A genomiális medicina szép új világa

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "A genomiális medicina szép új világa"

Átírás

1 A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet

2 A medicina legfőbb kihívásai Nagy népbetegségek elhízás/ cukorbetegség/metabolikus szindroma szív és érrendszeri betegségek veseelégtelenség malignus betegségek neurológiai psychiátriai betegségek fertőzéses, gyulladási szindrómák allergia, asthma, légzőrendszeri kórképek Gyógyszerhatás, kóros mellékhatás Átlagéletkor emelkedéséből adódó feladatok Immunizálás (védőoltás: fertőzés, tumor, allergia ) Őssejt terápia, szintetikus biológia Orvosi kommunikáció, egészségnevelés 4/27/2015 Komplex betegségek systems biology, bioinformatika

3 a modell..a humán genom Nature 171, április február az enciklopédia millió genom 4/27/ szeptember

4 Genom (a teljes örökítő anyag) és a genom szintű megközelítés Genetikai állományunk 26 ezer gén, (2x) 23 kromoszóma, 3.2 milliárd nukleotid betű 20 millió mutáció (SNP) 2m DNS/sejt 7.6 fénynap

5 FEHÉRJE FIZIKAI TECHNIKÁK Biofizika, nanofizika METODIKAI REPERTOIRE GCAATCGATCTGGTACAGTAGCTA GCAATTGATCGGGTACATTAGCTA Hap-Map/ 20 millió pontmutáció TELJES GENOM VIZSGÁLAT Adatbázisok Egy sejt analitika (subnano) EXPRESSZIÓS MICROARRAY/CHIP NANOTECHNOLÓGIA, Szilárd Fázisú KÉMIA DNS NYELVÉSZETI ELJÁRÁSOK ÚJ GENERÁCIÓS SZEKVENÁLÁSOK CRISP/Cas9 rendszer BIOINFORMATIKA GÉNHÁLÓZATOK- ÚTVONAL ANALÍZIS

6 Gyorsuló genetikai/genomikai adathalmaz A DNS adatok megkétszereződnek 18 havonta Ennek költségei a feleződnek 18 havonta

7 genome (2014) 5 million genome (2017)

8 Genome wide associations studies December, studies, p<5x markers 1000 genom project NHGRI GWA Catalog 8

9 Rheumatoid arthritis genetikai háttér -log10 trend test P PADI 4 HLA DRB1 PTP N22 IL2RA TNF IP2 IL2RB Nature 447, (7 June 2007) doi: /nature05911

10 A (emberi) genom misztériuma Fejérjekódolás Az emberi genom 99%-a szemét? Mobilis, ugráló elemek? ismétlődő szakaszok

11 DE!!!! nem lehet mindent az egyes génekből megérteni!!! hálózati hatások-káosz-elméletek környezeti hatások (epigenetika)-reverzibilitás metagenomika- genomok együttélése (microbiom)

12 Szemlélet váltás amikor öröklésről beszélünk szinte sose egy génre kell gondolnunk, hanem gének sokaságának hálózatára, együttműködésére (ennek zavara a betegség)

13 HÁLÓZAT T1DM Ismert gének alapján 68 újat azonosítottak Top 5: ESR1 VIL2 Smad2 RELA DAXX

14 EPIGENETIKA inaktív heterokromatin eukromatin aktív

15 4/27/2015 Epigenetikai faktorok (hatásukra módosul az öröklött tulajdonságok érvényesülése) ontogenesis-anyai hatás táplálkozás gyógyszerek, mérgek fizikai aktivitás microbiota- együttélő mikróbák ÉLETMÓD! fény zene stress, magatartási-, lelki-, meditatív hatások szociális környezet

16 Epigenetikai szabályozás a génexpresszióra hat, nem érinti az örökölt nukleotid szekvenciát, reverzibilis kovalens öröklődik

17 Az epigenetikai szabályozás DNS metiláció molekuláris alapjai 1. Citozin metiláció/demetiláció

18 A metabolikus memória: reverzibilis epigenetikai mechanizmus Sundararajan Jayaraman Circulation Research. 2012;110: Copyright American Heart Association, Inc. All rights reserved.

19 Az epigenetikai szabályozás molekuláris alapjai 2. Hiszton modifikáció acetiláció, foszforiláció, metiláció

20 Hiszton modifikációk= hiszton-kód

21

22 Hiszton acetlációs változások (is) felelősek a T sejt fenotípusok kialakításáért

23 Permisszív hiszton módosulások T sejteken Nat Rev Immunol. 9: Cell Research (2010) 20:4 12.

24 Az epigenetikai szabályozás molekuláris alapjai 3. Nem kódoló RNS (pl. mikro RNS, mirtron)

25 A Toll receptorokon át érkező PAMP/DAMP jelek mirns szabályozása

26 mir 155 fokozza az aktivált T sejtek proliferációját atopias dermatitisben Staphylococcal superantigen Allergen CTLA 4 mir 155 Cell proliferation Atopic dermatitis Sonkoly et al., J All Clin Immunol, 2010 Pivarcsi Andor ábrája

27 Zhang et al., Nature, Oct. 7, 2014 antivirális penicillin? Japán loncból (Lonicera japonica) készült főzetben atípusos mikrorns gátolja az influenza vírus több törzsének (H1N1, H5N1, H7N9) szaporodását 4/27/2015

28 Az epigenetikai szabályozás molekuláris alapjai 4. Telomera/telomeráz TTGGGG Replication Replication Replication sejthalál

29 Telomera/telomeráz

30

31 Az észlelt stressz hatása a telomer rövidülésre Krónikus beteg gyermekeket gondozó édesanyjainak lymphocytáiban Magasabb észlelt stressz esetén vér mononukleáris sejtekben szignifikánsan alacsonyabb telomeráz aktivitás és szignifikáns telomér rövidülés (9-17 évvel idősebb celluláris öregedés) Felgyorsult telomer rövidülés Alzheimer-betegeket gondozó személyeken

32 mikrpbiom bac species in/on humans bacs have approx genes metagenome : 350x core human genome Qin et al, Nature March 2010

33 A genomika/epigenomika haszna Biotechnológia Diagnosztika Terápia. személyreszabott orvoslás 4P: Predictive, Preventive, Personalized, Participatory

34 Kommunikáció és együttműködés orvos és páciens között Személyre szabott orvoslás! Személyre szabott (in silico tervezett) védőoltások Gyógyszer dózis- és mellékhatás (rassz- és egyéni) predikció

35

36 4/27/2015

2012.11.19. Epigenetikaikutatások pszichiátriai vonatkozásai 1850. A modern biológia fejlődése. 2001. február 15-16. Falus András. populációk (Darwin)

2012.11.19. Epigenetikaikutatások pszichiátriai vonatkozásai 1850. A modern biológia fejlődése. 2001. február 15-16. Falus András. populációk (Darwin) Epigenetikaikutatások pszichiátriai vonatkozásai 1850 populációk (Darwin) A modern biológia fejlődése Egyedek (Mendel) 1900 sejtek tervezett élőlények (szintetikus biológia) 2050 2020 1950 kromoszómák

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26 Hamar Péter RNS világ Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. 1 26 Főszereplők: DNS -> RNS -> fehérje A kód lefordítása Dezoxy-ribo-Nuklein-Sav: DNS az élet kódja megkettőződés (replikáció)

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

Az immunrendszer alapjai, sejtöregedés, tumorképződés. Biológiai alapismeretek

Az immunrendszer alapjai, sejtöregedés, tumorképződés. Biológiai alapismeretek Az immunrendszer alapjai, sejtöregedés, tumorképződés Biológiai alapismeretek Az immunrendszer Immunis (latin szó): jelentése mentes valamitől Feladata: a szervezetbe került idegen anyagok: 1. megtalálása

Részletesebben

Daganatok kialakulásában szerepet játszó molekuláris folyamatok

Daganatok kialakulásában szerepet játszó molekuláris folyamatok Daganatok kialakulásában szerepet játszó molekuláris folyamatok Genetikai változások Onkogének Tumorszuppresszor gének DNS hibajavító gének Telomer és telomeráz Epigenetikai változások DNS-metiláció Mikro-RNS

Részletesebben

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet erhesség és emlőrák genetikai szempontok Kosztolányi yörgy PE Orvosi enetikai Intézet Előfordulás 1 emlőrák / 3000 várandós fokozódása várható: öröklődő emlőrák diagnózisa családon belül : I. generáció

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend)

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) Országos Egészségbiztosítási Pénztár Elemzési, Orvosszakértői és Szakmai Ellenőrzési Főosztály Budapest, 2013. június 26.

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

Lujber László és a szerző engedélyé

Lujber László és a szerző engedélyé Allergia genetikai háttere Dr. Szalai Csaba 2012. Szeptember 24. 1 Allergia: multifaktoriális vagy komplex betegség: Genetikai háttér (több száz gén, több ezer genetikai variáció) + környezeti tényezők

Részletesebben

Sejtfeldolgozás Felhasználás

Sejtfeldolgozás Felhasználás Sejtterápia Sejtfeldolgozás Felhasználás Fagyasztva tárolás Sejtmosás Alap sejtszelekció Komplex sejtszelekció Ex vivo sejtszaporítás Sejtaktiválás Immunizálás Génmodifikálás Köldökzsinórvér bank Limfocita

Részletesebben

HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS

HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS Dr. Mohamed Mahdi MD. MPH. Department of Infectology and Pediatric Immunology University of Debrecen (MHSC) 2012 Diagnózis HIV antitest teszt: A HIV ellen termel

Részletesebben

A nyelv genetikai háttere

A nyelv genetikai háttere A nyelv genetikai háttere Szalontai Ádám ELTE Elméleti Nyelvészeti Doktori Program MTA Nyelvtudományi Intézet 2014. április 29. 1 / 41 Az előadás menete Genetikai bevezető Gének és nyelv elmélet KE család

Részletesebben

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök:

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök: Otthonápolás Cégegészség Fogorvos Homeopátia Online gyógyszertár RSS Iratkozzon fel RSS-csatornáinkra! KÖNYVAJÁNLÓ Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008.

Részletesebben

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Magyarósi Szilvia Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem DEMIN 2014. május 22.

Részletesebben

EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE. Falus András. Összefoglalás

EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE. Falus András. Összefoglalás 1 EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE Falus András Összefoglalás Az epigenetika, az örökítőanyag softvere Kovalens módosulások Anyai hatás és az egyedfejlődés Mitokondriális öröklés Táplálkozás

Részletesebben

Az agy betegségeinek molekuláris biológiája. 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5.

Az agy betegségeinek molekuláris biológiája. 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5. Az agy betegségeinek molekuláris biológiája 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5. Alzheimer kór 28 Prion betegség A prion betegség fertőző formáját nem egy genetikai

Részletesebben

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan 11. évfolyam BIOLÓGIA 1. Az emberi test szabályozása Idegi szabályozás Hormonális szabályozás 2. Az érzékelés Szaglás, tapintás, látás, íz érzéklés, 3. Általános egészségügyi ismeretek az egyes témákhoz

Részletesebben

A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora

A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora PÉCSI TUDOMÁNYEGYETEM 1. A gyógyszerészi gondozás kialakulásának történeti bemutatása, hátterében álló nemzetközi

Részletesebben

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1.

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1. Biobankok a Semmelweis Egyetemen Szalai Csaba 2009. július 1. Molnár Mária Judit MD, PhD A Semmelweis Egyetem Molekuláris Neurológiai Klinikai és Kutatási Központ igazgatója SE Molekuláris Neurológiai

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk.

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A genetikai betegségek mellett, génterápia alkalmazható szerzett betegségek, mint

Részletesebben

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós Összefoglalás A humángenetika korunk egyik legdinamikusabban fejlődő tudományága. Ennek a fejlődésnek legfőbb mozgatórugója az, hogy a humángenetika,

Részletesebben

II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI. origamigroup BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA

II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI. origamigroup BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI origamigroup www.origami.co.hu II. A rheumatoid arthritis kezelésének általános

Részletesebben

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

A biotechnológia alapjai A biotechnológia régen és ma. Pomázi Andrea

A biotechnológia alapjai A biotechnológia régen és ma. Pomázi Andrea A biotechnológia alapjai A biotechnológia régen és ma Pomázi Andrea A biotechnológia fogalma Alkalmazott biológia A fogalom állandó változásban van A biológia és a biotechnológia közötti különbség a méretekben

Részletesebben

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók

Részletesebben

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 Recesszív öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság

Részletesebben

Tudásmenedzsment és gyógyszerinnováció

Tudásmenedzsment és gyógyszerinnováció Tudásmenedzsment és gyógyszerinnováció Ipari szükségletek / elvárások Dr. Bátori Sándor Sanofi-aventis Innovatív Gyógyszerek Kutatása, MAGYOSZ, 2009.01.07. Alapvető együttm ttműködések Hosszútávú elhatározás:

Részletesebben

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik.

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. MUTÁCIÓK A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. Pontmutáció: A kromoszóma egy génjében pár nukleotidnál következik be változás.

Részletesebben

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter Magyar Orvostudományi Napok 2013. november 6 8 Hotel Novotel Budapest (Alkotás utca 63 67) Rendező: Magyar Orvostársaságok és Egyesületek Szövetsége (MOTESZ) Programtervezet 2013. november 6. 10.00 Megnyitó

Részletesebben

Katasztrófális antifoszfolipid szindróma

Katasztrófális antifoszfolipid szindróma Katasztrófális antifoszfolipid szindróma Gadó Klára Semmelweis Egyetem, I.sz. Belgyógyászati Klinika Antifoszfolipid szindróma Artériás és vénás thrombosis Habituális vetélés apl antitest jelenléte Mi

Részletesebben

ható gyógyszerjel Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26.

ható gyógyszerjel Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26. Légzőrendszerre ható gyógyszerjel gyszerjelöltek ltek hatásoss sossága Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26. Tudományos

Részletesebben

FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre

FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre A rendezvény helyszíne: Általános Orvostudományi Kar Cím: SZTE ÁOK Dékáni Hivatal 6720

Részletesebben

Néhány mondat a m á m j á b j e b t e eg e s g é s g é e g k e k g y g ó y g ó y g s y z s er e es e s k e k z e el e é l s é é s r é ől

Néhány mondat a m á m j á b j e b t e eg e s g é s g é e g k e k g y g ó y g ó y g s y z s er e es e s k e k z e el e é l s é é s r é ől Néhány mondat a májbetegségek gyógyszeres kezeléséről dr. Pár Gabriella PTE I. Belgyógyászati Klinika, Pécs A fontosabb májbetegségek Alkoholos zsirmáj - hepatitis - cirrhosis Krónikus B és C virus hepatitis

Részletesebben

A jövő záloga (a laboratóriumi medicinában is) a jelen oktatási rendszere. Muszbek László

A jövő záloga (a laboratóriumi medicinában is) a jelen oktatási rendszere. Muszbek László A jövő záloga (a laboratóriumi medicinában is) a jelen oktatási rendszere Muszbek László Debreceni Egyetem, Orvos és Egészségtudományi Centrum, Klinikai Kutató Központ Mi a laboratóriumi medicina? Az analítikai

Részletesebben

A gének világa, avagy a mi világunk is

A gének világa, avagy a mi világunk is Kovács Árpád Ferenc folyóirata Kovács Árpád Ferenc A gének világa, avagy a mi világunk is 1. rész: A genetika a kezdetektől napjainkig 2010 A gének világa, avagy a mi világunk is 1. Bevezetés életünk központjába

Részletesebben

Allergia prevenció újszülött-és csecsemőkorban

Allergia prevenció újszülött-és csecsemőkorban Allergia prevenció újszülött-és csecsemőkorban Dr. Réthy Lajos Attila (MD, PhD) Országos Gyermekegészségügyi Intézet Budapest European Academy of Allergology and Clinical Immunology, Section of Pediatrics

Részletesebben

Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata

Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata Doktori tézisek Dr. Kovács-Nagy Réka Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola Témavezető: Dr. Rónai Zsolt egyetemi adjunktus,

Részletesebben

Orvosi Genomika. 1. Trendek a modern orvostudományban. 2. Genomika és modern orvostudomány

Orvosi Genomika. 1. Trendek a modern orvostudományban. 2. Genomika és modern orvostudomány 1 1. ORVOSI GENOMIKA Orvosi Genomika 1. Trendek a modern orvostudományban DIA 1 Az emberi genom megfejtése óta eltelt 10 évben rendkívül gyors fejlődés ment végbe a genomikai technikákban, ill. a genomikai

Részletesebben

BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ

BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ V. M A G Y A R S E J T A N A L I T I K A I K O N F E R E N C I A M O L E

Részletesebben

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban 11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban HIV fertőzés kimutatása - (fiktív) esettanulmány 35 éves nő, HIV fertőzöttség gyanúja. Két partner az elmúlt időszakban. Fertőzött-e

Részletesebben

TÁPLÁLKOZÁSI AKADÉMIA Hírlevél IV. évfolyam 3. szám, 2011. március

TÁPLÁLKOZÁSI AKADÉMIA Hírlevél IV. évfolyam 3. szám, 2011. március Tisztelt Olvasó! A Táplálkozási Akadémia című hírlevél célja az, hogy az újságírók számára hiteles információkat nyújtson az egészséges táplálkozásról, életmódról, valamint a legújabb tudományos kutatási

Részletesebben

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban 11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban HIV fertőzés kimutatása (fiktív) esettanulmány 35 éves nő, HIV fertőzöttség gyanúja. Két partner az elmúlt időszakban. Fertőzött-e

Részletesebben

KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR

KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR MAI MENÜ Táplálkozás funkciói és hibái Egészség és táplálkozás Társadalmi igények Táplálkozás

Részletesebben

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN Kötelezı szinten tartó tanfolyam PÉCS 2009. október 14-16. PROGRAMFÜZET Kedves Kollégák! Közel egy évvel ezelıtt, 2008 júniusában

Részletesebben

Diabetes mellitus. Rácz Olivér Miskolci Egyetem Egészségügyi Kar. Diabetes mellitus

Diabetes mellitus. Rácz Olivér Miskolci Egyetem Egészségügyi Kar. Diabetes mellitus Diabetes mellitus Rácz Olivér Miskolci Egyetem Egészségügyi Kar 2009 diamisk.ppt 1 Diabetes mellitus Glukóz homeosztázis, inzulin, inzulin antagonisták Definíció és a probléma méretei A diabetes tünetei

Részletesebben

...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról

...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról ...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról Nem szeretjük az orvosságokat, nem szeretjük a kést, fejcsóválva állunk a nem túl fényes egészségügyi mutatók felett...

Részletesebben

Sejtek - őssejtek dióhéjban. 2014. február. Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest

Sejtek - őssejtek dióhéjban. 2014. február. Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest Sejtek - őssejtek dióhéjban 2014. február Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest A legtöbb sejtünk osztódik, differenciálódik, elpusztul... vérsejtek Vannak

Részletesebben

PRIMER IMMUNDEFICIENCIA - KOMPLEMENT DEFEKTUS. LABORVIZSGÁLATOK BEMUTATÁSA EGY BETEGÜNK KAPCSÁN

PRIMER IMMUNDEFICIENCIA - KOMPLEMENT DEFEKTUS. LABORVIZSGÁLATOK BEMUTATÁSA EGY BETEGÜNK KAPCSÁN 2014. 1. szám TESZTKÉRDÉSEI: PRIMER IMMUNDEFICIENCIA - KOMPLEMENT DEFEKTUS. LABORVIZSGÁLATOK BEMUTATÁSA EGY BETEGÜNK KAPCSÁN SZILÁGYI ÁGNES 1, VARGA LILIAN 1, PROHÁSZKA ZOLTÁN 1, DÉRFALVI BEÁTA 2 Milyen

Részletesebben

A krónikus hepatitis C vírus infekcióhoz társuló elégtelen celluláris immunválasz pathogenezise

A krónikus hepatitis C vírus infekcióhoz társuló elégtelen celluláris immunválasz pathogenezise Szakmai zárójelentés dr Pár Gabriella A krónikus hepatitis C vírus infekcióhoz társuló elégtelen celluláris immunválasz pathogenezise A hepatitis C virus (HCV) nagy közegészségügyi probléma. A világon

Részletesebben

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A TM vizsgálatok alapkérdései A vizsgálatok célja, információértéke? Az alkalmazás területei? Hogyan válasszuk ki az alkalmazott

Részletesebben

Az immunológia alapjai

Az immunológia alapjai Az immunológia alapjai Kacskovics Imre Eötvös Loránd Tudományegyetem Immunológiai Tanszék Budapest Citokinek Kisméretű, szolubilis proteinek és glikoproteinek. Hírvivő és szabályozó szereppel rendelkeznek.

Részletesebben

Magisztrális gyógyszerkészítés a Wilson kór terápiájában. Dr. Birinyi Péter Mikszáth Gyógyszertár 1088 Budapest, Mikszáth Kálmán tér 4.

Magisztrális gyógyszerkészítés a Wilson kór terápiájában. Dr. Birinyi Péter Mikszáth Gyógyszertár 1088 Budapest, Mikszáth Kálmán tér 4. Magisztrális gyógyszerkészítés a Wilson kór terápiájában Dr. Birinyi Péter Mikszáth Gyógyszertár 1088 Budapest, Mikszáth Kálmán tér 4. A Wilson kór mérföldkövei 1912. Wilson: Progressive lenticular degeneration:

Részletesebben

Tausz István házi gyermekorvos

Tausz István házi gyermekorvos Tausz István házi gyermekorvos A természet varázsát ontja bőven. A fűben, a virágban és a kőben. Ó nincs a földön oly silány anyag, Mely így vagy úgy ne szolgálná javad; De nincs oly jó, melyben ne volna

Részletesebben

A sejtciklus szabályozása

A sejtciklus szabályozása Molekuláris sejtbiológia A sejtciklus szabályozása? Dr. habil.. Kőhidai László Semmelweis Egyetem Genetikai, Sejt- és Immunbiológiai Intézet Sejtciklus fázisai S G 2 G 0 G 1 M G = gap gap S = synthesis

Részletesebben

BIOLÓGIA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ

BIOLÓGIA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ Biológia középszint 0801 ÉRETTSÉGI VIZSGA 2009. május 12. BIOLÓGIA KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ OKTATÁSI ÉS KULTURÁLIS MINISZTÉRIUM Útmutató a középszintű dolgozatok

Részletesebben

A HKO magyarázata és helye a komplementer medicina területén, hazai szabályozás, engedélyezés, továbbképzés joggyakorlata.

A HKO magyarázata és helye a komplementer medicina területén, hazai szabályozás, engedélyezés, továbbképzés joggyakorlata. Hagyományos Kínai Orvoslás és Kapcsolt technikái képzés 1.nap Bevezetés, tanfolyami ismertetés, beosztások. Tudományos eredmények a HKO mai állásáról, nemzetközi tanulmányok, értékelése, A HKO története,

Részletesebben

CF BETEGSÉG EGY ÁLTALÁNOS GYERMEKORVOS SZEMÜVEGÉN ÁT

CF BETEGSÉG EGY ÁLTALÁNOS GYERMEKORVOS SZEMÜVEGÉN ÁT CF BETEGSÉG EGY ÁLTALÁNOS GYERMEKORVOS SZEMÜVEGÉN ÁT Szabó László Belgyógyászat-Pulmonológia, Heim Pál Gyermekkórház, Csillebérci Családi Találkozó, 2014. 05.17-18. Vázlat 1. Holisztikus medicina 2. Fiatal

Részletesebben

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:

Részletesebben

Tudományos program. Fővédnök: Lovász László, az MTA elnöke

Tudományos program. Fővédnök: Lovász László, az MTA elnöke MAGYAR ORVOSTUDOMÁNYI NAPOK 2014. november 5-7 Hotel Novotel Budapest, 1123 Alkotás u. 63-67 Rendező: Magyar Orvostársaságok és Egyesületek Szövetsége (MOTESZ) Tudományos program Fővédnök: Lovász László,

Részletesebben

Molekuláris Medicina

Molekuláris Medicina Molekuláris Medicina Molekuláris Medicina Őssejt terápia Génterápia Tumor terápia Immunterápia Egyéb terápiák Vakcinák Genetikai diagnosztika Orvosi genomika Terápiák Diagnosztikák Orvostudomány: régi

Részletesebben

Poligénes v. kantitatív öröklődés

Poligénes v. kantitatív öröklődés 1. Öröklődés komplexebb sajátosságai 2. Öröklődés molekuláris alapja Poligénes v. kantitatív öröklődés Azok a tulajdonságokat amelyek mértékegységgel nem, vagy csak nehezen mérhetők, kialakulásuk kevéssé

Részletesebben

Gyermekkori IBD jellegzetességei. Dr. Tomsits Erika SE II. sz. Gyermekklinika

Gyermekkori IBD jellegzetességei. Dr. Tomsits Erika SE II. sz. Gyermekklinika Gyermekkori IBD jellegzetességei Dr. Tomsits Erika SE II. sz. Gyermekklinika Gyulladásos bélbetegség feltételezhetı Hasmenés >4 hét >2 székürítés naponta Folyékony/pépes széklet Crohn-betegség? Colitis

Részletesebben

OTKA zárójelentés 2004-2007

OTKA zárójelentés 2004-2007 OTKA zárójelentés 2004-2007 Humán vizsgálatok 2004. Korábban összefüggést találtunk a monocyte chemoattractant protein-1 (MCP-1) távoli szabályozó régiójában található polimorfizmusa és az asztma fokozott

Részletesebben

Klinikai Genomikai és Személyre Szabott Orvoslási Központ. Tudományos Hétf!

Klinikai Genomikai és Személyre Szabott Orvoslási Központ. Tudományos Hétf! Klinikai Genomikai és Személyre Szabott Orvoslási Központ 2012 Tudományos Hétf! Biomarker azonosítás feltételei: eszközök, készségek és kollaboráció Minták, Vizsgálatok, Beteg adatok Klinikus + bioinfo

Részletesebben

Neoplazma - szabályozottság nélküli osztódó sejt

Neoplazma - szabályozottság nélküli osztódó sejt 9. előadás Rák Rák kialakulása: A szervezet 10 14 sejtet tartalmaz, ezek mutálnak és osztódnak A rákos sejt nem követi a sejtosztódás korlátait és végül a rákos sejtek elfoglalják a normál szövetek helyét.

Részletesebben

Klinikai Immunológiai Interdiszciplináris Fórum II. (KIIF)

Klinikai Immunológiai Interdiszciplináris Fórum II. (KIIF) Klinikai Immunológiai Interdiszciplináris Fórum II. (KIIF) 2011.11.10 2011.11.12. Hotel Divinus, Debrecen Főszervező: Prof. Dr. Zeher Margit A Magyar Allergológiai és Klinikai Immunológiai Társaság és

Részletesebben

REFERENCIA MÉRÉSI RENDSZEREK A GENETIKAI DIAGNOSZTIKÁBAN: DNS-ALAPÚ REFERENCIA ANYAGOK FEJLESZTÉSE. PhD tézis rövid összefoglaló.

REFERENCIA MÉRÉSI RENDSZEREK A GENETIKAI DIAGNOSZTIKÁBAN: DNS-ALAPÚ REFERENCIA ANYAGOK FEJLESZTÉSE. PhD tézis rövid összefoglaló. REFERENCIA MÉRÉSI RENDSZEREK A GENETIKAI DIAGNOSZTIKÁBAN: DNS-ALAPÚ REFERENCIA ANYAGOK FEJLESZTÉSE PhD tézis rövid összefoglaló Márki-Zay János Reference Materials Unit, Institute for Reference Materials

Részletesebben

Kibővült laboratóriumi diagnosztikai lehetőségek a férfi infertilitás kivizsgálásában. Dr. Németh Julianna Laboratórium KFT, Budapest

Kibővült laboratóriumi diagnosztikai lehetőségek a férfi infertilitás kivizsgálásában. Dr. Németh Julianna Laboratórium KFT, Budapest Kibővült laboratóriumi diagnosztikai lehetőségek a férfi infertilitás kivizsgálásában Dr. Németh Julianna Laboratórium KFT, Budapest Infertilitás/subfertilitás Férfi infertilitás esetek 90%-ban spermium

Részletesebben

változások az SM kezelésében: tények és remények

változások az SM kezelésében: tények és remények változások az SM kezelésében: tények és remények Prof. Dr. Illés Zsolt Dél-Dániai Egyetem Odense az SM klinikai típusai relapszussal remisszióval szekunderprogresszív primer progresszív progresszív relapszáló

Részletesebben

XII. Down Szimpózium: Tudományos továbbképzés a magzati orvostan aktuális fejezeteiből P R O G R A M. 2014. június 5. CSÜTÖRTÖK

XII. Down Szimpózium: Tudományos továbbképzés a magzati orvostan aktuális fejezeteiből P R O G R A M. 2014. június 5. CSÜTÖRTÖK XII. Down Szimpózium: Tudományos továbbképzés a magzati orvostan aktuális fejezeteiből P R O G R A M 2014. június 5. CSÜTÖRTÖK 9:00 Megnyitó Szabó János 1,2, Széll Márta 1 SZTE ÁOK Orvosi Genetikai Intézet

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

A pályázati program megvalósítása közben 2008-2012 között három változtatás történt az eredeti tervhez képest:

A pályázati program megvalósítása közben 2008-2012 között három változtatás történt az eredeti tervhez képest: ZÁRÓJELENTÉS (OTKA 71883) Cím: Új terápiás módszerek kifejlesztése és hatásmechanizmusának tanulmányozása poliszisztémás autoimmun kórképekben Vezető kutató: Sipka Sándor (A) Résztvevők: Baráth Sándor

Részletesebben

Fehérje szintézis 2. TRANSZLÁCIÓ Molekuláris biológia kurzus 7. hét. Kun Lídia Genetikai, Sejt- és immunbiológiai Intézet

Fehérje szintézis 2. TRANSZLÁCIÓ Molekuláris biológia kurzus 7. hét. Kun Lídia Genetikai, Sejt- és immunbiológiai Intézet Fehérje szintézis 2. TRANSZLÁCIÓ Molekuláris biológia kurzus 7. hét Kun Lídia Genetikai, Sejt- és immunbiológiai Intézet Gén mrns Fehérje Transzkripció Transzláció A transzkriptum : mrns Hogyan mutatható

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

A klasszikus homeopátia gyógyítási rendszere

A klasszikus homeopátia gyógyítási rendszere A klasszikus homeopátia gyógyítási rendszere Szabady Júlia 2008. Felkészítő: Dr. Horváth Katalin Napjaink orvostudománya Vitathatatlan eredmények: - antibiotikumok - transzplantáció - humán genom Terápiás

Részletesebben

www.eduvital.net "Soha sem késő"! Megoldások a felnőttkori egészségnevelésből Falus András

www.eduvital.net Soha sem késő! Megoldások a felnőttkori egészségnevelésből Falus András www.eduvital.net "Soha sem késő"! Megoldások a felnőttkori egészségnevelésből Falus András Az EDUVITAL koncepció és gyakorlat www.eduvital.net Mit tanít az EDUVITAL csapata? Küldetés nyilatkozat A magyar

Részletesebben

Vezikuláris transzport

Vezikuláris transzport Molekuláris Sejtbiológia Vezikuláris transzport Dr. habil KŐHIDAI László Semmelweis Egyetem, Genetikai, Sejt- és Immunbiológiai Intézet 2005. november 3. Intracelluláris vezikul uláris transzport Kommunikáció

Részletesebben

Méhes Károly Genetikai Továbbképző Napok. Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek

Méhes Károly Genetikai Továbbképző Napok. Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek Méhes Károly Genetikai Továbbképző Napok Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek Kötelező szinten tartó tanfolyam Pécs 2011. október 19-21 PROGRAMFÜZET Kedves Vendégeink!

Részletesebben

Összefüggés a több műszakban végzett munka és a metabolikus szindróma között

Összefüggés a több műszakban végzett munka és a metabolikus szindróma között MUNKAVÉDELEM 1.4 Összefüggés a több műszakban végzett munka és a metabolikus szindróma között Tárgyszavak: váltott műszakos munka; nappali műszak; metabolikus szindróma; szérumlipid; vércukor; elhízás;

Részletesebben

Dózis-válasz görbe A dózis válasz kapcsolat ábrázolása a legáltalánosabb módja annak, hogy bemutassunk eredményeket a tudományban vagy a klinikai

Dózis-válasz görbe A dózis válasz kapcsolat ábrázolása a legáltalánosabb módja annak, hogy bemutassunk eredményeket a tudományban vagy a klinikai Dózis-válasz görbe A dózis válasz kapcsolat ábrázolása a legáltalánosabb módja annak, hogy bemutassunk eredményeket a tudományban vagy a klinikai gyakorlatban. Például egy kísérletben növekvő mennyiségű

Részletesebben

7. Rendszerszemléletű biológia a kémikus szemével. Genomika, proteomika, metabolomika

7. Rendszerszemléletű biológia a kémikus szemével. Genomika, proteomika, metabolomika 7. Rendszerszemléletű biológia a kémikus szemével Genomika, proteomika, metabolomika 7. Rendszerszemléletű biológia Redukcionista vs. Holisztikus szemlélet A rendszerszemléletű biológia (systems biology)

Részletesebben

LÉGZŐRENDSZER. Meixner Katalin

LÉGZŐRENDSZER. Meixner Katalin LÉGZŐRENDSZER Meixner Katalin Légzőrendszer részei - cavum nasi, orrmelléküregek - larynx - trachea - bronchi - pulmo Anatómiai áttekintés A légzés élettana Külső légzés: - O2- CO2 transzport - alveolusokban

Részletesebben

Dr. Barna Lajosné Országos Dietetikai szakmai Tagozat tagozatvezető. X.Országos Járóbeteg Szakdolgozói Konferencia Balatonfüred, 2013. szeptember 13.

Dr. Barna Lajosné Országos Dietetikai szakmai Tagozat tagozatvezető. X.Országos Járóbeteg Szakdolgozói Konferencia Balatonfüred, 2013. szeptember 13. Az vagy, amit megeszel! Dr. Barna Lajosné Országos Dietetikai szakmai Tagozat tagozatvezető X.Országos Járóbeteg Szakdolgozói Konferencia Balatonfüred, 2013. szeptember 13. A táplálkozás, mint életmódtényező

Részletesebben

Fotoferezis másként. Dr. Tremmel Anna Semmelweis Egyetem I.sz. Belgyógyászati Klinika Aferezis

Fotoferezis másként. Dr. Tremmel Anna Semmelweis Egyetem I.sz. Belgyógyászati Klinika Aferezis Fotoferezis másként Dr. Tremmel Anna Semmelweis Egyetem I.sz. Belgyógyászati Klinika Aferezis Extracorporális fotoferezis (ECP) Fotoaferezis ( PAP) Egy leukaferezis alapú immunmodulációs terápia: ahol

Részletesebben

Diagnosztikai irányelvek Paget-kórban

Diagnosztikai irányelvek Paget-kórban Diagnosztikai irányelvek Paget-kórban Dr. Donáth Judit Országos Reumatológiai és Fizioterápiás Intézet, Budapest HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012-2014 2015. ÁPRILIS 17.

Részletesebben

Nemzeti Akkreditáló Testület. BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz Az Országos Epidemiológiai Központ Virológiai főosztály (1097 Budapest, Albert

Részletesebben

2346-06 Radiofarmakológiai vizsgálatok követelménymodul szóbeli vizsgafeladatai

2346-06 Radiofarmakológiai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat: Munkabeosztása szerint hétfőtől Ön a meleglaboratóriumban fog dolgozni. Vegye át a meleglaboratóriumot a munkatársától! Az ellenőrzésnél térjen ki a dokumentációra és a radiofarmakonok leltározására

Részletesebben

Szívünk egészsége. Olessák Ágnes anyaga 2010.03.23.

Szívünk egészsége. Olessák Ágnes anyaga 2010.03.23. Szívünk egészsége Olessák Ágnes anyaga 2010.03.23. Egészséges szív és érrendszer Táplálékod legyen orvosságod, és ne gyógyszered a táplálékod Hippokratesz A szív működése Jobb kamra, pitvarkisvérkör CO2

Részletesebben

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 3. Részjelentés: 2003. November

Részletesebben

Szerkesztette: dr Lázár Sarnyai Nóra

Szerkesztette: dr Lázár Sarnyai Nóra Szerkesztette: dr Lázár Sarnyai Nóra A cukorbetegség (diabetes mellitus) a szénhidrátanyagcsere zavara, amely a vérben, illetve a testnedvekben megemelkedett cukorszinttel és kóros anyagcseretermékekkel

Részletesebben

A Ganoderma gyógygomba a hagyományos kínai orvoslás egyik alapköve,

A Ganoderma gyógygomba a hagyományos kínai orvoslás egyik alapköve, Gulyás Judit Régiós Képviselő Ganoderma gyógygomba Pecsétviaszgomba Dombóvár Tolna-, Somogy- Gyógygomba A Ganoderma gyógygomba a hagyományos kínai orvoslás egyik alapköve, a lélekerő-gomba, kulcs a jó

Részletesebben

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2.

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2. BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február 1. Az IPK bemutatása 2. A TILLING módszer Hol található az IPK? Gatersleben Általános adatok az IPK-ról Leibniz

Részletesebben

Dr.Lászlóffy Marianna 2012.Március 7.

Dr.Lászlóffy Marianna 2012.Március 7. Dr.Lászlóffy Marianna 2012.Március 7. Bevezetés Az iparosodott világ lakosságának 30-40%-ában fejlődik ki élete folyamán daganatos megbetegedése. A megbetegedések kb.70-90%-át környezeti karcinogének okozzák.

Részletesebben

Pszichológiai és pszichiátriai problémák időskorban. Kassai- Farkas Ákos osztályvezető főorvos c. egyetemi docens Nyírő Gyula Kórház

Pszichológiai és pszichiátriai problémák időskorban. Kassai- Farkas Ákos osztályvezető főorvos c. egyetemi docens Nyírő Gyula Kórház Pszichológiai és pszichiátriai problémák időskorban Kassai- Farkas Ákos osztályvezető főorvos c. egyetemi docens Nyírő Gyula Kórház Miről is beszélek: 1.) Általánosságban 2.) Egészségpszichológia 3.) Sikeres

Részletesebben