Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Save this PDF as:
 WORD  PNG  TXT  JPG

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll."

Átírás

1 Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott fajjal (Umbra krameri) foglalkoztunk, célunk a módszerek optimalizálása volt. Azonban a tervektől eltérően EcoTILLING helyett mikroszatellit elemzést végzünk. Ahogy a pályázatban (5. oldal) is említettük, ez utóbbi a populáció szerkezeti kérdések elemzésének egyik leginkább bevált módszere, amelyet széles körben alkalmaznak (ezt igazolja a szakterület vezető folyóiratában, a Molecular Ecology-ban folyamatosan megjelenő cikkek sokasága, de hasonlóan meghatározó a természetvédelmi orientációjú vizsgálatokban is, pl. Conservation Genetics). Alkalmazhatóságának alapvető korláta az, hogy előzetes szekvencia információkat igényel: ahhoz, hogy az egyedeket genotipizálni tudjuk, a genom régiókra specifikus PCR primerekre van szükség. Ez egyik kiválasztott fajra sem állt rendelkezésre a pályázat benyújtása idején. Új mikroszatellitek izolálása meglehetősen költséges, illetve a fajok közötti alkalmazhatóság még közeli rokon fajok esetén is nagyon bizonytalan. Ezért javasoltuk kiindulásképpen az EcoTILLING módszert, amely lényegesen nagyobb kapacitást és költséget igényel, így ezzel a módszerrel kevesebb minta elemezhető a rendelkezésre álló keretből. De semmivel nem ad több információt, mint a mikroszatellit, így az EcoTILLING használata értelmetlen, ha a mikroszatellit elemzés kivitelezhető évben 9 mikroszatellit régiót közöltek le az általunk is vizsgált fajra (Winkler és Weiss 2009). Ezek a mikroszatellit lokuszok tetranukleotid ismétlődő egységekből állnak, lehetővé téve az allélok egyértelmű azonosítását. Továbbá kipróbálásra kerültek Magyarországról származó mintákra is, így a régióban mutatott változatosságáról is informálódhattunk. Célunk ezeknek a kipróbálása, optimalizálása volt, első körben két populációra (Gögő-Szenke- Nagyszekeres és Pocsaj, minták forrása: BLKI). Ez a következő főbb lépéseket jelenti: DNS izolálása, tisztítása (eljárási lépések az 1. függelékben) PCR körülmények optimalizálása (2. és 3. függelék) PCR termékek ellenőrzése (szekvencia meghatározása, összevetése a leközölttel, 4. függelék) Teszt különböző populációkból származó egyedekre. Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Egy lokusz monomorfnak bizonyult (Tet9, ezt monomorfnak találta Winkler és Weiss is, mi sem találtuk jelét a változatosságnak). A Tet2 és Tet3 lokuszok azonosak (a két különböző primer pár ugyanazt a genomi régiót szaporítja fel), amelyből a Tet3 tisztább képet adott, ezért ezt tartottuk meg. Ilyen módon 7 régiónk maradt, amelyre az eljárási lépéseket sikerült optimalizálni és alkalmazhatónak tűnnek. Mivel az eljárás során az egyszerűbb agaróz gélen történő elválasztást használtuk, pillanatnyilag nehéz lenne megítélni a változatosságot. De 5 lokusz az eddigiek alapján (agaróz gél és szekvencia) is polimorfnak tűnik (3. és 4. függelék), pillanatnyilag a Tet6 és Tet8 lokuszokra ez kevésbé egyértelmű (de Winkler és Weiss alapján várhatóan polimorf). A PCR termékek mérete minden esetben a várt méret tartományba esett. Mindezek alapján a következő lépés a primerek fluoreszcens jelölése és az esetleges multiplex PCR lehetőségek feltérképezése, majd ezután következik a különböző populációkból

2 származó egyedek genotipizálása. Ez utóbbit kapilláris szekvenátor készüléken végezzük, ez a legbiztosabb eljárás a genotípus egyértelmű azonosítására. Tekintettel arra, hogy az EcoTILLING helyett mikroszatellit elemzést tudunk végezni, egy további fajt is be tudtunk vonni a részletesebb elemzésbe, ez a Gobio gobio. Mivel itt elsősorban taxonómiai kérdések tisztázása a cél, feltehetően DNS szekvenciák elemzése lesz a célravezető módszer. Leközölt információk alapján (Mendel et al 2008) a DNS izolálást megkezdtük (ez az 1. függelék szerint történik), a PCR primereket megrendeltük. A kivitelezéshez minden eszköz, szoftver és tapasztalat (pl. Bihari et al 2011) rendelkezésre áll. Referencia Bihari P., Sipos B., Melika G., Fehér B., Somogyi K., Stone GN, Pénzes Zs (2011) Western Palearctic phylogeography of an inquiline gallwasp: Synergus umbraculus Olivier 1791 (Hymenoptera: Cynipidae: Synergini). Biol J Linn Soc 102: Liker A, Bókony V, Kucsár A, Tóth Z, Szabó K, Kaholek B, Pénzes Zs (2009) Genetic relatedness in wintering groups of house sparrows (Passer domesticus). Molecular Ecology 18: Mendel et al (2008) Molecular phylogeny of the genus Gobio Cuvier, 1816 (Teleostei: Cyprinidae) and its contribution to taxonomy. Molecular Phylogenetics and Evolution 47: Winkler K.A. és Weiss T. (2009) Nine new tetranucleotide microsatellite DNA markers for the European mudminnow Umbra crameri. Conservation Genetics 10: Függelék 1. DNS izolálás Az izolálás 96%-os etanolban tárolt uszony darabból történt, amelynek egyharmadát használtuk fel. Az izolálás főbb lépései az alábbiak ( proteináz K protokoll, ahol a protk emésztést fenol-kloroform-izoamil alkoholos tisztítás követi, Hoelzel 1998 alapján): 75 µl extrakciós puffer µl Prot K (20mg/ml), a minta szétdörzsölése steril pipettaheggyel, majd 120 perc inkubálás 55 ºC-on, időnként kevergetve, majd lefugálva 75 µl fenol-kloroform-izoamil alkohol elegy (PCI, 25:24:1 arányban) hozzáadása, forgatva keverés, kb. 5 perc inkubálás szobahőmérsékleten 5 perc centrifugálás (7000g) a felső, vizes fázis áthelyezése új Eppendorfba ehhez a vizes fázishoz 75 µl kloroform-izoamil alkoholt (CI, 24:1 arányban) adva, forgatva keverés kb. 5 percig szobahőmérsékleten 3 perc centrifugálás (7000g) felső fázist új Eppendorfba téve ehhez 0.1 térfogat (7-8 µl) 3M nátrium-acetátot és térfogat (kb 150 µl) 96 %-os -20 ºC-os etanolt adunk, majd -20 ºC-on inkubáljuk (overnight).

3 5-7 perc centrifugálás (11000g) felülúszót eltávolítjuk, majd a maradékhoz 150 µl 70% etanolt adunk 5-7 perc centrifugálás (11000g) felülúszót leszívjuk feloldás 100 µl TE pufferben Extrakciós puffer: 50 mm Tris ph 7,5, 1 mm EDTA, 100 mm NaCl, 1% (w/v) SDS TE puffer: 10 mm Tris ph 8, 1mM EDTA ph 8. Hivatkozás: Hoelzel A. R. (1998) Molecular genetic analysis of populations, a practical approach. Oxford University Press, Oxford, UK. 2. Mikroszatellit PCR protokoll A PCR reakció összetétele, 10 µl végtérfogatban: 1.5 mm MgCl µm mindegyik dntp ből, 0.25 µm mindkét primerből 0.5 U Taq polymerase (Fermentast használtunk). Alap PCR program: 95 ºC (3 perc) 35 ciklus: 95 ºC (45 másodperc), Tm 20 mp, 72 ºC (30 mp) 72 ºC (7 perc) Gradiens PCR a hőmérséklet optimalizáláshoz: 42, 44, 45.4, 47.1, 49.2, 50.9, 53.1 ºC További optimalizálás (tet4, tet7): 53, 54.2, 55, 57.2, 59 ºC További optimalizálás (tet6, tet7, tet8): 45, 47.8, 51, 53.5, 55 ºC Az optimális annealing hőmérsékletek az alábbiak: tet1: 53 ºC tet2: 51 ºC tet3: 53.1 ºC tet4: 59 ºC tet5: 53.1 ºC tet6: 55 ºC tet7: 59 ºC tet8: 59 ºC tet9: 42-től 53.1 ºC-ig bármi jó A tet4 végül csak egy,touchdown PCR programmal működött megbízhatóan: 1. ciklus 65 ºC, 2.: 63 ºC, 3.: 61 ºC, 4. ciklustól 59 ºC, illetve összesen ugyanúgy 35 ciklus, mint az alap PCR programban. A kipróbált PCR primerek szekvenciája (5'-3') Winkler és Weiss (2009) alapján: UkrTet1: F: CATCAAATGTTGGCAGACTTGC R: GGGAAACCGCTATCCTGAC UkrTet2: F: AACACACAGACAGGACGTTCC R: GGGAGAAAGATGGGTGCC UkrTet3: F: GGGTGCCAGGCTGTTCTC R: ATCAATCGGACTAACGGTTCG UkrTet4: F: AGACGGCAGCACATAAGAA R: ATTATTGGTGTCCATCCCTGTC

4 UkrTet5: F: TCACCGCACAAAAGAAACAC UkrTet6: F: ATCGGTTTTTGCCCATCAGT UkrTet7: F: CAATAGTTCCCCAATCCTGG UkrTet8: F: CTTGGCTGTGGTGGTTGAA UkrTet9: F: CACAGTCTCAATGGGGGAAA R: AACACCAGGGAACTGCAGTCT R: CCGCAGATCGAAAGTTTGAC R: GTCTCGACCACCAAGCG R: GGGGGAGTCCCTGC R: CCAAGCCTAACCTGCTAAAGA Tet2 és Tet9 lokuszokat kivéve a többi használhatónak tűnik. 3. PCR optimalizálás példa Tet8 (baloldali ábra) és Tet6 (jobboldali ábra) PCR optimalizálása. A kapott PCR termékek elválasztása agaróz gélen történt, az ábra a hőmérséklettől való függést (és az optimalizálás jelentőségét) szemlélteti az U46 és U47 mintákra (Gögő-Szenke-Nagyszekeres). Feltehetően a Tet8 lokuszra mindkét egyed heterozigóta. Az egyedek tényleges genotípusának meghatározása már nagyobb felbontású, 1 bp különbség kimutatására alkalmas módszerekkel fog történni. Mivel a mikroszatelliteink 4 bp hosszúságú ismétlődő egységekből állnak, agaróz gélen az 1 vagy 2 egység (< 10 bp) eltérés nem különíthető el. A PCR körülmények optimalizálásához azonban ez elegendő. Tet7 lokuszon a két minta (U46 és U47) közötti eltérés egyértelmű agaróz gélen is (több különböző hőmérsékleten látjuk). Az U46 minta esetén egy intenzív csíkot látunk, de az egyed lehet, hogy heterozigóta. Az U47 egyed egyértelműen heterozigóta, a két allél között legalább 20 bp a különbség (5 ismétlődő egység). Winkler és Weiss (2009) Szlovákia és Magyarország területén összesen 9 allélt talált ezen a lokuszon, a bp méret tartományban, az ábrán látható allélok is ebben a tartományban vannak.

5 4. PCR optimalizálás és ellenőrzés szekvenálással. A Tet1 PCR optimalizálása az U1, U2 és U3 mintákkal (Pocsaji láp). A kapott PCR termékek elválasztása agaróz gélen történt, az ábra a hőmérséklettől való függést szemlélteti. Winkler és Weiss (2009, 1. táblázat) alapján a GATA motívum ismétlődik 29 alkalommal. A gélből kivágott fragmentet megszekvenálva igazoltuk, hogy a megfelelő régiót szaporítottuk fel:

6 A szekvenciákból az is kiderült, hogy U1 és U2 egyedek feltehetően eltérő allélt hordoznak.

Nádiposzáta fajok őszi vonulásának kor- és ivarfüggő mintázatai. Témavezetők:

Nádiposzáta fajok őszi vonulásának kor- és ivarfüggő mintázatai. Témavezetők: Szent István Egyetem, Állatorvos-tudományi Kar Biomatematikai és Számítástechnikai Tanszék Biológiai Intézet Nádiposzáta fajok őszi vonulásának kor- és ivarfüggő mintázatai Készítette: Czikkelyné Ágh Nóra

Részletesebben

Mi történik a genetikai laboratóriumban?

Mi történik a genetikai laboratóriumban? 12 Mi történik a genetikai laboratóriumban? A brossúra elkészítéséhez segítséget nyújtottak: Dr Ian M Frayling, Orvosi Genetikai Intézet (Institute of Medical Genetics), Walesi Egyetemi Klinika (University

Részletesebben

Fekete Jenő*, Ritz Ferenc**

Fekete Jenő*, Ritz Ferenc** Olajmeghatározási módszerek 2. Rész Mintaelőkészítés és mérési módszerek összehasonlító értékelése Olajszennyezések okozta hosszútávú mérgező képesség (toxicitás) Fekete Jenő*, Ritz Ferenc** Bevezetés

Részletesebben

Mágneses magrezonancia-spektroszkópia

Mágneses magrezonancia-spektroszkópia 1 Mágneses magrezonancia-spektroszkópia Egy- és kétdimenziós módszerek a kémiai szerkezetkutatásban Metodikai útmutató Szalontai Gábor Veszprémi Egyetem NMR Laboratórium Verziószám: 2.0 2003. március 2

Részletesebben

4.1. A szakcikkek felépítése... 4

4.1. A szakcikkek felépítése... 4 Kutatási eredmények publikálásának módszertana 1. Előszó a fejezethez... 2 2. Első lépés... 2 3. A kutatástól tudományos közlésig... 3 4. Tudományos szakcikk... 4 4.1. A szakcikkek felépítése... 4 5. Egyéb

Részletesebben

A nemteljesítési valószínűség és az optimális PTI-szint modellezése egy háztartási kérdőíves felmérés felhasználásával

A nemteljesítési valószínűség és az optimális PTI-szint modellezése egy háztartási kérdőíves felmérés felhasználásával Balás Tamás, Banai Ádám, Hosszú Zsuzsanna A nemteljesítési valószínűség és az optimális PTI-szint modellezése egy háztartási kérdőíves felmérés felhasználásával MNB-tanulmányok 117. 2015 Balás Tamás,

Részletesebben

QUANTA Lite Jo-1 708585 In Vitro diagnosztikai alkalmazásra CLIA Bonyolultság: magas

QUANTA Lite Jo-1 708585 In Vitro diagnosztikai alkalmazásra CLIA Bonyolultság: magas QUANTA Lite Jo-1 708585 In Vitro diagnosztikai alkalmazásra CLIA Bonyolultság: magas Javasolt alkalmazás QUANTA Lite Jo-1 egy enzimmel kapcsolt immunoszorbens assay (ELISA) a Jo-1 antitestek szemikvantitatív

Részletesebben

RADIOKÉMIAI MÉRÉS. Laboratóriumi neutronforrásban aktivált-anyagok felezési idejének mérése. = felezési idő. ahol: A = a minta aktivitása.

RADIOKÉMIAI MÉRÉS. Laboratóriumi neutronforrásban aktivált-anyagok felezési idejének mérése. = felezési idő. ahol: A = a minta aktivitása. RADIOKÉMIAI MÉRÉS Laboratóriumi neutronforrásban aktivált-anyagok felezési idejének mérése A radioaktív bomlás valószínűségét kifejező bomlási állandó (λ) helyett gyakran a felezési időt alkalmazzuk (t

Részletesebben

1. fejezet HUMÁN EGÉSZSÉGKOCKÁZAT BECSLÉSE

1. fejezet HUMÁN EGÉSZSÉGKOCKÁZAT BECSLÉSE 1. fejezet HUMÁN EGÉSZSÉGKOCKÁZAT BECSLÉSE 19 20 Tartalomjegyzék 1. Általános bevezetõ...25 1.1. Elõzmények...25 1.2. Általános alapelvek...27 2. Expozícióbecslés...29 2.1. Bevezetõ...29 2.1.1. A mért

Részletesebben

Medgyesi Márton Róbert Péter: A munkával való elégedettség nemzetközi összehasonlításban

Medgyesi Márton Róbert Péter: A munkával való elégedettség nemzetközi összehasonlításban Medgyesi Márton Róbert Péter: A munkával való elégedettség nemzetközi összehasonlításban (elektronikus verzió, készült 2006-ban) A tanulmány eredetileg nyomtatásban megjelent: Medgyesi Márton Róbert Péter

Részletesebben

A Ki-67 Proliferációs Index Meghatározásának Különböző Vonatkozásai Emlőrákban

A Ki-67 Proliferációs Index Meghatározásának Különböző Vonatkozásai Emlőrákban A Ki-67 Proliferációs Index Meghatározásának Különböző Vonatkozásai Emlőrákban Ph.D. Tézis Témavezető: Prof. Dr. Cserni Gábor D.Sc. Szegedi Tudományegyetem Pathologiai Intézet Szeged 2014 0 AZ ÉRTEKEZÉS

Részletesebben

Logisztikai információs rendszerek felépítés és fejlődési tendenciái. Gelei Andrea Kétszeri Dávid

Logisztikai információs rendszerek felépítés és fejlődési tendenciái. Gelei Andrea Kétszeri Dávid Műhelytanulmányok Vállalatgazdaságtan Intézet 1053 Budapest, Veres Pálné u. 36., 1828 Budapest, Pf. 489 (+36 1) 482-5901, fax: 482-5844, www.uni-corvinus.hu/vallgazd Vállalatgazdaságtan Intézet Logisztikai

Részletesebben

Szent István Egyetem Gödöllő. Arbuszkuláris mikorrhiza gombák diverzitás-vizsgálata tartamkísérletekben. Doktori (Ph.D.) értekezés.

Szent István Egyetem Gödöllő. Arbuszkuláris mikorrhiza gombák diverzitás-vizsgálata tartamkísérletekben. Doktori (Ph.D.) értekezés. Szent István Egyetem Gödöllő Arbuszkuláris mikorrhiza gombák diverzitás-vizsgálata tartamkísérletekben Doktori (Ph.D.) értekezés Sasvári Zita Gödöllő 2012. A doktori iskola neve: Biológia Tudományi Doktori

Részletesebben

Országos kompetenciamérés 2013. Országos jelentés

Országos kompetenciamérés 2013. Országos jelentés Országos kompetenciamérés 2013 Országos jelentés Szerzők Balázsi Ildikó, Lak Ágnes Rozina, Szabó Vilmos, Szabó Lívia Dóra, Vadász Csaba Tördelő Szabó Ágnes Balázsi Ildikó, Lak Ágnes Rozina, Szabó Vilmos,

Részletesebben

Halász Gábor A pedagógiai rendszerek általános hatás- és beválás vizsgálati rendszere

Halász Gábor A pedagógiai rendszerek általános hatás- és beválás vizsgálati rendszere 1 Halász Gábor A pedagógiai rendszerek általános hatás- és beválás vizsgálati rendszere TARTALOM Bevezetés 1 A hatás és beválás értelmezése 3 Hatás 3 Beválás 4 A hatásvizsgálat és beválás-vizsgálat 5 A

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

egymásba ágyazottsága védett területeken

egymásba ágyazottsága védett területeken Ornis 2002-bak_uj.qxd 2005-01-27 9:40 Page 17 Ornis Hungarica 10: 17-26. 2000 Fajszám-terület összefüggés és közösségek egymásba ágyazottsága védett területeken Bánszegi Zita, Báldi András és Bankovics

Részletesebben

Számítógépek az iskolában

Számítógépek az iskolában Tót Éva Számítógépek az iskolában No. 229 RESEARCH PAPERS HUNGARIAN INSTITUTE FOR EDUCATIONAL RESEARCH Tót Éva Számítógépek az iskolában OKTATÁSKUTATÓ INTÉZET BUDAPEST, 2001. KUTATÁS KÖZBEN 229 (219 228-ig

Részletesebben

(Nem jogalkotási aktusok) RENDELETEK

(Nem jogalkotási aktusok) RENDELETEK 2011.1.15. HU Az Európai Unió Hivatalos Lapja L 12/1 II (Nem jogalkotási aktusok) RENDELETEK A BIZOTTSÁG 10/2011/EK RENDELETE (2011. január 14.) az élelmiszerekkel rendeltetésszerűen érintkezésbe kerülő

Részletesebben

A nagy géndeletiók kimutatásának módszerei és alkalmazásuk egyes örökletes betegségekben

A nagy géndeletiók kimutatásának módszerei és alkalmazásuk egyes örökletes betegségekben A nagy géndeletiók kimutatásának módszerei és alkalmazásuk egyes örökletes betegségekben GERGICS PÉTER DR. 1 TŐKE JUDIT DR. 1 SZILÁGYI ÁGNES 2 SZAPPANOS ÁGNES DR. 1 KENDER ZOLTÁN DR. 1 BARTA GYÖRGY DR.

Részletesebben

Sörkészítés technológiájának kidolgozása kölesből

Sörkészítés technológiájának kidolgozása kölesből Sörkészítés technológiájának kidolgozása kölesből 1. Bevezetés A gabonafélék és származékaik ősidőktől fogva jelentős részét képzik az emberiség táplálékforrásának. A coeliákiás betegség már az ókorban

Részletesebben

A Maculinea boglárkalepkék Kárpát-medencéből ismert hangyagazdái, parazitoidjai és a hangyagazdák egyéb szociálparazitái

A Maculinea boglárkalepkék Kárpát-medencéből ismert hangyagazdái, parazitoidjai és a hangyagazdák egyéb szociálparazitái Természetvédelmi Közlemények 15, pp. 23-34, 2009 A Maculinea boglárkalepkék Kárpát-medencéből ismert hangyagazdái, parazitoidjai és a hangyagazdák egyéb szociálparazitái Debreceni Egyetem, Evolúciós Állattani

Részletesebben

A Kreditrendszer Megvalósítása a Magyar Felsőoktatási intézményekben

A Kreditrendszer Megvalósítása a Magyar Felsőoktatási intézményekben A felsœoktatási intézmények regisztrácós eljárásainak a Kreditrendszer bevezetése céljából történœ auditálása 1 A Kreditrendszer Megvalósítása a Magyar Felsőoktatási intézményekben Dr. C. J. Koster & Dr.

Részletesebben

2. Kvalitatív kutatás a Kritikus Incidensek Módszerével

2. Kvalitatív kutatás a Kritikus Incidensek Módszerével Zárójelentés az OTKA 49267 számú kutatásához A panaszhelyzetek hatékony menedzselése a fogyasztói szolgáltatásoknál 1. A kutatási folyamat bemutatása Kutatásunk a szakirodalom mélyreható tanulmányozásával

Részletesebben

NMR vizsgálatok szilárd fázisban A CP/MAS kísérlet és alkalmazásai

NMR vizsgálatok szilárd fázisban A CP/MAS kísérlet és alkalmazásai NMR vizsgálatok szilárd fázisban A CP/MAS kísérlet és alkalmazásai Szalontai Gábor Veszprémi Egyetem Szilikát- és Anyagmérnöki Tanszék NMR Laboratórium Verziószám: 1.2 CD, 2002. január NMR vizsgálatok

Részletesebben

Egészségügyi genetikai tesztek

Egészségügyi genetikai tesztek Egészségügyi genetikai tesztek MILYEN ESETBEN INDOKOLT GENETIKAI TESZTET VÉGEZNI? SZAKSZERŰ GENETIKAI TANÁCSADÁS MIRE KERES VÁLASZT A GENETIKAI TESZT? AZ ÖN DÖNTÉSE Egészségügyi genetikai tesztek Mindannyian

Részletesebben

ESTA szabvány A vetőmagcsávázás európai minőségbiztosítása Vetőmagcsávázásra és csávázott vetőmagra vonatkozó minőségbiztosítási rendszer

ESTA szabvány A vetőmagcsávázás európai minőségbiztosítása Vetőmagcsávázásra és csávázott vetőmagra vonatkozó minőségbiztosítási rendszer Cím ESTA szabvány Változat 1.2 ESA _12.0271 Dátum 2012. május 4. Szerző R Scheffer ESTA szabvány A vetőmagcsávázás európai minőségbiztosítása Vetőmagcsávázásra és csávázott vetőmagra vonatkozó minőségbiztosítási

Részletesebben

Az innovációs és ipari parkok szerepe az innováció erősítésében

Az innovációs és ipari parkok szerepe az innováció erősítésében Ipargazdasági Kutató és Tanácsadó Kft. 1117 Budapest, Dombóvári út 17-19. Tel.: (36 1) 204-2951 (36 1) 204-2970 Fax: (36 1) 204-2953 E-mail:ipargazd@t-online.h Internet:http://www.ikt.hu Az innovációs

Részletesebben

EGÉSZSÉGTELEN FŐISKOLAI ÉVEK? ÉLELMISZERVÁSÁRLÁSI ÉS FOGYASZTÁSI SZOKÁSOK

EGÉSZSÉGTELEN FŐISKOLAI ÉVEK? ÉLELMISZERVÁSÁRLÁSI ÉS FOGYASZTÁSI SZOKÁSOK EGÉSZSÉGTELEN FŐISKOLAI ÉVEK? ÉLELMISZERVÁSÁRLÁSI ÉS FOGYASZTÁSI SZOKÁSOK Árpád Ferenc PAPP-VÁRY 1 Zoltán SCHWANG 2 ABSTRACT The Marketing Institute of the Budapest College of Communication, Business and

Részletesebben

Hírfogyasztás, pluralizmus, demokratikus részvétel A sokszínű tájékozódás esélyei

Hírfogyasztás, pluralizmus, demokratikus részvétel A sokszínű tájékozódás esélyei Hírfogyasztás, pluralizmus, demokratikus részvétel A sokszínű tájékozódás esélyei Arra a kérdésre, hogy mennyire szabad és sokszínű a média, nem csak abból az irányból érdemes választ adni, hogy milyen

Részletesebben