A genomiális medicina szép új világa

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "A genomiális medicina szép új világa"

Átírás

1 A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet

2 A medicina legfőbb kihívásai Nagy népbetegségek elhízás/ cukorbetegség/metabolikus szindroma szív és érrendszeri betegségek veseelégtelenség malignus betegségek neurológiai psychiátriai betegségek fertőzéses, gyulladási szindrómák allergia, asthma, légzőrendszeri kórképek Gyógyszerhatás, kóros mellékhatás Átlagéletkor emelkedéséből adódó feladatok Immunizálás (védőoltás: fertőzés, tumor, allergia ) Őssejt terápia, szintetikus biológia Orvosi kommunikáció, egészségnevelés 4/27/2015 Komplex betegségek systems biology, bioinformatika

3 a modell..a humán genom Nature 171, április február az enciklopédia millió genom 4/27/ szeptember

4 Genom (a teljes örökítő anyag) és a genom szintű megközelítés Genetikai állományunk 26 ezer gén, (2x) 23 kromoszóma, 3.2 milliárd nukleotid betű 20 millió mutáció (SNP) 2m DNS/sejt 7.6 fénynap

5 FEHÉRJE FIZIKAI TECHNIKÁK Biofizika, nanofizika METODIKAI REPERTOIRE GCAATCGATCTGGTACAGTAGCTA GCAATTGATCGGGTACATTAGCTA Hap-Map/ 20 millió pontmutáció TELJES GENOM VIZSGÁLAT Adatbázisok Egy sejt analitika (subnano) EXPRESSZIÓS MICROARRAY/CHIP NANOTECHNOLÓGIA, Szilárd Fázisú KÉMIA DNS NYELVÉSZETI ELJÁRÁSOK ÚJ GENERÁCIÓS SZEKVENÁLÁSOK CRISP/Cas9 rendszer BIOINFORMATIKA GÉNHÁLÓZATOK- ÚTVONAL ANALÍZIS

6 Gyorsuló genetikai/genomikai adathalmaz A DNS adatok megkétszereződnek 18 havonta Ennek költségei a feleződnek 18 havonta

7 genome (2014) 5 million genome (2017)

8 Genome wide associations studies December, studies, p<5x markers 1000 genom project NHGRI GWA Catalog 8

9 Rheumatoid arthritis genetikai háttér -log10 trend test P PADI 4 HLA DRB1 PTP N22 IL2RA TNF IP2 IL2RB Nature 447, (7 June 2007) doi: /nature05911

10 A (emberi) genom misztériuma Fejérjekódolás Az emberi genom 99%-a szemét? Mobilis, ugráló elemek? ismétlődő szakaszok

11 DE!!!! nem lehet mindent az egyes génekből megérteni!!! hálózati hatások-káosz-elméletek környezeti hatások (epigenetika)-reverzibilitás metagenomika- genomok együttélése (microbiom)

12 Szemlélet váltás amikor öröklésről beszélünk szinte sose egy génre kell gondolnunk, hanem gének sokaságának hálózatára, együttműködésére (ennek zavara a betegség)

13 HÁLÓZAT T1DM Ismert gének alapján 68 újat azonosítottak Top 5: ESR1 VIL2 Smad2 RELA DAXX

14 EPIGENETIKA inaktív heterokromatin eukromatin aktív

15 4/27/2015 Epigenetikai faktorok (hatásukra módosul az öröklött tulajdonságok érvényesülése) ontogenesis-anyai hatás táplálkozás gyógyszerek, mérgek fizikai aktivitás microbiota- együttélő mikróbák ÉLETMÓD! fény zene stress, magatartási-, lelki-, meditatív hatások szociális környezet

16 Epigenetikai szabályozás a génexpresszióra hat, nem érinti az örökölt nukleotid szekvenciát, reverzibilis kovalens öröklődik

17 Az epigenetikai szabályozás DNS metiláció molekuláris alapjai 1. Citozin metiláció/demetiláció

18 A metabolikus memória: reverzibilis epigenetikai mechanizmus Sundararajan Jayaraman Circulation Research. 2012;110: Copyright American Heart Association, Inc. All rights reserved.

19 Az epigenetikai szabályozás molekuláris alapjai 2. Hiszton modifikáció acetiláció, foszforiláció, metiláció

20 Hiszton modifikációk= hiszton-kód

21

22 Hiszton acetlációs változások (is) felelősek a T sejt fenotípusok kialakításáért

23 Permisszív hiszton módosulások T sejteken Nat Rev Immunol. 9: Cell Research (2010) 20:4 12.

24 Az epigenetikai szabályozás molekuláris alapjai 3. Nem kódoló RNS (pl. mikro RNS, mirtron)

25 A Toll receptorokon át érkező PAMP/DAMP jelek mirns szabályozása

26 mir 155 fokozza az aktivált T sejtek proliferációját atopias dermatitisben Staphylococcal superantigen Allergen CTLA 4 mir 155 Cell proliferation Atopic dermatitis Sonkoly et al., J All Clin Immunol, 2010 Pivarcsi Andor ábrája

27 Zhang et al., Nature, Oct. 7, 2014 antivirális penicillin? Japán loncból (Lonicera japonica) készült főzetben atípusos mikrorns gátolja az influenza vírus több törzsének (H1N1, H5N1, H7N9) szaporodását 4/27/2015

28 Az epigenetikai szabályozás molekuláris alapjai 4. Telomera/telomeráz TTGGGG Replication Replication Replication sejthalál

29 Telomera/telomeráz

30

31 Az észlelt stressz hatása a telomer rövidülésre Krónikus beteg gyermekeket gondozó édesanyjainak lymphocytáiban Magasabb észlelt stressz esetén vér mononukleáris sejtekben szignifikánsan alacsonyabb telomeráz aktivitás és szignifikáns telomér rövidülés (9-17 évvel idősebb celluláris öregedés) Felgyorsult telomer rövidülés Alzheimer-betegeket gondozó személyeken

32 mikrpbiom bac species in/on humans bacs have approx genes metagenome : 350x core human genome Qin et al, Nature March 2010

33 A genomika/epigenomika haszna Biotechnológia Diagnosztika Terápia. személyreszabott orvoslás 4P: Predictive, Preventive, Personalized, Participatory

34 Kommunikáció és együttműködés orvos és páciens között Személyre szabott orvoslás! Személyre szabott (in silico tervezett) védőoltások Gyógyszer dózis- és mellékhatás (rassz- és egyéni) predikció

35

36 4/27/2015

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához?

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Falus András Genetikai, Sejt- és Immunbiológiai Intézet Semmelweis Egyetem Antal Péter Hadadi Éva

Részletesebben

2012.11.19. Epigenetikaikutatások pszichiátriai vonatkozásai 1850. A modern biológia fejlődése. 2001. február 15-16. Falus András. populációk (Darwin)

2012.11.19. Epigenetikaikutatások pszichiátriai vonatkozásai 1850. A modern biológia fejlődése. 2001. február 15-16. Falus András. populációk (Darwin) Epigenetikaikutatások pszichiátriai vonatkozásai 1850 populációk (Darwin) A modern biológia fejlődése Egyedek (Mendel) 1900 sejtek tervezett élőlények (szintetikus biológia) 2050 2020 1950 kromoszómák

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26 Hamar Péter RNS világ Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. 1 26 Főszereplők: DNS -> RNS -> fehérje A kód lefordítása Dezoxy-ribo-Nuklein-Sav: DNS az élet kódja megkettőződés (replikáció)

Részletesebben

Új utak az antipszichotikus gyógyszerek fejlesztésében

Új utak az antipszichotikus gyógyszerek fejlesztésében Új utak az antipszichotikus gyógyszerek fejlesztésében SCHIZO-08 projekt Dr. Zahuczky Gábor, PhD, ügyvezető igazgató UD-GenoMed Kft. Debrecen, 2010. november 22. A múlt orvostudománya Mindenkinek ugyanaz

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

Daganatok kialakulásában szerepet játszó molekuláris folyamatok

Daganatok kialakulásában szerepet játszó molekuláris folyamatok Daganatok kialakulásában szerepet játszó molekuláris folyamatok Genetikai változások Onkogének Tumorszuppresszor gének DNS hibajavító gének Telomer és telomeráz Epigenetikai változások DNS-metiláció Mikro-RNS

Részletesebben

Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what?

Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what? 2000 június 26 Új út kezdete, vagy egy út vége? Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what? 2000 június

Részletesebben

Az immunrendszer alapjai, sejtöregedés, tumorképződés. Biológiai alapismeretek

Az immunrendszer alapjai, sejtöregedés, tumorképződés. Biológiai alapismeretek Az immunrendszer alapjai, sejtöregedés, tumorképződés Biológiai alapismeretek Az immunrendszer Immunis (latin szó): jelentése mentes valamitől Feladata: a szervezetbe került idegen anyagok: 1. megtalálása

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet erhesség és emlőrák genetikai szempontok Kosztolányi yörgy PE Orvosi enetikai Intézet Előfordulás 1 emlőrák / 3000 várandós fokozódása várható: öröklődő emlőrák diagnózisa családon belül : I. generáció

Részletesebben

TÁMOP-4.1.2-08/1/A-2009-0011 Tantárgy címe: Transzdifferenciáció és regeneratív medicina Dr. Balogh Péter és Dr. Engelmann Péter

TÁMOP-4.1.2-08/1/A-2009-0011 Tantárgy címe: Transzdifferenciáció és regeneratív medicina Dr. Balogh Péter és Dr. Engelmann Péter Előadás Előadás címe Dia Dia címe száma 1. Őssejtek és transzdifferenciáció: bevezetés, alapok 2. Őssejt-típusok, fenntartásuk és homeosztázisuk 3. Regeneráció állatmodellekben 2. Alapfogalmak 3. Őssejt-kutatás

Részletesebben

Allergia immunológiája 2012.

Allergia immunológiája 2012. Allergia immunológiája 2012. AZ IMMUNVÁLASZ SZEREPLŐI BIOLÓGIAI MEGKÖZELÍTÉS Az immunrendszer A fő ellenfelek /ellenségek/ Limfociták, makrofágok antitestek, stb külső és belső élősködők (fertőzés, daganat)

Részletesebben

Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig

Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig ELTE TTK Biológiai Intézet Budapest, 2015. okt. 7. Dr. Mócsai Attila Semmelweis Egyetem ÁOK Élettani Intézet

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

Lujber László és a szerző engedélyé

Lujber László és a szerző engedélyé Allergia genetikai háttere Dr. Szalai Csaba 2012. Szeptember 24. 1 Allergia: multifaktoriális vagy komplex betegség: Genetikai háttér (több száz gén, több ezer genetikai variáció) + környezeti tényezők

Részletesebben

Az emberi erőforrás értéke

Az emberi erőforrás értéke Szabó László SZABÓ LÁSZLÓ Az emberi erőforrás értéke A génvizsgálat, mint egészségügyi prevenció Az emberi tényező fontos elem a stratégiai kezdeményezésekben, a versenyelőny megszerzésében és megtartásában.

Részletesebben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben esirna mirtron BEVEZETÉS TÉMAKÖRÖK Ősi RNS világ RNS-ek tradicionális szerepben bevezetés BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek

Részletesebben

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend)

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) Országos Egészségbiztosítási Pénztár Elemzési, Orvosszakértői és Szakmai Ellenőrzési Főosztály Budapest, 2013. június 26.

Részletesebben

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Magyarósi Szilvia Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem DEMIN 2014. május 22.

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

Az agy betegségeinek molekuláris biológiája. 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5.

Az agy betegségeinek molekuláris biológiája. 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5. Az agy betegségeinek molekuláris biológiája 1. Prion betegség 2. Trinukleotid ripít betegségek 3. ALS 4. Parkinson kór 5. Alzheimer kór 28 Prion betegség A prion betegség fertőző formáját nem egy genetikai

Részletesebben

Veleszületett rendellenességek etiológiai csoportjai

Veleszületett rendellenességek etiológiai csoportjai MULTIFAKTORIÁLIS ÖRÖKLŐDÉS PRIMER IZOLÁLT RENDELLENESSÉGEK: MALFORMÁCIÓK ÉS GYAKORI FELNŐTTKORI KOMPLEX BETEGSÉGEK Veleszületett rendellenességek etiológiai csoportjai Kromoszóma rendellenességek és kisméretű

Részletesebben

A laboratóriumi medicina fejlődése az elmúlt 35 évben

A laboratóriumi medicina fejlődése az elmúlt 35 évben A laboratóriumi medicina fejlődése az elmúlt 35 évben Kovács L. Gábor egyetemi tanár, az MTA rendes tagja Pécsi Tudományegyetem 1976 2011? INTÉZETIGAZGATÓ PROFESSZOROK KLINIKAI KÉMIA 1976 Mérleg Spektrofotométer

Részletesebben

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan 11. évfolyam BIOLÓGIA 1. Az emberi test szabályozása Idegi szabályozás Hormonális szabályozás 2. Az érzékelés Szaglás, tapintás, látás, íz érzéklés, 3. Általános egészségügyi ismeretek az egyes témákhoz

Részletesebben

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök:

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök: Otthonápolás Cégegészség Fogorvos Homeopátia Online gyógyszertár RSS Iratkozzon fel RSS-csatornáinkra! KÖNYVAJÁNLÓ Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008.

Részletesebben

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk.

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A genetikai betegségek mellett, génterápia alkalmazható szerzett betegségek, mint

Részletesebben

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté!

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté! Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában Kiss Máté! Magreceptor Kutató Laboratórium Biokémiai és Molekuláris Biológiai Intézet Debreceni Egyetem, Általános Orvostudományi

Részletesebben

Immunológia I. 2. előadás. Kacskovics Imre (imre.kacskovics@ttk.elte.hu)

Immunológia I. 2. előadás. Kacskovics Imre (imre.kacskovics@ttk.elte.hu) Immunológia I. 2. előadás Kacskovics Imre (imre.kacskovics@ttk.elte.hu) Az immunválasz kialakulása A veleszületett és az adaptív immunválasz összefonódása A veleszületett immunválasz mechanizmusai A veleszületett

Részletesebben

Sejtfeldolgozás Felhasználás

Sejtfeldolgozás Felhasználás Sejtterápia Sejtfeldolgozás Felhasználás Fagyasztva tárolás Sejtmosás Alap sejtszelekció Komplex sejtszelekció Ex vivo sejtszaporítás Sejtaktiválás Immunizálás Génmodifikálás Köldökzsinórvér bank Limfocita

Részletesebben

A minimális sejt. Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására

A minimális sejt. Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására A minimális sejt Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására Anyagcsere Gánti kemoton elmélete Minimum sejt Top down: Meglevő szervezetek genomjából indulunk ki Bottom

Részletesebben

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data.

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data. Budapesti Műszaki és Gazdaságtudományi Egyetem Méréstechnika és Információs rendszerek Tanszék Adatelemzés intelligens módszerekkel Hullám Gábor Adatelemzés hagyományos megközelítésben I. Megválaszolandó

Részletesebben

HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS

HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS Dr. Mohamed Mahdi MD. MPH. Department of Infectology and Pediatric Immunology University of Debrecen (MHSC) 2012 Diagnózis HIV antitest teszt: A HIV ellen termel

Részletesebben

Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során

Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során Ungvári Erika, Tóth Ákos Magyar Infektológiai és Klinikai Mikrobiológiai

Részletesebben

Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter

Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter Ikerregiszterek és egy ikervizsgálat gyakorlati megszervezése Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter 1 Ikerregiszterek Önkéntes

Részletesebben

A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora

A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora A Gyógyszerészi gondozás szakképesítés szakgyógyszerész jelöltjeinek szakvizsga tételsora PÉCSI TUDOMÁNYEGYETEM 1. A gyógyszerészi gondozás kialakulásának történeti bemutatása, hátterében álló nemzetközi

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter Magyar Orvostudományi Napok 2013. november 6 8 Hotel Novotel Budapest (Alkotás utca 63 67) Rendező: Magyar Orvostársaságok és Egyesületek Szövetsége (MOTESZ) Programtervezet 2013. november 6. 10.00 Megnyitó

Részletesebben

Tudásmenedzsment és gyógyszerinnováció

Tudásmenedzsment és gyógyszerinnováció Tudásmenedzsment és gyógyszerinnováció Ipari szükségletek / elvárások Dr. Bátori Sándor Sanofi-aventis Innovatív Gyógyszerek Kutatása, MAGYOSZ, 2009.01.07. Alapvető együttm ttműködések Hosszútávú elhatározás:

Részletesebben

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5.

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. 0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. Az Élet keletkezése 6. Modellek a biológiában - csak az

Részletesebben

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin A géntechnikák alkalmazási területei leltár Géntechnika 3 Dr. Gruiz Katalin Kutatás Genetikai: genomok feltérképezése: HUGO, mikroorganizmusoké, ujjlenyomatok készítése, jellegzetes szekvenciák keresése

Részletesebben

A nyelv genetikai háttere

A nyelv genetikai háttere A nyelv genetikai háttere Szalontai Ádám ELTE Elméleti Nyelvészeti Doktori Program MTA Nyelvtudományi Intézet 2014. április 29. 1 / 41 Az előadás menete Genetikai bevezető Gének és nyelv elmélet KE család

Részletesebben

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik.

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. MUTÁCIÓK A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. Pontmutáció: A kromoszóma egy génjében pár nukleotidnál következik be változás.

Részletesebben

BIOINFORMATIKA Ungvári Ildikó

BIOINFORMATIKA Ungvári Ildikó 1 BIOINFORMATIKA Ungvári Ildikó Az elmúlt évtizedekben a molekuláris biológiai, genomikai technológiák robbanásszerű fejlődése a biológiai adatok mennyiségének exponenciális növekedéséhez vezetett. Ebben

Részletesebben

KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR

KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR MAI MENÜ Táplálkozás funkciói és hibái Egészség és táplálkozás Társadalmi igények Táplálkozás

Részletesebben

EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE. Falus András. Összefoglalás

EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE. Falus András. Összefoglalás 1 EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE Falus András Összefoglalás Az epigenetika, az örökítőanyag softvere Kovalens módosulások Anyai hatás és az egyedfejlődés Mitokondriális öröklés Táplálkozás

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1.

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1. Biobankok a Semmelweis Egyetemen Szalai Csaba 2009. július 1. Molnár Mária Judit MD, PhD A Semmelweis Egyetem Molekuláris Neurológiai Klinikai és Kutatási Központ igazgatója SE Molekuláris Neurológiai

Részletesebben

ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma, 1979-1983

ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma, 1979-1983 ÖNÉLETRAJZ Személyes adatok Név: Születési hely: Széll Márta Szeged Születési idő: 1965. március 28. Családi állapota: férjezett (Dr. Balogh Nándor) Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997)

Részletesebben

A HLTF koordinált fehérje és DNS átrendezése és aktivitásának összehasonlítása a Bloom szindróma helikáz fehérjével

A HLTF koordinált fehérje és DNS átrendezése és aktivitásának összehasonlítása a Bloom szindróma helikáz fehérjével A HLTF koordinált fehérje és DNS átrendezése és aktivitásának összehasonlítása a Bloom szindróma helikáz fehérjével Ph.D disszertáció tézisei Yathish Jagadheesh Achar Témavezető: Dr. Haracska Lajos Magyar

Részletesebben

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós Összefoglalás A humángenetika korunk egyik legdinamikusabban fejlődő tudományága. Ennek a fejlődésnek legfőbb mozgatórugója az, hogy a humángenetika,

Részletesebben

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN Kötelezı szinten tartó tanfolyam PÉCS 2009. október 14-16. PROGRAMFÜZET Kedves Kollégák! Közel egy évvel ezelıtt, 2008 júniusában

Részletesebben

Bayesi relevancia és hatáserősség mértékek. PhD tézisfüzet. Hullám Gábor. Dr. Strausz György, PhD (BME)

Bayesi relevancia és hatáserősség mértékek. PhD tézisfüzet. Hullám Gábor. Dr. Strausz György, PhD (BME) Budapesti Műszaki és Gazdaságtudományi Egyetem Méréstechnika és Információs Rendszerek Tanszék Bayesi relevancia és hatáserősség mértékek Hullám Gábor Témavezető: Dr. Strausz György, PhD (BME) Budapest,

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

Humán genom program. Raskó István, Magyar Tudomány 2002/5 589.o

Humán genom program. Raskó István, Magyar Tudomány 2002/5 589.o Nyitás az életre Humán genom program A különböző rasszoknál léteznek kisebb eltérések melyek nem manifesztálódnak betegségben, de növelik azok kockázatát, illetve jelentkezhet étel- és gyógyszerallergia

Részletesebben

Allergiás reakciók molekuláris mechanizmusa

Allergiás reakciók molekuláris mechanizmusa Allergiás reakciók molekuláris mechanizmusa Erdei Anna Eötvös Loránd Tudományegyetem Immunológiai Tanszék Biológiai Intézet Immunológiai Tanszék MLDT továbbképzés 2015. április 22., Honvéd Kórház Bp. Az

Részletesebben

Molekuláris terápiák

Molekuláris terápiák Molekuláris terápiák Aradi, János Balajthy, Zoltán Csősz, Éva Scholtz, Beáta Szatmári, István Tőzsér, József Varga, Tamás Szerkesztette Balajthy, Zoltán és Tőzsér, József, Debreceni Egyetem Molekuláris

Részletesebben

AZ IMMUNRENDSZER VÁLASZAI A HPV FERTŐZÉSSEL KAPCSOLATOS KÉRDÉSEINKRE RAJNAVÖLGYI ÉVA DE OEC Immunológiai Intézet

AZ IMMUNRENDSZER VÁLASZAI A HPV FERTŐZÉSSEL KAPCSOLATOS KÉRDÉSEINKRE RAJNAVÖLGYI ÉVA DE OEC Immunológiai Intézet AZ IMMUNRENDSZER VÁLASZAI A HPV FERTŐZÉSSEL KAPCSOLATOS KÉRDÉSEINKRE RAJNAVÖLGYI ÉVA DE OEC Immunológiai Intézet A méhnyak rák előfordulása / év / 100 000 nő WHO 2005 A KÓROKOZÓK ÉS AZ IMMUNRENDSZER KÉTIRÁNYÚ

Részletesebben

Sejtek - őssejtek dióhéjban. 2014. február. Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest

Sejtek - őssejtek dióhéjban. 2014. február. Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest Sejtek - őssejtek dióhéjban 2014. február Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest A legtöbb sejtünk osztódik, differenciálódik, elpusztul... vérsejtek Vannak

Részletesebben

ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS

ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS Mi az öregedés? Egyrészről az idő múlásával definiálható, a születéstől eltelt idővel mérhető, kronológiai sajátosságú, Másrészről az idő múlásához köthető biológiai,

Részletesebben

10. Genomika 2. Microarrayek és típusaik

10. Genomika 2. Microarrayek és típusaik 10. Genomika 2. 1. Microarray technikák és bioinformatikai vonatkozásaik Microarrayek és típusaik Korrelált génexpresszió mint a funkcionális genomika eszköze 2. Kombinált megközelítés a funkcionális genomikában

Részletesebben

A jövő záloga (a laboratóriumi medicinában is) a jelen oktatási rendszere. Muszbek László

A jövő záloga (a laboratóriumi medicinában is) a jelen oktatási rendszere. Muszbek László A jövő záloga (a laboratóriumi medicinában is) a jelen oktatási rendszere Muszbek László Debreceni Egyetem, Orvos és Egészségtudományi Centrum, Klinikai Kutató Központ Mi a laboratóriumi medicina? Az analítikai

Részletesebben

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 Recesszív öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság

Részletesebben

Fedezd fel a tested! Az egészségfejlesztés prevenciós szolgáltatáscsaládja az All-Fitt Kft. fejlesztésében.

Fedezd fel a tested! Az egészségfejlesztés prevenciós szolgáltatáscsaládja az All-Fitt Kft. fejlesztésében. Fedezd fel a tested! Az egészségfejlesztés prevenciós szolgáltatáscsaládja az All-Fitt Kft. fejlesztésében. Egészségfejlesztés fogalma egészségünk fokozottabb kézbentartására és tökéletesítésére. fizikai,

Részletesebben

A proteomika új tudománya és alkalmazása a rákdiagnosztikában

A proteomika új tudománya és alkalmazása a rákdiagnosztikában BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK A proteomika új tudománya és alkalmazása a rákdiagnosztikában Tárgyszavak: proteom; proteomika; rák; diagnosztika; molekuláris gyógyászat; biomarker;

Részletesebben

Mozgás - Gyógyszer TÁMOP-4.2.2/08/1-2008-0006

Mozgás - Gyógyszer TÁMOP-4.2.2/08/1-2008-0006 TÁMOP-4.2.2/08/1-2008-0006 Mozgás - Gyógyszer Varga Csaba, Puskás László G, Balogh László, Kovács Gyula, Kiss Gábor, Seres Erika, Pósa Anikó, Magyariné Berkó Anikó, Molnár Andor, Szablics Péter, Orbán

Részletesebben

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:

Részletesebben

B-sejtek szerepe az RA patológiás folyamataiban

B-sejtek szerepe az RA patológiás folyamataiban B-sejtek szerepe az RA patológiás folyamataiban Erdei Anna Biológiai Intézet Immunológiai Tanszék Eötvös Loránd Tudományegyetem Immunológiai Tanszék ORFI, Helia, 2015 április 17. RA kialakulása Gary S.

Részletesebben

Kórház összes (24. HBCS) közvetlen költsége (100%)» 3 kritikus HB. » 2 kritikus. » 10 tovább. » Hátrányos he

Kórház összes (24. HBCS) közvetlen költsége (100%)» 3 kritikus HB. » 2 kritikus. » 10 tovább. » Hátrányos he Értékelemzett t arthritis protokoll beillesztése komplex terápiába Ábrahám Sándor CVS Life, PVM Dr. Áts Kt Katalin, Dr. Gál János Mobil: +3 36 30 971 9532 mikroorg.absa@chello.hu Homok kóra diagram Kórház

Részletesebben

A biotechnológia alapjai A biotechnológia régen és ma. Pomázi Andrea

A biotechnológia alapjai A biotechnológia régen és ma. Pomázi Andrea A biotechnológia alapjai A biotechnológia régen és ma Pomázi Andrea A biotechnológia fogalma Alkalmazott biológia A fogalom állandó változásban van A biológia és a biotechnológia közötti különbség a méretekben

Részletesebben

2.1. Multifaktoriális betegségek általános jellemzői

2.1. Multifaktoriális betegségek általános jellemzői 2. Multifaktoriális betegségek általános jellemzői... 1 2.1. Multifaktoriális betegségek általános jellemzői... 1 2.2. Környezeti tényezők... 2 2.3. Miért fontos kutatni a multifaktoriális betegségek genomikai

Részletesebben

Uzsoki utcai Kórház III. Belgyógyászati Osztály. Dr. Gyarmati Dorottya

Uzsoki utcai Kórház III. Belgyógyászati Osztály. Dr. Gyarmati Dorottya Uzsoki utcai Kórház III. Belgyógyászati Osztály Dr. Gyarmati Dorottya Természetben előforduló előanyagok Ergocalciferol D2 vitamin Cholecalciferol - D3 vitamin Alfacalcidol Biológiailag aktív forma Calcitriol

Részletesebben

Szakmai zárójelentés

Szakmai zárójelentés Szakmai zárójelentés A témavezető neve: dr. Antus Balázs A téma címe: A bronchiolitis obliterans szindróma pathomechanizmusa OTKA nyilvántartási szám: F 046526 Kutatási időtartam: 2004-2008. A kutatási

Részletesebben

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi

Részletesebben

Új terápiás lehetőségek (receptorok) a kardiológiában

Új terápiás lehetőségek (receptorok) a kardiológiában Új terápiás lehetőségek (receptorok) a kardiológiában Édes István Kardiológiai Intézet, Debreceni Egyetem Kardiomiociták Ca 2+ anyagcseréje és új terápiás receptorok 2. 1. 3. 6. 6. 7. 4. 5. 8. 9. Ca

Részletesebben

2. SZ. SZAKMAI ÖSSZEFOGLALÓ PIR 2

2. SZ. SZAKMAI ÖSSZEFOGLALÓ PIR 2 Az Országos Onkológiai Intézet Norvég Finanszírozási mechanizmus keretében elnyert Kutatás Fejlesztési Pályázata Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon

Részletesebben

II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI. origamigroup BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA

II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI. origamigroup BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI origamigroup www.origami.co.hu II. A rheumatoid arthritis kezelésének általános

Részletesebben

Vezikuláris transzport

Vezikuláris transzport Molekuláris Sejtbiológia Vezikuláris transzport Dr. habil KŐHIDAI László Semmelweis Egyetem, Genetikai, Sejt- és Immunbiológiai Intézet 2005. november 3. Intracelluláris vezikul uláris transzport Kommunikáció

Részletesebben

Őssejtkezelés kardiovaszkuláris kórképekben

Őssejtkezelés kardiovaszkuláris kórképekben Őssejtkezelés kardiovaszkuláris kórképekben Papp Zoltán Debreceni Egyetem Kardiológiai Intézet Klinikai Fiziológiai Tanszék Megmenthető a károsodott szív őssejtekkel? Funkcionális változások az öregedő

Részletesebben

Magisztrális gyógyszerkészítés a Wilson kór terápiájában. Dr. Birinyi Péter Mikszáth Gyógyszertár 1088 Budapest, Mikszáth Kálmán tér 4.

Magisztrális gyógyszerkészítés a Wilson kór terápiájában. Dr. Birinyi Péter Mikszáth Gyógyszertár 1088 Budapest, Mikszáth Kálmán tér 4. Magisztrális gyógyszerkészítés a Wilson kór terápiájában Dr. Birinyi Péter Mikszáth Gyógyszertár 1088 Budapest, Mikszáth Kálmán tér 4. A Wilson kór mérföldkövei 1912. Wilson: Progressive lenticular degeneration:

Részletesebben

Katasztrófális antifoszfolipid szindróma

Katasztrófális antifoszfolipid szindróma Katasztrófális antifoszfolipid szindróma Gadó Klára Semmelweis Egyetem, I.sz. Belgyógyászati Klinika Antifoszfolipid szindróma Artériás és vénás thrombosis Habituális vetélés apl antitest jelenléte Mi

Részletesebben

Alkímia Ma. az anyagról mai szemmel, a régiek megszállottságával. http://www.chem.elte.hu/alkimia_2015_16 KÖZÉPISKOLAI KÉMIAI LAPOK

Alkímia Ma. az anyagról mai szemmel, a régiek megszállottságával. http://www.chem.elte.hu/alkimia_2015_16 KÖZÉPISKOLAI KÉMIAI LAPOK Alkímia Ma az anyagról mai szemmel, a régiek megszállottságával http://www.chem.elte.hu/alkimia_2015_16 KÖZÉPISKOLAI KÉMIAI LAPOK ALKÍMIA MA KVÍZ Schiller Róbert Te miért gondolod, hogy vannak molekulák?

Részletesebben

Hol tart ma a mikrobiom klinikai megítélése? Útmutató gasztroenterológusoknak. Vad Eszter ESzSzK Mikrobiológia 2016.04.16.

Hol tart ma a mikrobiom klinikai megítélése? Útmutató gasztroenterológusoknak. Vad Eszter ESzSzK Mikrobiológia 2016.04.16. Hol tart ma a mikrobiom klinikai megítélése? Útmutató gasztroenterológusoknak Vad Eszter ESzSzK Mikrobiológia 2016.04.16. Balatonalmádi A humán mikrobiom : Egy igaz történet Rólad és a legközelebbi barátaid

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

Szegedi Biológiai Kutatóközpont Tudományos Diákkör. Dr. Kiss Antal. kiss.antal(at)brc.mta.hu. http://www.brc.hu/

Szegedi Biológiai Kutatóközpont Tudományos Diákkör. Dr. Kiss Antal. kiss.antal(at)brc.mta.hu. http://www.brc.hu/ Szegedi Biológiai Kutatóközpont Tudományos Diákkör Tudományos Diákköri felelős: Dr. Kiss Antal Telefon: Email: Az Intézet honlapja: kiss.antal(at)brc.mta.hu http://www.brc.hu/ Farmakogenomikai kutatások

Részletesebben

A domináns öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

A domináns öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 A domináns öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság

Részletesebben

Néhány mondat a m á m j á b j e b t e eg e s g é s g é e g k e k g y g ó y g ó y g s y z s er e es e s k e k z e el e é l s é é s r é ől

Néhány mondat a m á m j á b j e b t e eg e s g é s g é e g k e k g y g ó y g ó y g s y z s er e es e s k e k z e el e é l s é é s r é ől Néhány mondat a májbetegségek gyógyszeres kezeléséről dr. Pár Gabriella PTE I. Belgyógyászati Klinika, Pécs A fontosabb májbetegségek Alkoholos zsirmáj - hepatitis - cirrhosis Krónikus B és C virus hepatitis

Részletesebben

ható gyógyszerjel Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26.

ható gyógyszerjel Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26. Légzőrendszerre ható gyógyszerjel gyszerjelöltek ltek hatásoss sossága Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26. Tudományos

Részletesebben

A HKO magyarázata és helye a komplementer medicina területén, hazai szabályozás, engedélyezés, továbbképzés joggyakorlata.

A HKO magyarázata és helye a komplementer medicina területén, hazai szabályozás, engedélyezés, továbbképzés joggyakorlata. Hagyományos Kínai Orvoslás és Kapcsolt technikái képzés 1.nap Bevezetés, tanfolyami ismertetés, beosztások. Tudományos eredmények a HKO mai állásáról, nemzetközi tanulmányok, értékelése, A HKO története,

Részletesebben

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban 11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban HIV fertőzés kimutatása - (fiktív) esettanulmány 35 éves nő, HIV fertőzöttség gyanúja. Két partner az elmúlt időszakban. Fertőzött-e

Részletesebben