A genomiális medicina szép új világa

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "A genomiális medicina szép új világa"

Átírás

1 A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet

2 A medicina legfőbb kihívásai Nagy népbetegségek elhízás/ cukorbetegség/metabolikus szindroma szív és érrendszeri betegségek veseelégtelenség malignus betegségek neurológiai psychiátriai betegségek fertőzéses, gyulladási szindrómák allergia, asthma, légzőrendszeri kórképek Gyógyszerhatás, kóros mellékhatás Átlagéletkor emelkedéséből adódó feladatok Immunizálás (védőoltás: fertőzés, tumor, allergia ) Őssejt terápia, szintetikus biológia Orvosi kommunikáció, egészségnevelés 4/27/2015 Komplex betegségek systems biology, bioinformatika

3 a modell..a humán genom Nature 171, április február az enciklopédia millió genom 4/27/ szeptember

4 Genom (a teljes örökítő anyag) és a genom szintű megközelítés Genetikai állományunk 26 ezer gén, (2x) 23 kromoszóma, 3.2 milliárd nukleotid betű 20 millió mutáció (SNP) 2m DNS/sejt 7.6 fénynap

5 FEHÉRJE FIZIKAI TECHNIKÁK Biofizika, nanofizika METODIKAI REPERTOIRE GCAATCGATCTGGTACAGTAGCTA GCAATTGATCGGGTACATTAGCTA Hap-Map/ 20 millió pontmutáció TELJES GENOM VIZSGÁLAT Adatbázisok Egy sejt analitika (subnano) EXPRESSZIÓS MICROARRAY/CHIP NANOTECHNOLÓGIA, Szilárd Fázisú KÉMIA DNS NYELVÉSZETI ELJÁRÁSOK ÚJ GENERÁCIÓS SZEKVENÁLÁSOK CRISP/Cas9 rendszer BIOINFORMATIKA GÉNHÁLÓZATOK- ÚTVONAL ANALÍZIS

6 Gyorsuló genetikai/genomikai adathalmaz A DNS adatok megkétszereződnek 18 havonta Ennek költségei a feleződnek 18 havonta

7 genome (2014) 5 million genome (2017)

8 Genome wide associations studies December, studies, p<5x markers 1000 genom project NHGRI GWA Catalog 8

9 Rheumatoid arthritis genetikai háttér -log10 trend test P PADI 4 HLA DRB1 PTP N22 IL2RA TNF IP2 IL2RB Nature 447, (7 June 2007) doi: /nature05911

10 A (emberi) genom misztériuma Fejérjekódolás Az emberi genom 99%-a szemét? Mobilis, ugráló elemek? ismétlődő szakaszok

11 DE!!!! nem lehet mindent az egyes génekből megérteni!!! hálózati hatások-káosz-elméletek környezeti hatások (epigenetika)-reverzibilitás metagenomika- genomok együttélése (microbiom)

12 Szemlélet váltás amikor öröklésről beszélünk szinte sose egy génre kell gondolnunk, hanem gének sokaságának hálózatára, együttműködésére (ennek zavara a betegség)

13 HÁLÓZAT T1DM Ismert gének alapján 68 újat azonosítottak Top 5: ESR1 VIL2 Smad2 RELA DAXX

14 EPIGENETIKA inaktív heterokromatin eukromatin aktív

15 4/27/2015 Epigenetikai faktorok (hatásukra módosul az öröklött tulajdonságok érvényesülése) ontogenesis-anyai hatás táplálkozás gyógyszerek, mérgek fizikai aktivitás microbiota- együttélő mikróbák ÉLETMÓD! fény zene stress, magatartási-, lelki-, meditatív hatások szociális környezet

16 Epigenetikai szabályozás a génexpresszióra hat, nem érinti az örökölt nukleotid szekvenciát, reverzibilis kovalens öröklődik

17 Az epigenetikai szabályozás DNS metiláció molekuláris alapjai 1. Citozin metiláció/demetiláció

18 A metabolikus memória: reverzibilis epigenetikai mechanizmus Sundararajan Jayaraman Circulation Research. 2012;110: Copyright American Heart Association, Inc. All rights reserved.

19 Az epigenetikai szabályozás molekuláris alapjai 2. Hiszton modifikáció acetiláció, foszforiláció, metiláció

20 Hiszton modifikációk= hiszton-kód

21

22 Hiszton acetlációs változások (is) felelősek a T sejt fenotípusok kialakításáért

23 Permisszív hiszton módosulások T sejteken Nat Rev Immunol. 9: Cell Research (2010) 20:4 12.

24 Az epigenetikai szabályozás molekuláris alapjai 3. Nem kódoló RNS (pl. mikro RNS, mirtron)

25 A Toll receptorokon át érkező PAMP/DAMP jelek mirns szabályozása

26 mir 155 fokozza az aktivált T sejtek proliferációját atopias dermatitisben Staphylococcal superantigen Allergen CTLA 4 mir 155 Cell proliferation Atopic dermatitis Sonkoly et al., J All Clin Immunol, 2010 Pivarcsi Andor ábrája

27 Zhang et al., Nature, Oct. 7, 2014 antivirális penicillin? Japán loncból (Lonicera japonica) készült főzetben atípusos mikrorns gátolja az influenza vírus több törzsének (H1N1, H5N1, H7N9) szaporodását 4/27/2015

28 Az epigenetikai szabályozás molekuláris alapjai 4. Telomera/telomeráz TTGGGG Replication Replication Replication sejthalál

29 Telomera/telomeráz

30

31 Az észlelt stressz hatása a telomer rövidülésre Krónikus beteg gyermekeket gondozó édesanyjainak lymphocytáiban Magasabb észlelt stressz esetén vér mononukleáris sejtekben szignifikánsan alacsonyabb telomeráz aktivitás és szignifikáns telomér rövidülés (9-17 évvel idősebb celluláris öregedés) Felgyorsult telomer rövidülés Alzheimer-betegeket gondozó személyeken

32 mikrpbiom bac species in/on humans bacs have approx genes metagenome : 350x core human genome Qin et al, Nature March 2010

33 A genomika/epigenomika haszna Biotechnológia Diagnosztika Terápia. személyreszabott orvoslás 4P: Predictive, Preventive, Personalized, Participatory

34 Kommunikáció és együttműködés orvos és páciens között Személyre szabott orvoslás! Személyre szabott (in silico tervezett) védőoltások Gyógyszer dózis- és mellékhatás (rassz- és egyéni) predikció

35

36 4/27/2015

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához?

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Falus András Genetikai, Sejt- és Immunbiológiai Intézet Semmelweis Egyetem Antal Péter Hadadi Éva

Részletesebben

2012.11.19. Epigenetikaikutatások pszichiátriai vonatkozásai 1850. A modern biológia fejlődése. 2001. február 15-16. Falus András. populációk (Darwin)

2012.11.19. Epigenetikaikutatások pszichiátriai vonatkozásai 1850. A modern biológia fejlődése. 2001. február 15-16. Falus András. populációk (Darwin) Epigenetikaikutatások pszichiátriai vonatkozásai 1850 populációk (Darwin) A modern biológia fejlődése Egyedek (Mendel) 1900 sejtek tervezett élőlények (szintetikus biológia) 2050 2020 1950 kromoszómák

Részletesebben

Humán genom variációk single nucleotide polymorphism (SNP)

Humán genom variációk single nucleotide polymorphism (SNP) Humán genom variációk single nucleotide polymorphism (SNP) A genom ~ 97 %-a két különböző egyedben teljesen azonos ~ 1% különbség: SNP miatt ~2% különbség: kópiaszámbeli eltérés, deléciók miatt 11-12 millió

Részletesebben

Epigenetikai Szabályozás

Epigenetikai Szabályozás Epigenetikai Szabályozás Kromatin alapegysége a nukleoszóma 1. DNS Linker DNS Nukleoszóma mag H1 DNS 10 nm 30 nm Nukleoszóma gyöngy (4x2 hiszton molekula + 146 nukleotid pár) 10 nm-es szál 30 nm-es szál

Részletesebben

Epigenetika kihívások az ökotoxikológiában

Epigenetika kihívások az ökotoxikológiában Epigenetika kihívások az ökotoxikológiában Bakonyi Gábor és Szabó Borbála Szent István Egyetem, Gödöllő Állattani és Állatökológiai Tanszék V. ÖKOTOXIKOLÓGIAI KONFERENCIA, MAGYAR ÖKOTOXIKOLÓGIAI TÁRSASÁG,

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45

Részletesebben

A preventív vakcináció lényege :

A preventív vakcináció lényege : Vakcináció Célja: antigénspecifkus immunválasz kiváltása a szervezetben A vakcina egy olyan készítmény, amely fokozza az immunitást egy adott betegséggel szemben (aktiválja az immunrendszert). A preventív

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia Fehérje expressziós rendszerek Gyógyszerészi Biotechnológia Expressziós rendszerek Cél: rekombináns fehérjék előállítása nagy tisztaságban és nagy mennyiségben kísérleti ill. gyakorlati (therapia) felhasználásokra

Részletesebben

Új utak az antipszichotikus gyógyszerek fejlesztésében

Új utak az antipszichotikus gyógyszerek fejlesztésében Új utak az antipszichotikus gyógyszerek fejlesztésében SCHIZO-08 projekt Dr. Zahuczky Gábor, PhD, ügyvezető igazgató UD-GenoMed Kft. Debrecen, 2010. november 22. A múlt orvostudománya Mindenkinek ugyanaz

Részletesebben

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)

Részletesebben

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26 Hamar Péter RNS világ Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. 1 26 Főszereplők: DNS -> RNS -> fehérje A kód lefordítása Dezoxy-ribo-Nuklein-Sav: DNS az élet kódja megkettőződés (replikáció)

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Az immunrendszer alapjai, sejtöregedés, tumorképződés. Biológiai alapismeretek

Az immunrendszer alapjai, sejtöregedés, tumorképződés. Biológiai alapismeretek Az immunrendszer alapjai, sejtöregedés, tumorképződés Biológiai alapismeretek Az immunrendszer Immunis (latin szó): jelentése mentes valamitől Feladata: a szervezetbe került idegen anyagok: 1. megtalálása

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what?

Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what? 2000 június 26 Új út kezdete, vagy egy út vége? Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what? 2000 június

Részletesebben

Daganatok kialakulásában szerepet játszó molekuláris folyamatok

Daganatok kialakulásában szerepet játszó molekuláris folyamatok Daganatok kialakulásában szerepet játszó molekuláris folyamatok Genetikai változások Onkogének Tumorszuppresszor gének DNS hibajavító gének Telomer és telomeráz Epigenetikai változások DNS-metiláció Mikro-RNS

Részletesebben

ADATBÁNYÁSZAT I. ÉS OMICS

ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT

Részletesebben

I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

A fő egészségügyi kihívások

A fő egészségügyi kihívások A fő egészségügyi kihívások Öregedés Mentális betegségek Fertőző betegségek Elhízás, diabetes Allergia, asztma Szív- és érbetegségek Autoimmun kórképek Rák Komplex betegségek Rendszerbiológia Bioinformatika,

Részletesebben

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet erhesség és emlőrák genetikai szempontok Kosztolányi yörgy PE Orvosi enetikai Intézet Előfordulás 1 emlőrák / 3000 várandós fokozódása várható: öröklődő emlőrák diagnózisa családon belül : I. generáció

Részletesebben

Allergia immunológiája 2012.

Allergia immunológiája 2012. Allergia immunológiája 2012. AZ IMMUNVÁLASZ SZEREPLŐI BIOLÓGIAI MEGKÖZELÍTÉS Az immunrendszer A fő ellenfelek /ellenségek/ Limfociták, makrofágok antitestek, stb külső és belső élősködők (fertőzés, daganat)

Részletesebben

TÁMOP-4.1.2-08/1/A-2009-0011 Tantárgy címe: Transzdifferenciáció és regeneratív medicina Dr. Balogh Péter és Dr. Engelmann Péter

TÁMOP-4.1.2-08/1/A-2009-0011 Tantárgy címe: Transzdifferenciáció és regeneratív medicina Dr. Balogh Péter és Dr. Engelmann Péter Előadás Előadás címe Dia Dia címe száma 1. Őssejtek és transzdifferenciáció: bevezetés, alapok 2. Őssejt-típusok, fenntartásuk és homeosztázisuk 3. Regeneráció állatmodellekben 2. Alapfogalmak 3. Őssejt-kutatás

Részletesebben

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend)

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) Országos Egészségbiztosítási Pénztár Elemzési, Orvosszakértői és Szakmai Ellenőrzési Főosztály Budapest, 2013. június 26.

Részletesebben

I./1. fejezet: Jelátviteli utak szerepe a daganatok kialakulásában A daganatkeletkezés molekuláris háttere

I./1. fejezet: Jelátviteli utak szerepe a daganatok kialakulásában A daganatkeletkezés molekuláris háttere I./1. fejezet: Jelátviteli utak szerepe a daganatok kialakulásában A daganatkeletkezés molekuláris háttere Kopper László A fejezet célja, hogy megismerje a hallgató a daganatok kialakulásában szerepet

Részletesebben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben esirna mirtron BEVEZETÉS TÉMAKÖRÖK Ősi RNS világ RNS-ek tradicionális szerepben bevezetés BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek

Részletesebben

Az emberi erőforrás értéke

Az emberi erőforrás értéke Szabó László SZABÓ LÁSZLÓ Az emberi erőforrás értéke A génvizsgálat, mint egészségügyi prevenció Az emberi tényező fontos elem a stratégiai kezdeményezésekben, a versenyelőny megszerzésében és megtartásában.

Részletesebben

Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig

Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig ELTE TTK Biológiai Intézet Budapest, 2015. okt. 7. Dr. Mócsai Attila Semmelweis Egyetem ÁOK Élettani Intézet

Részletesebben

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Magyarósi Szilvia Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem DEMIN 2014. május 22.

Részletesebben

Veleszületett rendellenességek etiológiai csoportjai

Veleszületett rendellenességek etiológiai csoportjai MULTIFAKTORIÁLIS ÖRÖKLŐDÉS PRIMER IZOLÁLT RENDELLENESSÉGEK: MALFORMÁCIÓK ÉS GYAKORI FELNŐTTKORI KOMPLEX BETEGSÉGEK Veleszületett rendellenességek etiológiai csoportjai Kromoszóma rendellenességek és kisméretű

Részletesebben

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök:

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök: Otthonápolás Cégegészség Fogorvos Homeopátia Online gyógyszertár RSS Iratkozzon fel RSS-csatornáinkra! KÖNYVAJÁNLÓ Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008.

Részletesebben

Lujber László és a szerző engedélyé

Lujber László és a szerző engedélyé Allergia genetikai háttere Dr. Szalai Csaba 2012. Szeptember 24. 1 Allergia: multifaktoriális vagy komplex betegség: Genetikai háttér (több száz gén, több ezer genetikai variáció) + környezeti tényezők

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté!

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté! Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában Kiss Máté! Magreceptor Kutató Laboratórium Biokémiai és Molekuláris Biológiai Intézet Debreceni Egyetem, Általános Orvostudományi

Részletesebben

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem Tisztelt Hölgyem, Tisztelt Uram! Örömmel jelentjük be Önöknek, hogy a Genomikai Medicina és Ritka Betegségek Intézetének egyik új projektje azon betegségek genetikai hátterének feltérképezésére irányul,

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data.

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data. Budapesti Műszaki és Gazdaságtudományi Egyetem Méréstechnika és Információs rendszerek Tanszék Adatelemzés intelligens módszerekkel Hullám Gábor Adatelemzés hagyományos megközelítésben I. Megválaszolandó

Részletesebben

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan 11. évfolyam BIOLÓGIA 1. Az emberi test szabályozása Idegi szabályozás Hormonális szabályozás 2. Az érzékelés Szaglás, tapintás, látás, íz érzéklés, 3. Általános egészségügyi ismeretek az egyes témákhoz

Részletesebben

avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest

avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest Iparilag alkalmazható szekvenciák, avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest Neutrokin α - jelentős kereskedelmi érdekek

Részletesebben

HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS

HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS Dr. Mohamed Mahdi MD. MPH. Department of Infectology and Pediatric Immunology University of Debrecen (MHSC) 2012 Diagnózis HIV antitest teszt: A HIV ellen termel

Részletesebben

Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter

Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter Ikerregiszterek és egy ikervizsgálat gyakorlati megszervezése Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter 1 Ikerregiszterek Önkéntes

Részletesebben

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Szalma Katalin Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Témavezető: Dr. Turai István, OSSKI Budapest, 2010. október 4. Az ionizáló sugárzás sejt kölcsönhatása Antone

Részletesebben

A laboratóriumi medicina fejlődése az elmúlt 35 évben

A laboratóriumi medicina fejlődése az elmúlt 35 évben A laboratóriumi medicina fejlődése az elmúlt 35 évben Kovács L. Gábor egyetemi tanár, az MTA rendes tagja Pécsi Tudományegyetem 1976 2011? INTÉZETIGAZGATÓ PROFESSZOROK KLINIKAI KÉMIA 1976 Mérleg Spektrofotométer

Részletesebben

A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora

A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora PÉCSI TUDOMÁNYEGYETEM 1. A gyógyszerészi gondozás kialakulásának történeti bemutatása, hátterében álló nemzetközi

Részletesebben

Az agy betegségeinek molekuláris biológiája. 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5.

Az agy betegségeinek molekuláris biológiája. 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5. Az agy betegségeinek molekuláris biológiája 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5. Alzheimer kór 28 Prion betegség A prion betegség fertőző formáját nem egy genetikai

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

Immunológia I. 2. előadás. Kacskovics Imre (imre.kacskovics@ttk.elte.hu)

Immunológia I. 2. előadás. Kacskovics Imre (imre.kacskovics@ttk.elte.hu) Immunológia I. 2. előadás Kacskovics Imre (imre.kacskovics@ttk.elte.hu) Az immunválasz kialakulása A veleszületett és az adaptív immunválasz összefonódása A veleszületett immunválasz mechanizmusai A veleszületett

Részletesebben

17.2. ábra Az immunválasz kialakulása és lezajlása patogén hatására

17.2. ábra Az immunválasz kialakulása és lezajlása patogén hatására 11. 2016. nov 30. 17.2. ábra Az immunválasz kialakulása és lezajlása patogén hatására 17.3. ábra A sejtközötti térben és a sejten belül élő és szaporodó kórokozók ellen kialakuló védekezési mechanizmusok

Részletesebben

Sejtfeldolgozás Felhasználás

Sejtfeldolgozás Felhasználás Sejtterápia Sejtfeldolgozás Felhasználás Fagyasztva tárolás Sejtmosás Alap sejtszelekció Komplex sejtszelekció Ex vivo sejtszaporítás Sejtaktiválás Immunizálás Génmodifikálás Köldökzsinórvér bank Limfocita

Részletesebben

Receptorok és szignalizációs mechanizmusok

Receptorok és szignalizációs mechanizmusok Molekuláris sejtbiológia: Receptorok és szignalizációs mechanizmusok Dr. habil Kőhidai László Semmelweis Egyetem Genetikai, Sejt- és Immunbiológiai Intézet Sejtek szignalizációs kapcsolatai Sejtek szignalizációs

Részletesebben

A minimális sejt. Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására

A minimális sejt. Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására A minimális sejt Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására Anyagcsere Gánti kemoton elmélete Minimum sejt Top down: Meglevő szervezetek genomjából indulunk ki Bottom

Részletesebben

Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során

Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során Ungvári Erika, Tóth Ákos Magyar Infektológiai és Klinikai Mikrobiológiai

Részletesebben

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk.

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A genetikai betegségek mellett, génterápia alkalmazható szerzett betegségek, mint

Részletesebben

A Telomerase-specific Doxorubicin-releasing Molecular Beacon for Cancer Theranostics

A Telomerase-specific Doxorubicin-releasing Molecular Beacon for Cancer Theranostics A Telomerase-specific Doxorubicin-releasing Molecular Beacon for Cancer Theranostics Yi Ma, Zhaohui Wang, Min Zhang, Zhihao Han, Dan Chen, Qiuyun Zhu, Weidong Gao, Zhiyu Qian, and Yueqing Gu Angew. Chem.

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

FEHÉRJE VAKCINÁK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA III.

FEHÉRJE VAKCINÁK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA III. Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére FEHÉRJE VAKCINÁK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA III.

Részletesebben

XVIII. ORSZÁGOS JÁRÓBETEG SZAKELLÁTÁSI KONFERENCIA

XVIII. ORSZÁGOS JÁRÓBETEG SZAKELLÁTÁSI KONFERENCIA XVIII. ORSZÁGOS JÁRÓBETEG SZAKELLÁTÁSI KONFERENCIA 2016. 09.16. EGÉSZSÉGFEJLESZTÉS INTEGRÁLÁSA SZAKELLÁTÁSBA SZERZŐK: DR RABÓCZKI ANITA FŐIGAZGATÓ DR SUSKÓ MIHÁLY NŐGYÓGYÁSZ FŐORVOS SZAKÁCS IBOLYA EFI

Részletesebben

ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma, 1979-1983

ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma, 1979-1983 ÖNÉLETRAJZ Személyes adatok Név: Születési hely: Széll Márta Szeged Születési idő: 1965. március 28. Családi állapota: férjezett (Dr. Balogh Nándor) Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997)

Részletesebben

Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata

Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata Dr. Nemes Karolina, Márk Ágnes, Dr. Hajdu Melinda, Csorba Gézáné, Dr. Kopper László, Dr. Csóka Monika, Dr.

Részletesebben

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter Magyar Orvostudományi Napok 2013. november 6 8 Hotel Novotel Budapest (Alkotás utca 63 67) Rendező: Magyar Orvostársaságok és Egyesületek Szövetsége (MOTESZ) Programtervezet 2013. november 6. 10.00 Megnyitó

Részletesebben

Tudásmenedzsment és gyógyszerinnováció

Tudásmenedzsment és gyógyszerinnováció Tudásmenedzsment és gyógyszerinnováció Ipari szükségletek / elvárások Dr. Bátori Sándor Sanofi-aventis Innovatív Gyógyszerek Kutatása, MAGYOSZ, 2009.01.07. Alapvető együttm ttműködések Hosszútávú elhatározás:

Részletesebben

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G.

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G. 1955: 46 emberi kromoszóma van 1961: mrns 1975: DNS szekvenálás 1982: gén-bank adatbázisok 1983: R (polymerase chain reaction) Mérföldkövek 1 J. D. Watson F. H.. rick 2008 1953 2003 Watson genomja DNS

Részletesebben

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai Kar: TTK Tantárgy: CITOGENETIKA Kód: AOMBCGE3 ECTS Kredit: 3 A tantárgyat oktató intézet: TTK Mikrobiális Biotechnológiai és Sejtbiológiai Tanszék A tantárgy felvételére ajánlott félév: 3. Melyik félévben

Részletesebben

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5.

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. 0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. Az Élet keletkezése 6. Modellek a biológiában - csak az

Részletesebben

Allergiás reakciók molekuláris mechanizmusa

Allergiás reakciók molekuláris mechanizmusa Allergiás reakciók molekuláris mechanizmusa Erdei Anna Eötvös Loránd Tudományegyetem Immunológiai Tanszék Biológiai Intézet Immunológiai Tanszék MLDT továbbképzés 2015. április 22., Honvéd Kórház Bp. Az

Részletesebben

2. SZ. SZAKMAI ÖSSZEFOGLALÓ PIR 2

2. SZ. SZAKMAI ÖSSZEFOGLALÓ PIR 2 Az Országos Onkológiai Intézet Norvég Finanszírozási mechanizmus keretében elnyert Kutatás Fejlesztési Pályázata Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon

Részletesebben

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin A géntechnikák alkalmazási területei leltár Géntechnika 3 Dr. Gruiz Katalin Kutatás Genetikai: genomok feltérképezése: HUGO, mikroorganizmusoké, ujjlenyomatok készítése, jellegzetes szekvenciák keresése

Részletesebben

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik.

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. MUTÁCIÓK A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. Pontmutáció: A kromoszóma egy génjében pár nukleotidnál következik be változás.

Részletesebben

A nyelv genetikai háttere

A nyelv genetikai háttere A nyelv genetikai háttere Szalontai Ádám ELTE Elméleti Nyelvészeti Doktori Program MTA Nyelvtudományi Intézet 2014. április 29. 1 / 41 Az előadás menete Genetikai bevezető Gének és nyelv elmélet KE család

Részletesebben

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:

Részletesebben

A rákkutatás kihívásai, a rákkutatók megoldásai

A rákkutatás kihívásai, a rákkutatók megoldásai A rákkutatás kihívásai, a rákkutatók megoldásai Cserepes Mihály, Ph.D. hallgató - Semmelweis Egyetem - Országos Onkológiai Intézet - MTA-TTK Enzimológiai Intézet Forrás: http://www.lifetechnologies.com

Részletesebben

Kórház összes (24. HBCS) közvetlen költsége (100%)» 3 kritikus HB. » 2 kritikus. » 10 tovább. » Hátrányos he

Kórház összes (24. HBCS) közvetlen költsége (100%)» 3 kritikus HB. » 2 kritikus. » 10 tovább. » Hátrányos he Értékelemzett t arthritis protokoll beillesztése komplex terápiába Ábrahám Sándor CVS Life, PVM Dr. Áts Kt Katalin, Dr. Gál János Mobil: +3 36 30 971 9532 mikroorg.absa@chello.hu Homok kóra diagram Kórház

Részletesebben

Mozgás - Gyógyszer TÁMOP-4.2.2/08/1-2008-0006

Mozgás - Gyógyszer TÁMOP-4.2.2/08/1-2008-0006 TÁMOP-4.2.2/08/1-2008-0006 Mozgás - Gyógyszer Varga Csaba, Puskás László G, Balogh László, Kovács Gyula, Kiss Gábor, Seres Erika, Pósa Anikó, Magyariné Berkó Anikó, Molnár Andor, Szablics Péter, Orbán

Részletesebben

A proteomika új tudománya és alkalmazása a rákdiagnosztikában

A proteomika új tudománya és alkalmazása a rákdiagnosztikában BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK A proteomika új tudománya és alkalmazása a rákdiagnosztikában Tárgyszavak: proteom; proteomika; rák; diagnosztika; molekuláris gyógyászat; biomarker;

Részletesebben

BIOINFORMATIKA Ungvári Ildikó

BIOINFORMATIKA Ungvári Ildikó 1 BIOINFORMATIKA Ungvári Ildikó Az elmúlt évtizedekben a molekuláris biológiai, genomikai technológiák robbanásszerű fejlődése a biológiai adatok mennyiségének exponenciális növekedéséhez vezetett. Ebben

Részletesebben

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1.

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1. Biobankok a Semmelweis Egyetemen Szalai Csaba 2009. július 1. Molnár Mária Judit MD, PhD A Semmelweis Egyetem Molekuláris Neurológiai Klinikai és Kutatási Központ igazgatója SE Molekuláris Neurológiai

Részletesebben

1. ESET DIAGNÓZIS: LYMPHADENITIS MESENTERIALIS. 16 éves nő: görcsös hasi fájdalom, hányinger, hányás, vizes hasmenés, collaptiform rosszullét

1. ESET DIAGNÓZIS: LYMPHADENITIS MESENTERIALIS. 16 éves nő: görcsös hasi fájdalom, hányinger, hányás, vizes hasmenés, collaptiform rosszullét 1. ESET 16 éves nő: görcsös hasi fájdalom, hányinger, hányás, vizes hasmenés, collaptiform rosszullét Sebészeti osztály hasi UH: bélfal ödéma, ascites konzervatív kezelés DIAGNÓZIS: LYMPHADENITIS MESENTERIALIS

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE. Falus András. Összefoglalás

EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE. Falus András. Összefoglalás 1 EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE Falus András Összefoglalás Az epigenetika, az örökítőanyag softvere Kovalens módosulások Anyai hatás és az egyedfejlődés Mitokondriális öröklés Táplálkozás

Részletesebben

Szakmai zárójelentés

Szakmai zárójelentés Szakmai zárójelentés A témavezető neve: dr. Antus Balázs A téma címe: A bronchiolitis obliterans szindróma pathomechanizmusa OTKA nyilvántartási szám: F 046526 Kutatási időtartam: 2004-2008. A kutatási

Részletesebben

Bioinformatika 2 10.el

Bioinformatika 2 10.el 10.el őadás Prof. Poppe László BME Szerves Kémia és Technológia Tsz. Bioinformatika proteomika Előadás és gyakorlat 2009. 04. 24. Genomikavs. proteomika A genomika módszereivel nem a tényleges fehérjéket

Részletesebben

Sejtmag, magvacska magmembrán

Sejtmag, magvacska magmembrán Sejtmag, magvacska magmembrán Láng Orsolya Semmelweis Egyetem, Genetikai, Sejt- és Immunbiológiai Intézet Kompartmentalizáció Prokaryóta Cytoplazma Eukaryóta Endomembrán Kromatin Plazma membrán Eredménye

Részletesebben

A HLTF koordinált fehérje és DNS átrendezése és aktivitásának összehasonlítása a Bloom szindróma helikáz fehérjével

A HLTF koordinált fehérje és DNS átrendezése és aktivitásának összehasonlítása a Bloom szindróma helikáz fehérjével A HLTF koordinált fehérje és DNS átrendezése és aktivitásának összehasonlítása a Bloom szindróma helikáz fehérjével Ph.D disszertáció tézisei Yathish Jagadheesh Achar Témavezető: Dr. Haracska Lajos Magyar

Részletesebben

Összefoglalás első fejezete

Összefoglalás első fejezete Összefoglalás Az utóbbi években a transzkriptómikai vizsgálatokban alkalmazott technológiák fejlődésének köszönhetően a genom kutatás területén jelentős előrehaladás figyelhető meg. A disszertáció első

Részletesebben

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN Kötelezı szinten tartó tanfolyam PÉCS 2009. október 14-16. PROGRAMFÜZET Kedves Kollégák! Közel egy évvel ezelıtt, 2008 júniusában

Részletesebben

Mit tud a genetika. Génterápiás lehetőségek MPS-ben. Dr. Varga Norbert

Mit tud a genetika. Génterápiás lehetőségek MPS-ben. Dr. Varga Norbert Mit tud a genetika Génterápiás lehetőségek MPS-ben Dr. Varga Norbert Oki terápia Terápiás lehetőségek MPS-ben A kiváltó okot gyógyítja meg ERT Enzimpótló kezelés Őssejt transzplantáció Genetikai beavatkozások

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Új terápiás lehetőségek (receptorok) a kardiológiában

Új terápiás lehetőségek (receptorok) a kardiológiában Új terápiás lehetőségek (receptorok) a kardiológiában Édes István Kardiológiai Intézet, Debreceni Egyetem Kardiomiociták Ca 2+ anyagcseréje és új terápiás receptorok 2. 1. 3. 6. 6. 7. 4. 5. 8. 9. Ca

Részletesebben

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók

Részletesebben

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A NÖVÉNYGENETIKA Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 A citológia és a genetika társtudománya Citogenetika A kromoszómák eredetét, szerkezetét, genetikai funkcióját,

Részletesebben

2.1. Multifaktoriális betegségek általános jellemzői

2.1. Multifaktoriális betegségek általános jellemzői 2. Multifaktoriális betegségek általános jellemzői... 1 2.1. Multifaktoriális betegségek általános jellemzői... 1 2.2. Környezeti tényezők... 2 2.3. Miért fontos kutatni a multifaktoriális betegségek genomikai

Részletesebben

Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL

Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL KÖZÖS STRATÉGIA KIFEJLESZTÉSE MOLEKULÁRIS MÓDSZEREK ALKALMAZÁSÁVAL

Részletesebben

Humán genom program. Raskó István, Magyar Tudomány 2002/5 589.o

Humán genom program. Raskó István, Magyar Tudomány 2002/5 589.o Nyitás az életre Humán genom program A különböző rasszoknál léteznek kisebb eltérések melyek nem manifesztálódnak betegségben, de növelik azok kockázatát, illetve jelentkezhet étel- és gyógyszerallergia

Részletesebben