÁSZAT SEGÍTÉSÉRE SZÁMOS TANKÖNYV ELÉRHETŐ TÁMOP C-13/1/KONV

7 AZ ADATBÁNYÁSZAT JELENTŐSÉGE A sejtek funkcionális állapotát megérthetjük és magyarázhatjuk a különféle OMICS adatok (biomarkerek) integrálásával. Ezek az adatok alkalmasak beteg és egészséges szövetek, sejtek összehasonlítására, melyek alapján diagnosztikai markerek kidolgozása illetve gyógyászati célpontok azonosítása válik lehetővé.

8 MIT JELENT AZ OMICS? A szó végén az OMICS azt jelenti, hogy biológiai molekulák igen nagy számát vizsgálja. A biológiai molekulák típusai alapján létezik: Genomics Proteomics Metabolomics

9 GENOMICS A Genomics három fő kategóriába csoportosítható: Genotipizálás (a genom szekvenciájának analízise) Transcriptomics (a gének mrns-sé átírt formájának vizsgálata) Epigenomics (a génexpresszió epigenetikai szabályozását vizsgálja)

10 GENOTIPIZÁLÁS A genotipizálás célja: A gének fiziológiai funkciójának megismerése A gén kombinációk szerepe betegségek iránti fogékonyság meghatározásában A gének szerepe különféle betegségek kialakulásában A vizsgálatban felhasznált paraméterek: A gének közötti variációk (inzerciók, deléciók stb) leggyakrabban használt a single nucleotide polymorphisms avagy SNP-ek Tag SNP-k Módszerek: Szekvenálás Array-alapú genotipizálás Genom alapú asszociációs vizsgálatok

11 DNS SZEKVENÁLÁS (Chain termination DNA sequencing) TÁMOP C-13/1/KONV (A) Initiation of strand synthesis Primer Templát DNS T T T T T T T T T 3 5 (B) A dideoxynucleotid Bázis (D) Autoradiograf A C T G (C) A lánc szintézise leáll, amikor ddntp-t adunk a rendszerhez DNS szekvencia dda T T T dda T dda T T T T T dda dda dda Az A család GAATTGGCGCG GAATTGGCGC GAATTGGCG GAATTGGC GAATTGG GAATTG GAATT GAAT GAA GA G

12 AUTOMATIZÁLT DNS SZEKVENÁLÁS (A) dda ddt ddc ddg ddntp-k mindegyik más fluorescens jelzéssel Szekvenálás, termék darabok ddt dda dda ddg ddc ddc ddg Detector Imaging rendszer Fluorescens sávok elvonulnak a detektor előtt (B) CACCGCATCGAAATTAACTTCCAAAGTTAAGCTTGG

13 A GÉNEXPRESSZIÓ VIZSGÁLATA A gén expessziós mintázat vizsgálata: azaz az mrns keverék minőségi és mennyiségi összehasonlítása Felhasználás: fenotipikus különbségek meghatározása, egészséges és beteg mintákban a különbségek felfedése Kihívás: a transzkriptom sokkal variábilisabb, mint a genom, nem csak sejttípusok és egyedek között, hanem környezeti hatások következtében is

14 A GÉNEXPRESSZIÓ VIZSGÁLATA 1. RNS izolálása, cdns szintézise Klinikai minta 2. A jelzett mintát a DNS microarray chip-hez hibridizálása 4. Adatok analízise és klinikai adatokkal történő összevetése 3. Szkennelés 8x4x2 2x4x8

15 MICROARRAY ADATOK VISSZAELLENŐRZÉSE Polimeráz lánc reakcióval SAGE alkalmazásával

16 POLIMERÁZ LÁNCREAKCIÓ (POLYMERASE CHAIN REACTION) (PCR) TÁMOP C-13/1/KONV Ciklus DNS minták felmelegítése DNS láncok szeparálódása Primerek bekötődése Primerek extenzió

17 Begyűjtés, ligálás más fragmentumokhoz, szekvenálás TÁMOP C-13/1/KONV SAGE Oligo(dT) lánc RNS hozzáadása mrns 5 Dupla láncú cdns-sé konvertálás 3 cdns 5 Emésztés Alul-gyel A vég fragmentum eliminálása Az BsmFI szekvenciát tartalmazó oligo ligálása 3 T T T T T T T T A A A A T T T T A A A A T T T T A A A A T T T T A A A A Cellulóz gyöngy T T T T A A A A

18 EPIGENETIKAI VIZSGÁLATOK Az epigenetikai szabályozás azt jelenti, hogy a gének működését a DNS szekvenciában bekövetkező változásokon túlmenően más hatások is befolyásolják Az epigenom vizsgálatának az a célja, hogy megismerjük az epigenetikai folyamatokat és azok betegségre kifejtett hatását

19 EPIGENETIKAI VIZSGÁLATOK Átalakítás Mod Kromatin átalakítás Me Hiszton összetétel Nem kódoló RNS-k Mod Me Hiszton módosulás DNS metiláció

20 KÖSZÖNÖM A FIGYELMET JELEN MUNKA AZ EURÓPAI UNIÓ TÁMOGATÁSÁVAL, AZ EURÓPAI SZOCIÁLIS ALAP TÁRSFINANSZÍROZÁSÁVAL VALÓSUL MEG, AZ ÉLETTUDOMÁNYI-KLINIKAI FELSŐOKTATÁS GYAKORLATORIENTÁLT ÉS HALLGATÓBARÁT KORSZERŰSÍTÉSE A VIDÉKI KÉPZŐHELYEK NEMZETKÖZI VERSENYKÉPESSÉGÉNEK ERŐSÍTÉSÉRE CÍMŰ, TÁMOP C-13/1/KONV AZONOSÍTÓSZÁMÚ PROJEKT KERETÉBEN.

A BIOLÓGIAI GYÓGY- SZEREK FEJLESZTÉSÉNEK FINANSZÍROZÁSA ÉS TERÁPIÁS CÉLTERÜLETEI

A BIOLÓGIAI GYÓGY- SZEREK FEJLESZTÉSÉNEK FINANSZÍROZÁSA ÉS TERÁPIÁS CÉLTERÜLETEI Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére A BIOLÓGIAI GYÓGY- SZEREK FEJLESZTÉSÉNEK FINANSZÍROZÁSA

Részletesebben

KOAGULÁCIÓS FAKTOROK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA

KOAGULÁCIÓS FAKTOROK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 KOAGULÁCIÓS FAKTOROK

Részletesebben

SZEMÉLYRE SZABOTT ORVOSLÁS II.

SZEMÉLYRE SZABOTT ORVOSLÁS II. Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 SZEMÉLYRE SZABOTT

Részletesebben

FEHÉRJE VAKCINÁK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA III.

FEHÉRJE VAKCINÁK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA III. Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére FEHÉRJE VAKCINÁK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA III.

Részletesebben

A BIOTECHNOLÓGIA ALKALMAZÁSI LEHETŐSÉGEI A GYÓGYSZERKUTATÁSBAN

A BIOTECHNOLÓGIA ALKALMAZÁSI LEHETŐSÉGEI A GYÓGYSZERKUTATÁSBAN Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 A BIOTECHNOLÓGIA

Részletesebben

DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer

Részletesebben

HORMONOK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA

HORMONOK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 HORMONOK BIOTECHNOLÓGIAI

Részletesebben

Humán genom variációk single nucleotide polymorphism (SNP)

Humán genom variációk single nucleotide polymorphism (SNP) Humán genom variációk single nucleotide polymorphism (SNP) A genom ~ 97 %-a két különböző egyedben teljesen azonos ~ 1% különbség: SNP miatt ~2% különbség: kópiaszámbeli eltérés, deléciók miatt 11-12 millió

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

Készült:

Készült: Tananyag címe: Transzaminázok vizsgálata Szerző: Dr. Mótyán János András, egyetemi tanársegéd Biokémiai és Molekuláris Biológiai Intézet Általános Orvostudományi Kar Debreceni Egyetem Készült: 2014.12.01-2015.01.31.

Részletesebben

II. GENOMIKA: TÖBBFÉLE MAKROMOLEKULA VIZSGÁLATA EGYIDŐBEN

II. GENOMIKA: TÖBBFÉLE MAKROMOLEKULA VIZSGÁLATA EGYIDŐBEN II. GENOMIKA: TÖBBFÉLE MAKROMOLEKULA VIZSGÁLATA EGYIDŐBEN Genomika Strukturális Funkcionális Integratív Strukturális genomika Genomkönyvtárak DNS szekvenálás Genom programok Polimorfizmusok RFLP DNS könyvtár

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest

avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest Iparilag alkalmazható szekvenciák, avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest Neutrokin α - jelentős kereskedelmi érdekek

Részletesebben

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:

Részletesebben

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem Tisztelt Hölgyem, Tisztelt Uram! Örömmel jelentjük be Önöknek, hogy a Genomikai Medicina és Ritka Betegségek Intézetének egyik új projektje azon betegségek genetikai hátterének feltérképezésére irányul,

Részletesebben

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia Fehérje expressziós rendszerek Gyógyszerészi Biotechnológia Expressziós rendszerek Cél: rekombináns fehérjék előállítása nagy tisztaságban és nagy mennyiségben kísérleti ill. gyakorlati (therapia) felhasználásokra

Részletesebben

Epigenetikai Szabályozás

Epigenetikai Szabályozás Epigenetikai Szabályozás Kromatin alapegysége a nukleoszóma 1. DNS Linker DNS Nukleoszóma mag H1 DNS 10 nm 30 nm Nukleoszóma gyöngy (4x2 hiszton molekula + 146 nukleotid pár) 10 nm-es szál 30 nm-es szál

Részletesebben

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A NÖVÉNYGENETIKA Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 A citológia és a genetika társtudománya Citogenetika A kromoszómák eredetét, szerkezetét, genetikai funkcióját,

Részletesebben

A fogorvostanhallgatók önálló orvosi kémia és biokémia képzésének kidolgozása

A fogorvostanhallgatók önálló orvosi kémia és biokémia képzésének kidolgozása Az élettudományi- klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 A fogorvostanhallgatók

Részletesebben

Témavezető: Dr. Sándor János. Debreceni Egyetem, Népegészségügyi Kar, Megelőző Orvostani Intézet Biostatisztikai és Epidemiológiai Tanszék

Témavezető: Dr. Sándor János. Debreceni Egyetem, Népegészségügyi Kar, Megelőző Orvostani Intézet Biostatisztikai és Epidemiológiai Tanszék TÁMOP-4.2.2.-A-11/1/KONV-2012-0031 1 Népegészségügyi ellenőr szak IV. évfolyam, 2 Népegészségügyi ellenőr III. évfolyam Témavezető: Dr. Sándor János Debreceni Egyetem, Népegészségügyi Kar, Megelőző Orvostani

Részletesebben

Hogyan lesznek új gyógyszereink? Bevezetés a gyógyszerkutatásba

Hogyan lesznek új gyógyszereink? Bevezetés a gyógyszerkutatásba Hogyan lesznek új gyógyszereink? Bevezetés a gyógyszerkutatásba Keserű György Miklós, PhD, DSc Magyar Tudományos Akadémia Természettudományi Kutatóközpont A gyógyszerkutatás folyamata Megalapozó kutatások

Részletesebben

Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben

Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben Dr. Kovács Tamás, Kovács Árpád László Kármentesítés Aktuális Kérdései 2013 Budapest, 2013.03.21-22 Bioremediáció során

Részletesebben

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data.

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data. Budapesti Műszaki és Gazdaságtudományi Egyetem Méréstechnika és Információs rendszerek Tanszék Adatelemzés intelligens módszerekkel Hullám Gábor Adatelemzés hagyományos megközelítésben I. Megválaszolandó

Részletesebben

Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL

Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL KÖZÖS STRATÉGIA KIFEJLESZTÉSE MOLEKULÁRIS MÓDSZEREK ALKALMAZÁSÁVAL

Részletesebben

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G.

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G. 1955: 46 emberi kromoszóma van 1961: mrns 1975: DNS szekvenálás 1982: gén-bank adatbázisok 1983: R (polymerase chain reaction) Mérföldkövek 1 J. D. Watson F. H.. rick 2008 1953 2003 Watson genomja DNS

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai Kar: TTK Tantárgy: CITOGENETIKA Kód: AOMBCGE3 ECTS Kredit: 3 A tantárgyat oktató intézet: TTK Mikrobiális Biotechnológiai és Sejtbiológiai Tanszék A tantárgy felvételére ajánlott félév: 3. Melyik félévben

Részletesebben

10. Genomika 2. Microarrayek és típusaik

10. Genomika 2. Microarrayek és típusaik 10. Genomika 2. 1. Microarray technikák és bioinformatikai vonatkozásaik Microarrayek és típusaik Korrelált génexpresszió mint a funkcionális genomika eszköze 2. Kombinált megközelítés a funkcionális genomikában

Részletesebben

BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ

BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ V. M A G Y A R S E J T A N A L I T I K A I K O N F E R E N C I A M O L E

Részletesebben

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR)

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR) Genomika (A genom, génállomány vizsgálata) Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel DNS szekvenálási eljárások DNS ujjlenyomat (VNTR) DNS chipek statikus és dinamikus információk vizsgálata

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

ENZIMEK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA

ENZIMEK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ENZIMEK BIOTECHNOLÓGIAI

Részletesebben

Könyvtárak, szekvenálás, mutagenezis

Könyvtárak, szekvenálás, mutagenezis Könyvtárak, szekvenálás, mutagenezis GÉNKÖNYVTÁRAK GENOMIÁLIS KÖNYVTÁR (könyvtár rendelésre: pl. Stratagene) vektor: -fág (helyettesítő), kozmid, YAC, PAC, BAC méret: N = ln(1-p)/ln[1-(i/g)] klónok száma

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

A proteomika új tudománya és alkalmazása a rákdiagnosztikában

A proteomika új tudománya és alkalmazása a rákdiagnosztikában BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK A proteomika új tudománya és alkalmazása a rákdiagnosztikában Tárgyszavak: proteom; proteomika; rák; diagnosztika; molekuláris gyógyászat; biomarker;

Részletesebben

DNS replikáció. DNS RNS Polipeptid Amino terminus. Karboxi terminus. Templát szál

DNS replikáció. DNS RNS Polipeptid Amino terminus. Karboxi terminus. Templát szál DNS replikáció DNS RNS Polipeptid Amino terminus Templát szál Karboxi terminus Szuper-csavarodott prokarióta cirkuláris DNS Hisztonok komplexe DNS hisztonokra történő felcsvarodása Hiszton-kötött negatív

Részletesebben

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár

Részletesebben

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Szántó-Egész Réka 1, Mohr Anita 1, Sipos Rita 1, Dallmann Klára 1, Ujhelyi Gabriella 2, Koppányné Szabó Erika

Részletesebben

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.)

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.) Genomika Új korszak, paradigmaváltás, forradalom: a teljes genomok ismeretében a biológia adatokban gazdag tudománnyá válik. Új kutatási módszerek, új szemlélet. Hajtóerõk: Genomszekvenálási projektek

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi

Részletesebben

Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform Tudásmenedzsment, oktatás és képzés a gyógyszerinnovációban - Munkaértékezlet - Botz Lajos Budapest, Duna Palota, 2009. január 7.

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

REKOMBINÁNS FEHÉRJÉK IPARI MÉRETŰ ELŐÁLLÍTÁSA I.

REKOMBINÁNS FEHÉRJÉK IPARI MÉRETŰ ELŐÁLLÍTÁSA I. Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 REKOMBINÁNS FEHÉRJÉK

Részletesebben

Az egészségügyi miniszter 8013/2007. (EüK. 19.) EüM. tájékoztatója

Az egészségügyi miniszter 8013/2007. (EüK. 19.) EüM. tájékoztatója Az egészségügyi miniszter 8013/2007. (EüK. 19.) EüM tájékoztatója az egészségügyi szakellátás társadalombiztosítási finanszírozásának egyes kérdéseirıl szóló 9/1993. (IV. 2.) NM rendelet 2. számú mellékletében

Részletesebben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben esirna mirtron BEVEZETÉS TÉMAKÖRÖK Ősi RNS világ RNS-ek tradicionális szerepben bevezetés BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek

Részletesebben

Emlősök korai embrionális génjei kifejeződésének vizsgálata. molekuláris biológiai módszerekkel. Baji Gál Árpád

Emlősök korai embrionális génjei kifejeződésének vizsgálata. molekuláris biológiai módszerekkel. Baji Gál Árpád Emlősök korai embrionális génjei kifejeződésének vizsgálata molekuláris biológiai módszerekkel Doktori értekezés tézisei Baji Gál Árpád Biológia Doktori Iskola, iskolavezető: Prof. Erdei Anna Szerkezeti

Részletesebben

3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció

3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció 3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció A vírus genetikai anyagának vizsgálata (direkt víruskimutatási módszer) biztosítja a legrészletesebb és legspecifikusabb információkat a kimutatott

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi

Részletesebben

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

Új temékek az UD-GenoMed Kft. kínálatában!

Új temékek az UD-GenoMed Kft. kínálatában! Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai

Részletesebben

Biotechnológia, egészség- és környezetvédelem. Műegyetem - Kutatóegyetem Biotechnológia, egészség-és környezetvédelem

Biotechnológia, egészség- és környezetvédelem. Műegyetem - Kutatóegyetem Biotechnológia, egészség-és környezetvédelem Biotechnológia, egészség- és környezetvédelem Kr.e. 6000 Kr.e. 5000 Ereky Károly (1878-1952) A biotechnológia a munkaszervezési tudomány, azaz technológia, élő szervezetekkel, más szóval biotechnológiai

Részletesebben

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26 Hamar Péter RNS világ Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. 1 26 Főszereplők: DNS -> RNS -> fehérje A kód lefordítása Dezoxy-ribo-Nuklein-Sav: DNS az élet kódja megkettőződés (replikáció)

Részletesebben

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika DNS munka a gyakorlatban 2012.10.12. Természetvédelmi genetika Munka fázisok DNS kivonás elektroforézis (fakultatív lépés) PCR Elektroforézis Szekvenálás Szekvencia elemzés faji azonosítás; variabilitás,

Részletesebben

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Rohonczy Kata, Zoller Linda, Fodor Andrea, Tabajdiné, dr. Pintér Vera FoodMicro Kft. Célkitűzés Élelmiszerekben és takarmányokban

Részletesebben

I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.

Részletesebben

BIOLÓGIAI HATÓANYAGOK TESZTELÉSE BIOTECHNOLÓGIAI MÓDSZEREKKEL

BIOLÓGIAI HATÓANYAGOK TESZTELÉSE BIOTECHNOLÓGIAI MÓDSZEREKKEL Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 BIOLÓGIAI HATÓANYAGOK

Részletesebben

Véralvadásgátló hatású pentaszacharidszulfonsav származék szintézise

Véralvadásgátló hatású pentaszacharidszulfonsav származék szintézise Véralvadásgátló hatású pentaszacharidszulfonsav származék szintézise Varga Eszter IV. éves gyógyszerészhallgató DE-GYTK GYÓGYSZERÉSZI KÉMIAI TANSZÉK Témavezető: Dr. Borbás Anikó tanszékvezető, egyetemi

Részletesebben

A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése. Kiss Erzsébet Kovács László

A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése. Kiss Erzsébet Kovács László A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése Kiss Erzsébet Kovács László Bevezetés Nagy gazdasági gi jelentıségük k miatt a gyümölcs lcsök, termések fejlıdésének mechanizmusát

Részletesebben

A genetikai lelet értelmezése monogénes betegségekben

A genetikai lelet értelmezése monogénes betegségekben A genetikai lelet értelmezése monogénes betegségekben Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika A ~20 ezer fehérje-kódoló gén a 23 pár kromoszómán A kromoszómán található bázisok száma: 250M

Részletesebben

ÚJ GENERÁCIÓS SZEKVENÁLÁS

ÚJ GENERÁCIÓS SZEKVENÁLÁS VÍZMIKROBIOLÓGUSOK XI. ORSZÁGOS KONFERENCIÁJA - 2012 ÚJ GENERÁCIÓS SZEKVENÁLÁS LEHETŐSÉG, VAGY NEHÉZSÉG? MÁRIALIGETI KÁROLY EÖTVÖS LORÁND TUDOMÁNYEGYETEM, BUDAPEST 1953 JAMES D. WATSON, FRANCIS CRICK:

Részletesebben

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós Összefoglalás A humángenetika korunk egyik legdinamikusabban fejlődő tudományága. Ennek a fejlődésnek legfőbb mozgatórugója az, hogy a humángenetika,

Részletesebben

Epigenetika kihívások az ökotoxikológiában

Epigenetika kihívások az ökotoxikológiában Epigenetika kihívások az ökotoxikológiában Bakonyi Gábor és Szabó Borbála Szent István Egyetem, Gödöllő Állattani és Állatökológiai Tanszék V. ÖKOTOXIKOLÓGIAI KONFERENCIA, MAGYAR ÖKOTOXIKOLÓGIAI TÁRSASÁG,

Részletesebben

ELLENANYAGOK ÉS SZÁRMAZÉKAIK

ELLENANYAGOK ÉS SZÁRMAZÉKAIK Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ELLENANYAGOK

Részletesebben

Új utak az antipszichotikus gyógyszerek fejlesztésében

Új utak az antipszichotikus gyógyszerek fejlesztésében Új utak az antipszichotikus gyógyszerek fejlesztésében SCHIZO-08 projekt Dr. Zahuczky Gábor, PhD, ügyvezető igazgató UD-GenoMed Kft. Debrecen, 2010. november 22. A múlt orvostudománya Mindenkinek ugyanaz

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

A géntechnológiát megalapozó felfedezések

A géntechnológiát megalapozó felfedezések 2010. december BIOTECHNOLÓGIA Rova tvezető: Dr. Heszky László akadémikus A géntechnológia genetikai alapjai c. I. fejezet 1-5. részében azokat a tudományos eredményeket mutattuk be, melyek bizonyítják,

Részletesebben

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor,

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, 1 A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, (Debreceni Egyetem Állattenyésztéstani Tanszék) A bármilyen

Részletesebben

A laboratóriumi medicina fejlődése az elmúlt 35 évben

A laboratóriumi medicina fejlődése az elmúlt 35 évben A laboratóriumi medicina fejlődése az elmúlt 35 évben Kovács L. Gábor egyetemi tanár, az MTA rendes tagja Pécsi Tudományegyetem 1976 2011? INTÉZETIGAZGATÓ PROFESSZOROK KLINIKAI KÉMIA 1976 Mérleg Spektrofotométer

Részletesebben

KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR

KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR MAI MENÜ Táplálkozás funkciói és hibái Egészség és táplálkozás Társadalmi igények Táplálkozás

Részletesebben

Biomolekuláris nanotechnológia. Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium

Biomolekuláris nanotechnológia. Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium Biomolekuláris nanotechnológia Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium Az élő szervezetek példája azt mutatja, hogy a fehérjék és nukleinsavak kiválóan alkalmasak önszerveződő molekuláris

Részletesebben

Molekuláris biológiai diagnosztika alkalmazása

Molekuláris biológiai diagnosztika alkalmazása Molekuláris biológiai diagnosztika alkalmazása (HIV, HCV, HBV szabad vírus mennyiség meghatározás) a napi rutin diagnosztikában Reichenberger Anna Mária, Dr. Sárvári Csilla Dr. Ujhelyi Eszter Fıvárosi

Részletesebben

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód)

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2.1 Nukleotidok, nukleinsavak Információátadás (örökítőanyag) Információs egység

Részletesebben

I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika

I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika A genomika főbb területei Strukturális (szerkezeti ) genomika Funkcionális (működési) genomika Transzkriptomika Proteomika Integratív

Részletesebben

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Finanszírozási Mechanizmus által támogatott projekt Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Alap támogatással javul

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-8/1/A-29-11 Az orvosi biotechnológiai

Részletesebben

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók

Részletesebben

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)

Részletesebben

Terápiarezisztencia-fehérjéket kódoló mrns kvantitatív kimutatása PCRtechnikával. nyirokcsomójában

Terápiarezisztencia-fehérjéket kódoló mrns kvantitatív kimutatása PCRtechnikával. nyirokcsomójában Terápiarezisztencia-fehérjéket kódoló mrns kvantitatív kimutatása PCRtechnikával lymphomás kutyák nyirokcsomójában Sunyál Orsolya V. évfolyam Témavezetık: Dr. Vajdovich Péter Szabó Bernadett SZIE-ÁOTK

Részletesebben

Csak, mert igazad van, az nem jelenti azt, hogy én tévedek. Csak azt, hogy még nem láttad az életet az én oldalamról. MOTTÓ A MAI NAPRA:

Csak, mert igazad van, az nem jelenti azt, hogy én tévedek. Csak azt, hogy még nem láttad az életet az én oldalamról. MOTTÓ A MAI NAPRA: Gyógyszerészet és ismeretterjesztés Szeged, 2016. 12. 10., szombat MOTTÓ A MAI NAPRA: Csak, mert igazad van, az nem jelenti azt, hogy én tévedek. Csak azt, hogy még nem láttad az életet az én oldalamról.

Részletesebben

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Fehérjét kódol? Tulajdonságai? -Hol lokalizálódik? -Oldható? -3D szerkezete? -Accession #? -Annotációja elérhető? Már benne

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

RNS-ek. 1. Az ősi RNS Világ: - az élet hajnalán. 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek

RNS-ek. 1. Az ősi RNS Világ: - az élet hajnalán. 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek RNS-ek RNS-ek 1. Az ősi RNS Világ: - az élet hajnalán 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek 3. Egy újonnan felfedezett RNS Világ: - szabályozó RNS-ek 4. Transzkripció Ősi

Részletesebben

Készült: Módosítva: július

Készült: Módosítva: július Tananyag címe: Transzaminázok vizsgálata Szerző: Dr. Mótyán János András egyetemi tanársegéd Biokémiai és Molekuláris Biológiai Intézet Általános Orvostudományi Kar Debreceni Egyetem Készült: 2014.12.01-2015.01.31.

Részletesebben

ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL

ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL EREDMÉNYEK Munkacsoportunk úttörő szerepet játszott a molekuláris onkológiai (onkogenetikai)

Részletesebben

1. A megyében végzett jelentősebb kutatási témák, projektek ráfordításainak ágazati megoszlása (összesen 4 859 millió Ft-ról áll rendelkezésre adat):

1. A megyében végzett jelentősebb kutatási témák, projektek ráfordításainak ágazati megoszlása (összesen 4 859 millió Ft-ról áll rendelkezésre adat): Megyei statisztikai profil a Smart Specialisation Strategy (S3) megalapozásához c. dokumentum kiegészítése a Magyar Tudományos Akadémia adataival Csongrád megye Az alábbi dokumentum a Smart Specialisation

Részletesebben

Kórház összes (24. HBCS) közvetlen költsége (100%)» 3 kritikus HB. » 2 kritikus. » 10 tovább. » Hátrányos he

Kórház összes (24. HBCS) közvetlen költsége (100%)» 3 kritikus HB. » 2 kritikus. » 10 tovább. » Hátrányos he Értékelemzett t arthritis protokoll beillesztése komplex terápiába Ábrahám Sándor CVS Life, PVM Dr. Áts Kt Katalin, Dr. Gál János Mobil: +3 36 30 971 9532 mikroorg.absa@chello.hu Homok kóra diagram Kórház

Részletesebben

5. Molekuláris biológiai technikák

5. Molekuláris biológiai technikák 5. Molekuláris biológiai technikák DNS szaporítás kémcsőben és élőben. Klónozás, PCR, cdna, RT-PCR, realtime-rt-pcr, Northern-, Southernblotting, génexpresszió, FISH 5. Molekuláris szintű biológiai technikák

Részletesebben

Klinikai kémia. Laboratóriumi diagnosztika. Szerkesztette: Szarka András. Írta: Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis Egyetem

Klinikai kémia. Laboratóriumi diagnosztika. Szerkesztette: Szarka András. Írta: Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis Egyetem Klinikai kémia Laboratóriumi diagnosztika Szerkesztette: Szarka András Írta: Szarka András (1-8, 11-15. fejezet) Keszler Gergely (9, 10. fejezet) Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis

Részletesebben

A Legionella jelenlétének kimutatása

A Legionella jelenlétének kimutatása A Legionella jelenlétének kimutatása Diagnosztikai lehetőségek Kari András Budapest 2016. 04.07. Legionella nemzetség: aerob coccoid-pálca Gram (gyengén festődik) kataláz +, oxidáz +, hippurátot hidrulizálja

Részletesebben

A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete)

A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete) A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete) I. Ritka Betegség regiszterek Európában II. Ritka betegség regiszterek

Részletesebben

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel Gyakorlat helye: BIOMI Kft. Gödöllő, Szent-Györgyi A. u. 4. (Nemzeti Agrárkutatási és Innovációs Központ épülete volt

Részletesebben