MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék. Atomoktól a csillagokig, Budapest, február 23.

Save this PDF as:
 WORD  PNG  TXT  JPG

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék. Atomoktól a csillagokig, Budapest, február 23."

Átírás

1 MIT TEHET A FIZIKUS A RÁKKUTATÁSÉRT? Pipek Orsolya ELTE TTK Komplex rendszerek fizikája tanszék Atomoktól a csillagokig, Budapest, február 23.

2 Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. ÁTTEKINTÉS 1

3 Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. ÁTTEKINTÉS Motiváció 1

4 Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. ÁTTEKINTÉS Motiváció A DNS szerkezete, története 1

5 Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. ÁTTEKINTÉS Új kutatási lehetőségek Motiváció A DNS szerkezete, története 1

6 Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. ÁTTEKINTÉS Új kutatási lehetőségek Motiváció Szekvenálási technikák A DNS szerkezete, története 1

7 Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. ÁTTEKINTÉS Kihívások az adatfeldolgozásban Új kutatási lehetőségek Motiváció Szekvenálási technikák A DNS szerkezete, története 1

8 Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. ÁTTEKINTÉS Kihívások az adatfeldolgozásban Új kutatási lehetőségek Motiváció Reményteli jövő Szekvenálási technikák A DNS szerkezete, története 1

9 Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. ÁTTEKINTÉS Szükséges szaktudás Kihívások az adatfeldolgozásban Új kutatási lehetőségek Motiváció Reményteli jövő Szekvenálási technikák A DNS szerkezete, története 1

10 ÁTTEKINTÉS Szükséges szaktudás Kihívások az adatfeldolgozásban Új kutatási lehetőségek Összegzés Motiváció Reményteli jövő Szekvenálási technikák A DNS szerkezete, története 1

11 MOTIVÁCIÓ: MIÉRT FOGLALKOZUNK GENETIKÁVAL? 2

12 MOTIVÁCIÓ: MIÉRT FOGLALKOZUNK GENETIKÁVAL? főleg fizikusként 2

13 MOTIVÁCIÓ: MIÉRT FOGLALKOZUNK GENETIKÁVAL? főleg fizikusként hasznos genetikai betegségek 2

14 MOTIVÁCIÓ: MIÉRT FOGLALKOZUNK GENETIKÁVAL? főleg fizikusként hasznos genetikai betegségek szükséges óriási feldolgozatlan adatmennyiség 2

15 MOTIVÁCIÓ: MIÉRT FOGLALKOZUNK GENETIKÁVAL? főleg fizikusként hasznos genetikai betegségek szükséges óriási feldolgozatlan adatmennyiség érdekes új, felfedezetlen területek, kihívások 2

16 MOTIVÁCIÓ: MIÉRT FOGLALKOZUNK GENETIKÁVAL? főleg fizikusként hasznos genetikai betegségek szükséges óriási feldolgozatlan adatmennyiség érdekes új, felfedezetlen területek, kihívások képesek vagyunk rá fizikusok jó problémamegoldók 2

17 MI A DNS? 3

18 MI A DNS? dezoxiribonukleinsav Feladata: genetikai utasítások összességének kódolása örökítőanyag, genom (vírusoknál RNS) utód megörökli az apai és anyai DNS felét öröklött tulajdonságok Felépítése: hatalmas makromolekula, két egymás köré csavarodott polinukleotid szál monomer egysége: nukleotid adenin A G purin váz guanin T C pirimidin váz timin dezoxiribóz foszfátcsoport nukleobázis citozin 3

19 MI A DNS? P nukleotid D C 4

20 MI A DNS? nukleotid 5 P P D CA D C P D C polinukleotid szál P D CT P D CT 3 4

21 MI A DNS? P nukleotid D C polinukleotid szál 5 P P P P D D D bázispár CA T C G CT A D D D P P P 5 kettős polinukleotid szál 3 D CT A D P 3 4

22 MI A DNS? P nukleotid D Humán genom: 3 milliárd ( ) bázispár minden testi sejtben! C polinukleotid szál 5 3 P P P P D D D D bázispár CA T C G CT A CT A D D D D P P P P 5 3 kettős polinukleotid szál 4

23 MI A DNS? Humán genom: 3 milliárd ( ) bázispár minden testi sejtben! 5

24 MI A DNS? Bázispárok átlagos távolsága: 0,34 nm (0, m) Humán genom: 3 milliárd ( ) bázispár minden testi sejtben! 5

25 MI A DNS? Emberi test: 37,2 billió (3, ) sejt! (2013, DOI: / ) Bázispárok átlagos távolsága: 0,34 nm (0, m) Humán genom: 3 milliárd ( ) bázispár minden testi sejtben! 5

26 MI A DNS? Emberi test: 37,2 billió (3, ) sejt! (2013, DOI: / ) 3, m 250 CSE Bázispárok átlagos távolsága: 0,34 nm (0, m) Humán genom: 3 milliárd ( ) bázispár minden testi sejtben! 5

27 MI A DNS? Emberi test: 37,2 billió (3, ) sejt! (2013, DOI: / ) 3, m 250 CSE Bázispárok átlagos távolsága: 0,34 nm (0, m) 250x Humán genom: 3 milliárd ( ) bázispár minden testi sejtben! 5

28 MI A DNS? Emberi test: 37,2 billió (3, ) sejt! (2013, DOI: / ) 3, m 250 CSE Ezt nagyon be kell csomagolni! Bázispárok átlagos távolsága: 0,34 nm (0, m) 250x Humán genom: 3 milliárd ( ) bázispár minden testi sejtben! 5

29 MI A DNS? Emberi test: 37,2 billió (3, ) sejt! (2013, DOI: / ) 3, m 250 CSE Ezt nagyon be kell csomagolni! Bázispárok átlagos távolsága: 0,34 nm (0, m) Humán genom: 3 milliárd ( ) bázispár minden testi sejtben! 6

30 MI A DNS? Információ kódolása: bázissorendben 3 egymás melletti bázis ( kodon ) kódol egy aminosavat aminosavak fehérjék A szervezet működésében a konkrét bázissorendnek meghatározó szerepe van. transzkripció transzláció Cél: a bázissorend (és következményeinek) feltérképezése SZEKVENÁLÁS 7

31 A DNS TÖRTÉNETE 8

32 1879 izzólámpa 1869 Friedrich Miescher izolálja a nukleint eddig ismeretlen, a sejtmagban ( nukleusz ) elhelyezkedő anyag nem fehérje A DNS TÖRTÉNETE A tübingeni egyetem laboratóriuma (1879 körül) 8

33 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet A DNS TÖRTÉNETE 8

34 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet 1937 Első röntgen-diffrakciós felvétel A DNS TÖRTÉNETE rossz minőségű de látszik a rendezett térszerkezet a szerkezet azonosítása nem sikerült (William Astbury) 8

35 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet 1937 Első röntgen-diffrakciós felvétel A DNS TÖRTÉNETE Nyitray László, Pál Gábor: Griffith-kísérlet 1944 Avery MacLeod McCarty kísérlet: a DNS hordozza a genetikai információt! RNS-, fehérje- és DNS-bontó enzimek mi okozza a transzformációt? RNS? fehérjék? DNS? 8

36 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet 1937 Első röntgen-diffrakciós felvétel A DNS TÖRTÉNETE Nyitray László, Pál Gábor: Griffith-kísérlet 1944 Avery MacLeod McCarty kísérlet: a DNS hordozza a genetikai információt! RNS-, fehérje- és DNS-bontó enzimek mi okozza a transzformációt? RNS? fehérjék? DNS? 8

37 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet 1937 Első röntgen-diffrakciós felvétel A DNS TÖRTÉNETE 1947 tranzisztor 1944 Avery MacLeod McCarty kísérlet: a DNS hordozza a genetikai információt! 1953 Watson-Crick kettős hélix modell (Franklin felvétele alapján) Franklin fizikus volt! elméleti megfontolások Crick is! 8

38 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet 1937 Első röntgen-diffrakciós felvétel A DNS TÖRTÉNETE 1947 tranzisztor 1944 Avery MacLeod McCarty kísérlet: a DNS hordozza a genetikai információt! 1953 Watson-Crick kettős hélix modell (Franklin felvétele alapján) 1957 Crick: centrális dogma (transzkripció, transzláció) 8

39 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet 1937 Első röntgen-diffrakciós felvétel A DNS TÖRTÉNETE 1947 tranzisztor 1970 számológép 1944 Avery MacLeod McCarty kísérlet: a DNS hordozza a genetikai információt! 1953 Watson-Crick kettős hélix modell (Franklin felvétele alapján) 1957 Crick: centrális dogma (transzkripció, transzláció) 1977 Első szekvenálás (Sanger, Maxam, Gilbert) 8

40 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet 1937 Első röntgen-diffrakciós felvétel A DNS TÖRTÉNETE 1947 tranzisztor 1970 számológép 1990 WWW 1944 Avery MacLeod McCarty kísérlet: a DNS hordozza a genetikai információt! 1953 Watson-Crick kettős hélix modell (Franklin felvétele alapján) 1957 Crick: centrális dogma (transzkripció, transzláció) 1977 Első szekvenálás (Sanger, Maxam, Gilbert) 1990 Megkezdődik a humán genom szekvenálása 8

41 1879 izzólámpa 1931 TEM 1869 Friedrich Miescher izolálja a nukleint 1919 Alkotórészek azonosítása, polimer szerkezet 1937 Első röntgen-diffrakciós felvétel A DNS TÖRTÉNETE 1947 tranzisztor 1970 számológép 1990 WWW 2000 τ-neutrínó 1944 Avery MacLeod McCarty kísérlet: a DNS hordozza a genetikai információt! 1953 Watson-Crick kettős hélix modell (Franklin felvétele alapján) 1957 Crick: centrális dogma (transzkripció, transzláció) 1977 Első szekvenálás (Sanger, Maxam, Gilbert) 1990 Megkezdődik a humán genom szekvenálása 2001 A teljes humán genom publikálása 8

42 ÚJ KUTATÁSI LEHETŐSÉGEK 9

43 ÚJ KUTATÁSI LEHETŐSÉGEK különbségek DNS és DNS között: örökletes és szerzett mutációk nagy része ártatlan : szemszín, hajszín stb. genetikai betegségek okozói: a DNS egyes szakaszainak hibái, mutációi (akár egy bázis megváltozása is!) színvakság (örökletes) sarlósejtes vérszegénység (örökletes) laktózérzékenység (lehet szerzett) naponta 500 ezer molekuláris hiba (endogén és exogén tényezők miatt) 9

44 ÚJ KUTATÁSI LEHETŐSÉGEK különbségek DNS és DNS között: örökletes és szerzett mutációk nagy része ártatlan : szemszín, hajszín stb. genetikai betegségek okozói: a DNS egyes szakaszainak hibái, mutációi (akár egy bázis megváltozása is!) színvakság (örökletes) sarlósejtes vérszegénység (örökletes) laktózérzékenység (lehet szerzett) naponta 500 ezer molekuláris hiba (endogén és exogén tényezők miatt) Miért ritkák ehhez képest a genetikai betegségek? a hibák véletlenszerűek nagyon hatékony javító-mechanizmusok! 9

45 ÚJ KUTATÁSI LEHETŐSÉGEK különbségek DNS és DNS között: örökletes és szerzett mutációk nagy része ártatlan : szemszín, hajszín stb. genetikai betegségek okozói: a DNS egyes szakaszainak hibái, mutációi (akár egy bázis megváltozása is!) színvakság (örökletes) sarlósejtes vérszegénység (örökletes) laktózérzékenység (lehet szerzett) naponta 500 ezer molekuláris hiba (endogén és exogén tényezők miatt) Miért ritkák ehhez képest a genetikai betegségek? a hibák véletlenszerűek nagyon hatékony javító-mechanizmusok! Nem akkor van baj, ha a DNS elromlik, hanem ha nem tudjuk kijavítani! 9

46 ÚJ KUTATÁSI LEHETŐSÉGEK Néhány lehetséges mutáció: Kis-skálás Nagy-skálás pontmutáció (T>G) 10

47 ÚJ KUTATÁSI LEHETŐSÉGEK Néhány lehetséges mutáció: Kis-skálás Nagy-skálás pontmutáció (T>G) inzerció 10

48 ÚJ KUTATÁSI LEHETŐSÉGEK Néhány lehetséges mutáció: Kis-skálás Nagy-skálás pontmutáció (T>G) inzerció deléció 10

49 ÚJ KUTATÁSI LEHETŐSÉGEK Néhány lehetséges mutáció: Kis-skálás Nagy-skálás pontmutáció (T>G) inzerció deléció kromoszómán belüli: deléció 10

50 ÚJ KUTATÁSI LEHETŐSÉGEK Néhány lehetséges mutáció: Kis-skálás Nagy-skálás pontmutáció (T>G) inzerció deléció kromoszómán belüli: deléció inzerció/duplikáció 10

51 ÚJ KUTATÁSI LEHETŐSÉGEK Néhány lehetséges mutáció: Kis-skálás Nagy-skálás pontmutáció (T>G) inzerció deléció kromoszómán belüli: deléció inzerció/duplikáció inverzió 10

52 ÚJ KUTATÁSI LEHETŐSÉGEK Néhány lehetséges mutáció: Kis-skálás Nagy-skálás pontmutáció (T>G) inzerció deléció kromoszómán belüli: deléció inzerció/duplikáció inverzió kromoszómák közti: inzerció 10

53 ÚJ KUTATÁSI LEHETŐSÉGEK Néhány lehetséges mutáció: Kis-skálás Nagy-skálás pontmutáció (T>G) inzerció deléció kromoszómán belüli: deléció inzerció/duplikáció inverzió kromoszómák közti: inzerció transzlokáció 10

54 Néhány DNS-javító mechanizmus: ÚJ KUTATÁSI LEHETŐSÉGEK egyik szálon sérült DNS javítása: 1. hiba felismerése, hibás szakasz eltávolítása 2. másik szálról komplementer szakasz legyártása BER: oxidálódott, alkilizálódott vagy hidrolizálódott nukleotidok cseréje NER: hélixszerkezetet torzító mutációk javítása MMR: nem összetartozó (tehát nem AT vagy CG) bázispárok korrekciója kettős szál törés: szálak összeragasztása NHEJ: minta nélkül, rövid átfedő szakaszt keresve ( rövid deléciók) rekombináció: minta alapján NHEJ mechanizmus 11

55 ÚJ KUTATÁSI LEHETŐSÉGEK 12

56 ÚJ KUTATÁSI LEHETŐSÉGEK A DNS másolása és javítása nagyon komplex feladat, nagyon sok enzim és fehérje vesz részt benne! egyelőre nagyon keveset tudunk a konkrét mechanizmusokról, ezek feltérképezése lenne a cél BRCA1 13

57 ÚJ KUTATÁSI LEHETŐSÉGEK A DNS másolása és javítása nagyon komplex feladat, nagyon sok enzim és fehérje vesz részt benne! egyelőre nagyon keveset tudunk a konkrét mechanizmusokról, ezek feltérképezése lenne a cél BRCA1 Módszer: 13

58 ÚJ KUTATÁSI LEHETŐSÉGEK A DNS másolása és javítása nagyon komplex feladat, nagyon sok enzim és fehérje vesz részt benne! egyelőre nagyon keveset tudunk a konkrét mechanizmusokról, ezek feltérképezése lenne a cél BRCA1 Módszer: 1. Egy adag sejtben direkt, célzottan rontsuk el valamelyik fontosnak gyanított gént. ( mutáns sejtek) 13

59 ÚJ KUTATÁSI LEHETŐSÉGEK A DNS másolása és javítása nagyon komplex feladat, nagyon sok enzim és fehérje vesz részt benne! egyelőre nagyon keveset tudunk a konkrét mechanizmusokról, ezek feltérképezése lenne a cél BRCA1 Módszer: 1. Egy adag sejtben direkt, célzottan rontsuk el valamelyik fontosnak gyanított gént. ( mutáns sejtek) 2. Kezeljük az egészséges és a mutáns sejteket valamilyen károsító anyaggal, ami véletlenszerű mutációkat hoz létre. 13

60 ÚJ KUTATÁSI LEHETŐSÉGEK A DNS másolása és javítása nagyon komplex feladat, nagyon sok enzim és fehérje vesz részt benne! egyelőre nagyon keveset tudunk a konkrét mechanizmusokról, ezek feltérképezése lenne a cél BRCA1 Módszer: 1. Egy adag sejtben direkt, célzottan rontsuk el valamelyik fontosnak gyanított gént. ( mutáns sejtek) 2. Kezeljük az egészséges és a mutáns sejteket valamilyen károsító anyaggal, ami véletlenszerű mutációkat hoz létre. 3. Vizsgáljuk, hogy a mutáns és az egészséges sejtek mennyire jól tudják kijavítani a véletlenszerű mutációkat. 13

61 ÚJ KUTATÁSI LEHETŐSÉGEK A DNS másolása és javítása nagyon komplex feladat, nagyon sok enzim és fehérje vesz részt benne! egyelőre nagyon keveset tudunk a konkrét mechanizmusokról, ezek feltérképezése lenne a cél BRCA1 Módszer: 1. Egy adag sejtben direkt, célzottan rontsuk el valamelyik fontosnak gyanított gént. ( mutáns sejtek) 2. Kezeljük az egészséges és a mutáns sejteket valamilyen károsító anyaggal, ami véletlenszerű mutációkat hoz létre. 3. Vizsgáljuk, hogy a mutáns és az egészséges sejtek mennyire jól tudják kijavítani a véletlenszerű mutációkat. 4. Abból, hogy a mutáns sejtekben milyen típusú végleges mutációkat találunk, következtetni lehet arra, hogy az eredetileg megrongált génnek melyik javító-mechanizmusban milyen szerepe van. 13

62 ÚJ KUTATÁSI LEHETŐSÉGEK A DNS másolása és javítása nagyon komplex feladat, nagyon sok enzim és fehérje vesz részt benne! egyelőre nagyon keveset tudunk a konkrét mechanizmusokról, ezek feltérképezése lenne a cél BRCA1 Módszer: 1. Egy adag sejtben direkt, célzottan rontsuk el valamelyik fontosnak gyanított gént. ( mutáns sejtek) 2. Kezeljük az egészséges és a mutáns sejteket valamilyen károsító anyaggal, ami véletlenszerű mutációkat hoz létre. 3. Vizsgáljuk, hogy a mutáns és az egészséges sejtek mennyire jól tudják kijavítani a véletlenszerű mutációkat. 4. Abból, hogy a mutáns sejtekben milyen típusú végleges mutációkat találunk, következtetni lehet arra, hogy az eredetileg megrongált génnek melyik javító-mechanizmusban milyen szerepe van. SZEKVENÁLÁS + SZEKVENÁLÁSI ADATOK ELEMZÉSE 13

63 ÚJ KUTATÁSI LEHETŐSÉGEK Közös projectek az MTA Enzimológiai Intézetével: 14

64 SZEKVENÁLÁSI TECHNIKÁK Sanger-szekvenálás 15

65 SZEKVENÁLÁSI TECHNIKÁK 5 Sanger-szekvenálás C C C 3 DNS C C 15

66 SZEKVENÁLÁSI TECHNIKÁK 5 Sanger-szekvenálás C 3 C C + primer 5 C 3 DNS C DNS-polimeráz 15

67 SZEKVENÁLÁSI TECHNIKÁK 5 Sanger-szekvenálás C 3 OH C C + primer 5 + OH OH C 3 DNS C DNS-polimeráz OH dgtp, dctp, datp, dttp 15

68 SZEKVENÁLÁSI TECHNIKÁK 5 Sanger-szekvenálás C 3 OH C C + primer 5 + OH + H X OH C 3 DNS C DNS-polimeráz OH dgtp, dctp, datp, dttp ddatp 15

69 SZEKVENÁLÁSI TECHNIKÁK 5 Sanger-szekvenálás C C C 3 DNS C C 16

70 SZEKVENÁLÁSI TECHNIKÁK 5 Sanger-szekvenálás 3 3 C C C X 5 C 3 DNS C X 5 16

71 SZEKVENÁLÁSI TECHNIKÁK 5 Sanger-szekvenálás 3 3 C?? C gélelektroforézis?? A C X 5?? C A 3 DNS C X 5 16

72 SZEKVENÁLÁSI TECHNIKÁK 5 Sanger-szekvenálás C ddatp ddgtp ddttp ddctp C C C T C G C A G T A A G C G T C A T 3 DNS C 17

73 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 18

74 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 1. DNS felszaporítása (PCR), darabokra ( short read ) tördelése 18

75 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 1. DNS felszaporítása (PCR), darabokra ( short read ) tördelése 2. Egyszálú short readek rögzítése a cellán primerekkel 18

76 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 1. DNS felszaporítása (PCR), darabokra ( short read ) tördelése 2. Egyszálú short readek rögzítése a cellán primerekkel 3. Short readek felszaporítása a közvetlen környezetükben klaszterenként (1000+) teljesen azonos short readek 18

77 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 1. DNS felszaporítása (PCR), darabokra ( short read ) tördelése 2. Egyszálú short readek rögzítése a cellán primerekkel 3. Short readek felszaporítása a közvetlen környezetükben klaszterenként (1000+) teljesen azonos short readek 4. Cella leöntése a négyféle festékanyaggal megjelölt ddntp-vel és DNS-polimeráz enzimmel 18

78 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 1. DNS felszaporítása (PCR), darabokra ( short read ) tördelése 2. Egyszálú short readek rögzítése a cellán primerekkel 3. Short readek felszaporítása a közvetlen környezetükben klaszterenként (1000+) teljesen azonos short readek 4. Cella leöntése a négyféle festékanyaggal megjelölt ddntp-vel és DNS-polimeráz enzimmel 5. Klaszterenkénti színes foltok rögzítése képként 18

79 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 1. DNS felszaporítása (PCR), darabokra ( short read ) tördelése 2. Egyszálú short readek rögzítése a cellán primerekkel 3. Short readek felszaporítása a közvetlen környezetükben klaszterenként (1000+) teljesen azonos short readek 4. Cella leöntése a négyféle festékanyaggal megjelölt ddntp-vel és DNS-polimeráz enzimmel 5. Klaszterenkénti színes foltok rögzítése képként 6. Beépült bázisok semlegesítése 18

80 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 1. DNS felszaporítása (PCR), darabokra ( short read ) tördelése 2. Egyszálú short readek rögzítése a cellán primerekkel 3. Short readek felszaporítása a közvetlen környezetükben klaszterenként (1000+) teljesen azonos short readek 4. Cella leöntése a négyféle festékanyaggal megjelölt ddntp-vel és DNS-polimeráz enzimmel 5. Klaszterenkénti színes foltok rögzítése képként 6. Beépült bázisok semlegesítése 18

81 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 1. DNS felszaporítása (PCR), darabokra ( short read ) tördelése 2. Egyszálú short readek rögzítése a cellán primerekkel 3. Short readek felszaporítása a közvetlen környezetükben klaszterenként (1000+) teljesen azonos short readek 4. Cella leöntése a négyféle festékanyaggal megjelölt ddntp-vel és DNS-polimeráz enzimmel 5. Klaszterenkénti színes foltok rögzítése képként 6. Beépült bázisok semlegesítése 18

82 SZEKVENÁLÁSI TECHNIKÁK NGS: next-generation sequencing 19

83 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 1. Képekből szöveges short read x koordináta színintenzitás y x y A C G T G C? G? T 20

84 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 1. Képekből szöveges short read x koordináta színintenzitás y x y A C G T G C? G? GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 ID szekvencia (ID) megbízhatóság (quality) FASTQ formátum 20

85 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 2. Short read-ből teljes genom: összeillesztés A. referencia genom (minta) nélkül: de-novo illesztés tt_és elada z_egy s_fel iviál sszet ez_eg _és_n etett is_fe s_nem gy_ös em_tr _triv _össz viáli szetet adat. ett_é 21

86 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 2. Short read-ből teljes genom: összeillesztés A. referencia genom (minta) nélkül: de-novo illesztés z_egy_össz tt_és em_tr viális_feladat. ez_eg szetet iviális_fe gy_ös ett_és_nem_triv elada sszet _és_n etett 21

87 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 2. Short read-ből teljes genom: összeillesztés A. referencia genom (minta) nélkül: de-novo illesztés z_egy_össz tt_és em_tr viális_feladat. ez_eg szetet iviális_fe gy_ös ett_és_nem_triv elada sszet _és_n etett ez_egy_összetett_és_nem_triviális_feladat. 21

88 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 2. Short read-ből teljes genom: összeillesztés A. referencia genom (minta) nélkül: de-novo illesztés B. referencia genom segítségével ez_így_már_sokkal_könnyebb. már_s künny nyebb így_m ez_íg yebb. z_így l_kün _künn ár_so 21

89 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 2. Short read-ből teljes genom: összeillesztés A. referencia genom (minta) nélkül: de-novo illesztés B. referencia genom segítségével ez_így_már_sokkal_könnyebb. ez_íg már_s l_kün yebb. így_már_so nyebb z_így _künn künny De még ez is bonyolult! 21

90 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 2. Short read-ből teljes genom: összeillesztés A. referencia genom (minta) nélkül: de-novo illesztés B. referencia genom segítségével ez_így_már_sokkal_könnyebb. ez_íg már_s l_kün yebb. így_már_so nyebb z_így _künn künny De még ez is bonyolult! deléció pontmutáció 21

91 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 3. Illesztett short read-ekből mutációk Alapfeladat: hosszú szöveges fájl elemzése soronként (genomi pozíciónként) a) eltérnek-e a readek a referencia genomtól? b) több vizsgált minta esetén (pl. kezelt/kezeletlen): eltérnek-e a readek egymástól a mintákban? ez sokkal fontosabb! Bonyodalmak: a) van-e elég read az adott helyen (lefedettség)? b) mennyire megbízható a readen belül az adott bázis? ( base quality ) c) mennyire megbízható a read felillesztése? ( mapping quality ) d) eléggé eltérnek-e a minták, a többi minta mennyire zajos? rengeteg, különböző feladatra specializált mutáció detektáló algoritmus és eszköz 22

92 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 3. Illesztett short read-ekből mutációk sok izogenikus minta estén referencia genomtól való eltérések, illesztési hibák korrigálódnak egyéni mutációk detektálására (például kezelés hatása) gyors pontos (megfelelő paraméterválasztással nagyon kevés fals pozitív eredmény) 23

93 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések 1. Mutációs spektrumok felvétele mintánként (páciensenként): G T G G GTA > G A A 24

94 bázishármasra eső mutációk száma Pipek Orsolya, ELTE TTK Komplex rendszerek fizikája tanszék február 23. KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések 1. Mutációs spektrumok felvétele mintánként (páciensenként): G T G G GTA > G A A 96-komponensű vektorok 24

95 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések 1. Mutációs spektrumok felvétele mintánként (páciensenként): 2. Páciensek csoportosítása, mátrixba rendezése ráktípusonként (szervenként): mutációs katalógus K = 96 páciensek: (G-1). G. 25

96 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések 1. Mutációs spektrumok felvétele mintánként (páciensenként): 2. Páciensek csoportosítása, mátrixba rendezése ráktípusonként (szervenként): 3. Feltételezzük, hogy a konkrét páciensek spektrumai kikeverhetők néhány mutációs folyamatra jellemző spektrum ( szignatúra ) kombinációjaként: M = P E mutációs katalógus szignatúrák súlyfaktorai mutációs szignatúrák Feladat: egy ismert mátrix felbontása két másik (ismeretlen dimenziójú!) mátrix szorzatára 26

97 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések 1. Mutációs spektrumok felvétele mintánként (páciensenként): 2. Páciensek csoportosítása, mátrixba rendezése ráktípusonként (szervenként): 3. Feltételezzük, hogy a konkrét páciensek spektrumai kikeverhetők néhány mutációs folyamatra jellemző spektrum ( szignatúra ) kombinációjaként: 4. Kérdések: Igaz-e, hogy az egyes ráktípusoknál megjelenő konkrét spektrumok visszavezethetők néhány (3-5) mutációs folyamat hatásának a kombinációjára? Ha igen, találunk-e olyan folyamatokat, amik többféle ráktípusnál is aktívak? 27

98 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések 1. Mutációs spektrumok felvétele mintánként (páciensenként): 2. Páciensek csoportosítása, mátrixba rendezése ráktípusonként (szervenként): 3. Feltételezzük, hogy a konkrét páciensek spektrumai kikeverhetők néhány mutációs folyamatra jellemző spektrum ( szignatúra ) kombinációjaként: 4. Kérdések: Igaz-e, hogy az egyes ráktípusoknál megjelenő konkrét spektrumok visszavezethetők néhány (3-5) mutációs folyamat hatásának a kombinációjára? IGEN. Ha igen, találunk-e olyan folyamatokat, amik többféle ráktípusnál is aktívak? IGEN. 27

99 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések öregedés dohányzás kettős DNS-szál törések javítómechanizmusának hiánya 28

100 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések Mire jó ez az egész? Tegyük fel, hogy egy daganatban a mutációs spektrum felbontásából kiderül, hogy a kettős DNS-szál törések javítómechanizmusa hibásan működik. Ekkor a daganatot olyan kemoterápiás szerrel kezelve, mely gátolja az alternatív DNS-javító mechanizmusokat, a daganat megsemmisíthető. Az egészséges sejtek túlélik, hiszen bennük az eredeti javítási útvonal jól működik. Viszont az olyan daganatokra, ahol ez a javítómechanizmus nem hibás, ugyanez a szer nem fog jól hatni. A kezelést nem az határozza meg, hogy a daganat melyik szervben van, hanem a mutációs folyamatok összessége! 29

101 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések 30

102 KIHÍVÁSOK AZ ADATFELDOLGOZÁSBAN 4. Mutációkból következtetések Mit kell ehhez még tenni? Meg kell ismerni a különböző DNS-javító mechanizmusok hibáira utaló jeleket (szignatúrákat), hogy azonosíthatóak legyenek a mutációs spektrumokból. Meg kell ismerni a különböző kemoterápiás szerek hatásait és olyanokat kell fejleszteni, melyek kiaknázzák a daganatsejtek hiányosságait. Ez egy nagyon fontos és nemes feladat. 31

103 REMÉNYTELI JÖVŐ NGS módszerek egyre olcsóbb adatot gyártani egyre több adat publikus online 32

104 REMÉNYTELI JÖVŐ 33

105 REMÉNYTELI JÖVŐ 34

106 REMÉNYTELI JÖVŐ Nanopore MinION akkora mint egy pendrive USB csatlakozóval csatlakoztatható a számítógéphez élőben szekvenál a DNS megfelelő preparálása után semmilyen további laborfelszerelést nem igényel 1000 USD (< 300 ezer HUF) 35

107 REMÉNYTELI JÖVŐ Diagnosztika, szűrések egyes cégek 300 ezer HUF alatti összegért teljes genomot szekvenálnak, elemeznek Rizikófaktorok korai felismerése magzati DNS az anya véréből (180 ezer HUF) főleg kromoszóma-többszöröződéssel járó genetikai betegségek (pl. Down-kór, Turnerszindróma) kimutatása a terhesség korai szakaszában Személyre szabott gyógyítás ( personalised medicine ) a konkrét genetikai háttér nagyban befolyásolja a különböző terápiákra adott reakciót ha rutinfeladattá válik a teljes genom szekvenálása a diagnosztikában, a pácienseket csak olyan jellegű kezeléseknek kell alávetni, amire várhatóan jól reagálnak Kutatás: még nagyon sok mindent nem tudunk! 36

108 SZÜKSÉGES SZAKTUDÁS erős természettudományos képzettség: fizika, vegyész szak jó választás egyéni problémamegoldásra tréningel modellalkotás statisztikai, matematikai ismeretek programozói készség (nem feltétlenül informatikai szaktudás!) angol nyelvtudás kreativitás (jó kérdéseket kell jól feltenni) hajlam a csapatmunkára (molekuláris biológiában nincs egyéni eredmény) érdeklődés a biológiai kérdések iránt adatvizualizációs készség Nem feltétlenül tudás! 37

109 ÖSSZEGZÉS A molekuláris biológia eszközei egyre gyorsabban fejlődnek, a kísérletek egyre olcsóbbá válnak. Az így keletkező hatalmas adatmennyiséggel a biológusok nem tudnak mit kezdeni. Rengeteg ígéretes kutatási terület van, amibe érdemes munkát befektetni. Mind a tudomány, mind az orvoslás szempontjában kiemelkedő jelentőségű eredmények születnek. Európában az adatok elemzéséhez értő bioinformatikusok kevesen vannak és viszonylag ritkán biológusok vagy informatikusok. (És soha nem orvosok.) Hasznos és fontos terület, melyben a komplex rendszerek elemzéséhez értő tudósokra van szükség. 38

110 KÖSZÖNÖM A FIGYELMET!

111 ÁBRÁK, VIDEÓK Nap (5): Föld (5): DNS nagy-skálás szerkezete (6): Transzláció, transzkripció (7): Tübingeni egyetem laboratórium (8): Astbury diffrakciós felvétele (8): Griffith-kísérlet (8): Watson és Crick (8): Franklin diffrakciós felvétele (8): Gélelektroforézis (8): Kettős száltörés javítása, PARP inhibitor hatása (videók, 12, 30): BRCA1 komplex (13): MTA TTK épülete (13): Illumina szekvenálás, világító klaszterek (18): Illumina szekvenálás (videó, 19): Nanopore szekvenálás (videók, 33-34): Nanopore MinION (35):

Human genome project

Human genome project Human genome project Pataki Bálint Ármin 2017.03.14. Pataki Bálint Ármin Human genome project 2017.03.14. 1 / 14 Agenda 1 Biológiai bevezető 2 A human genome project lefolyása 3 Alkalmazások, kitekintés

Részletesebben

Nukleinsavak. Szerkezet, szintézis, funkció

Nukleinsavak. Szerkezet, szintézis, funkció Nukleinsavak Szerkezet, szintézis, funkció Nukleinsavak, nukleotidok, nukleozidok 1869-ben Miescher a sejtmagból egy savas természetű, lúgban oldódó foszfortartalmú anyagot izolált, amit később, eredetére

Részletesebben

Poligénes v. kantitatív öröklődés

Poligénes v. kantitatív öröklődés 1. Öröklődés komplexebb sajátosságai 2. Öröklődés molekuláris alapja Poligénes v. kantitatív öröklődés Azok a tulajdonságokat amelyek mértékegységgel nem, vagy csak nehezen mérhetők, kialakulásuk kevéssé

Részletesebben

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!!

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!! Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció 1859 1865 1869 1952 Hershey & Chase 1953!!! 1879 1903 1951 1950 1944 1928 1911 1 1. DNS szerkezete Mi az örökítő anyag? Friedrich Miescher

Részletesebben

DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer

Részletesebben

Genetika. Tartárgyi adatlap: tantárgy adatai

Genetika. Tartárgyi adatlap: tantárgy adatai Genetika Előadás a I. éves Génsebészet szakos hallgatók számára Tartárgyi adatlap: tantárgy adatai 2.1. Tantárgy címe Genetika 2.2. Előadás felelőse Dr. Mara Gyöngyvér, docens 2.3. Egyéb oktatási tevékenységek

Részletesebben

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód)

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2.1 Nukleotidok, nukleinsavak Információátadás (örökítőanyag) Információs egység

Részletesebben

A gyakorlat elméleti háttere A DNS molekula a sejt információhordozója. A DNS nemzedékről nemzedékre megőrzi az élőlények genetikai örökségét.

A gyakorlat elméleti háttere A DNS molekula a sejt információhordozója. A DNS nemzedékről nemzedékre megőrzi az élőlények genetikai örökségét. A kísérlet megnevezése, célkitűzései: DNS molekula szerkezetének megismertetése Eszközszükséglet: Szükséges anyagok: színes gyurma, papírsablon Szükséges eszközök: olló, hurkapálcika, fogpiszkáló, cérna,

Részletesebben

Johann Gregor Mendel Az olmüci (Olomouc) és bécsi egyetem diákja Brünni ágostonrendi apát (nem szovjet tudós) Tudatos és nagyon alapos kutat

Johann Gregor Mendel Az olmüci (Olomouc) és bécsi egyetem diákja Brünni ágostonrendi apát (nem szovjet tudós) Tudatos és nagyon alapos kutat 10.2.2010 genmisk1 1 Áttekintés Mendel és a mendeli törvények Mendel előtt és körül A genetika törvényeinek újbóli felfedezése és a kromoszómák Watson és Crick a molekuláris biológoa központi dogmája 10.2.2010

Részletesebben

CHO H H H OH H OH OH H CH2OH HC OH HC OH HC OH CH 2

CHO H H H OH H OH OH H CH2OH HC OH HC OH HC OH CH 2 4. Előadás ukleozidok, nukleotidok, nukleinsavak Történeti háttér Savas karakterű anyagok a sejtmagból 1869-71 DS a sejtmag fő komponense F. Miescher (Svájc) 1882 Flemming: Chromatin elnevezés Waldeyer:

Részletesebben

Az élő szervezetek felépítése I. Biogén elemek biomolekulák alkotóelemei a természetben előforduló elemek közül 22 fordul elő az élővilágban O; N; C; H; P; és S; - élő anyag 99%-a Biogén elemek sajátosságai:

Részletesebben

I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

CHO H H H OH H OH OH H CH2OH CHO OH H HC OH HC OH HC OH CH 2 OH

CHO H H H OH H OH OH H CH2OH CHO OH H HC OH HC OH HC OH CH 2 OH 4. Előadás ukleozidok, nukleotidok, nukleinsavak Történeti háttér Savas karakterű anyagok a sejtmagból 1869-71 DS a sejtmag fő komponense nuclein Friedrich Miescher (Svájc, 1844-1895) 1970: FM Insitute

Részletesebben

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik.

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. MUTÁCIÓK A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. Pontmutáció: A kromoszóma egy génjében pár nukleotidnál következik be változás.

Részletesebben

Nukleinsavak építőkövei

Nukleinsavak építőkövei ukleinsavak Szerkezeti hierarchia ukleinsavak építőkövei Pirimidin Purin Pirimidin Purin Timin (T) Adenin (A) Adenin (A) Citozin (C) Guanin (G) DS bázisai bázis Citozin (C) Guanin (G) RS bázisai bázis

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR)

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR) Genomika (A genom, génállomány vizsgálata) Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel DNS szekvenálási eljárások DNS ujjlenyomat (VNTR) DNS chipek statikus és dinamikus információk vizsgálata

Részletesebben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben esirna mirtron BEVEZETÉS TÉMAKÖRÖK Ősi RNS világ RNS-ek tradicionális szerepben bevezetés BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek

Részletesebben

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód)

2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2. Sejtalkotó molekulák II. Az örökítőanyag (DNS, RNS replikáció), és az öröklődés molekuláris alapjai (gén, genetikai kód) 2.1 Nukleotidok, nukleinsavak Információátadás (örökítőanyag) Információs egység

Részletesebben

A nukleinsavak polimer vegyületek. Mint polimerek, monomerekből épülnek fel, melyeket nukleotidoknak nevezünk.

A nukleinsavak polimer vegyületek. Mint polimerek, monomerekből épülnek fel, melyeket nukleotidoknak nevezünk. Nukleinsavak Szerkesztette: Vizkievicz András A nukleinsavakat először a sejtek magjából sikerült tiszta állapotban kivonni. Innen a név: nucleus = mag (lat.), a sav a kémhatásukra utal. Azonban nukleinsavak

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai Kar: TTK Tantárgy: CITOGENETIKA Kód: AOMBCGE3 ECTS Kredit: 3 A tantárgyat oktató intézet: TTK Mikrobiális Biotechnológiai és Sejtbiológiai Tanszék A tantárgy felvételére ajánlott félév: 3. Melyik félévben

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

Nanotechnológia. Nukleinsavak. Készítette - Fehérvári Gábor

Nanotechnológia. Nukleinsavak. Készítette - Fehérvári Gábor Nanotechnológia Nukleinsavak Készítette - Fehérvári Gábor Bevezető A nukleinsavak az élő anyag alapvetően fontos komponensei. Meghatározó szerepet töltenek be az átöröklésben, a fehérjék szintézisében

Részletesebben

DNS-számítógép. Balló Gábor

DNS-számítógép. Balló Gábor DNS-számítógép Balló Gábor Bevezetés A nukleinsavak az élő szervezetek egyik legfontosabb alkotórészei. Ezekben tárolódnak ugyanis az öröklődéshez, és a fehérjeszintézishez szükséges információk. Bár a

Részletesebben

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan 11. évfolyam BIOLÓGIA 1. Az emberi test szabályozása Idegi szabályozás Hormonális szabályozás 2. Az érzékelés Szaglás, tapintás, látás, íz érzéklés, 3. Általános egészségügyi ismeretek az egyes témákhoz

Részletesebben

DNS, RNS, Fehérjék. makromolekulák biofizikája. Biológiai makromolekulák. A makromolekulák TÖMEG szerinti mennyisége a sejtben NAGY

DNS, RNS, Fehérjék. makromolekulák biofizikája. Biológiai makromolekulák. A makromolekulák TÖMEG szerinti mennyisége a sejtben NAGY makromolekulák biofizikája DNS, RNS, Fehérjék Kellermayer Miklós Tér Méret, alak, lokális és globális szerkezet Idő Fluktuációk, szerkezetváltozások, gombolyodás Kölcsönhatások Belső és külső kölcsöhatások,

Részletesebben

Makromolekulák. Fehérjetekeredé. rjetekeredés. Biopolimer. Polimerek

Makromolekulák. Fehérjetekeredé. rjetekeredés. Biopolimer. Polimerek Biopolimerek Makromolekulá Makromolekulák. Fehé Fehérjetekeredé rjetekeredés. Osztódó sejt magorsófonala 2011. November 16. Huber Tamá Tamás Dohány levél epidermális sejtjének aktin hálózata Bakteriofágból

Részletesebben

Géntechnológia és fehérjemérnökség

Géntechnológia és fehérjemérnökség Géntechnológia és fehérjemérnökség Szerkesztette: Nyitray László Alexa Anita (12. és 13. fejezet) Fodor Krisztián (3. és 9. fejezet) Garai Ágnes (4. és 5. fejezet) Glatz Gábor (6. és 7. fejezet) Radnai

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze

Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze László Éva Babeş-Bolyai Tudományegyetem, Kolozsvár A polimeráz láncreakció (PCR) napjaink molekuláris biológiai (genetikai) kutatásának nélkülözhetetlen

Részletesebben

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26 Hamar Péter RNS világ Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. 1 26 Főszereplők: DNS -> RNS -> fehérje A kód lefordítása Dezoxy-ribo-Nuklein-Sav: DNS az élet kódja megkettőződés (replikáció)

Részletesebben

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Szántó-Egész Réka 1, Mohr Anita 1, Sipos Rita 1, Dallmann Klára 1, Ujhelyi Gabriella 2, Koppányné Szabó Erika

Részletesebben

A genetikai lelet értelmezése monogénes betegségekben

A genetikai lelet értelmezése monogénes betegségekben A genetikai lelet értelmezése monogénes betegségekben Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika A ~20 ezer fehérje-kódoló gén a 23 pár kromoszómán A kromoszómán található bázisok száma: 250M

Részletesebben

CIÓ A GENETIKAI INFORMÁCI A DNS REPLIKÁCI

CIÓ A GENETIKAI INFORMÁCI A DNS REPLIKÁCI A GENETIKAI INFORMÁCI CIÓ TÁROLÁSA ÉS S KIFEJEZŐDÉSE A DNS SZERKEZETE Két antiparalel (ellentétes lefutású) polinukleotid láncból álló kettős helix A két lánc egy képzeletbeli közös tengely körül van feltekeredve,

Részletesebben

ADATBÁNYÁSZAT I. ÉS OMICS

ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT

Részletesebben

RNS-ek. 1. Az ősi RNS Világ: - az élet hajnalán. 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek

RNS-ek. 1. Az ősi RNS Világ: - az élet hajnalán. 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek RNS-ek RNS-ek 1. Az ősi RNS Világ: - az élet hajnalán 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek 3. Egy újonnan felfedezett RNS Világ: - szabályozó RNS-ek 4. Transzkripció Ősi

Részletesebben

A gének világa, avagy a mi világunk is

A gének világa, avagy a mi világunk is Kovács Árpád Ferenc folyóirata Kovács Árpád Ferenc A gének világa, avagy a mi világunk is 1. rész: A genetika a kezdetektől napjainkig 2010 A gének világa, avagy a mi világunk is 1. Bevezetés életünk központjába

Részletesebben

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Rohonczy Kata, Zoller Linda, Fodor Andrea, Tabajdiné, dr. Pintér Vera FoodMicro Kft. Célkitűzés Élelmiszerekben és takarmányokban

Részletesebben

a III. kategória (11-12. évfolyam) feladatlapja

a III. kategória (11-12. évfolyam) feladatlapja 2009/2010. tanév I. forduló a III. kategória (11-12. évfolyam) feladatlapja Versenyző neve:... évfolyama: Iskolája : Település : Felkészítő szaktanár neve:.. Megoldási útmutató A verseny feladatait nyolc

Részletesebben

Proteomkutatás egy új tudományág születése

Proteomkutatás egy új tudományág születése BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK Proteomkutatás egy új tudományág születése Tárgyszavak: humán genom; genomika; proteomika; kutatás; fehérjeszerkezet; háromdimenziós szerkezet; gyógyszeripar.

Részletesebben

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA 1. Nukleinsavak keresztrejtvény (12+1 p) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 1. A nukleinsavak a.-ok összekapcsolódásával kialakuló polimerek. 2. Purinvázas szerves bázis, amely az

Részletesebben

Humán genom variációk single nucleotide polymorphism (SNP)

Humán genom variációk single nucleotide polymorphism (SNP) Humán genom variációk single nucleotide polymorphism (SNP) A genom ~ 97 %-a két különböző egyedben teljesen azonos ~ 1% különbség: SNP miatt ~2% különbség: kópiaszámbeli eltérés, deléciók miatt 11-12 millió

Részletesebben

2. SZ. SZAKMAI ÖSSZEFOGLALÓ PIR 2

2. SZ. SZAKMAI ÖSSZEFOGLALÓ PIR 2 Az Országos Onkológiai Intézet Norvég Finanszírozási mechanizmus keretében elnyert Kutatás Fejlesztési Pályázata Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon

Részletesebben

Embriószelekció PGD-vel genetikai terheltség esetén. Kónya Márton Istenhegyi Géndiagnosztika

Embriószelekció PGD-vel genetikai terheltség esetén. Kónya Márton Istenhegyi Géndiagnosztika Embriószelekció PGD-vel genetikai terheltség esetén Kónya Márton Istenhegyi Géndiagnosztika A praeimplantatiós genetikai diagnosztika (PGD) a praenatalis diagnosztika legkorábbi formája, a beágyazódás

Részletesebben

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A NÖVÉNYGENETIKA Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 A citológia és a genetika társtudománya Citogenetika A kromoszómák eredetét, szerkezetét, genetikai funkcióját,

Részletesebben

A replikáció mechanizmusa

A replikáció mechanizmusa Az öröklődés molekuláris alapjai A DNS megkettőződése, a replikáció Szerk.: Vizkievicz András A DNS-molekula az élőlények örökítő anyaga, kódolt formában tartalmazza mindazon információkat, amelyek a sejt,

Részletesebben

Előadások témája: Elsősorban a DNS, a gének és genomok molekuláris biológiája. Tételsorok mindenkinek a honlapon:

Előadások témája: Elsősorban a DNS, a gének és genomok molekuláris biológiája. Tételsorok mindenkinek a honlapon: MOLEKULÁRIS BIOLÓGIA Előadások témája: Elsősorban a DNS, a gének és genomok molekuláris biológiája Előadásokra járni kötelező, de nincs névsor olvasás. Zárthelyi dolgozat nincs. Vegyész és hidrobiológus

Részletesebben

Mit tud a genetika. Génterápiás lehetőségek MPS-ben. Dr. Varga Norbert

Mit tud a genetika. Génterápiás lehetőségek MPS-ben. Dr. Varga Norbert Mit tud a genetika Génterápiás lehetőségek MPS-ben Dr. Varga Norbert Oki terápia Terápiás lehetőségek MPS-ben A kiváltó okot gyógyítja meg ERT Enzimpótló kezelés Őssejt transzplantáció Genetikai beavatkozások

Részletesebben

A proteomika új tudománya és alkalmazása a rákdiagnosztikában

A proteomika új tudománya és alkalmazása a rákdiagnosztikában BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK A proteomika új tudománya és alkalmazása a rákdiagnosztikában Tárgyszavak: proteom; proteomika; rák; diagnosztika; molekuláris gyógyászat; biomarker;

Részletesebben

A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában

A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában Budapest, 2014. február 22. Ritka Betegségek Világnapja A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában dr. Kósa János PentaCore Laboratórium, Budapest Semmelweis Egyetem I. sz.

Részletesebben

I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika

I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika I. Strukturális Genomika II. Funkcionális Genomika III. Integratív Genomika A genomika főbb területei Strukturális (szerkezeti ) genomika Funkcionális (működési) genomika Transzkriptomika Proteomika Integratív

Részletesebben

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem Tisztelt Hölgyem, Tisztelt Uram! Örömmel jelentjük be Önöknek, hogy a Genomikai Medicina és Ritka Betegségek Intézetének egyik új projektje azon betegségek genetikai hátterének feltérképezésére irányul,

Részletesebben

Géntechnológia és fehérjemérnökség

Géntechnológia és fehérjemérnökség Géntechnológia és fehérjemérnökség elektronikus-jegyzet szerzők: Az ELTE Biokémiai Tanszék Munkaközössége Alexa Anita (12. és 13. fejezet), Fodor Krisztián (3. és 9. fejezet), Garai Ágnes (4. és 5. fejezet),

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

A géntechnológiát megalapozó felfedezések

A géntechnológiát megalapozó felfedezések 2010. december BIOTECHNOLÓGIA Rova tvezető: Dr. Heszky László akadémikus A géntechnológia genetikai alapjai c. I. fejezet 1-5. részében azokat a tudományos eredményeket mutattuk be, melyek bizonyítják,

Részletesebben

A géntechnológia genetikai alapjai (I./3.)

A géntechnológia genetikai alapjai (I./3.) Az I./2. rész (Gének és funkciójuk) rövid összefoglalója A gének a DNS információt hordozó szakaszai, melyekben a 4 betű (ATCG) néhány ezerszer, vagy százezerszer ismétlődik. A gének önálló programcsomagként

Részletesebben

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia Fehérje expressziós rendszerek Gyógyszerészi Biotechnológia Expressziós rendszerek Cél: rekombináns fehérjék előállítása nagy tisztaságban és nagy mennyiségben kísérleti ill. gyakorlati (therapia) felhasználásokra

Részletesebben

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

Népegészségügyi genomika

Népegészségügyi genomika Népegészségügyi genomika Népegészségügyi genomika Tartalom 1. A genom szerkezete... 1 1. A genom szerkzet... 1 1.1. Bevezetés a humán genom... 1 1.2. A genetika rövid története... 1 2. A DNS szerkezete...

Részletesebben

MAGYOT évi Tudományos Szimpóziuma Május 5-6, Budapest

MAGYOT évi Tudományos Szimpóziuma Május 5-6, Budapest MAGYOT 2017. évi Tudományos Szimpóziuma Május 5-6, Budapest A petefészekrákok kezelésében nem régen került bevezetésre egy újabb fenntartó kezelés BRCA mutációt hordozó (szomatikus vagy germinális) magas

Részletesebben

,:/ " \ OH OH OH - 6 - / \ O / H / H HO-CH, O, CH CH - OH ,\ / "CH - ~(H CH,-OH \OH. ,-\ ce/luló z 5zer.~ezere

,:/  \ OH OH OH - 6 - / \ O / H / H HO-CH, O, CH CH - OH ,\ / CH - ~(H CH,-OH \OH. ,-\ ce/luló z 5zer.~ezere - 6 - o / \ \ o / \ / \ () /,-\ ce/luló z 5zer.~ezere " C=,1 -- J - 1 - - ---,:/ " - -,,\ / " - ~( / \ J,-\ ribóz: a) r.yílt 12"('.1, b) gyürus íormája ~.. ~ en;én'. fu5 héli'(ef1e~: egy menete - 7-5.

Részletesebben

ÚJ GENERÁCIÓS SZEKVENÁLÁS

ÚJ GENERÁCIÓS SZEKVENÁLÁS VÍZMIKROBIOLÓGUSOK XI. ORSZÁGOS KONFERENCIÁJA - 2012 ÚJ GENERÁCIÓS SZEKVENÁLÁS LEHETŐSÉG, VAGY NEHÉZSÉG? MÁRIALIGETI KÁROLY EÖTVÖS LORÁND TUDOMÁNYEGYETEM, BUDAPEST 1953 JAMES D. WATSON, FRANCIS CRICK:

Részletesebben

Az örökítőanyag. Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase

Az örökítőanyag. Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase SZTE, Orv. Biol. Int., Mol- és Sejtbiol. Gyak., VIII. Az örökítőanyag Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase Ez az

Részletesebben

PrenaTest Újgenerációs szekvenálást és z-score

PrenaTest Újgenerációs szekvenálást és z-score PrenaTest Újgenerációs szekvenálást és z-score számítást alkalmazó, nem-invazív prenatális molekuláris genetikai teszt a magzati 21-es triszómia észlelésére, anyai vérből végzett DNS izolálást követően

Részletesebben

Alkímia Ma. az anyagról mai szemmel, a régiek megszállottságával. http://www.chem.elte.hu/alkimia_2015_16 KÖZÉPISKOLAI KÉMIAI LAPOK

Alkímia Ma. az anyagról mai szemmel, a régiek megszállottságával. http://www.chem.elte.hu/alkimia_2015_16 KÖZÉPISKOLAI KÉMIAI LAPOK Alkímia Ma az anyagról mai szemmel, a régiek megszállottságával http://www.chem.elte.hu/alkimia_2015_16 KÖZÉPISKOLAI KÉMIAI LAPOK ALKÍMIA MA KVÍZ Schiller Róbert Te miért gondolod, hogy vannak molekulák?

Részletesebben

Farmakológus szakasszisztens Farmakológus szakasszisztens 2/34

Farmakológus szakasszisztens Farmakológus szakasszisztens 2/34 -06 Farmakológus szakasszisztens feladatok A 0/007 (II. 7.) SzMM rendelettel módosított /006 (II. 7.) OM rendelet Országos Képzési Jegyzékről és az Országos Képzési Jegyzékbe történő felvétel és törlés

Részletesebben

Rácz Olivér, Ništiar Ferenc, Hubka Beáta, Miskolci Egyetem, Egészségügyi Kar 2010

Rácz Olivér, Ništiar Ferenc, Hubka Beáta, Miskolci Egyetem, Egészségügyi Kar 2010 Kromoszóma eltérések Rácz Olivér, Ništiar Ferenc, Hubka Beáta, Miskolci Egyetem, Egészségügyi Kar 2010 20.3.2010 genmisk6.ppt 1 Alapfogalmak ismétlése Csak a sejtosztódás közben láthatóak (de természetesen

Részletesebben

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik.

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. MUTÁCIÓK A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. Pontmutáció: A kromoszóma egy génjében pár nukleotidnál következik be változás.

Részletesebben

Tudománytörténeti visszatekintés

Tudománytörténeti visszatekintés GENETIKA I. AZ ÖRÖKLŐDÉS TÖRVÉNYSZERŰSÉGEI Minek köszönhető a biológiai sokféleség? Hogyan történik a tulajdonságok átörökítése? Tudománytörténeti visszatekintés 1. Keveredés alapú öröklődés: (1761-1766,

Részletesebben

20 éves a Mamma Klinika

20 éves a Mamma Klinika 20 éves a Mamma Klinika A sejtdiagnosztika modern eszközei a diagnosztikában és terápiában dr Járay Balázs, dr Székely Eszter Medserv Kft, Semmelweis Egyetem II. Patológiai Intézet Budapest 1 22196 betegből

Részletesebben

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor,

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, 1 A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, (Debreceni Egyetem Állattenyésztéstani Tanszék) A bármilyen

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

Nukleinsavak SZERKEZET, SZINTÉZIS, FUNKCIÓ

Nukleinsavak SZERKEZET, SZINTÉZIS, FUNKCIÓ Nukleinsavak SZERKEZET, SZINTÉZIS, FUNKCIÓ Nukleinsavak, nukleotidok, nukleozidok 1869-ben Miescher a sejtmagból egy savas természetű, lúgban oldódó foszfortartalmú anyagot izolált, amit később, eredetére

Részletesebben

Fehérjeszerkezet, és tekeredés

Fehérjeszerkezet, és tekeredés Fehérjeszerkezet, és tekeredés Futó Kinga 2013.10.08. Polimerek Polimer: hasonló alegységekből (monomer) felépülő makromolekulák Alegységek száma: tipikusan 10 2-10 4 Titin: 3,435*10 4 aminosav C 132983

Részletesebben

A DOHÁNYZÁS OKOZTA DNS KÁROSODÁSOK ÉS JAVÍTÁSUK VIZSGÁLATA EMBERI CUMULUS ÉS GRANULOSA SEJTEKBEN. Sinkó Ildikó PH.D.

A DOHÁNYZÁS OKOZTA DNS KÁROSODÁSOK ÉS JAVÍTÁSUK VIZSGÁLATA EMBERI CUMULUS ÉS GRANULOSA SEJTEKBEN. Sinkó Ildikó PH.D. A DOHÁNYZÁS OKOZTA DNS KÁROSODÁSOK ÉS JAVÍTÁSUK VIZSGÁLATA EMBERI CUMULUS ÉS GRANULOSA SEJTEKBEN Sinkó Ildikó PH.D. ÉRTEKEZÉS TÉZISEI Témavezető: Dr. Raskó István Az értekezés a Szegedi Tudományegyetem

Részletesebben

Kémiai Intézet Kémiai Laboratórium. F o t o n o k k e r e s z tt ü z é b e n a D N S

Kémiai Intézet Kémiai Laboratórium. F o t o n o k k e r e s z tt ü z é b e n a D N S Szalay SzalayPéter Péter egyetemi egyetemi tanár tanár ELTE, ELTE,Kémiai Kémiai Intézet Intézet Elméleti ElméletiKémiai Kémiai Laboratórium Laboratórium F o t o n o k k e r e s z tt ü z é b e n a D N S

Részletesebben

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Szalma Katalin Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Témavezető: Dr. Turai István, OSSKI Budapest, 2010. október 4. Az ionizáló sugárzás sejt kölcsönhatása Antone

Részletesebben

A rákkutatás kihívásai, a rákkutatók megoldásai

A rákkutatás kihívásai, a rákkutatók megoldásai A rákkutatás kihívásai, a rákkutatók megoldásai Cserepes Mihály, Ph.D. hallgató - Semmelweis Egyetem - Országos Onkológiai Intézet - MTA-TTK Enzimológiai Intézet Forrás: http://www.lifetechnologies.com

Részletesebben

A kémiai energia átalakítása a sejtekben

A kémiai energia átalakítása a sejtekben A kémiai energia átalakítása a sejtekben A sejtek olyan mikroszkópikus képződmények amelyek működése egy vegyi gyárhoz hasonlítható. Tehát a sejtek mikroszkópikus vegyi gyárak. Mi mindenben hasonlítanak

Részletesebben

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Dr. Nagy Bálint az MTA doktora fokozat megszerzéséhez a fenti címen nyújtott be a

Részletesebben

ALKÍMIA MA Az anyagról mai szemmel, a régiek megszállottságával. www.chem.elte.hu/pr

ALKÍMIA MA Az anyagról mai szemmel, a régiek megszállottságával. www.chem.elte.hu/pr ALKÍMIA MA Az anyagról mai szemmel, a régiek megszállottságával www.chem.elte.hu/pr Kvíz az előző előadáshoz 1) Mikor kapott Paul Ehrlich orvosi Nobel-díjat? A) Idén. B) Pont 100 éve, 1908-ban. C) Nem

Részletesebben

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45

Részletesebben

Genetikai szótár. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

Genetikai szótár. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 Genetikai szótár Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A London IDEAS Genetikai Tudáspark, Egyesült Királyság szótárából módosítva. A munkát

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

BIOTERMÉK TECHNOLÓGIA-2

BIOTERMÉK TECHNOLÓGIA-2 BIOTERMÉK TECHNOLÓGIA-2 MSc Biomérnök hallgatók számára Előadó: 3 + 0 + 0 óra, 4 kredit szóbeli vizsga Pécs Miklós, Ballagi András Elérhetőség: F épület, FE lépcsőház földszint 1 (463-) 40-31 pecs@eik.bme.hu

Részletesebben

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Finanszírozási Mechanizmus által támogatott projekt Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Alap támogatással javul

Részletesebben

NANOTECHNOLOGIA 6. előadás

NANOTECHNOLOGIA 6. előadás NANOTECHNOLOGIA 6. előadás A plazmid: Ha meg akarjuk ismerni egy fehérje működését, akkor sokat kell belőle előállítanunk. Ezt akár úgy is megtehetjük, hogy a kívánt géndarabot egy baktérumba ültetjük

Részletesebben

BETEGTÁJÉKOZTATÓ Genetikai szűrés lehetőségei az Országos Onkológiai Intézetben

BETEGTÁJÉKOZTATÓ Genetikai szűrés lehetőségei az Országos Onkológiai Intézetben Norvég Finanszírozási Mechanizmus által támogatott projekt mus által támogatott projekt BETEGTÁJÉKOZTATÓ Genetikai szűrés lehetőségei az Országos Onkológiai Intézetben Kedves Betegeink! A daganatokról

Részletesebben

A (human)genetika alapja

A (human)genetika alapja A (human)genetika alapja Genom diagnosztika - születés elött - tünetek megjelenése elött - hordozó diagnosztika Prenatalis genetikai diagnosztika indikációi emelkedett valószinüség egy gén betegségre egyik

Részletesebben

Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása.

Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása. Növények klónozása Klónozás Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása. Görög szó: klon, jelentése: gally, hajtás, vessző. Ami

Részletesebben

BIOLÓGIA VERSENY 10. osztály 2016. február 20.

BIOLÓGIA VERSENY 10. osztály 2016. február 20. BIOLÓGIA VERSENY 10. osztály 2016. február 20. Kód Elérhető pontszám: 100 Elért pontszám: I. Definíció (2x1 = 2 pont): a) Mikroszkopikus méretű szilárd részecskék aktív bekebelezése b) Molekula, a sejt

Részletesebben

Az onkológia alapjai. Szántó János DE OEC Onkológiai Tanszék ÁNTSZ 2010. február

Az onkológia alapjai. Szántó János DE OEC Onkológiai Tanszék ÁNTSZ 2010. február Az onkológia alapjai Szántó János DE OEC Onkológiai Tanszék ÁNTSZ 2010. február Statisztika Megbetegedés halálozás Világ: 15 20 M 7-8 M Mo.: 70.000 36.000 Azaz hazánkban minden negyedik állampolgár daganatos

Részletesebben

Tudományközi beszélgetések

Tudományközi beszélgetések VILÁGOSSÁG 2003/9 10. Tudományrendszer Tudományközi beszélgetések Molekuláris biológia A XXI. század tudományrendszere című nagyprojektje keretében tudományközti beszélgetések sorozatát indította el az

Részletesebben

Evolúcióelmélet és az evolúció mechanizmusai

Evolúcióelmélet és az evolúció mechanizmusai Evolúcióelmélet és az evolúció mechanizmusai Az élet Darwini szemlélete Melyek az evolúció bizonyítékai a világban? EVOLÚCIÓ: VÁLTOZATOSSÁG Mutáció Horizontális géntranszfer Genetikai rekombináció Rekombináció

Részletesebben

Intelligens molekulákkal a rák ellen

Intelligens molekulákkal a rák ellen Intelligens molekulákkal a rák ellen Kotschy András Servier Kutatóintézet Rákkutatási kémiai osztály A rákos sejt Miben más Hogyan él túl Áttekintés Rákos sejtek célzott támadása sejtmérgekkel Fehérjék

Részletesebben

BIOGÉN ELEMEK Azok a kémiai elemek, amelyek az élőlények számára létfontosságúak

BIOGÉN ELEMEK Azok a kémiai elemek, amelyek az élőlények számára létfontosságúak BIOGÉN ELEMEK Azok a kémiai elemek, amelyek az élőlények számára létfontosságúak A több mint száz ismert kémiai elem nagyobbik hányada megtalálható az élőlények testében is, de sokuknak nincsen kimutatható

Részletesebben