20 éves a Mamma Klinika

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "20 éves a Mamma Klinika"

Átírás

1 20 éves a Mamma Klinika A sejtdiagnosztika modern eszközei a diagnosztikában és terápiában dr Járay Balázs, dr Székely Eszter Medserv Kft, Semmelweis Egyetem II. Patológiai Intézet Budapest

2

3 1

4 22196 betegből biopszia történt

5

6 Citológiai dignózisok megoszlása C % C % C ,8% C ,7% C ,5% Összesen %

7 1-9 mm 982 IDC mm 15mm-nél nagyobb C1 C2 C3 C4 C5 6,3% 7% 3,27% 4,7% 1,8% 0,3% 16,6% 9,3% 7,5% 21,4% 17,7% 14% 42% 63% 73%

8 Kiegészítő vizsgálatok citológiai mintákon Speciális festések--kórokozók, nyák - diagnosztikus cél Immuncitokémiai vizsgálatok--diagnosztikus és terápiás cél hám vagy egyéb tumor, receptor status Fluorescens in situ hibridizáció--terápiás cél Polimeráz lánc reakció--terápiás cél Szekvenálás--terápiás cél Célzott kezelés

9

10 Immuncitokémia direkt keneten Érveink mások is.

11 Immuncitokémia direkt keneten Érveink - Ellenérvek Gyors Egyszerű Látványos Vér elszíntelenedik Controll. Könnyű elrontani hm Korlátozott mennyiségű anyag Törött keneten nem működik (automatában)

12 Terápiás célú immuncitokémiai vizsgálatok Mikor? Inoperábilis esetekben Ha a core biopszia ellenjavalt vagy nem kivitelezhető Metastasisok esetében a prognosztikai markerek meghatározhatóak aspirációs citológiai mintán is

13 Immunhisztokémia - Immuncitokémia Differenciálatlan daganatok eredetének(hisztogenezisének) tisztázása Áttéti daganat esetén a daganat kiindulási szervének meghatározása Fehérjék kimutatása a daganatban, melynek prognosztikai és / vagy terápiás jelentősége van Tumor markerek ( szöveti)

14 CK + sejtek - lobuláris cc. áttéte

15

16 ????????????????????????????????? Angiosarcoma Idiopatiás-jól körülírt tapintható csomó Irradiációs-sötét vörös vagy ibolya színű bőrelváltozás, ezzel összefüggő tapintható csomó

17 Angiosarcoma-citológia

18

19 CD 31, CD 34

20 Sanger szekvenálás Emlőrákok esetében leírt és vizsgálható mutációk Kritériuma minimum 35% tumorarány a mintában, esetleg ALM-Ph 20-25% tumoraránynál. Abban az esetben, ha a vizsgált mintában mutációt detektálunk, a mutációt tartalmazó génszakaszt újraszekvenáljuk. Vizsgálható gének: PIK3CA gén 1. és 20. exonja EGFR gén és 21. exonja HER2 gén 19. és 20. exonja AKT1 gén 4. exonja MET gén és 19. exonja NGS (IonTorrent) szekvenálás Kritériuma minimum 25% tumorarány a mintában. A kiértékelés során az egy minta két párhuzamos szekvenálásának readszámát ellenőrizzük, majd összehasonlítjuk. Elsősorban azokat a mutációkat leletezzük ki, amelyek mindkét párhuzamos vizsgálatban jelen vannak, illetve a Quality értékük minimum 30, a Coverage értékük pedig minimum 200. Vizsgálható gének: BRCA1-2, PIK3CA, EGFR, TP53, HER2, AKT, PTEN, MET, ATM, CHEK2 PTEN, AKT, EGFR, MET: NGS szekvenálás HER2-gátlókkal történő kezelés hatékonyságát befolyásolja a rezisztencia kialakulása, amely lehetőségei közé tartozik többek között, hogy megváltozik a jelút (PTEN és p27 vesztése, AKT aktiválása) vagy más receptorokhoz tartozó jelutak aktiválódnak (pl. EGFR3, MET). BRCA1-2, PTEN, ATM, CHEK2: NGS szekvenálás "BRBRCAness": a BRCA-funkció elvesztését kísérő hasonló változások- más tumorokon (spordaikus emlőrákon vagy más tumortípusokon)-, amelyek szenzitizálhatnak PARP-gátlókkal szemben. Bizonyos szuppresszor gének aktivitása jelezheti ennek a fennállását.

21

22 KRAS P C R - R F L P KRAS gén pontmutáció vizsgálata 12. codon GGT 13. codon GGC EGFR immun vizsgálattal kiegészítve! Ha nem mutált és EGFR pozitív reagál. Módszer DNS izolálás PCR-RFLP szekvenálás

23

24

25

26 PCR - RFLP

27

28 1* * Fluorescence Fluorescence H codon HCT codon H358 hct116 6x Wt Mut Wt Mut Pozitív kontroll minták Alsó marker Felső marker Alsó marker Felső marker Time (seconds) * 0 1 2* Time (seconds) Heterogén(mut/wt) termék az enzim denat. miatt. Mut. Wt. Experion kapilláris gélelektroforézis virtuális gélkép 0% Mut. 2.5% 5% Mut. Mut. 7.5% Mut. 10% Mut. 20% Mut. 30% Mut. 40% Mut. 50% 70% Mut. Mut. 100% Mut. dr Rásó Erzsébet

29 >1_Kr6#SrS_C01_05 sequence exported from chromatogram file TNAGTCCATTTTCATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTG TGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATC ATTTTGTGGACGAATATGATCCAACAATAGAGGtAAATCTTGTTTTAATATGCATATTAC TGGGTGCAGGACCAAN >1_Kr3#SrS_A01_01 sequence exported from chromatogram file CCNNTNNCNTTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTA GTTGGAGCTGGTNGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTT GTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGGT GCAGGACCAA ABI 3100 Genetic Analyser / BigDye Cycle Sequencing kit alkalmazásával dr Rásó Erzsébet

30 Reliability of immunocytochemical and fluorescence in situ hybridization tests performed on fine needle aspiration cytology samples of breast tumors: a comparative study Balazs Acs, M.D., Nora Szekely, M.D., Marcell Szasz A. M.D., Ph.D., Gabor Lotz, M.D., Ph.D., Tamas Szekely, M.D., Roland Istok, M.D., Eszter Szekely, M.D., Ph.D., Janina Kulka M.D. Ph.D., Balazs Jaray, M.D. 2nd Department of Pathology, Semmelweis University, Budapest, Hungary

31

32

33

34 Eredményeink a közleményből oestrogén IC 97 db volt, 25 %-ban fals neg volt keneten, de ahol + volt, ott a szövettan is az volt. HER2 IC már gyengébb, de ha +, akkor a szövettan is, de nem szenzitív, azaz sok a fals neg. A HER2 FISH 100%-os volt.

35

36

37

38

A tüdő adenocarcinomák szubklasszifikációja. Dr. Szőke János Molekuláris Patológiai Osztály Budapest, 2008 december 5.

A tüdő adenocarcinomák szubklasszifikációja. Dr. Szőke János Molekuláris Patológiai Osztály Budapest, 2008 december 5. A tüdő adenocarcinomák szubklasszifikációja Dr. Szőke János Molekuláris Patológiai Osztály Budapest, 2008 december 5. Háttér A tüdő ACA heterogén tumor csoport és a jelenlegi klasszifikáció elsősorban

Részletesebben

Immunhisztokémiai vizsgálatok hematoxylinnal festett keneteken

Immunhisztokémiai vizsgálatok hematoxylinnal festett keneteken Immunhisztokémiai vizsgálatok hematoxylinnal festett keneteken Polgár Zoltánné Semmelweis Egyetem I.sz.Patológiai és Kísérleti Rákkutató Intézet, Budapest A gyakorlatban számtalan esetben fordul elő, hogy

Részletesebben

Dr. Ottó Szabolcs Országos Onkológiai Intézet

Dr. Ottó Szabolcs Országos Onkológiai Intézet Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001. Részjelentés: 200. November 0.-2004.

Részletesebben

Diagnosztikus problémák és prognosztikai faktorok prosztatarákban

Diagnosztikus problémák és prognosztikai faktorok prosztatarákban Diagnosztikus problémák és prognosztikai faktorok prosztatarákban Ph.D. Tézis Dr. Tarján Miklós Témavezet : Prof. Dr. Cserni Gábor SZTE - Patológiai Intézet Bács-Kiskun Megyei Kórház Patológiai Osztály

Részletesebben

Her2 fehérje overexpresszió gyomorrákokban: Hazai tapasztalatok

Her2 fehérje overexpresszió gyomorrákokban: Hazai tapasztalatok Her2 fehérje overexpresszió gyomorrákokban: Hazai tapasztalatok Dr. Lotz Gábor, Dr. Szirtes Ildikó, Dr. Kiss András Prof. Tímár József, Prof. Kulka Janina Semmelweis Egyetem II. Pathologiai Intézet - Exophyticus

Részletesebben

Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai markerek kutatása

Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai markerek kutatása A 48750 OTKA pályázat eredményeit összefoglaló szakmai záróbeszámoló A pályázat címe Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai

Részletesebben

http://www.rimm.dote.hu Tumor immunológia

http://www.rimm.dote.hu Tumor immunológia http://www.rimm.dote.hu Tumor immunológia A tumorok és az immunrendszer kapcsolatai Tumorspecifikus és tumorasszociált antigének A tumor sejteket ölő sejtek és mechanizmusok Az immunológiai felügyelet

Részletesebben

54/2005. (XI. 23.) EüM rendelet. az egyes egészségügyi szakképesítések szakmai és vizsgakövetelményeinek kiadásáról

54/2005. (XI. 23.) EüM rendelet. az egyes egészségügyi szakképesítések szakmai és vizsgakövetelményeinek kiadásáról 54/2005. (XI. 23.) EüM rendelet az egyes egészségügyi szakképesítések szakmai és vizsgakövetelményeinek kiadásáról A szakképzésrıl szóló 1993. évi LXXVI. törvény 5. -a (1) bekezdésének a) pontjában foglalt

Részletesebben

ÁLTALÁNOS KÓRBONCTAN ÉS KÓRSZÖVETTAN SZAKMAKÓD: 5400 Patológia Szakma főcsoport 54 PATOLÓGIA

ÁLTALÁNOS KÓRBONCTAN ÉS KÓRSZÖVETTAN SZAKMAKÓD: 5400 Patológia Szakma főcsoport 54 PATOLÓGIA ÁLTALÁNOS KÓRBONCTAN ÉS KÓRSZÖVETTAN SZAKMAKÓD: 5400 Patológia Szakma főcsoport 54 PATOLÓGIA Tevékenységek progresszív ellátási szint szerinti besorolása progresszív ellátási szint I. II. III. 11041 Vizsgálat

Részletesebben

EGFR-tirozinkináz-inhibitorok alkalmazása tüdőrákban: szenzitivitás és rezisztencia

EGFR-tirozinkináz-inhibitorok alkalmazása tüdőrákban: szenzitivitás és rezisztencia 38 Gyógyszergyári közlemény EGFR-tirozinkináz-inhibitorok alkalmazása tüdőrákban: szenzitivitás és rezisztencia Moldvay Judit 1, Peták István 2,3 1 Semmelweis Egyetem Pulmonológiai Klinika, 2 Semmelweis

Részletesebben

II./3.3.2 fejezet:. A daganatok célzott kezelése

II./3.3.2 fejezet:. A daganatok célzott kezelése II./3.3.2 fejezet:. A daganatok célzott kezelése Kopper László A fejezet célja, hogy megismerje a hallgató a célzott terápiák lehetőségeit és a fejlesztés lényeges lépéseit. A fejezet teljesítését követően

Részletesebben

Az emlőrák patológiai diagnosztikája, feldolgozása és kórszövettani leletezése. Szakmai útmutatás a III. emlőrák konszenzuskonferencia alapján.

Az emlőrák patológiai diagnosztikája, feldolgozása és kórszövettani leletezése. Szakmai útmutatás a III. emlőrák konszenzuskonferencia alapján. Az emlőrák patológiai diagnosztikája, feldolgozása és kórszövettani leletezése. Szakmai útmutatás a III. emlőrák konszenzuskonferencia alapján. Cserni Gábor (1,2), Kulka Janina (3), Francz Monika (4),

Részletesebben

Kettős férfi emlőrák és a beteg utógondozása

Kettős férfi emlőrák és a beteg utógondozása Bevezetés A férfi emlőrák ritka betegség, általában 100 női emlőrákra jut egy férfi emlőrákos beteg. Egyes populációkban ez az arány más lehet, így például az afrikai fekete lakosság körében 2,4% (1).

Részletesebben

poszter szám a poszter címe a bemutató neve

poszter szám a poszter címe a bemutató neve A Magyar Onkológusok Társaságának XXVI. Kongresszusa Budapest, 2005. november 10-12. Poszterek P1-P103 (bejelentett és ként elfogadott prezentációk) Almási Andrea P025 a címe Az epidermális növekedési

Részletesebben

ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL

ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL EREDMÉNYEK Munkacsoportunk úttörő szerepet játszott a molekuláris onkológiai (onkogenetikai)

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

Rezidensképzés Japánban - a japán patológus rezidensek mindennapjain keresztül

Rezidensképzés Japánban - a japán patológus rezidensek mindennapjain keresztül Rezidensképzés Japánban - a japán patológus rezidensek mindennapjain keresztül Székács Eszter Department of Diagnostic Pathology, Kyoto University Hospital, Kyoto Heianjingu, Kyoto Japán (lakossága: 127millió)

Részletesebben

Jelátviteli uatk és daganatképződés

Jelátviteli uatk és daganatképződés Jelátviteli uatk és daganatképződés Tímár József Semmelweis Egyetem, Klinikai Központ 2.sz. Patológiai Intézet MTA-SE Molekuláris Onkológia Kutatócsoport, Budapest A HER-2 genetikája emberi daganatokban

Részletesebben

Terhességi papilláris pajzsmirigycarcinoma Citodiagnózis, kiegészítő vizsgálatok

Terhességi papilláris pajzsmirigycarcinoma Citodiagnózis, kiegészítő vizsgálatok Terhességi papilláris pajzsmirigycarcinoma Citodiagnózis, kiegészítő vizsgálatok Esetbemutatás dr. Székely Tamás, dr. Székely Eszter, dr. Istók Roland, dr. Kovács István, dr. Járay Balázs dr. Tóbiás Bálint*,

Részletesebben

Genomikai vizsgálatok jelentősége a daganatterápiában. Csuka Orsolya Országos Onkológiai Intézet Pathogenetikai Osztály Budapest 2011.

Genomikai vizsgálatok jelentősége a daganatterápiában. Csuka Orsolya Országos Onkológiai Intézet Pathogenetikai Osztály Budapest 2011. Genomikai vizsgálatok jelentősége a daganatterápiában Csuka Orsolya Országos Onkológiai Intézet Pathogenetikai Osztály Budapest 2011. április Integrált kliniko-genomikai modell kialakítása a daganatos

Részletesebben

Emlődaganatok gyógyszeres kezelés. Dr.Tóth Judit DE OEC Onkológiai Tanszék

Emlődaganatok gyógyszeres kezelés. Dr.Tóth Judit DE OEC Onkológiai Tanszék Emlődaganatok gyógyszeres kezelés Dr.Tóth Judit DE OEC Onkológiai Tanszék Epidemiológia Kb.7000-8000 új eset évente Mo-on Idősebbek betegsége: -25 éves korban: 5/100 000-50 éves korban: 150/100 000-75

Részletesebben

a daganatos halálozás csökkentésére

a daganatos halálozás csökkentésére Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 3. Részjelentés: 2003. November

Részletesebben

TÜDİRÁKOK ONKOLÓGIÁJA

TÜDİRÁKOK ONKOLÓGIÁJA TÜDİRÁKOK ONKOLÓGIÁJA Dr. Maráz Anikó Szegedi Tudományegyetem Onkoterápiás Klinika 2012. november 14. Daganatos halálozás Európában, 1955-2015 Daganatos betegségek incidenciája /WHO, 2006/ Tüdı 1 200 000

Részletesebben

XV. Cytologus Kongresszus és Aspirációs citológia

XV. Cytologus Kongresszus és Aspirációs citológia XV. Cytologus Kongresszus és Aspirációs citológia Akkreditált tanfolyam (DE/2016.I./00165) 2016. március 31-április 1. Siófok, Prémium Hotel Panoráma - 2 - Időpont Tanfolyam: 2016. március 31-április 1.

Részletesebben

A melanocyták (naevussejtek) daganatai. Benignus. Malignus. Naevus pigmentosus (festékes anyajegy) szerzett veleszületett.

A melanocyták (naevussejtek) daganatai. Benignus. Malignus. Naevus pigmentosus (festékes anyajegy) szerzett veleszületett. A melanocyták (naevussejtek) daganatai Benignus Naevus pigmentosus (festékes anyajegy) szerzett veleszületett Malignus Melanoma malignum Szerzett NP barna, 6 mm-nél kisebb, éles határú NP junctionalis

Részletesebben

Bár az emlőrák elsősorban a posztmenopauzális nők betegsége, a betegek mintegy 5,5%-a 40 évesnél, 2%-a 35 évesnél fiatalabb a diagnózis idején. Ezekbe

Bár az emlőrák elsősorban a posztmenopauzális nők betegsége, a betegek mintegy 5,5%-a 40 évesnél, 2%-a 35 évesnél fiatalabb a diagnózis idején. Ezekbe Bár az emlőrák elsősorban a posztmenopauzális nők betegsége, a betegek mintegy 5,5%-a 40 évesnél, 2%-a 35 évesnél fiatalabb a diagnózis idején. Ezekben a korcsoportokban ez a leggyakoribb daganatos halálozási

Részletesebben

Új diagnosztikai és prognosztikai vizsgálatok a húgyhólyag rosszindulatú daganatain

Új diagnosztikai és prognosztikai vizsgálatok a húgyhólyag rosszindulatú daganatain Új diagnosztikai és prognosztikai vizsgálatok a húgyhólyag rosszindulatú daganatain Doktori tézisek dr. Riesz Péter Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Témavezető: Dr. Romics Imre

Részletesebben

Emlődiagnosztika. Szabó Endre

Emlődiagnosztika. Szabó Endre Emlődiagnosztika Szabó Endre Aki csak 1 dolgot bír megjegyezni: Ne nyúlj az emlőhöz menstruáció előtt! Fejlődés Klinikai vizsgálat csomó váladék bőr elváltozás Szűrés Tabár László fájdalom Módszerek mammográfia

Részletesebben

Daganatok kialakulásában szerepet játszó molekuláris folyamatok

Daganatok kialakulásában szerepet játszó molekuláris folyamatok Daganatok kialakulásában szerepet játszó molekuláris folyamatok Genetikai változások Onkogének Tumorszuppresszor gének DNS hibajavító gének Telomer és telomeráz Epigenetikai változások DNS-metiláció Mikro-RNS

Részletesebben

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 Zárójelentés: 2001. május 15.-2004.

Részletesebben

A.) Biopsziás mintavétel lehetőségei és a biopsziás anyagok kezelésével kapcsolatos tudnivalók.

A.) Biopsziás mintavétel lehetőségei és a biopsziás anyagok kezelésével kapcsolatos tudnivalók. II./2.5. fejezet: Daganatok szövettani diagnosztikája Kulka Janina Ebben a fejezetben a daganatból történő szövettani mintavétel lehetőségeit és értékelését, illetve értékének korlátait, valamint a sebészeti

Részletesebben

Férfi emlő és vékonybél leiomyosarcomája

Férfi emlő és vékonybél leiomyosarcomája A férfi emlő rosszindulatú daganata a ritkább megbetegedések közé tartozik, Magyarországon, mint Európában általában, 100 női emlőrákra esik egy férfi emlőrák. Az emlő sarcomája a női emlő rosszindulatú

Részletesebben

Az eddigi szakmai, vezetői, oktatói és tudományos munka ismertetése

Az eddigi szakmai, vezetői, oktatói és tudományos munka ismertetése Az eddigi szakmai, vezetői, oktatói és tudományos munka ismertetése SZAKMAI TEVÉKENYSÉG A nyolcvanas évek legelején kapcsolódtam be a Holló István professzor vezette endokrin csoport munkájába első munkahelyemen,

Részletesebben

Dr. Losonczy György egyetemi tanár Pulmonológiai Klinika Semmelweis Egyetem Klinikai onkológia speciális kurzus. 2014.

Dr. Losonczy György egyetemi tanár Pulmonológiai Klinika Semmelweis Egyetem Klinikai onkológia speciális kurzus. 2014. Dr. Losonczy György egyetemi tanár Pulmonológiai Klinika Semmelweis Egyetem Klinikai onkológia speciális kurzus. 2014. Tüdőrák incidencia és prevalencia Magyarországon 2000-2013 között A panasz nyomán

Részletesebben

Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ

Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ Azért, mert a kemoterápia bizonyított módon fokozza a gyógyulás esélyét! A kemoterápiának az a célja, hogy az esetleg, vagy biztosan visszamaradt daganatsejtek

Részletesebben

Paradigmaváltás a daganatok patológiai diagnosztikájában: molekuláris alapú differenciáldiagnosztika, prognosztikus és prediktív patológia

Paradigmaváltás a daganatok patológiai diagnosztikájában: molekuláris alapú differenciáldiagnosztika, prognosztikus és prediktív patológia Paradigmaváltás a daganatok patológiai diagnosztikájában: molekuláris alapú differenciáldiagnosztika, prognosztikus és prediktív patológia Eredeti közlemény Orosz Zsolt 1, Sápi Zoltán 4, Szentirmay Zoltán

Részletesebben

Tumorbiológia Dr. Tóvári József (Országos Onkológiai Intézet)

Tumorbiológia Dr. Tóvári József (Országos Onkológiai Intézet) a Magyar Tudományos Akadémia Biológiai Osztály, Immunológiai Bizottsága és a Magyar Immunológiai Társaság Immunológia Világnapja - 2016 Tumorbiológia Dr. Tóvári József (Országos Onkológiai Intézet) Az

Részletesebben

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 Zárójelentés: 2001. május 15.-2004.

Részletesebben

Immunhisztokémia: Előhívó rendszerek, problémák és megoldások

Immunhisztokémia: Előhívó rendszerek, problémák és megoldások Immunhisztokémia: Előhívó rendszerek, problémák és megoldások Dr. Krenács Tibor Semmelweis Egyetem I.sz. Patológiai és Kísérleti Rákkutató Intézet Budapest Patológus Klasszikus patomorfológia Klinikai

Részletesebben

E4 A Gyermekkori szervezett lakossági emlőszűrések hatása az emlőműtétek

E4 A Gyermekkori szervezett lakossági emlőszűrések hatása az emlőműtétek 08.30-09.30 09.00-10.30 Pátria terem 2005. november 10. csütörtök E1 MEGNYITÓ E2 1.Nemzeti Üléselnökök: Rákkontroll Kovács Attila, Program Csonka I. Csaba, Ottó Szabolcs E3 Kásler Ottó jellegzetességei,

Részletesebben

Lymphomák molekuláris patológiai diagnosztikája

Lymphomák molekuláris patológiai diagnosztikája OTKA nyilvántartási szám:t/f 043323 Lymphomák molekuláris patológiai diagnosztikája ZÁRÓJELENTÉS A lymphomák diagnosztikája és klasszifikációja az elmúlt 10 évben jelentősen átalakult. A jelenlegi osztályozás

Részletesebben

Cytológia - híd a klinikus és a pathológus között. Székely Eszter Járay Balázs Istók Roland

Cytológia - híd a klinikus és a pathológus között. Székely Eszter Járay Balázs Istók Roland Cytológia - híd a klinikus és a pathológus között Székely Eszter Járay Balázs Istók Roland Miért végzünk cytológiai vizsgálatot? Mert izgalmas szellemi kihívást jelent Imádunk mikroszkópban sejteket vizsgálni

Részletesebben

Fej-nyaki daganatok prognosztikai patológiai diagnosztikája

Fej-nyaki daganatok prognosztikai patológiai diagnosztikája Fej-nyaki daganatok prognosztikai patológiai diagnosztikája Tóth Erika, Veleczky Zsuzsa, Szentirmay Zoltán Országos Onkológiai Intézet A múlt 1860 Az első polyp eltávolítása 1871 Az első fej-nyak pathologia

Részletesebben

a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz

a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület RÉSZLETEZÕ OKIRAT a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz Az Országos Epidemiológiai Központ Bakteriológiai Mikológiai Parazitológiai és Tipizáló fõosztály

Részletesebben

A fejezet felépítése

A fejezet felépítése II./2.7. fejezet: A daganatok molekuláris diagnosztikája Kovalszky Ilona A fejezet célja, hogy megismerje a hallgató azokat a molekuláris diagnosztikai módszereket, melyek a napi gyakorlatban vagy kutatási

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2347-06 Analitika követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2347-06 Analitika követelménymodul szóbeli vizsgafeladatai 1. feladat A műtőből olyan szövettani minták kerülnek a patológiai osztályra, melyek nincsenek kellően előkészítve. Magyarázza el a főműtősnőnek a minta előkészítésének fontosságát! - a sejtpusztulás folyamatai

Részletesebben

RÉSZLETES PROGRAM. 2013. szeptember 26., csütörtök

RÉSZLETES PROGRAM. 2013. szeptember 26., csütörtök 2013. szeptember 26., csütörtök 8:00 Érkezés, regisztráció 9:00-10:30 Gyakorlat orientált neuropatológia - Rezidens kurzus Catalonia terem Üléselnök: Reiniger Lilla (Budapest) Turányi Eszter (Budapest)

Részletesebben

A pre-analitika szerepe a patológiai minták. Dr. Lotz Gábor Semmelweis Egyetem, II. sz. Patológiai Intézet

A pre-analitika szerepe a patológiai minták. Dr. Lotz Gábor Semmelweis Egyetem, II. sz. Patológiai Intézet A pre-analitika szerepe a patológiai minták megőrz rzöttségében Dr. Lotz Gábor Semmelweis Egyetem, II. sz. Patológiai Intézet A sebészeti anyagok útja Műtő OPTIMÁLIS HŐMÉRSÉKLET (20-22 C) IDŐFAKTOR (15

Részletesebben

meghatározásának jelentősége

meghatározásának jelentősége A HerHer-2 státusz meghatározásának jelentősége gyomorkarcinomában Tímár József, Szirtes Ildikó, Lotz Gábor, Kulka Janina SE 2.sz. Pathologiai Intézet 140 HER-2 fokozott expressziót mutató Emlőrák 20%

Részletesebben

A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban

A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban Összefoglaló közlemény 21 A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban Bálint Bálint L. 1, Nagy László 1,2 1 Debreceni Egyetem Orvos- és Egészségtudományi Centrum, Biokémiai és

Részletesebben

70. Patológus Kongresszus. a Magyar Patológusok Társasága és a Nemzetközi Pathologiai Akadémia (IAP) Magyar Divíziója rendezésében

70. Patológus Kongresszus. a Magyar Patológusok Társasága és a Nemzetközi Pathologiai Akadémia (IAP) Magyar Divíziója rendezésében 70. Patológus Kongresszus a Magyar Patológusok Társasága és a Nemzetközi Pathologiai Akadémia (IAP) Magyar Divíziója rendezésében Siófok, Hotel Azúr 2011. szeptember 29-október 1. MÁSODIK ÉRTESÍTÉS Tisztségviselők

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

HER2 immunhisztokémiai vizsgálatok minôségellenôrzése

HER2 immunhisztokémiai vizsgálatok minôségellenôrzése HER2 immunhisztokémiai vizsgálatok minôségellenôrzése Egy magyarországi körvizsgálat eredményei Eredeti közlemény Cserni Gábor 1, Kálmán Ede 2, Kulka Janina 3, Orosz Zsolt 4, Udvarhelyi Nóra 4, Krenács

Részletesebben

III./5. GIST. Bevezetés. A fejezet felépítése. A.) Panaszok. B.) Anamnézis. Pápai Zsuzsanna

III./5. GIST. Bevezetés. A fejezet felépítése. A.) Panaszok. B.) Anamnézis. Pápai Zsuzsanna III./5. GIST Pápai Zsuzsanna A fejezet célja: a GIST daganatok epidemiológiájának, tüneteinek, diagnosztikájának valamint, kezelési lehetőségeinek áttekintése egy beteg esetének bemutatásán keresztül.

Részletesebben

MULTIDROG REZISZTENCIA IN VIVO KIMUTATÁSA PETEFÉSZEK TUMOROKBAN MOLEKULÁRIS LEKÉPEZÉSSEL

MULTIDROG REZISZTENCIA IN VIVO KIMUTATÁSA PETEFÉSZEK TUMOROKBAN MOLEKULÁRIS LEKÉPEZÉSSEL MULTIDROG REZISZTENCIA IN VIVO KIMUTATÁSA PETEFÉSZEK TUMOROKBAN MOLEKULÁRIS LEKÉPEZÉSSEL Dr. Krasznai Zoárd Tibor Debreceni Egyetem OEC Szülészeti és Nőgyógyászati Klinika Debrecen, 2011. 10.17. Bevezetés

Részletesebben

eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program

eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program Agydaganatok sugárterápia iránti érzékenységének növelése génterápiás eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program Doktori

Részletesebben

III./9.3 Méhtest rosszindulatú daganatai

III./9.3 Méhtest rosszindulatú daganatai III./9.3 Méhtest rosszindulatú daganatai Tömösváry Zoltán, Langmár Zoltán, Bánhidy Ferenc Az alábbi fejezet során a méhtest rosszindulatú daganatait mutatjuk be. A méhtestrák gyakoriságát, típusait, diagnosztikáját,

Részletesebben

ONCOCYTÁS S PAJZSMIRIGY TUMOROK DIFFERENCIÁLDIAGNOSZTIK LDIAGNOSZTIKÁJA. Péter Ilona. ziuma Budapest 2008.

ONCOCYTÁS S PAJZSMIRIGY TUMOROK DIFFERENCIÁLDIAGNOSZTIK LDIAGNOSZTIKÁJA. Péter Ilona. ziuma Budapest 2008. ONCOCYTÁS S PAJZSMIRIGY TUMOROK DIFFERENCIÁLDIAGNOSZTIK LDIAGNOSZTIKÁJA Péter Ilona Az Országos Onkológiai Intézet és s a Dako közös s szimpóziuma ziuma Budapest 2008. Oncocyta a pajzsmirigyben Definíci

Részletesebben

EGYETEMI DOKTORI (Ph.D) TÉZISEK

EGYETEMI DOKTORI (Ph.D) TÉZISEK EGYETEMI DOKTORI (Ph.D) TÉZISEK 1 EGYETEMI DOKTORI (Ph.D) TÉZISEK Melanoma progresszióval összefüggı genetikai és génexpressziós változások Rákosy Zsuzsa Témavezetı: Dr. Balázs Margit tanszékvezetı egyetemi

Részletesebben

A PAJZSMIRIGY DAGANATAIRÓL. 2015. 11. 25. Dr. Békési Gábor és Dr. Marczell István SE II. sz. Belklinika

A PAJZSMIRIGY DAGANATAIRÓL. 2015. 11. 25. Dr. Békési Gábor és Dr. Marczell István SE II. sz. Belklinika A PAJZSMIRIGY DAGANATAIRÓL 2015. 11. 25. Dr. Békési Gábor és Dr. Marczell István SE II. sz. Belklinika A PAJZSMIRIGY GÖBÖS BETEGSÉGEI A tapintható csomók gyakorisága 5-7%, a nem tapinthatókkal együtt 13-40%.

Részletesebben

SENTINEL NYIROKCSOMÓ SZCINTIGRÁFIA EMLŐRÁKBAN- MÓDSZERTANI ÚTMUTATÓ

SENTINEL NYIROKCSOMÓ SZCINTIGRÁFIA EMLŐRÁKBAN- MÓDSZERTANI ÚTMUTATÓ SENTINEL NYIROKCSOMÓ SZCINTIGRÁFIA EMLŐRÁKBAN- MÓDSZERTANI ÚTMUTATÓ Írta: Rajtár Mária 1. Háttér információk és definíciók Az emlőrák sebészi kezelése során az axillaris blockdissectióval eltávolított

Részletesebben

Füle Tibor. Humán papillómavírus a méhnyakrákokban és a környező szövetekben. Témavezető: Dr. Kovalszky Ilona

Füle Tibor. Humán papillómavírus a méhnyakrákokban és a környező szövetekben. Témavezető: Dr. Kovalszky Ilona Ph.D. ÉRTEKEZÉS TÉZISEI Humán papillómavírus a méhnyakrákokban és a környező szövetekben Füle Tibor Témavezető: Dr. Kovalszky Ilona Semmelweis Egyetem I. sz. Patológiai és Kísérleti Rákkutató Intézet 2005

Részletesebben

III./14.2. Acusticus neurinoma

III./14.2. Acusticus neurinoma III./14.2. Acusticus neurinoma Pálos Györgyi A fejezet célja, hogy megismerje a hallgató az acusticus neurinoma tüneteit, illetve a betegség felismerésében és követésében fontos diagnosztikus és terápiás

Részletesebben

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Finanszírozási Mechanizmus által támogatott projekt Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Alap támogatással javul

Részletesebben

Molekuláris biológiai technikák

Molekuláris biológiai technikák Molekuláris biológiai technikák Wunderlich Lívius A Molekuláris biológiai technikák jegyzet igyekszik átfogó képet adni a jövő tudományának, a molekuláris biológiának a módszertanáról. A technikák elméleti

Részletesebben

70. Patológus Kongresszus: Metszetszeminárium 3

70. Patológus Kongresszus: Metszetszeminárium 3 70. Patológus Kongresszus: Metszetszeminárium 3 Dr. Khoór András Associate Professor and Chair Department of Laboratory Medicine and Pathology Mayo Clinic, Jacksonville, Florida Kórtörténet Egy 67 éves

Részletesebben

A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában

A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában Budapest, 2014. február 22. Ritka Betegségek Világnapja A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában dr. Kósa János PentaCore Laboratórium, Budapest Semmelweis Egyetem I. sz.

Részletesebben

Az Egészségügyi Minisztérium módszertani levele Immunhisztokémiai és immuncitokémiai módszerek alkalmazása a patológiában

Az Egészségügyi Minisztérium módszertani levele Immunhisztokémiai és immuncitokémiai módszerek alkalmazása a patológiában 1 Az Egészségügyi Minisztérium módszertani levele Immunhisztokémiai és immuncitokémiai módszerek alkalmazása a patológiában Készítette: Az Országos Pathologiai Intézet és a Pathologus Szakmai Kollégium

Részletesebben

UROLÓGIAI KLINIKA. A vese + ureter endoszkópos sebészete

UROLÓGIAI KLINIKA. A vese + ureter endoszkópos sebészete UROLÓGIAI KLINIKA A vese + ureter endoszkópos sebészete óraszám: 8 prof. Dr. Tóth Csaba egyetemi tanár prof. Dr. Tóth Csaba egyetemi tanár A felvétel feltételei: Érdeklődés az urológiai endoszkópia iránt.

Részletesebben

Platina bázisú kemoterápia hatása különböző biomarkerek expressziójára tüdőrákokban

Platina bázisú kemoterápia hatása különböző biomarkerek expressziójára tüdőrákokban Platina bázisú kemoterápia hatása különböző biomarkerek expressziójára tüdőrákokban Pápay J. 1, Sápi Z. 1 Gyulai M. 5, Egri G. 2, Szende B. 1, Tímár J. 4 Moldvay J. 3 1: Semmelweis Egyetem, I.sz.Patológiai

Részletesebben

Tóth Erika Sebészeti és Molekuláris Patológia Osztály Országos Onkológiai Intézet. Frank Diagnosztika Szimpózium, DAKO Workshop 2012.

Tóth Erika Sebészeti és Molekuláris Patológia Osztály Országos Onkológiai Intézet. Frank Diagnosztika Szimpózium, DAKO Workshop 2012. Tóth Erika Sebészeti és Molekuláris Patológia Osztály Országos Onkológiai Intézet Frank Diagnosztika Szimpózium, DAKO Workshop 2012.december 7 1. Sporadikus és örökletes pajzsmirigy daganatokban eddig

Részletesebben

A csontvelői eredetű haem-és lymphangiogén endothel progenitor sejtek szerepe tüdőrákokban. Doktori tézisek. Dr. Bogos Krisztina

A csontvelői eredetű haem-és lymphangiogén endothel progenitor sejtek szerepe tüdőrákokban. Doktori tézisek. Dr. Bogos Krisztina A csontvelői eredetű haem-és lymphangiogén endothel progenitor sejtek szerepe tüdőrákokban Doktori tézisek Dr. Bogos Krisztina Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Pulmonológia program

Részletesebben

A sugárterápia változó szerepe és indikációi a mammográfiás szűrés bevezetése óta

A sugárterápia változó szerepe és indikációi a mammográfiás szűrés bevezetése óta A sugárterápia változó szerepe és indikációi a mammográfiás szűrés bevezetése óta Polgár Cs. Mészáros N. Országos Onkológiai Intézet, Sugárterápiás Centrum Mammográfiás szűrés harmadik szűrési ciklus (2006-2007)

Részletesebben

Nőgyógyászati daganatok carcinogenesis, szignálutak, célzott terápiák

Nőgyógyászati daganatok carcinogenesis, szignálutak, célzott terápiák Nőgyógyászati daganatok carcinogenesis, szignálutak, célzott terápiák Tóth Erika Sebészeti és Molekuláris Patológiai Osztály Országos Onkológiai Intézet Az előadás vázlata 1. Célzott terápia definíció

Részletesebben

A molekuláris diagnosztika finanszírozása

A molekuláris diagnosztika finanszírozása A molekuláris diagnosztika finanszírozása Dr. Varga Péter főosztályvezető Országos Egészségbiztosítási Pénztár Elemzési, Orvosszakértői és Szakmai Ellenőrzési Főosztály Budapest, 2015. március 5. 1. A

Részletesebben

Szinoviális szarkómák patogenezisében szerepet játszó szignálutak jellemzése szöveti multiblokk technika alkalmazásával

Szinoviális szarkómák patogenezisében szerepet játszó szignálutak jellemzése szöveti multiblokk technika alkalmazásával Szinoviális szarkómák patogenezisében szerepet játszó szignálutak jellemzése szöveti multiblokk technika alkalmazásával Fónyad László 1, Moskovszky Linda 1, Szemlaky Zsuzsanna 1, Szendrői Miklós 2, Sápi

Részletesebben

Húgyhólyagdaganatok új diagnosztikus és prognosztikus markerei

Húgyhólyagdaganatok új diagnosztikus és prognosztikus markerei Húgyhólyagdaganatok új diagnosztikus és prognosztikus markerei Doktori értekezés dr. Törzsök Péter Semmelweis Egyetem Elméleti Orvostudományok Doktori Iskola Témavezető: Dr. Kiss András, Ph.D., egyetemi

Részletesebben

Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben

Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben Dr. Hermann Csaba Doktori (Ph.D.) Értekezés Tézisfüzet Témavezetı: Prof. Dr. Madácsy László egyetemi tanár Programvezetı: Prof. Dr. Tulassay

Részletesebben

Bízom benne, új szolgáltatásunk segíteni fog abban, hogy Ön és munkatársai minél hatékonyabban vegyék igénybe az Intézet laborszolgáltatásait.

Bízom benne, új szolgáltatásunk segíteni fog abban, hogy Ön és munkatársai minél hatékonyabban vegyék igénybe az Intézet laborszolgáltatásait. Klinikusok, a laborvizsgálatokat megrendelő és értelmező munkatársak Budapest, 2015 június 3 KK/KL/126/2015 tárgy: Hírlevél indítása klinikusok számára Kedves Munkatársak! A Semmelweis Egyetemen a diagnosztikai

Részletesebben

HUMAN IMMUNODEFICIENCY VIRUS (HIV) ÉS AIDS

HUMAN IMMUNODEFICIENCY VIRUS (HIV) ÉS AIDS HUMAN IMMUNODEFICIENCY VIRUS (HIV) ÉS AIDS Dr. Mohamed Mahdi MD. MPH. Department of Infectology and Pediatric Immunology University of Debrecen 2010 Történelmi tények a HIV-ről 1981: Első megjelenés San

Részletesebben

Az Egészségügyi Minisztérium szakmai irányelve. A non-invazív hólyagdaganat kezeléséről Készült az EAU guideline 2009 alapján.

Az Egészségügyi Minisztérium szakmai irányelve. A non-invazív hólyagdaganat kezeléséről Készült az EAU guideline 2009 alapján. Az Egészségügyi Minisztérium szakmai irányelve A non-invazív hólyagdaganat kezeléséről Készült az EAU guideline 2009 alapján. Készítette: az Urológiai Szakmai Kollégium 1. Alapvető megfontolások 1.1. A

Részletesebben

Bemutatkozás Dr. Lehoczky István. 2013. december 4..

Bemutatkozás Dr. Lehoczky István. 2013. december 4.. Bemutatkozás Dr. Lehoczky István 2013. december 4.. A baromfihoz eddig ilyen viszony fűzött Képzettség: 1991 1995. Szinyei Merse Pál Gimnázium, Budapest, Érettségi. 1995 2001. Kaposvári Egyetem, Állattudományi

Részletesebben

Epithelialis-mesenchymalis átmenet vastagbél daganatokban

Epithelialis-mesenchymalis átmenet vastagbél daganatokban Epithelialis-mesenchymalis átmenet vastagbél daganatokban Éles Klára Országos Onkológiai Intézet Sebészi és Molekuláris Daganatpatológiai Centrum Budapest, 2010. 12. 03. Epithelialis-mesenchymalis átmenet

Részletesebben

2.3.11. Az agyi áttétek ellátása

2.3.11. Az agyi áttétek ellátása 2.3.11. Az agyi áttétek ellátása Tóth Andrea, Torgyík László, Szentmártoni Gyöngyvér cél Ebben a fejezetben az agyi áttétek kezelésének lehetőségeit tekintjük át, érintve az epidemiológia, etiológia a

Részletesebben

MISKOLCI EGYETEM Egészségügyi Kar OLKDA alapszak Képalkotó szakirány. Az emlőelváltozások radiológiai és patológiai eredményeinek összehasonlítása

MISKOLCI EGYETEM Egészségügyi Kar OLKDA alapszak Képalkotó szakirány. Az emlőelváltozások radiológiai és patológiai eredményeinek összehasonlítása MISKOLCI EGYETEM Egészségügyi Kar OLKDA alapszak Képalkotó szakirány Az emlőelváltozások radiológiai és patológiai eredményeinek összehasonlítása Konzulens: Készítette: Dr. Antalfi Bálint Drótos Anita

Részletesebben

A tüdőcitológia jelentősége a tüdődaganatok neoadjuváns kezelésének tervezésében

A tüdőcitológia jelentősége a tüdődaganatok neoadjuváns kezelésének tervezésében A tüdőcitológia jelentősége a tüdődaganatok neoadjuváns kezelésének tervezésében Pápay Judit SE, I.sz.Patológiai és Kísérleti Rákkutató Intézet 70. Patológus Kongresszus Siófok 2011. szept. 29 - okt.1.

Részletesebben

A kolorektális rákok KRAS-mutációs státuszának hatása az Avastin-terápia hatékonyságára

A kolorektális rákok KRAS-mutációs státuszának hatása az Avastin-terápia hatékonyságára Eredeti közlemény 99 A kolorektális rákok KRAS-mutációs státuszának hatása az Avastin-terápia hatékonyságára Hegedűs Zita 1, Barbai Tamás 1, Tátrai Péter 1, Hegedűs Balázs 1, Kiss András 1, Rásó Erzsébet

Részletesebben

Debreceni Egyetem Általános Orvostudományi Kar Patológiai Intézet

Debreceni Egyetem Általános Orvostudományi Kar Patológiai Intézet MTA DOKTORI ÉRTEKEZÉS ÚJ MÓDSZEREK A DAGANATOK GENETIKAI JELLEGZETESSÉGEINEK ÉS HETEROGENITÁSÁNAK VIZSGÁLATÁRA Dr. Méhes Gábor Debreceni Egyetem Általános Orvostudományi Kar Patológiai Intézet Debrecen,

Részletesebben

cobas KRAS Mutation Test KRAS

cobas KRAS Mutation Test KRAS cobas KRAS Mutation Test CSAK IN VITRO DIAGNOSZTIKAI CÉLRA. cobas DNA Sample Preparation Kit DNA SP 24 Tests P/N: 05985536190 cobas KRAS Mutation Test KRAS 24 Tests P/N: 05852170190 MEGJEGYZÉS: A termék

Részletesebben

VAN ÚJ A N.A.P. ALATT. A Magyar Tüdőgyógyász Társaság Onkopulmonológiai Szekciójának konferenciája Danubius Hotel Hélia, Budapest 2015.december 3-5.

VAN ÚJ A N.A.P. ALATT. A Magyar Tüdőgyógyász Társaság Onkopulmonológiai Szekciójának konferenciája Danubius Hotel Hélia, Budapest 2015.december 3-5. VAN ÚJ A N.A.P. ALATT A Magyar Tüdőgyógyász Társaság Onkopulmonológiai Szekciójának konferenciája Danubius Hotel Hélia, Budapest 205.december 3-5. PROGRAM 205. december 3. (csütörtök) 5.00 Érkezés, Regisztráció,

Részletesebben

Daganatok fogalma, általános jellegzetességeik és osztályozásuk. Zalatnai Attila

Daganatok fogalma, általános jellegzetességeik és osztályozásuk. Zalatnai Attila Daganatok fogalma, általános jellegzetességeik és osztályozásuk Zalatnai Attila Daganat: olyan kóros szövetszaporulat, mely a szervezet saját sejtjeiból kiindulva, fokozatosan függetlenedik a fiziológiás

Részletesebben

Chapter 10 Hungarian Summary. Az onkológiai gyógyszerfejlesztés eredetileg DNS-károsodást indukáló vegyületekre

Chapter 10 Hungarian Summary. Az onkológiai gyógyszerfejlesztés eredetileg DNS-károsodást indukáló vegyületekre 10 Összefoglaló Összefoglaló Az onkológiai gyógyszerfejlesztés eredetileg DNS-károsodást indukáló vegyületekre összpontosított, melyek az osztódó rákos sejteket célozzák meg. Jelenleg, nagy hangsúly fektetődik

Részletesebben

Molekuláris módszerek a vizeletcitológiai preparátumok vizsgálatában

Molekuláris módszerek a vizeletcitológiai preparátumok vizsgálatában Molekuláris módszerek a vizeletcitológiai preparátumok vizsgálatában Dr. Lotz Gábor 1, Pajor Gábor 2 1 Semmelweis Egyetem, II. Patológiai Intézet 2 Pécsi Tudományegyetem ÁOK, Patológiai Intézet Vizeletcitológia:

Részletesebben

II./3.4. fejezet: Daganatos betegségek sugárkezelésének alapelvei

II./3.4. fejezet: Daganatos betegségek sugárkezelésének alapelvei II./3.4. fejezet: Daganatos betegségek sugárkezelésének alapelvei Hideghéty Katalin A fejezet célja, hogy a hallgató megismerkedjen a sugárkezelés általános alapelveivel, és rálátást szerezzen a különböző

Részletesebben

Áttekintés az emlőrák megbetegedések és a gyógyítás helyzetéről Magyarországon beleértve a 2001 óta folyó mammográfiás szűréseket. Dr.

Áttekintés az emlőrák megbetegedések és a gyógyítás helyzetéről Magyarországon beleértve a 2001 óta folyó mammográfiás szűréseket. Dr. Áttekintés az emlőrák megbetegedések és a gyógyítás helyzetéről Magyarországon beleértve a 2001 óta folyó mammográfiás szűréseket. Dr. Kovács Attila 1 Emlőrák Világszerte a 5. leggyakoribb rák nőkben (valamennyi

Részletesebben

Kapcsolat vizsgálat II: kontingencia táblák jelentősége és használata az epidemiológiában, diagnosztikában: RR, OR. ROC analízis.

Kapcsolat vizsgálat II: kontingencia táblák jelentősége és használata az epidemiológiában, diagnosztikában: RR, OR. ROC analízis. Kapcsolat vizsgálat II: kontingencia táblák jelentősége és használata az epidemiológiában, diagnosztikában: RR, OR. ROC analízis. Dr. Prohászka Zoltán Az MTA doktora Semmelweis Egyetem III. Sz. Belgyógyászati

Részletesebben

Xenobiotikum transzporterek vizsgálata humán keratinocitákban és bőrben

Xenobiotikum transzporterek vizsgálata humán keratinocitákban és bőrben DOKTORI (PHD) ÉRTEKEZÉS TÉZISEI Xenobiotikum transzporterek vizsgálata humán keratinocitákban és bőrben Bebes Attila Témavezető: Dr. Széll Márta tudományos tanácsadó Szegedi Tudományegyetem Bőrgyógyászati

Részletesebben