II. GENOMIKA: TÖBBFÉLE MAKROMOLEKULA VIZSGÁLATA EGYIDŐBEN

Save this PDF as:
 WORD  PNG  TXT  JPG

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "II. GENOMIKA: TÖBBFÉLE MAKROMOLEKULA VIZSGÁLATA EGYIDŐBEN"

Átírás

1 II. GENOMIKA: TÖBBFÉLE MAKROMOLEKULA VIZSGÁLATA EGYIDŐBEN

2 Genomika Strukturális Funkcionális Integratív

3 Strukturális genomika Genomkönyvtárak DNS szekvenálás Genom programok Polimorfizmusok RFLP

4 DNS könyvtár készítés humán genom 1. Emésztés RE-kal Emberi duplaszálú (ds) DNS (genomi) DNS fragmensek milliói DNS fragment plazmidba építése Plazmidok baktériumba juttatása Rekombináns DNS molekulák Génkönyvtár

5 Genomkönyvtár készítés 2. 2.: 1.: ligálás emésztés plazmid restrikciós vektorba endonukleázzal

6 Genomkönyvtár készítés : 2.: transzformáció ligálás plazmid vektorba Escherichia coli-ba

7 Génkönyvtárak 4. Genom könyvtár: klóngyűjtemény, amelyben megtalálható egy adott organizmus genomjának minden darabja (genom projektek) Felhasználása: szekvenálás, gének izolálása cdns könyvtár: egy organizmus összes mrns-ének másolatait tartalmazza Felhasználás: génszerkezet megállapítása, cdns-ek izolálása (intron-mentes gének). A transzkriptomot hivatott reprezentálni. EST könyvtár: expressed sequence tag, a transzkriptomot reprezentálja, de a cdns-eknek csak valamelyik végét (5 vagy 3 ) tartalmazza. Felhasználás: egy sejttípus vagy szövettípus transzkriptom gyors meghatározása (értsd: Milyen gének fejeződnek ki ebben a sejtben?). Az aktív genom gyors szekvenálására is használták.

8 cdns-könyvtár készítés 5. Hogyan készítünk cdns-t? mrns cdns 5 GGGGG 5 második cdns 3 CCCCC 3 első szál szál AAAAAAAAA 3 3 TTTTTTTTT 5 1. RNS (mrns) tisztítás: használhatunk teljes, vagy mrns preparátumot 2. Reverz transzkripció: oligo-dt primerrel és reverz transzkriptázzal (RNS-függő DNS polimeráz) elkészítjük a cdns első szálát 3. RNáz kezelés 4. Linker szintézis: terminális dezoxinukleotidil transzferázzal (DNS polimeráz, amely nem igényel templátot) oligo G linkert szintetizálunk 5. Második szál szintézis: oligo dc primerrel és DNS polimerázzal készül el a cdns második szála.

9 DNS szekvenálás A Sanger módszer 6. v Didezoxi-nukleotid módszer Stop-nukleotid módszer Láncterminációs módszer AUTOMATIZÁLHATÓ

10 DNS szekvenálás A Sanger módszer 7. (A) A DNS szál szintézis kezdete Primer 5 3 Templát DNS (B) Didezoxinukleotid T T T Bázis T T T T T T 3 5 (D) Az autoradiogram eredménye A T G C DNS szekvencia GAATTGGCGCG GAATTGGCGC GAATTGGCG GAATTGGC GAATTGG GAATTG GAATT GAAT GAA GA G Az A család dda dda (C) Amikor egy ddntp (a példában ddatp) kapcsolódik, a szál szintézise leáll dda dda T T T dda T T T dda T T T

11 Templát: 3 DNS szekvenálás A Sanger módszer 8. CCGGTAGCAACT 5 Primer : 5 GG 3 datp + ddatp dctp dgtp dttp datp dctp + ddctp dgtp dttp datp dctp dgtp + ddgtp dttp datp dctp dgtp dttp + ddttp GGCCA GGCCATCGTTGA GGC GGCC GGCCATC GGCCATCG GGCCATCGTTG GGCCAT GGCCATCGT GGCCATCGTT n A C G T A3 G T T G C T A C C5 A templát DNS-sel komplementer szekvencia

12 9. Automatizált DNS szekvenálás fluoreszcens ddntp-kel (A) dda ddt ddc ddg ddntp-k mindegyik típus más-más színű fluoreszcens festékkel megjelölve Szekvenálási reakció, a termékek frakciói ddt dda dda ddg ddc ddc ddg Detektor Képalkotó rendszer (B) CACCGCATCGAAATTAACTTCCAAAGTTAAGCTTGG

13 Valódi egymolekulás szekvenálás tsms bp-os DNS szálak szekvenálása 100 milliós nagyságrendben, egyidőben Naponta több milliárd bázis megszekvenálása

14 Humán Genom Program 10.

15 A módszerek 11. Hierarchikus módszer vs. Shotgun szekvenálás Kromoszómák (HGP) (Celera) Nagy BAC klónok készítése, végeik megszekvenálása Teljes genom feldarabolás és azonnali szekvenálás BAC klónok darabolása, szubklónozás

16 Ki a megszekvenált genom gazdája? 2001 A humán genom program eredményeként a haploid humán genom nyers szekvenciája 50 férfi és nő etnikailag diverz csoportja (HGP) 8 ismeretlen etnikumú férfi 21 férfi és nő etnikailag diverz csoportja (Celera) 2 férfi, 3 nő, 1-1 ázsiai, afrikai, latin.-amerikai 2 kaukázusi Az első teljes emberi genom 2006 Az teljes genom kiegészítése az 1-es kromoszómával 2007 Az első 2 diploid genom: Venter & Watson 2008 Egy han kínai és egy yoruba férfi diploid genomja

17 Genom programok 13.

18 Polimorfizmusok/molekuláris markerek 14. a humán genomban Polimorfizmus SNP Single Nucleotide Polymorphisms Alap szekvencia (bp) 1 STR: mikroszatellit 2-20 (?) VNTR: miniszatellit RFLP - Polimorfizmus: többalakúság (görög) Polimorf DNS lokusz: amelyen két vagy több eltérő allél figyelhető meg egy adott népességben

19 VNTR és STR analízis Amplifikálás PCR-rel A PCR primerek azon DNS szekvenciáknak komplementerei, amelyek közvetlenül a ripít szomszédságában vannak. A PCR termék hossza függ: a ripítben ismétlődő egység hosszától a kópiák számától VNTRek: 3 személy 4 pár homológ kromoszómája A B C

20 VNTR és STR analízis Gélelektroforézis Az egység DNS szakasz hosszának ismeretében és a PCR termék mérete alapján meghatározható a kópiák száma. Adott emberre jellemző mintázatot kapunk. Anya Apa Lányok Fiúk Apasági vizsgálat, személyazonosítás DNS ujjlenyomat Érzékeny technika: egyetlen hajhagyma vagy vércsepp alapján elvégezhető

21 SNP-k 17. Egyetlen nukleotid (A, T, G, vagy C) cseréje/változása a genomban ACGGCTAA Egy variáció SNP, ha a populáción belül valamennyi allélja minimum 1% gyakorisággal előfordul. Az SNP-k 66,6%-ban C--->T cserét jelentenek.

22 SNP-k 17. Egyetlen nukleotid (A, T, G, vagy C) cseréje/változása a genomban ATGGCTAA Egy variáció SNP, ha a populáción belül valamennyi allélja minimum 1% gyakorisággal előfordul. Az SNP-k 66,6%-ban C--->T cserét jelentenek.

23 SNP-k vizsgálata: ASA 18. PCR termékek Primerek Normál allél A polimorf specifikus oligo hosszabb Polimorf allél PCR reakció Közös primer 3 vége fluoreszcensen jelölt Homozigóta normál genotípus Heterozigóta genotípus Homozigóta polimorf genotípus Elektroforézis méret

24 RFLP 19. Restriction Fragment Length Polymorphism restrikciós fragment hosszúság-polimorfizmus Restrikciós emésztést követő PCR Agaróz gél elektroforézis Ha egy báziscsere létrehoz vagy megszüntet egy restrikciós enzim felismerési helyet, akkor a hasítás mintázata megváltozik: a PCR során felsokszorozott DNS szakaszok emésztése során keletkező fragmentumok száma és mérete alapján a genotípus meghatározható.

25 RFLP 20. RFLP markerek öröklődése Szülők Gyerekek Genotípusok

26 Funkcionális genomika 21. Microchip Microarray scanner

27 A Chip (microarray) technológia 22. Strukturális genomika GENOM - szekvencia megállapítása - mutációk felderítése - egy nukleotid eltérések (SNP) - deléció inszerció - metilációs mintázat DNS chip-ek CITOPLAZMA DNS Funkcionális genomika TRANSZKRIPTOM - gén expresszió megváltozása, - splice-variánsok kimutatása - szabályozó RNS-ek (mirns) kimutatása transzkripció SEJTMAG transzláció pre-mrns protein trns Fehérje chip-ek PROTEOM mrns riboszóma - kifejeződés - módosítások - kölcsönhatások

28 A DNS chip 23. DNS-chipen több ezer gén aktivitását nyomon tudjuk követni. Minden pont egy génre jellemző szekvenciát tartalmaz. A biológiai mintából kinyert, fluoreszcensen megjelölt RNS a gén aktivitásával arányos fluoreszcens jelet ad. - a működés alapja: DNS-DNS vagy DNS-RNS hibridizáció - nagyszámú gén expressziós mintázatának egyidejű meghatározása - egy chip 6-10,000 gén vizsgálatára alkalmas. - cdns chipek - oligonukleotid chip-ek

29 1. Chip elkészítése: - nyomtatás kontrol 2. Szövetminták begyűjtése beteg RNS tisztítás 4. Reverz transzkripció (fluoreszcens jelölés) 5. Hibridizálás 6. Detektálás

30 1. RNS izolálás. cdns szintézis. Microarray analízis - összefoglalás 25. minta 4. Adatelemzés 2. Jelölt próbák és a microarray hibridizálása 8x4x2 2x4x8 3. Szkennelés

31 ChIP (kromatin immunprecipitáció) Az antitest a specifikus transzkripciós faktorhoz köt 26. Formaldehiddel kezelt sejtek DNS fragmentek kinyerése szonikálással Antitestekkel való tisztítás A kromatin/antitest komplex összegyűjtése DNS tisztítás A fragmentek és a transzkripciós faktorok között keresztkötések létesülnek Specifikus transzkripciós faktor kötőhelyet tartalmazó DNS szekvencia

32 Real-Time PCR 27. alapja: fluoreszcencia detektálása a PCR reakció mindenegyes ciklusában A fluoreszcencia intenzitása arányos a PCR termék mennyiségével a reakció végén nincs szükség gél-alapú kiértékelésre analízis: szoftver alapú

33 28.

34 29. mrns expresszió vizsgálata lépések: RNS tisztítás (totál RNS, mrns; sejt, szövet) reverz transzkripció (RNS cdns) Real-Time PCR Fogalmak Real-Time PCR = qpcr (kvantitatív) RT2-PCR = qrt-pcr RT-PCR = reverz transzkripciót követő PCR

35 30. allél-specifikus Real-Time PCR TaqMan próbával az egyik primer 3 - vége az SNP-re kell, hogy essen a DNS szintézis, azaz a PCR reakció működik, ha a használt primer 3 -vége az SNP-vel komplementer ebben az esetben detektálható a riporter fluoreszcenciája

36 fluoreszcencia 31. kezelt-kezeletlen egészséges-beteg érzékenyebb a DNS chipeknél kevesebb minta egyidejű analízise Relatív kópiaszám meghatározás: Ct tumor egészséges ciklusszám

37 Na-biszulfitos kezelés Met CpG CpG Na-Biszulfit Met CpG UpG 2a. MetilC-Seq PCR Klónozás Szekvenálás 2b. Real-Time PCR

38 33.

39 33.

40 33.

I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika

I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika A genomika főbb területei Strukturális (szerkezeti ) genomika Funkcionális (működési) genomika Transzkriptomika Proteomika Integratív

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

ADATBÁNYÁSZAT I. ÉS OMICS

ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT

Részletesebben

SEMMELWEIS UNIVERSITY, BUDAPEST PCR. Vannay Ádám 2011. 1 st Department of Pediatrics; vannay@gyer1.sote.hu

SEMMELWEIS UNIVERSITY, BUDAPEST PCR. Vannay Ádám 2011. 1 st Department of Pediatrics; vannay@gyer1.sote.hu PCR Vannay Ádám 2011 Definíció A PCR során a DNS/cDNS egy relatív kis darabkáját sokszorozzuk meg. Miért, illetve mire jó a PCR? Egyszerű Nagyon érzékeny Olcsó Klónozás Genotipizálás (szekvenálás, RFLP,

Részletesebben

Korszerű identifikálási módszerek a mikrobiológiai gyakorlatban

Korszerű identifikálási módszerek a mikrobiológiai gyakorlatban Korszerű identifikálási módszerek a mikrobiológiai gyakorlatban Mráz Balázs 1, Zoller Linda 1, Fodor Andrea 1, Szántó-Egész Réka 2, Tabajdiné Pintér Veronika 1 1 Wessling Hungary Kft. Mikrobiológiai Laboratórium

Részletesebben

A Molekuláris Biológia Technológiai Arzenálja-II

A Molekuláris Biológia Technológiai Arzenálja-II A Molekuláris Biológia Technológiai Arzenálja-II GENOMIKA: TÖBBFÉLE MAKROMOLEKULA VIZSGÁLATA EGYIDŐBEN Strukturális genomika a genomika azon területe, mely a genom, a DNS szerkezetével foglalkozik. Eszköztára:

Részletesebben

10. Genomika 2. Microarrayek és típusaik

10. Genomika 2. Microarrayek és típusaik 10. Genomika 2. 1. Microarray technikák és bioinformatikai vonatkozásaik Microarrayek és típusaik Korrelált génexpresszió mint a funkcionális genomika eszköze 2. Kombinált megközelítés a funkcionális genomikában

Részletesebben

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.)

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.) Genomika Új korszak, paradigmaváltás, forradalom: a teljes genomok ismeretében a biológia adatokban gazdag tudománnyá válik. Új kutatási módszerek, új szemlélet. Hajtóerõk: Genomszekvenálási projektek

Részletesebben

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi

Részletesebben

Melyik gén mutáns egy betegségben? Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika

Melyik gén mutáns egy betegségben? Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika Melyik gén mutáns egy betegségben? Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika Mit tudtunk meg a Human Genom Projectnek köszönhetően? 9 ember (1 nő és 8 férfi) genomi nukleotid-szekvenciáját

Részletesebben

Molekuláris biológiai technikák

Molekuláris biológiai technikák Molekuláris biológiai technikák Wunderlich Lívius A Molekuláris biológiai technikák jegyzet igyekszik átfogó képet adni a jövő tudományának, a molekuláris biológiának a módszertanáról. A technikák elméleti

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

Nőknél előfordulhat X-hez kötött recesszív rendellenesség? Ha igen, hogyan? Miért van sokkal kevesebb színtévesztő nő?

Nőknél előfordulhat X-hez kötött recesszív rendellenesség? Ha igen, hogyan? Miért van sokkal kevesebb színtévesztő nő? Nőknél előfordulhat X-hez kötött recesszív rendellenesség? Ha igen, hogyan? Igen: érintett apa és érintett anya esetében, vagy érintett apa és hordozó anya esetében Miért van sokkal kevesebb színtévesztő

Részletesebben

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR)

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR) Genomika (A genom, génállomány vizsgálata) Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel DNS szekvenálási eljárások DNS ujjlenyomat (VNTR) DNS chipek statikus és dinamikus információk vizsgálata

Részletesebben

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor,

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, 1 A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, (Debreceni Egyetem Állattenyésztéstani Tanszék) A bármilyen

Részletesebben

DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer

Részletesebben

Géntechnológia és fehérjemérnökség

Géntechnológia és fehérjemérnökség Géntechnológia és fehérjemérnökség elektronikus-jegyzet szerzők: Az ELTE Biokémiai Tanszék Munkaközössége Alexa Anita (12. és 13. fejezet), Fodor Krisztián (3. és 9. fejezet), Garai Ágnes (4. és 5. fejezet),

Részletesebben

Nukleinsavak. Szerkezet, szintézis, funkció

Nukleinsavak. Szerkezet, szintézis, funkció Nukleinsavak Szerkezet, szintézis, funkció Nukleinsavak, nukleotidok, nukleozidok 1869-ben Miescher a sejtmagból egy savas természetű, lúgban oldódó foszfortartalmú anyagot izolált, amit később, eredetére

Részletesebben

Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai markerek kutatása

Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai markerek kutatása A 48750 OTKA pályázat eredményeit összefoglaló szakmai záróbeszámoló A pályázat címe Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai

Részletesebben

Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze

Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze László Éva Babeş-Bolyai Tudományegyetem, Kolozsvár A polimeráz láncreakció (PCR) napjaink molekuláris biológiai (genetikai) kutatásának nélkülözhetetlen

Részletesebben

Az örökítőanyag. Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase

Az örökítőanyag. Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase SZTE, Orv. Biol. Int., Mol- és Sejtbiol. Gyak., VIII. Az örökítőanyag Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase Ez az

Részletesebben

NAGY ÁTERESZTŐKÉPESSÉGŰ MOLEKULÁRIS BIOREMEDIÁCIÓS CENTRUM LÉTREHOZÁSA DR. KOVÁCS TAMÁS VEZÉRIGAZGATÓ-HELYETTES BUDAPEST, 2015.03.

NAGY ÁTERESZTŐKÉPESSÉGŰ MOLEKULÁRIS BIOREMEDIÁCIÓS CENTRUM LÉTREHOZÁSA DR. KOVÁCS TAMÁS VEZÉRIGAZGATÓ-HELYETTES BUDAPEST, 2015.03. NAGY ÁTERESZTŐKÉPESSÉGŰ MOLEKULÁRIS BIOREMEDIÁCIÓS CENTRUM LÉTREHOZÁSA DR. KOVÁCS TAMÁS VEZÉRIGAZGATÓ-HELYETTES BUDAPEST, 2015.03.25 A PROJEKT Az Enviroinvest Zrt és az MTA Szegedi Biológiai Kutatóközpont

Részletesebben

Tartalomjegyzék TARTALOMJEGYZÉK

Tartalomjegyzék TARTALOMJEGYZÉK Tartalomjegyzék TARTALOMJEGYZÉK Tartalomjegyzék... 1 Rövidítések jegyzéke... 3 Ábrák és táblázatok jegyzéke... 5 Ábrák... 5 Táblázatok... 5 Bevezetés... 6 Irodalmi háttér... 8 Komplex öröklõdésû jellegek

Részletesebben

Új temékek az UD-GenoMed Kft. kínálatában!

Új temékek az UD-GenoMed Kft. kínálatában! Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Temperamentum, kognitív teljesítmény és hipnábilitás pszichogenetikai asszociációvizsgálatai

Temperamentum, kognitív teljesítmény és hipnábilitás pszichogenetikai asszociációvizsgálatai Temperamentum, kognitív teljesítmény és hipnábilitás pszichogenetikai asszociációvizsgálatai Habilitációs dolgozat Veres-Székely Anna, Ph.D. 2010 TARTALOMJEGYZÉK BEVEZETÉS... 4 Ábrajegyzék... 6 Táblázatok

Részletesebben

A géntechnológia genetikai alapjai (I./3.)

A géntechnológia genetikai alapjai (I./3.) Az I./2. rész (Gének és funkciójuk) rövid összefoglalója A gének a DNS információt hordozó szakaszai, melyekben a 4 betű (ATCG) néhány ezerszer, vagy százezerszer ismétlődik. A gének önálló programcsomagként

Részletesebben

Egyetemi doktori (PhD) értekezés tézisei

Egyetemi doktori (PhD) értekezés tézisei Egyetemi doktori (PhD) értekezés tézisei HUMÁN PAPILLOMAVÍRUS 16 E6 ÉS E7 ONKOPROTEINEK HATÁSA A KERATINOCITÁK DIFFERENCIÁLÓDÁSÁBAN RÉSZTVEVŐ GÉNEK TRANSZKRIPCIÓS SZABÁLYOZÁSÁRA Oraveczné Gyöngyösi Eszter

Részletesebben

Géntechnológia és fehérjemérnökség

Géntechnológia és fehérjemérnökség Géntechnológia és fehérjemérnökség Szerkesztette: Nyitray László Alexa Anita (12. és 13. fejezet) Fodor Krisztián (3. és 9. fejezet) Garai Ágnes (4. és 5. fejezet) Glatz Gábor (6. és 7. fejezet) Radnai

Részletesebben

Génszerkezet és génfunkció

Génszerkezet és génfunkció Általános és Orvosi Genetika jegyzet 4. fejezetének bővítése a bakteriális genetikával 4. fejezet Génszerkezet és génfunkció 1/ Bakteriális genetika Nem szükséges külön hangsúlyoznunk a baktériumok és

Részletesebben

Klinikai kémia. Laboratóriumi diagnosztika. Szerkesztette: Szarka András. Írta: Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis Egyetem

Klinikai kémia. Laboratóriumi diagnosztika. Szerkesztette: Szarka András. Írta: Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis Egyetem Klinikai kémia Laboratóriumi diagnosztika Szerkesztette: Szarka András Írta: Szarka András (1-8, 11-15. fejezet) Keszler Gergely (9, 10. fejezet) Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis

Részletesebben

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel Gyakorlat helye: BIOMI Kft. Gödöllő, Szent-Györgyi A. u. 4. (Nemzeti Agrárkutatási és Innovációs Központ épülete volt

Részletesebben

5. Molekuláris biológiai technikák

5. Molekuláris biológiai technikák 5. Molekuláris biológiai technikák DNS szaporítás kémcsőben és élőben. Klónozás, PCR, cdna, RT-PCR, realtime-rt-pcr, Northern-, Southernblotting, génexpresszió, FISH 5. Molekuláris szintű biológiai technikák

Részletesebben

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan fehérjét (FC-1 killer toxint) választ ki a tápközegbe, amely elpusztítja az opportunista patogén Cryptococcus neoformans-t.

Részletesebben

Emlősök korai embrionális génjei kifejeződésének vizsgálata. molekuláris biológiai módszerekkel. Baji Gál Árpád

Emlősök korai embrionális génjei kifejeződésének vizsgálata. molekuláris biológiai módszerekkel. Baji Gál Árpád Emlősök korai embrionális génjei kifejeződésének vizsgálata molekuláris biológiai módszerekkel Doktori értekezés Baji Gál Árpád Biológia Doktori Iskola, iskolavezető: Prof. Erdei Anna Szerkezeti biokémia

Részletesebben

A Molekuláris Biológia Technológiai Arzenálja - I

A Molekuláris Biológia Technológiai Arzenálja - I A Molekuláris Biológia Technológiai Arzenálja - I 0. BEVEZETÉS A molekuláris biológia fogalmát kétféle értelemben használjuk. Az egyik értelmezés szerint a molekuláris biológia egy tudományterület, amely

Részletesebben

SZOMATIKUS ÉS Y KROMOSZÓMÁN LOKALIZÁLÓDÓ STR MARKEREK POPULÁCIÓGENETIKAI VIZSGÁLATA

SZOMATIKUS ÉS Y KROMOSZÓMÁN LOKALIZÁLÓDÓ STR MARKEREK POPULÁCIÓGENETIKAI VIZSGÁLATA SZEGEDI TUDOMÁNYEGYETEM TERMÉSZETTUDOMÁNYI KAR SZOMATIKUS ÉS Y KROMOSZÓMÁN LOKALIZÁLÓDÓ STR MARKEREK POPULÁCIÓGENETIKAI VIZSGÁLATA PhD dolgozat Készítette: Beer Zsuzsanna Szakvezető: Prof. Dr. Varga Tibor

Részletesebben

GENOMIKA Fogalmak genom genetika genomika szerkezetét összehasonlít funkcióit A genomika főbb területei (1) Strukturális (szerkezeti) genomika (2)

GENOMIKA Fogalmak genom genetika genomika szerkezetét összehasonlít funkcióit A genomika főbb területei (1) Strukturális (szerkezeti) genomika (2) GENOMIKA Fogalmak A genom az élőlényekben, illetve azok egyetlen sejtjében található öröklési anyag (DNS) teljes állománya. A genetika a tulajdonságok öröklésével, egyes gének szerkezetével és működésével

Részletesebben

A replikáció mechanizmusa

A replikáció mechanizmusa Az öröklődés molekuláris alapjai A DNS megkettőződése, a replikáció Szerk.: Vizkievicz András A DNS-molekula az élőlények örökítő anyaga, kódolt formában tartalmazza mindazon információkat, amelyek a sejt,

Részletesebben

A proteomika új tudománya és alkalmazása a rákdiagnosztikában

A proteomika új tudománya és alkalmazása a rákdiagnosztikában BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK A proteomika új tudománya és alkalmazása a rákdiagnosztikában Tárgyszavak: proteom; proteomika; rák; diagnosztika; molekuláris gyógyászat; biomarker;

Részletesebben

Molekuláris terápiák

Molekuláris terápiák Molekuláris terápiák Aradi, János Balajthy, Zoltán Csősz, Éva Scholtz, Beáta Szatmári, István Tőzsér, József Varga, Tamás Szerkesztette Balajthy, Zoltán és Tőzsér, József, Debreceni Egyetem Molekuláris

Részletesebben

Hogyan segíti a MALDI-TOF MS az aerob baktériumok gyors species identifikálását. Kardos Gábor DEOEC Orvosi Mikrobiológiai Intézet

Hogyan segíti a MALDI-TOF MS az aerob baktériumok gyors species identifikálását. Kardos Gábor DEOEC Orvosi Mikrobiológiai Intézet Hogyan segíti a MALDI-TOF MS az aerob baktériumok gyors species identifikálását Kardos Gábor DEOEC Orvosi Mikrobiológiai Intézet Módszerek Biokémiai profil csöves biokémia ID kitek (API, Cristal, Biolog,

Részletesebben

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin A géntechnikák alkalmazási területei leltár Géntechnika 3 Dr. Gruiz Katalin Kutatás Genetikai: genomok feltérképezése: HUGO, mikroorganizmusoké, ujjlenyomatok készítése, jellegzetes szekvenciák keresése

Részletesebben

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G.

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G. 1955: 46 emberi kromoszóma van 1961: mrns 1975: DNS szekvenálás 1982: gén-bank adatbázisok 1983: R (polymerase chain reaction) Mérföldkövek 1 J. D. Watson F. H.. rick 2008 1953 2003 Watson genomja DNS

Részletesebben

Gyógyszerek és DNS mutációk kimutatása vérből

Gyógyszerek és DNS mutációk kimutatása vérből Gyógyszerek és DNS mutációk kimutatása vérből AKI kíváncsi kémikus kutatótábor Kolostyák Zsuzsanna, Békés Márta, Varga Bálint 2010. Július 2. Enzimek; metabolizmus - A legtöbb biokémiai lépést enzimek

Részletesebben

A HUMÁN WFIKKN1 FEHÉRJE FUNKCIONÁLIS JELLEMZÉSE

A HUMÁN WFIKKN1 FEHÉRJE FUNKCIONÁLIS JELLEMZÉSE A HUMÁN WFIKKN1 FEHÉRJE FUNKCIONÁLIS JELLEMZÉSE Doktori (Ph.D.) értekezés tézisei Kondás Katalin Témavezetı: Prof. Dr. Patthy László Eötvös Loránd Tudományegyetem, Természettudományi Kar, Biológia Doktori

Részletesebben

Új molekuláris biológiai módszerek

Új molekuláris biológiai módszerek Wunderlich Lívius előadásában: Új molekuláris biológiai módszerek 2012/13 tavasz Központi jegyzet hiányában készült, tisztázatlan jogállású hallgatói jegyzet. Nyomokban elgépeléseket, valamint tartalmi

Részletesebben

A nukleáris genom felépítése

A nukleáris genom felépítése A nukleáris genom felépítése 1000 bp = 1 kbp (10 3 ) egy prokariota gén mérete, 1000 kb = 1 Mbp (10 6 ), 1000 Mb = 1 Gbp (10 9 ) 0,6x10 6 bp 600 gén? Mycoplasma genitalium 4,7x10 6 bp 4 700 gén? 4300 gén

Részletesebben

A KALPAIN ÉS A PROTEIN KINÁZ/FOSZFATÁZ RENDSZEREK VIZSGÁLATA

A KALPAIN ÉS A PROTEIN KINÁZ/FOSZFATÁZ RENDSZEREK VIZSGÁLATA EGYETEMI DOKTORI (Ph.D.) ÉRTEKEZÉS TÉZISEI A KALPAIN ÉS A PROTEIN KINÁZ/FOSZFATÁZ RENDSZEREK VIZSGÁLATA Kölcsönhatás a posztszintetikus fehérje módosító rendszerek között Kovács László DEBRECENI EGYETEM

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

Az MsDwf1 - törpe diploid Medicago sativa növények mutációt hordoznak a gibberellin 3-β-hidroxiláz génben

Az MsDwf1 - törpe diploid Medicago sativa növények mutációt hordoznak a gibberellin 3-β-hidroxiláz génben Az MsDwf1 - törpe diploid Medicago sativa növények mutációt hordoznak a gibberellin 3-β-hidroxiláz génben Dalmadi Ágnes Biológia Doktori Iskola, Klasszikus és Molekuláris Genetika Doktori Program A Doktori

Részletesebben

Molekuláris biológiai módszerek

Molekuláris biológiai módszerek Molekuláris biológiai módszerek laborgyakorlatok középiskolásoknak Az MTA Szakmódszertani pályázata (Sz-049/2014) támogatásával készült Dr. Bodai László Szegedi Tudományegyetem, Biokémiai és Molekuláris

Részletesebben

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód)

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2.1 Nukleotidok, nukleinsavak Információátadás (örökítőanyag) Információs egység

Részletesebben

VÁLASZ OPPONENSI VÉLEMÉNYRE

VÁLASZ OPPONENSI VÉLEMÉNYRE VÁLASZ OPPONENSI VÉLEMÉNYRE Dr. Taller János Tudományos főmunkatárs Pannon Egyetem, Georgikon Kar, Növénytudományi és Biotechnológiai Tanszék Biotechnológiai Kutatócsoport Farkas Valéria Tejtermelést és

Részletesebben

AZ IS30 BAKTERIÁLIS INSZERCIÓS ELEM CÉLSZEKVENCIA VÁLASZTÁSÁNAK MOLEKULÁRIS TÉNYEZŐI DOKTORI ÉRTEKEZÉS TÉZISEI SZABÓ MÓNIKA

AZ IS30 BAKTERIÁLIS INSZERCIÓS ELEM CÉLSZEKVENCIA VÁLASZTÁSÁNAK MOLEKULÁRIS TÉNYEZŐI DOKTORI ÉRTEKEZÉS TÉZISEI SZABÓ MÓNIKA AZ IS30 BAKTERIÁLIS INSZERCIÓS ELEM CÉLSZEKVENCIA VÁLASZTÁSÁNAK MOLEKULÁRIS TÉNYEZŐI DOKTORI ÉRTEKEZÉS TÉZISEI SZABÓ MÓNIKA Gödöllő 2007. 1 A Doktori Iskola megnevezése: Szent István Egyetem Biológia Tudományi

Részletesebben

ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL

ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL EREDMÉNYEK Munkacsoportunk úttörő szerepet játszott a molekuláris onkológiai (onkogenetikai)

Részletesebben

Előadások témája: Elsősorban a DNS, a gének és genomok molekuláris biológiája. Tételsorok mindenkinek a honlapon:

Előadások témája: Elsősorban a DNS, a gének és genomok molekuláris biológiája. Tételsorok mindenkinek a honlapon: MOLEKULÁRIS BIOLÓGIA Előadások témája: Elsősorban a DNS, a gének és genomok molekuláris biológiája Előadásokra járni kötelező, de nincs névsor olvasás. Zárthelyi dolgozat nincs. Vegyész és hidrobiológus

Részletesebben

A minimális sejt. Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására

A minimális sejt. Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására A minimális sejt Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására Anyagcsere Gánti kemoton elmélete Minimum sejt Top down: Meglevő szervezetek genomjából indulunk ki Bottom

Részletesebben

Gyermekgyógyászat 2016/4 teszt megoldókulcs. Melyek a hemokultúra negatív endocarditisek leggyakoribb kórokozói?

Gyermekgyógyászat 2016/4 teszt megoldókulcs. Melyek a hemokultúra negatív endocarditisek leggyakoribb kórokozói? Gyermekgyógyászat 2016/4 teszt megoldókulcs A macskakarmolási betegség és egyéb bartonellosisok Trethon András Melyek a hemokultúra negatív endocarditisek leggyakoribb kórokozói? a) E. faecalis és E. faecium

Részletesebben

HUMÁN PAPILLOMAVÍRUS FERTİZÉS HATÁSA AZ EPIGENETIKAI ÉS JELÁTVITELI SZABÁLYOZÓ FOLYAMATOKRA KERATINOCITÁKBAN

HUMÁN PAPILLOMAVÍRUS FERTİZÉS HATÁSA AZ EPIGENETIKAI ÉS JELÁTVITELI SZABÁLYOZÓ FOLYAMATOKRA KERATINOCITÁKBAN Egyetemi doktori (Ph.D.) értekezés tézisei HUMÁN PAPILLOMAVÍRUS FERTİZÉS HATÁSA AZ EPIGENETIKAI ÉS JELÁTVITELI SZABÁLYOZÓ FOLYAMATOKRA KERATINOCITÁKBAN Szalmás Anita Témavezetı: Dr. Kónya József DEBRECENI

Részletesebben

cobas TaqScreen MPX Test for use on the cobas s 201 system

cobas TaqScreen MPX Test for use on the cobas s 201 system cobas TaqScreen MPX Test for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test MPX 96 Tests P/N: 04584244 190 cobas TaqScreen MPX Control Kit MPX CTL 6 Sets P/N: 04626290

Részletesebben

Az anti-apoptózis mechanizmus vizsgálata agyi ischaemia/hypoxia modellekben

Az anti-apoptózis mechanizmus vizsgálata agyi ischaemia/hypoxia modellekben OTKA T-037887 zárójelentés Az anti-apoptózis mechanizmus vizsgálata agyi ischaemia/hypoxia modellekben Az ischaemias stroke-ot követően az elzáródott ér ellátási területének centrumában percek, órák alatt

Részletesebben

Dr. Erbszt András Szt. János Kh. Idegsebészeti Osztály NEVES BETEGBIZTONSÁGI FÓRUM

Dr. Erbszt András Szt. János Kh. Idegsebészeti Osztály NEVES BETEGBIZTONSÁGI FÓRUM Dr. Erbszt András Szt. János Kh. Idegsebészeti Osztály 2013.10.10. NEVES BETEGBIZTONSÁGI FÓRUM Definíció Szegmentum tévesztésről akkor beszélünk a gerincsebészetben amikor a sebész nem a tervezett magasságban

Részletesebben

Rekombináns Géntechnológia

Rekombináns Géntechnológia Rekombináns Géntechnológia Tartalom: 1 1. Biotechnológia, géntechnológia, társadalom 2. Genetikai rekombináció 3. Génbevitel tenyésztett sejtekbe 4. Genetikailag módosított szervezetek (GMO-k) 4a. Transzgénikus

Részletesebben

Az emberi erőforrás értéke

Az emberi erőforrás értéke Szabó László SZABÓ LÁSZLÓ Az emberi erőforrás értéke A génvizsgálat, mint egészségügyi prevenció Az emberi tényező fontos elem a stratégiai kezdeményezésekben, a versenyelőny megszerzésében és megtartásában.

Részletesebben

Könyvtárak, szekvenálás, mutagenezis

Könyvtárak, szekvenálás, mutagenezis Könyvtárak, szekvenálás, mutagenezis GÉNKÖNYVTÁRAK GENOMIÁLIS KÖNYVTÁR (könyvtár rendelésre: pl. Stratagene) vektor: -fág (helyettesítő), kozmid, YAC, PAC, BAC méret: N = ln(1-p)/ln[1-(i/g)] klónok száma

Részletesebben

CzB 2010. Élettan: a sejt

CzB 2010. Élettan: a sejt CzB 2010. Élettan: a sejt Sejt - az élet alapvető egysége Prokaryota -egysejtű -nincs sejtmag -nincsenek sejtszervecskék -DNS = egy gyűrű - pl., bactériumok Eukaryota -egy-/többsejtű -sejmag membránnal

Részletesebben

MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék. Atomoktól a csillagokig, Budapest, február 23.

MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék. Atomoktól a csillagokig, Budapest, február 23. MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék Atomoktól a csillagokig, Budapest, 2017. február 23. Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája

Részletesebben

Humán genom variációk single nucleotide polymorphism (SNP)

Humán genom variációk single nucleotide polymorphism (SNP) Humán genom variációk single nucleotide polymorphism (SNP) A genom ~ 97 %-a két különböző egyedben teljesen azonos ~ 1% különbség: SNP miatt ~2% különbség: kópiaszámbeli eltérés, deléciók miatt 11-12 millió

Részletesebben

COBAS AmpliPrep/COBAS TaqMan HCV Qualitative Test, version 2.0

COBAS AmpliPrep/COBAS TaqMan HCV Qualitative Test, version 2.0 COBAS AmpliPrep/COBAS TaqMan HCV Qualitative Test, version 2.0 IN VITRO DIAGNOSZTIKAI CÉLRA. COBAS AmpliPrep/COBAS TaqMan HCV HCVQLV2 72 Tests P/N: 05480477 190 Qualitative Test, v2.0 COBAS AmpliPrep/COBAS

Részletesebben

++ mm. +m +m +m +m. Hh,fF Hh,fF hh,ff hh,ff. ff Ff. Hh hh. ff ff ff ff. Hh Hh hh hh

++ mm. +m +m +m +m. Hh,fF Hh,fF hh,ff hh,ff. ff Ff. Hh hh. ff ff ff ff. Hh Hh hh hh Múlt órán: Genetikai alapelvek, monogénes öröklődés Elgondolkodtató feladat Vajon miért nem halnak ki az olyan mendeli öröklődésű rendellenességek, mint a Phenylketonuria, vagy a Huntington kór? A PKU

Részletesebben

PÉCSI TUDOMÁNYEGYETEM ÁLTALÁNOS ORVOSTUDOMÁNYI KAR Áramlási citometria, sejtszeparálás ÁRAMLÁSI CITOMETRIA, SEJTSZEPARÁLÁS BIOFIZIKA 2. 2015. március 3. Dr. Bugyi Beáta Biofizikai Intézet ÁRAMLÁSI folyadékáramban

Részletesebben

Pozitron-emissziós tomográf (PET) mire való és hogyan működik?

Pozitron-emissziós tomográf (PET) mire való és hogyan működik? Pozitron-emissziós tomográf (PET) mire való és hogyan működik? Major Péter Atomoktól csillagokig, 2011. nov. 10. Vázlat Mi az hogy Tomográf? (fajták, képek) Milyen tomográfok vannak, miért van ennyi? Milyen

Részletesebben

molekuláris (RAPD, SSR, AFLP és SCAR) jellemzése.

molekuláris (RAPD, SSR, AFLP és SCAR) jellemzése. 1 Különböző nyár, búza és kender genotípusok molekuláris (RAPD, SSR, AFLP és SCAR) jellemzése. Doktori értekezés Törjék Ottó Gödöllő 2001. 2 Doktori iskola: Vezetője: Tudományága: Program: Programvezető:

Részletesebben

(11) Lajstromszám: E 008 532 (13) T2 EURÓPAI SZABADALOM SZÖVEGÉNEK FORDÍTÁSA

(11) Lajstromszám: E 008 532 (13) T2 EURÓPAI SZABADALOM SZÖVEGÉNEK FORDÍTÁSA !HU00000832T2! (19) HU (11) Lajstromszám: E 008 32 (13) T2 MAGYAR KÖZTÁRSASÁG Szellemi Tulajdon Nemzeti Hivatala EURÓPAI SZABADALOM SZÖVEGÉNEK FORDÍTÁSA (21) Magyar ügyszám: E 03 783231 (22) A bejelentés

Részletesebben

BSc záróvizsga tételek Szerves kémia

BSc záróvizsga tételek Szerves kémia BSc záróvizsga tételek Szerves kémia A) tételsor 1. Gyökös mechanizmusú szubsztitúciós és addíciós reakciók. A telített szénhidrogének halogénezése. Allil-helyzetű szubsztitúciós halogénezés. A hidrogén-bromid

Részletesebben

Gyógyászati jelentõségû rekombináns DNS termékek elõállítása

Gyógyászati jelentõségû rekombináns DNS termékek elõállítása Gyógyászati jelentõségû rekombináns DNS termékek elõállítása Géntechnikák 4. rész Dr. Gruiz Katalin Dr. Szvoboda György Gyógyászati jelentõségû rekombináns DNS termékek elõállítása Maximálisan üzleti alapon

Részletesebben

Biokatalízis, biokonverziók, biotranszformációk Rákhely, Gábor

Biokatalízis, biokonverziók, biotranszformációk Rákhely, Gábor Biokatalízis, biokonverziók, biotranszformációk Rákhely, Gábor Biokatalízis, biokonverziók, biotranszformációk Rákhely, Gábor Publication date 2012 Szerzői jog 2012 Szegedi Tudományegyetem TÁMOP-4.1.2.A/1-11/1

Részletesebben

A doktori értekezés tézisei. A növényi NRP fehérjék lehetséges szerepe a hiszton defoszforiláció szabályozásában, és a hőstressz válaszban.

A doktori értekezés tézisei. A növényi NRP fehérjék lehetséges szerepe a hiszton defoszforiláció szabályozásában, és a hőstressz válaszban. A doktori értekezés tézisei A növényi NRP fehérjék lehetséges szerepe a hiszton defoszforiláció szabályozásában, és a hőstressz válaszban. Bíró Judit Témavezető: Dr. Fehér Attila Magyar Tudományos Akadémia

Részletesebben

genetikai variációk, szerepük k a mindennapi transzfúziológiai ziológiai gyakorlatban

genetikai variációk, szerepük k a mindennapi transzfúziológiai ziológiai gyakorlatban A vércsoport v rendszereket érintő genetikai variációk, szerepük k a mindennapi transzfúziológiai ziológiai gyakorlatban Tordai Attila OVSZK Molekuláris Diagnosztikai Labor Transzfúzi ziólógiai szinten

Részletesebben

7. A SEJT A SEJT 1. ÁLTALÁNOS TUDNIVALÓK

7. A SEJT A SEJT 1. ÁLTALÁNOS TUDNIVALÓK A SEJT 1. ÁLTALÁNOS TUDNIVALÓK DIA 1 DIA 2 DIA 3 DIA 4 A sejtbiológia a biológiának az a tudományterülete, amely a sejt szerkezeti felépítésével, a különféle sejtfolyamatokkal (sejtlégzés, anyagtranszport,

Részletesebben

1. Célkitűzésem a praeeclampsiában és HELLP szindrómában eltérő expresszivitást mutató

1. Célkitűzésem a praeeclampsiában és HELLP szindrómában eltérő expresszivitást mutató Egyes lepényi jelátviteli utak vizsgálata praeeclampsiában és HELLP szindrómában, különös tekintettel a leptin és a leptin receptor közötti kapcsolatra Doktori (Ph.D.) értekezés Készítette: Dr. Várkonyi

Részletesebben

A legtöbbet vizsgált fonalas gomba eredetű vic gén a N. crassa het-c génje. E gén egy 966 aminosav hosszúságú glicinben gazdag transzmembrán fehérjét

A legtöbbet vizsgált fonalas gomba eredetű vic gén a N. crassa het-c génje. E gén egy 966 aminosav hosszúságú glicinben gazdag transzmembrán fehérjét Bevezetés A saját-idegen felismerés az élő szervezetek általános tulajdonsága. Magasabb rendű eukarióták esetében kiemelkedő szerepe van a szövetek, szervek identitásának fenntartásában, valamint a kórokozók

Részletesebben

Népegészségügyi genomika

Népegészségügyi genomika Népegészségügyi genomika Népegészségügyi genomika Tartalom 1. A genom szerkezete... 1 1. A genom szerkzet... 1 1.1. Bevezetés a humán genom... 1 1.2. A genetika rövid története... 1 2. A DNS szerkezete...

Részletesebben

cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system

cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test, v2.0 MPX v2.0 96 Tests P/N: 05969492 190 cobas TaqScreen MPX Control Kit,

Részletesebben

Közhasznúsági Beszámoló. Egry József Általános Iskola. Tolnai Alapítvány

Közhasznúsági Beszámoló. Egry József Általános Iskola. Tolnai Alapítvány Közhasznúsági Beszámoló 2012 Egry József Általános Iskola Tolnai Alapítvány Adószám: 18953305-1-20 8360 Keszthely, Vásár tér 10. Keszthely,2013.02.15. 1 Közhasznúsági melléklet részei 1. Az alapítvány

Részletesebben

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6 Agilent 2100 Bioanalyzer mikrokapilláris gélelektroforézis rendszer G2943CA 2100 Bioanalyzer system forgalmazó: Kromat Kft. 1112 Budapest Péterhegyi u. 98. t:36 (1) 248-2110 www.kromat.hu bio@kromat.hu

Részletesebben

A sejtes szervezıdés elemei (sejtalkotók / sejtorganellumok)

A sejtes szervezıdés elemei (sejtalkotók / sejtorganellumok) A sejtes szervezıdés elemei (sejtalkotók / sejtorganellumok) 1 Sejtorganellumok vizsgálata: fénymikroszkóp elektronmikroszkóp pl. scanning EMS A szupramolekuláris struktúrák további szervezıdése sejtorganellumok

Részletesebben

A GÉNEXPRESSZIÓ VIZSGÁLATA

A GÉNEXPRESSZIÓ VIZSGÁLATA A GÉNEXPRESSZIÓ VIZSGÁLATA A DNS nemcsak tárolja az információt, hanem lehetővé teszi annak szabályozott érvényre jutását, kifejeződését. A génexpresszió során a génekről RNS-molekulák keletkeznek (transzkripció),

Részletesebben

Molekuláris biológiai diagnosztika alkalmazása

Molekuláris biológiai diagnosztika alkalmazása Molekuláris biológiai diagnosztika alkalmazása (HIV, HCV, HBV szabad vírus mennyiség meghatározás) a napi rutin diagnosztikában Reichenberger Anna Mária, Dr. Sárvári Csilla Dr. Ujhelyi Eszter Fıvárosi

Részletesebben

cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system

cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test, v2.0 MPX v2.0 96 Tests P/N: 05969492 190 cobas TaqScreen MPX Control Kit,

Részletesebben

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához?

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Falus András Genetikai, Sejt- és Immunbiológiai Intézet Semmelweis Egyetem Antal Péter Hadadi Éva

Részletesebben

BIOTECHNOLÓGIA SVM II. Mikroorganizmusok azonosítása környezeti mintákból molekuláris ökológiai technikák segítségével

BIOTECHNOLÓGIA SVM II. Mikroorganizmusok azonosítása környezeti mintákból molekuláris ökológiai technikák segítségével BIOTECHNOLÓGIA SVM II. Mikroorganizmusok azonosítása környezeti mintákból molekuláris ökológiai technikák segítségével BEVEZETÉS Az 1970-es évek elejéig a mikrobiológusok túlnyomó többsége reménytelen,

Részletesebben

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód)

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2.1 Nukleotidok, nukleinsavak Információátadás (örökítőanyag) Információs egység

Részletesebben

20 éves a Mamma Klinika

20 éves a Mamma Klinika 20 éves a Mamma Klinika A sejtdiagnosztika modern eszközei a diagnosztikában és terápiában dr Járay Balázs, dr Székely Eszter Medserv Kft, Semmelweis Egyetem II. Patológiai Intézet Budapest 1 22196 betegből

Részletesebben

Készült a Pannon Egyetem, Állat- és Agrárkörnyezettudományi

Készült a Pannon Egyetem, Állat- és Agrárkörnyezettudományi PANNON EGYETEM GEORGIKON KAR Állattudományi és Állattenyésztéstani Tanszék DOKTORI (PhD) ÉRTEKEZÉS Készült a Pannon Egyetem, Állat- és Agrárkörnyezettudományi Doktori Iskola keretében Doktori Iskola vezető:

Részletesebben

Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 468 EGYEDAZONOSÍTÁS ÉS SZÁRMAZÁSELLENİRZÉS HIPERPOLIMORF MIKROSZATELLITA

Részletesebben

COBAS TaqMan HBV Test HBV HPS

COBAS TaqMan HBV Test HBV HPS COBAS TaqMan HBV Test For Use With The High Pure System IN VITRO DIAGNOSZTIKAI CÉLRA. COBAS TaqMan HBV Test HBV HPS 48 Tests P/N: 03500756 190 High Pure System Viral Nucleic Acid Kit 48 Tests P/N: 03502295

Részletesebben

Mi a bioinformatika? Bioinformatika: számítógépes módszerek kidolgozása és alkalmazása a biológiai információ kezelésére és elemzésére.

Mi a bioinformatika? Bioinformatika: számítógépes módszerek kidolgozása és alkalmazása a biológiai információ kezelésére és elemzésére. BIOINFORMATIKA Mi a bioinformatika? Bioinformatika: számítógépes módszerek kidolgozása és alkalmazása a biológiai információ kezelésére és elemzésére. A bioinformatika céljai Adatbázisok létrehozása és

Részletesebben