Epigenetikaikutatások pszichiátriai vonatkozásai A modern biológia fejlődése február Falus András. populációk (Darwin)

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "2012.11.19. Epigenetikaikutatások pszichiátriai vonatkozásai 1850. A modern biológia fejlődése. 2001. február 15-16. Falus András. populációk (Darwin)"


1 Epigenetikaikutatások pszichiátriai vonatkozásai 1850 populációk (Darwin) A modern biológia fejlődése Egyedek (Mendel) 1900 sejtek tervezett élőlények (szintetikus biológia) kromoszómák gének, DNS modell (molekuláris biológia) modellek (systems biology) összes gén- genom genomika, proteomika Falus András február

2 Genetikai állományunk A genom Minden emberi testi sejtben 2x 23 kromoszóma ~ gén ~ 3.2 milliárd nukleotidbetű ~ 2m DNS sejt 7.7 fénynap!!! 2 m DNA cell 5.9 lightdays Élővilág megismerése evolúció Két fő motiváció Genetika & egészség/betegség A legfőbb orvosi problémák Társadalom öregedése Idegrendszeri betegségek Fertőzéses, gyulladási betegségek Elhízás/ cukorbetegség Allergia, asthma Szív- és érrendszeri betegségek Rák Komplex betegségek systems biology, bioinformatika 8 2

3 Egyesült Királyság Előrebecsült betegségek / lakos Ischaemiás szívhalál 4300 Szívinfarctus (új eset) 8250 Agyvérzéses halál 1100 Agyvérzés (új eset) 4500 Emlőrák (új eset) 6270 Vastagbélrák (új eset) 5410 Prostatarák (új eset) 3290 Cukorbetegség (új eset) %!! A genetika haszna Biotechnológia Diagnosztika Terápia. személyreszabott orvoslás Agyi degeneratív (új eset) 2000 METODIKAI REPERTOIRE TELJES GENOM VIZSGÁLAT Evolúciós és funkcionális elemek az emberi tumorokban GCAATCGATCTGGTACAGTAGCTA GCAATTGATCGGGTACATTAGCTA Hap-Map/ 20 millió pontmutáció GRO-seq FEHÉRJE FIZIKAI TECHNIKÁK Biofizika, nanofizika Nagy László ábrájából ADATBÁZISOK EXPRESSZIÓS MICROARRAY/CHIP NANOTECHNOLÓGIA, Szilárd Fázisú KÉMIA NYELVÉSZET ELJÁRÁSOK BIOINFORMATIKA GÉNHÁLÓZATOK- ÚTVONAL ANALÍZIS 3

4 Hagyományos biológia Rendszer-szemléletű biológia A DNS szekvencia adatok megkétszereződnek 18 havonta A megismert genomok száma duplázódik 18 havonta A szekvenálás költségei a feleződnek 18 havonta Pongor Sándor ábrája 10 év múlva? Személyre szabott orvoslás! Fejlett genetikai diagnosztika Fejlett számítógépes adatelemzés Szoros együttműködés orvos és páciens között Személyre szabott védőoltások 4

5 Genome-wide associations studies December, studies,p<5x markers 1000 genom project NHGRI GWA Catalog 17 Nem várt fejlemények: missing heritability Az emberi DNS elemeinek enciklopédiája Etnikai eltérések Multifaktoriális fenotípusok (betegségek) - hálózati hatások Környezeti hatások (epigenetika)-reverzibilitás Kódoló-nem kódoló Ritka és nagy hatású vs gyakori és kishatású allélek Metagenomika- genomok szimbiózisa (microbiom) 5

6 Fenotípus Fehérje Fenotípus mrns Fehérje mrns Gén DNS Gén Azonos gének különbözó génexpresszió + GWAS- teljes genom megközelítés Környezeti változás Koronária szűkület Több generáción át ható (ártalmas) környezeti hatás Asztma rizikó KOR Anya- 1. generáció Magzat- 2. generáció Magzat reproduktív sejtjei- 3. generáció 23 Li et al. Maternal and grandmaternal smoking patterns are associated with early childhood asthma. Chest 2005;127:

7 heterokromatin CpG-metiláció Hiszton-acetiláció eukromatin Nagymértékben összetekeredett nukleotidszál, kikapcsolt gének Kitekeredett nukleotidszál, bekapcsolt gének 7

8 Biokibernetikai gondolat Metiláció De-acetiláció De-metiláció Acetiláció számítógép REVERZIBILIS FOLYAMAT!! biológiai rendszer Epigenetikai faktorok ontogenesis-anyai hatás táplálkozás gyógyszerek, mérgek fertőzés, besugárzás fizikai aktivitás fény zene stress, magatartási-, lelki-, meditatív hatások Metabolikus fenotípus táplálkozás TÁPLÁLKOZÁSI PROGRAMOZÁS TERHESSÉG ÉS SZOPTATÁS IDEJÉN DNS metiláció, stb) Öröklődik a következő generációban 8

9 EVOLÚCIÓS IRÁNY?? Az eltérő genetikai háttér következményei csak környezeti hatásra (pl. fertőzés) manifesztálódnak veszély-érzékelő receptor endotoxin receptor Lehetséges epigenetikus hatással rendelkező pszichoszociális tényezők Epigenetikus hatású szociális tapasztalatok Szülői magatartás Krónikus stressz Életmód Purebl György ábrája Champagne, F. A. (2010) Dev Psychobiol 52: Purebl György ábrája 9

10 Szülői magatartás - rágcsálók Magas anyai anyai gondoskodás kisebb hippokampális GR1 7 promotor metiláció, erősebb GR expresszió, csökkent stresszelhetőség 1,2 Alacsony gondoskodásnál ERalpha össztrogénreceptor csökkent expressziója, felnőttkorban is - ennek aktivitása készíti részben fel a nőstényt az anyai viselkedésre 3,4 Szülői magatartás - ember Gyermekkori abúzuson átesett öngyilkosok post mortem vizsgálatában alacsonyabb hippocampalis elemezve GR expresszió, magasabb fokú GR1F promotor metiláció 1 Egészséges felnőttek periferiás vér mononukleáris sejtjeiben hasonlították össze a GR response elementet tartalmazó géneket a gyermekkorban alacsony SES-sel rendelkező személyeknél down regulációja 2 A IV BDNF prompotor régióban a prefrontális kéregben emelkedett metiláció, zebularine alkalmazásával (metiláció inhibitor) a BDNF a nem abuzált kölykök szintjére emelhető 5 1 McGowan és mtsai (2009). Nat Neurosci, 12(3), Weaver et al (2004). Nat Neurosci 7(8): Szyf et al (2005). Front Neuroendocrinol 26(3-4): Miller és mtsai (2009). PNAS 106(34), ,4 Champagne et al (2003, 2006) Physioll Behav, 79(3), Biol Psychiat, 59(12), Roth et al (2009). Biol Psychiat, 65(9), Purebl György ábrája Purebl György ábrája Gyermekkori stressz és védettség Szociális izoláció magasabb kortizolszint, gyengült immunológiai fittness rhesusmajmokban 1 Fizikailag és inspiráló ingerekben is gazdag környezet növeli a szinaptikus plaszticitást, csökkenti a szorongásosságot és javítja a gondolkodást 2 Védett és pozitív ingerekben gazdag környezetben a cortizolszint és stressz gátolt szociális viselkedés patkányban javul 3, és javul az anyai viselkedés színvonala is 4,5 A gyermekkori gazdag és inspiratív környezet és felnőttkori egészség: Huntington transzgénikus egerekben késleltette a BDNF csökkenés szintjét és a tünetek kialakulását 6 Felnőttkori epigenetikus hatások a magatartásra Szociális alulmaradási kísérletek (rágcsálók) HPA aktivitás növekedése, depresszió egyik állatkísérletes modaellje 1,2,3 A stresszhatások feltehetően a BDNF transzkripciós aktivitása keresztül érvényesülnek 4 A nc accumbensben a histone H3-K27 dimetilációja és deacetilálódása mint legyőzöttség mind izoláció esetén 5 1 Gordon és mtsai (1992) Physiology and Behav 51(3), Nithianantharajah & Hannan (2006). Nat Rev Neurosci 7(9), ) 3 Morley-Fletcher és mtsai (2003) Eu J Neurosci18(12), ). 4,5 Bredy és mtsai (2003, 2004) Neurosci, 118(2), Eu J Neurosci 20(5), Hockly és mtsai (2002) Ann Neurol 51(2), Purebl György ábrája 1 Meerlo és mtsai (1996) Stress 1(1), Blanchard és mtsai (1993). Behav Brain Res 58(1 2), Keeney és mtsai (2006). J Neuroendocrin 18(5), Tsankova és mtsai (2006) Nat Neurosci, 9(4), Wilkinson és mtsai (2009). J Neurosci 29(24), Purebl György ábrája 10

11 hippocampus Charney: Behavior genetics and postgenomics BEHAVIORAL AND BRAIN SCIENCES (2012) 35: Szociális környezet Szociális jelátvitel betegség/egészség Social processes IL6 mrns DNS CNS function Peripheral neurobiology Gén Cell signal transduction Transcription factors Genome 11

12 FEJLŐDÉSI ÁLLAPOT Waddington, 1942 totipotent pluripotent multipotent unipotent Az egyedfejlődés irreverzibilis? REPROGRAMOZÁS INDUKÁLT PLURIPOTENS ŐSSEJTEK Orvosi Nobel díj, október 8. Sir John B. Gurdon Shinya Yamanaka 12

13 Dolly: szül július Anyai testi sejt Telomerák rövidülése Arthritis Pulmonáris Adenocarcinoma Petesejt Sejtmag átültetés Feb 14, 2003 Dolly elpusztult Dolly egy hatéves juh genetikai anyagát kapta egy petesejtben Az epigenetikai programozási mintázat nem volt megfelelő. Fenotípus Fehérje Fenotípus Fenotípus Fehérje Fenotípus mrns Fehérje mrns mrns Fehérje mrns Gén DNS Gén Gén DNS Gén 13

14 Ornish D, Lin J, Daubenmier J, Weidner G, Epel E, Kemp C, Magbanua MJ, Marlin R, Yglecias L, Carroll PR, Blackburn EH. Department of Medicine, University of California, San Francisco, CA, USA. Increased telomerase activity and comprehensive lifestyle changes: a pilot study. Lancet Oncol Nov;9(11): Epub 2008 Sep 15. Genetika-epigenetika Az öröklődés (hajlam) lényegében irreverzibilis Az epigenetikai hatások nagyrésze reverzibilis AZ ÉLETMÓD VÁLTOZTATÁS ÓRIÁSI JELENTŐSÉGE!!! Küldetés nyilatkozat Prof. Dr. Kopp Mária A magyar társadalom jelenlegi egészségi állapota és távlati kilátásai minden felelősen gondolkodó számára kötelező feladatokat jelölnek ki. Ezért mi, pedagógusok, orvosok, biológusok, pszichológusok, szociológusok, bioetikusok és egészségpolitikai szakemberek életre hívtuk az EDUVITAL Nonprofit Egészségnevelési Társaságot. Folyt. 14

15 PEDAGÓGUSOK biológia-egészségtan, osztályfőnök tanárok, tanítók nevelési tanácsadók Primer célcsoportok LELKÉSZEK EÜ. SZAKEMBEREK védőnők házi/gyerek/orvosok szociális munkások KISEBBSÉGI SZERVEZETEK FIATAL TÁRSADALOM ÚJSÁGÍRÓK EDUVITAL TUDOMÁNYOS TESTÜLET Dr. Antal Emese, táplálkozástudomány, a Magyar Dietetikusok Országos Szövetségének elnöke Dr. Ádány Róza, egyetemi tanár, népegészségtan, WHO "Társadalmi Sebezhetőség és Egészség" Kollaborációs Központ vezetője Dr. Bagdy Emőke professzor emeritus, pszichológia, Károli Gáspár Református Egyetem, Személyiség és Klinikai Pszichológiai Tanszék, pszichológia Dr. Cseh Károly, egyetemi tanár, Semmelweis Egyetem Népegészségtani Intézet, munka- és foglalkozás egészségügy Dr. Falus András, alapító, egyetemi tanár, akadémikus, Semmelweis Egyetem Genetikai, Sejt és Immunbiológiai Intézet, biológus, genetikus, genetika, epigenetika Járóka Lívia, a Roma Education Fund képviselője, EU Parlamenti képviselő, kisebbségi/roma/ ügy Dr. Kalabay László, PhD, egyetemi tanár, Semmelweis Egyetem, Családorvosi Tanszék, családorvoslás Dr. Kopp Mária, alapító, egyetemi tanár, pszichológus, orvos Dr. Madarasi Anna, PhD,, osztályvezető főorvos, Szent János Kórház, gyermekgyógyász Dr. Mészáros Judit, egyetemi tanár, Semmelweis Egyetem Egészségtudományi Kar dékánja, eü.szakdolgozók Dr. Molnár Mária Judit, egyetemi tanár, Semmelweis Egyetem Molekuláris Neurológiai Központ, neurogenetika és ritka betegségek Nagyné Horváth Emília, pedagógus, az Egészségtan oktatás országos koordinátora, egészségtan oktatás Nagy Tímea, olimpiai- és világbajnok párbajtőrvívó, sport, gyógypedagógia Dr. Oberfrank Ferenc, egyetemi tanár, Kísérleti Orvostudományi Kutató Intézet, bioetika Dr. Somhegyi Annamária prevenciós igazgató, testnevelés, mozgás Dr. Tompa Anna, egyetemi tanár, Semmelweis Egyetem, Népegészségtani Intézet, prevenciós orvostudomány, toxikológia, népegészségtan Dr. Túry Ferenc egyetemi tanár, Semmelweis Egyetem, Magatartástudományi Intézet, pszichiátria Dr. Varga Péter Pál, Országos Gerincgyógyászati Központ vezető főorvosa, mozgás-és sporttudomány TEMATIKAI MODULOK I. (és kombinációik) Genetika és epigenetika, örökölt és szerzett tulajdonságok, rendszerbiológia, biológiai hálózatok, evolúciós szemlélet Iskolai környezet-és egészségvédelem, az egészségtan oktatása Közegészségbiológiai és toxikológiai alapfogalmak, prevenció és egészségtudatosság Táplálkozásbiológia, dietetika, evészavarok A testnevelés és a sport szerepe az emberi egészségben A roma-és hátrányos helyzetű közösségek egészségnevelési feladatai, cigánypasztoráció Kábítószerek, alkohol-és drogfüggés, drogprevenció TEMATIKAI MODULOK II. (és kombinációik) Örökletes és szerzett elemek gyermek-és ifjúkori betegségekben, védőoltások, sürgősségi helyzetek A lelki működés alapfogalmai, szülői magatartás, stress Életmód és világnézet, a főbb világvallások és az emberi egészség kapcsolata Testi és mentális higiénia: szezonális biológiai és pszichológiai hatások A szexuálitás, életmód és szexuális nevelés, etika és szociológia A modern biológia és az egészségmegőrzés, bioetikai kihívások Az egészség fogalma és mitosza a közmédiákban 15

16 Ismerje meg az EDUVITAL NET képzéseit, programjait, célkitűzéseit! Csatlakozzon hozzánk! EDUVITAL NET Nonprofit Egészségnevelési Társaság 1089 Budapest, Nagyvárad tér (1) , +36 (1)

A genomiális medicina szép új világa

A genomiális medicina szép új világa A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012 2014 2015. ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet A medicina


www.eduvital.net "Soha sem késő"! Megoldások a felnőttkori egészségnevelésből Falus András

www.eduvital.net Soha sem késő! Megoldások a felnőttkori egészségnevelésből Falus András www.eduvital.net "Soha sem késő"! Megoldások a felnőttkori egészségnevelésből Falus András Az EDUVITAL koncepció és gyakorlat www.eduvital.net Mit tanít az EDUVITAL csapata? Küldetés nyilatkozat A magyar


Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához?

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Falus András Genetikai, Sejt- és Immunbiológiai Intézet Semmelweis Egyetem Antal Péter Hadadi Éva


ETK-EDUVITAL ELŐADÁSSOROZAT. Vas utcai délutánok. 2014/2015 II. félév és 2015/2016 I. félév

ETK-EDUVITAL ELŐADÁSSOROZAT. Vas utcai délutánok. 2014/2015 II. félév és 2015/2016 I. félév ETK-EDUVITAL ELŐADÁSSOROZAT Vas utcai délutánok 2015 2014/2015 II. félév és 2015/2016 I. félév Összeállította: Dr. Urbán Veronika főiskolai tanár Semmelweis Egyetem, Egészségtudományi Kar, Alapozó Egészségtudományi


...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról

...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról ...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról Nem szeretjük az orvosságokat, nem szeretjük a kést, fejcsóválva állunk a nem túl fényes egészségügyi mutatók felett...


Epigenetikai Szabályozás

Epigenetikai Szabályozás Epigenetikai Szabályozás Kromatin alapegysége a nukleoszóma 1. DNS Linker DNS Nukleoszóma mag H1 DNS 10 nm 30 nm Nukleoszóma gyöngy (4x2 hiszton molekula + 146 nukleotid pár) 10 nm-es szál 30 nm-es szál


A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató


Tanárképzés főiskolai és egyetemi szinten. Egészségtan tanár (1995-2005) kb. 1000-1200 fő Egészségfejlesztés-tanár MA ( 2005-) képzés kb 150 fő

Tanárképzés főiskolai és egyetemi szinten. Egészségtan tanár (1995-2005) kb. 1000-1200 fő Egészségfejlesztés-tanár MA ( 2005-) képzés kb 150 fő Tanárképzés főiskolai és egyetemi szinten. Egészségtan tanár (1995-2005) kb. 1000-1200 fő Egészségfejlesztés-tanár MA ( 2005-) képzés kb 150 fő Szakterületi ismeretek Az egészségfejlesztés célja, fogalma,


12. évfolyam esti, levelező

12. évfolyam esti, levelező 12. évfolyam esti, levelező I. ÖKOLÓGIA EGYED FELETTI SZERVEZŐDÉSI SZINTEK 1. A populációk jellemzése, növekedése 2. A populációk környezete, tűrőképesség 3. Az élettelen környezeti tényezők: fény hőmérséklet,


Tudományos program. Fővédnök: Lovász László, az MTA elnöke

Tudományos program. Fővédnök: Lovász László, az MTA elnöke MAGYAR ORVOSTUDOMÁNYI NAPOK 2014. november 5-7 Hotel Novotel Budapest, 1123 Alkotás u. 63-67 Rendező: Magyar Orvostársaságok és Egyesületek Szövetsége (MOTESZ) Tudományos program Fővédnök: Lovász László,


Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45


HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember


Humán genom variációk single nucleotide polymorphism (SNP)

Humán genom variációk single nucleotide polymorphism (SNP) Humán genom variációk single nucleotide polymorphism (SNP) A genom ~ 97 %-a két különböző egyedben teljesen azonos ~ 1% különbség: SNP miatt ~2% különbség: kópiaszámbeli eltérés, deléciók miatt 11-12 millió


TARTALOM. 1. Bevezetés 2. A viselkedés genetikája 3. A viselkedés evolúciója

TARTALOM. 1. Bevezetés 2. A viselkedés genetikája 3. A viselkedés evolúciója GÉNEK ÉS VISELKEDÉS TARTALOM 1. Bevezetés 2. A viselkedés genetikája 3. A viselkedés evolúciója 1. BEVEZETÉS Ok és Okozat 1 Agy Viselkedés DNS Környezet Test: mereven huzalozott szabályok; agy: plasztikus


Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet erhesség és emlőrák genetikai szempontok Kosztolányi yörgy PE Orvosi enetikai Intézet Előfordulás 1 emlőrák / 3000 várandós fokozódása várható: öröklődő emlőrák diagnózisa családon belül : I. generáció


Dr. Herényi Levente egyetemi docens Biofizikai és Sugárbiológiai Intézet 1094 Budapest, Tűzoltó u. 37-47.

Dr. Herényi Levente egyetemi docens Biofizikai és Sugárbiológiai Intézet 1094 Budapest, Tűzoltó u. 37-47. I. évfolyam MATEMA TIKA BIOFIZIKA ÁLTALÁNOS ÉS SZERVETLEN KÉMIA GYÓGYSZERÉSZI NÖVÉNYTAN BIOLÓGIA TUDOMÁNYTÖRTÉNE T ÉS PROPEDEUTIKA, a 2. félévben heti 1 óra Dr. Gergó Lajos egyetemi docens 1092 Budapest,



ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT


4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program

4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program 4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program Kurzusvezetö és kurzuscím 4101-K A magatartás modellezése neurokémiája és gyógyszeres befolyásolása. (magyar) (Dr. Bagdy György)


Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Magyarósi Szilvia Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem DEMIN 2014. május 22.


Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes.

Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes. Múlt órán: Lehetséges tesztfeladatok: Kitől származik a variáció-szelekció paradigma, mely szerint az egyéni, javarészt öröklött különbségek között a társadalmi harc válogat? Fromm-Reichmann Mill Gallton


3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan 11. évfolyam BIOLÓGIA 1. Az emberi test szabályozása Idegi szabályozás Hormonális szabályozás 2. Az érzékelés Szaglás, tapintás, látás, íz érzéklés, 3. Általános egészségügyi ismeretek az egyes témákhoz


Új utak az antipszichotikus gyógyszerek fejlesztésében

Új utak az antipszichotikus gyógyszerek fejlesztésében Új utak az antipszichotikus gyógyszerek fejlesztésében SCHIZO-08 projekt Dr. Zahuczky Gábor, PhD, ügyvezető igazgató UD-GenoMed Kft. Debrecen, 2010. november 22. A múlt orvostudománya Mindenkinek ugyanaz





0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5.

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. 0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. Az Élet keletkezése 6. Modellek a biológiában - csak az


Munkatársi, munkahelyi kapcsolatok Stressz mint cardiovasculáris rizikófaktor. Lang Erzsébet Vasútegészségügy NK. Kft.

Munkatársi, munkahelyi kapcsolatok Stressz mint cardiovasculáris rizikófaktor. Lang Erzsébet Vasútegészségügy NK. Kft. Munkatársi, munkahelyi kapcsolatok Stressz mint cardiovasculáris rizikófaktor Lang Erzsébet Vasútegészségügy NK. Kft. Pécs Kardiológia ????? Miért??? Lehet, hogy külön utakon járunk?! Együtt könnyebb?


Az egészség fogalma, az egészségi állapotot meghatározó tényezık. A holisztikus egészségszemlélet dimenziói és ezek jellemzıi. /II.

Az egészség fogalma, az egészségi állapotot meghatározó tényezık. A holisztikus egészségszemlélet dimenziói és ezek jellemzıi. /II. Az egészség fogalma, az egészségi állapotot meghatározó tényezık. A holisztikus egészségszemlélet dimenziói és ezek jellemzıi. /II. Tétel/ Ihász Ferenc PhD. Nyugat-magyarországi Egyetem Apáczai Csere János


A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)


Természetes szelekció és adaptáció

Természetes szelekció és adaptáció Természetes szelekció és adaptáció Amiről szó lesz öröklődő és variábilis fenotípus természetes szelekció adaptáció evolúció 2. Természetes szelekció Miért fontos a természetes szelekció (TSZ)? 1. C.R.


TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK



BIOLÓGIA OSZTÁLYOZÓ VIZSGA ÉS JAVÍTÓVIZSGA KÖVETELMÉNYEK (2016) BIOLÓGIA OSZTÁLYOZÓ VIZSGA ÉS JAVÍTÓVIZSGA KÖVETELMÉNYEK (2016) 1 Biológia tantárgyból mindhárom évfolyamon (10.-11.-12.) írásbeli és szóbeli vizsga van. A vizsga részei írásbeli szóbeli Írásbeli Szóbeli


Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást


Figyelemhiány/Hiperaktivitás Zavar - ADHD TÁJÉKOZTATÓ FÜZET. ADHD-s gyermekek családjai részére

Figyelemhiány/Hiperaktivitás Zavar - ADHD TÁJÉKOZTATÓ FÜZET. ADHD-s gyermekek családjai részére Figyelemhiány/Hiperaktivitás Zavar - ADHD TÁJÉKOZTATÓ FÜZET ADHD-s gyermekek családjai részére KEZELÉSI TÁJÉKOZTATÓ FÜZET Ezt a tájékoztató füzetet azért készítettük, hogy segítsünk a FIGYELEMHIÁNY/HIPERAKTIVITÁS


11. évfolyam esti, levelező

11. évfolyam esti, levelező 11. évfolyam esti, levelező I. AZ EMBER ÉLETMŰKÖDÉSEI II. ÖNSZABÁLYOZÁS, ÖNREPRODUKCIÓ 1. A szabályozás információelméleti vonatkozásai és a sejtszintű folyamatok (szabályozás és vezérlés, az idegsejt


A domináns öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

A domináns öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 A domináns öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság


Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai Kar: TTK Tantárgy: CITOGENETIKA Kód: AOMBCGE3 ECTS Kredit: 3 A tantárgyat oktató intézet: TTK Mikrobiális Biotechnológiai és Sejtbiológiai Tanszék A tantárgy felvételére ajánlott félév: 3. Melyik félévben


Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter Magyar Orvostudományi Napok 2013. november 6 8 Hotel Novotel Budapest (Alkotás utca 63 67) Rendező: Magyar Orvostársaságok és Egyesületek Szövetsége (MOTESZ) Programtervezet 2013. november 6. 10.00 Megnyitó


Az autonómia és complience, a fogyatékosság elfogadtatásának módszerei

Az autonómia és complience, a fogyatékosság elfogadtatásának módszerei Az autonómia és complience, a fogyatékosság elfogadtatásának módszerei Dr. Kollár János egyetemi adjunktus Debreceni Egyetem Orvos- és Egészségtudományi Centrum, Népegészségügyi Kar Magatartástudományi


Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi


Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök:

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök: Otthonápolás Cégegészség Fogorvos Homeopátia Online gyógyszertár RSS Iratkozzon fel RSS-csatornáinkra! KÖNYVAJÁNLÓ Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008.


Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem Tisztelt Hölgyem, Tisztelt Uram! Örömmel jelentjük be Önöknek, hogy a Genomikai Medicina és Ritka Betegségek Intézetének egyik új projektje azon betegségek genetikai hátterének feltérképezésére irányul,


A 2014/2015-ös tanévben hallgatói jogviszonyt létesítő hallgatók kurrikuluma felmenő rendszerben

A 2014/2015-ös tanévben hallgatói jogviszonyt létesítő hallgatók kurrikuluma felmenő rendszerben A 2014/2015-ös tanévben hallgatói jogviszonyt létesítő hallgatók kurrikuluma felmenő rendszerben A tantárgy elnevezése Kreditkó Előtanulmány Számonkérés d ELMÉLETI MODUL 1. szemeszter kötelező Anatómia,


0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5.

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. 0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. Az Élet keletkezése 6. Modellek a biológiában - csak az


GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:


Apor Vilmos Katolikus Iskolaközpont Helyi tanterv Szabadon választható tantárgy: biológia 11-12. évfolyam

Apor Vilmos Katolikus Iskolaközpont Helyi tanterv Szabadon választható tantárgy: biológia 11-12. évfolyam 1 Apor Vilmos Katolikus Iskolaközpont Helyi tanterv Szabadon választható tantárgy: biológia 11-12. évfolyam 2 Tantárgyi struktúra és óraszámok A tantárgy heti óraszáma A tantárgy éves óraszáma 11. évfolyam


Az első 1000 nap táplálási és gondozási szempontjai a bio-pszicho-szociális modell alapján

Az első 1000 nap táplálási és gondozási szempontjai a bio-pszicho-szociális modell alapján Az első 1000 nap táplálási és gondozási szempontjai a bio-pszicho-szociális modell alapján Dr. Scheuring Noémi Heim Pál Gyermekkórház, Budapest Kávészünet-17 Házi Gyermekorvosok Egyesülete XVII. Tudományos


Epigenetika kihívások az ökotoxikológiában

Epigenetika kihívások az ökotoxikológiában Epigenetika kihívások az ökotoxikológiában Bakonyi Gábor és Szabó Borbála Szent István Egyetem, Gödöllő Állattani és Állatökológiai Tanszék V. ÖKOTOXIKOLÓGIAI KONFERENCIA, MAGYAR ÖKOTOXIKOLÓGIAI TÁRSASÁG,


Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 Recesszív öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság


A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85


Semmelweis Egyetem VIII. Infektológiai Továbbképző Tanfolyam

Semmelweis Egyetem VIII. Infektológiai Továbbképző Tanfolyam 2015. március 20 21. Fókuszban az antibiotikum terápia PROGRAM 2015. MÁRCIUS 20. PÉNTEK 07.30 09.00 Regisztráció 09.00 09.30 Antibiotikum kezelés jelene és jövője 09.30 10.00 10.00 10.30 Prof. Dr. Ludwig


Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon


Magyar Gyermeknőgyógyász Társaság XXXI. Kongresszusa 2011. május 13-14. Gyula

Magyar Gyermeknőgyógyász Társaság XXXI. Kongresszusa 2011. május 13-14. Gyula Magyar Gyermeknőgyógyász Társaság XXXI. Kongresszusa 2011. május 13-14. Gyula 2011. május 13. Péntek: 08:0010:00-10:30 Regisztráció Megnyitó, köszöntők Dr. Párducz László a Békés Megyei Pándy Kálmán Kórház


Transzgénikus. nikus állatok. Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk bejuttatott DNS-t t tartalmaz.

Transzgénikus. nikus állatok. Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk bejuttatott DNS-t t tartalmaz. Transzgénikus nikus állatok Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk zremüködéssel bejuttatott DNS-t t tartalmaz. I. A KONKRÉT T GÉNSEBG NSEBÉSZETI SZETI TECHNIKA A beavatkozást


A meddőség a páciensek szemszögéből. Borján Eszter Semmelweis Egyetem Egészségtudományi Kar Ápolástan Tanszék

A meddőség a páciensek szemszögéből. Borján Eszter Semmelweis Egyetem Egészségtudományi Kar Ápolástan Tanszék A meddőség a páciensek szemszögéből Borján Eszter Semmelweis Egyetem Egészségtudományi Kar Ápolástan Tanszék Egészség - betegség Az egészség nem csupán a betegség és nyomorékság hiánya, hanem a teljes


Johann Gregor Mendel Az olmüci (Olomouc) és bécsi egyetem diákja Brünni ágostonrendi apát (nem szovjet tudós) Tudatos és nagyon alapos kutat

Johann Gregor Mendel Az olmüci (Olomouc) és bécsi egyetem diákja Brünni ágostonrendi apát (nem szovjet tudós) Tudatos és nagyon alapos kutat 10.2.2010 genmisk1 1 Áttekintés Mendel és a mendeli törvények Mendel előtt és körül A genetika törvényeinek újbóli felfedezése és a kromoszómák Watson és Crick a molekuláris biológoa központi dogmája 10.2.2010


dr. Gábriel Róbert államvizsga témák:

dr. Gábriel Róbert államvizsga témák: dr. Gábriel Róbert államvizsga témák: 1. Diabeteszes retinopátia vizsgálata kísérleti állatmodellekben 2. Retinális ishemia vizsgálata kísérleti állatmodelleken 3. Peptidek és peptid analógok által mediált


Egészséggel kapcsolatos nézetek, hiedelmek, modellek, egészségvédő magatartásformák

Egészséggel kapcsolatos nézetek, hiedelmek, modellek, egészségvédő magatartásformák Egészséggel kapcsolatos nézetek, hiedelmek, modellek, egészségvédő magatartásformák Orvosi pszichológia előadás 2. hét Merza Katalin merza.katalin@sph.unideb.hu Egészségmagatartás fogalma Minden olyan


Molekuláris Medicina

Molekuláris Medicina Molekuláris Medicina Molekuláris Medicina Őssejt terápia Génterápia Tumor terápia Immunterápia Egyéb terápiák Vakcinák Genetikai diagnosztika Orvosi genomika Terápiák Diagnosztikák Orvostudomány: régi


A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában

A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában Budapest, 2014. február 22. Ritka Betegségek Világnapja A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában dr. Kósa János PentaCore Laboratórium, Budapest Semmelweis Egyetem I. sz.


Szorongás és depresszió a reprodukciós problémával küzdő nők körében

Szorongás és depresszió a reprodukciós problémával küzdő nők körében Szorongás és depresszió a reprodukciós problémával küzdő nők körében Lakatos Enikő¹, ², Balog Piroska¹ ¹Semmelweis Egyetem Magatartástudományi Intézet, Budapest ²Semmelweis Egyetem Mentális Egészségtudományok


1. Emlődaganatok neoadjuváns kezelésének hatása a műtéti technikára Témavezető: Dr. Harsányi László PhD egyetemi docens

1. Emlődaganatok neoadjuváns kezelésének hatása a műtéti technikára Témavezető: Dr. Harsányi László PhD egyetemi docens SZAKDOLGOZAT TÉMAJAVASLATOK A 2012/2013 tanévre Semmelweis Egyetem Általános Orvostudományi Kar I. sz. Sebészeti Klinika SEBÉSZET 1. Emlődaganatok neoadjuváns kezelésének hatása a műtéti technikára 2.


Állatorvos-tudományi Kar Évfolyam szintű heti órarend 2013/2014-s tanév, 2. félév Biológia BSc képzés: I. Évfolyam

Állatorvos-tudományi Kar Évfolyam szintű heti órarend 2013/2014-s tanév, 2. félév Biológia BSc képzés: I. Évfolyam Biológia BSc képzés: I. Évfolyam NÖVÉNYRENDSZERTAN NÖVÉNYRENDSZERTAN BIOMATEMATIKA HEFOP 2. KÉMIA ÁLLATSZERVEZETTAN ÁLLATSZERVEZETTAN BIOMATEMATIKA Előadás HEFOP 2. KÉMIA FÖLDTUDOMÁNYOK elmélet FIZIKA


Vezető betegségek Magyarországon. Szív-érrendszeri betegségek és magasvérnyomás Civilizációs ártalmak?

Vezető betegségek Magyarországon. Szív-érrendszeri betegségek és magasvérnyomás Civilizációs ártalmak? Vezető betegségek Magyarországon Szív-érrendszeri betegségek és magasvérnyomás Civilizációs ártalmak? Megválaszolandó Kérdések Melyek azok a betegségek amelyek a ranglistát vezetik? Mennyire vagyunk felelősek


Az egészségügyi gondozás és prevenció alapszak MINTATANTERVE 2006/2007

Az egészségügyi gondozás és prevenció alapszak MINTATANTERVE 2006/2007 Az egészségügyi gondozás és prevenció alapszak MINTATANTERVE 2006/2007 1 EF30003 Anatómia I. # kollokvium 42 28 3+2 köt. 1 EF30001 Biokémia I. (Kémiai, biokémiai általános alapfogalmak) #& kollokvium 14


I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.


Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter

Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter Ikerregiszterek és egy ikervizsgálat gyakorlati megszervezése Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter 1 Ikerregiszterek Önkéntes


Babeş Bolyai Tudományegyetem, Kolozsvár Szociológia és Szociális Munka Kar. Egészségpszichológia és közegészségtan dr.

Babeş Bolyai Tudományegyetem, Kolozsvár Szociológia és Szociális Munka Kar. Egészségpszichológia és közegészségtan dr. Babeş Bolyai Tudományegyetem, Kolozsvár Szociológia és Szociális Munka Kar Egészségpszichológia és közegészségtan dr. Dégi László Csaba A tantárgy leírása Tartalmi leírás Az előadás megismerteti a szociális


Evolúció. Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet

Evolúció. Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet Evolúció Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet Mi az evolúció? Egy folyamat: az élőlények tulajdonságainak változása a környezethez való alkalmazkodásra Egy






ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS Mi az öregedés? Egyrészről az idő múlásával definiálható, a születéstől eltelt idővel mérhető, kronológiai sajátosságú, Másrészről az idő múlásához köthető biológiai,


Őssejtkezelés kardiovaszkuláris kórképekben

Őssejtkezelés kardiovaszkuláris kórképekben Őssejtkezelés kardiovaszkuláris kórképekben Papp Zoltán Debreceni Egyetem Kardiológiai Intézet Klinikai Fiziológiai Tanszék Megmenthető a károsodott szív őssejtekkel? Funkcionális változások az öregedő


Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi





EGÉSZSÉG MAGATARTÁSTAN Egészség - alapismeretek

EGÉSZSÉG MAGATARTÁSTAN Egészség - alapismeretek EGÉSZSÉG MAGATARTÁSTAN Egészség - alapismeretek Dr. Gritz Arnoldné egeszseg@t-online.hu Semmelweis Egyetem Testnevelési és Sporttudományi Kar 2009/2010 FEJEZETEK Az egészség-magatartástan interdisciplináris


Tudománytörténeti visszatekintés

Tudománytörténeti visszatekintés GENETIKA I. AZ ÖRÖKLŐDÉS TÖRVÉNYSZERŰSÉGEI Minek köszönhető a biológiai sokféleség? Hogyan történik a tulajdonságok átörökítése? Tudománytörténeti visszatekintés 1. Keveredés alapú öröklődés: (1761-1766,


dr. Gábriel Róbert államvizsga témák:

dr. Gábriel Róbert államvizsga témák: dr. Gábriel Róbert államvizsga témák: 1. Diabeteszes retinopátia vizsgálata kísérleti állatmodellekben 2. Retinális ishemia vizsgálata kísérleti állatmodelleken 3. Peptidek és peptid analógok által mediált


A FITNESZ SZEKTOR szerepe az egészségfejlesztésben. Dr Zopcsák László

A FITNESZ SZEKTOR szerepe az egészségfejlesztésben. Dr Zopcsák László A FITNESZ SZEKTOR szerepe az egészségfejlesztésben Dr Zopcsák László 2013 Bemutatkozás Dr. Zopcsák László PhD Magyar Fitnesz és Egészségfejlesztési Szövetség (MHESZ) Elnök Európai Egészségfejlesztési és


Budapest, 2005. november 12. SZSÉG. Dr. Badacsonyiné Kassai Krisztina dietetikus, védőnő MDOSZ

Budapest, 2005. november 12. SZSÉG. Dr. Badacsonyiné Kassai Krisztina dietetikus, védőnő MDOSZ Ételed az életed! TáplT plálkozás egészs szség megelőzés Budapest, 2005. november 12. EGÉSZS SZSÉGTUDAT(OSSÁG) G) A TUDÁS S EGÉSZS SZSÉG Dr. Badacsonyiné Kassai Krisztina dietetikus, védőnő MDOSZ ALAPVETŐ





Joint Action program a depresszió és öngyilkosságok megelőzésére. Dr. Purebl György Prof Dr. Kurimay Tamás Székely András Tóth Mónika

Joint Action program a depresszió és öngyilkosságok megelőzésére. Dr. Purebl György Prof Dr. Kurimay Tamás Székely András Tóth Mónika Joint Action program a depresszió és öngyilkosságok megelőzésére Dr. Purebl György Prof Dr. Kurimay Tamás Székely András Tóth Mónika Joint Action of Mental Health and Well-being Munkacsomagok: Depression,


Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Szalma Katalin Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Témavezető: Dr. Turai István, OSSKI Budapest, 2010. október 4. Az ionizáló sugárzás sejt kölcsönhatása Antone



CSALÁDTERVEZ TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE. Dr. Erős s Erika CSALÁDTERVEZ DTERVEZÉS KÜLÖNÖS TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE Dr. Erős s Erika A családtervez dtervezés s törtt rténete Magyarországon gon Veleszületett letett rendellenességek (CA) Jelenleg


Magyarországi Evangélikus Egyház Sztehlo Gábor Evangélikus Óvoda, Általános Iskola és Gimnázium

Magyarországi Evangélikus Egyház Sztehlo Gábor Evangélikus Óvoda, Általános Iskola és Gimnázium Témakörök Biológia Osztályozó vizsgákhoz 2012/2013 9. Természettudományos Osztálya-kémia tagozat A növények életműködései Légzés és kiválasztás Gázcserenylások működése Növényi párologtatás vizsgálata


Etológia. Irányzatok a biológiában. Pongrácz Péter, PhD Etológia Tanszék

Etológia. Irányzatok a biológiában. Pongrácz Péter, PhD Etológia Tanszék Etológia Irányzatok a biológiában Pongrácz Péter, PhD Etológia Tanszék Etológia helye a biológia vizsgálódás szintjei szerint Szerveződési szintek Populációk Egyedek Neurális szabályozás Sejtek DNS Tudományág


Miért válaszd az egészségfejlesztés-tanár mesterszakot a JGYPK-n?

Miért válaszd az egészségfejlesztés-tanár mesterszakot a JGYPK-n? Miért válaszd az egészségfejlesztés-tanár mesterszakot a JGYPK-n? A tanári pálya iránt érdeklődő felvételizőként valószínűleg gondoltál már arra, hogy ehhez a hivatáshoz nemcsak a tudás közvetítése, hanem





A KOGNITÍV PSZICHOTERÁPIA ALAPJAI 1. Perczel Forintos Dóra Semmelweis Egyetem Klinikai Pszichológia Tanszék 2010

A KOGNITÍV PSZICHOTERÁPIA ALAPJAI 1. Perczel Forintos Dóra Semmelweis Egyetem Klinikai Pszichológia Tanszék 2010 A KOGNITÍV PSZICHOTERÁPIA ALAPJAI 1. Perczel Forintos Dóra Semmelweis Egyetem Klinikai Pszichológia Tanszék 2010 INGER TUDATTALAN KÉSZTETÉS EMÓCIÓ PSZICHOANALITIKUS MODELL Beck, 1974. INGER EMÓCIÓ TANULÁSELMÉLETI


Populációgenetikai vizsgálatok eredményei hangulatzavarokban. Képalkotó vizsgálatok alkalmazása a neuropszichofarmakológiában

Populációgenetikai vizsgálatok eredményei hangulatzavarokban. Képalkotó vizsgálatok alkalmazása a neuropszichofarmakológiában Populációgenetikai vizsgálatok eredményei hangulatzavarokban Képalkotó vizsgálatok alkalmazása a neuropszichofarmakológiában Juhász Gabriella Semmelweis Egyetem, GYTK, Gyógyszerhatástani Intézet Neuroscience


A MOTESZ Képzési és Tudományos Bizottsága által 2007. június 15-én minősített rendezvények

A MOTESZ Képzési és Tudományos Bizottsága által 2007. június 15-én minősített rendezvények A MOTESZ Képzési és Tudományos Bizottsága által 2007. június 15-én minősített rendezvények Címe: Hazamentem a PIC-ből II. Kongresszus Szervező: New Instant Bt. Helyszín: Budapest Időpont: 2/10/2007-2/10/2007


Tartalom. 3. A búskomor Homo sapiens A depresszió tüneteinek evolúciós pszichológiai értelmezése (Birkás Béla)... 57 ELŐSZÓ... 13

Tartalom. 3. A búskomor Homo sapiens A depresszió tüneteinek evolúciós pszichológiai értelmezése (Birkás Béla)... 57 ELŐSZÓ... 13 Tartalom ELŐSZÓ............................................... 13 A KÖTET SZERZŐI........................................ 15 I. RÉSZ BEVEZETÉS 1. Pszichológiai adaptáció és maladaptáció A lelki működés





Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak.

Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak. Evolúció Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak. Latin eredetű szó, jelentése: kibontakozás Időben egymást


FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre

FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre A rendezvény helyszíne: Általános Orvostudományi Kar Cím: SZTE ÁOK Dékáni Hivatal 6720


Prof. Dr. Szabad János Tantárgyfelelős beosztása

Prof. Dr. Szabad János Tantárgyfelelős beosztása Tantárgy neve Genetika Tantárgy kódja BIB 1506 Meghírdetés féléve 5 Kreditpont 4 Összóraszám (elmélet + gyakorlat) 3+0 Számonkérés módja Kollokvium Előfeltétel (tantárgyi kód) BIB 1411 Tantárgyfelelős


Humánetológia Humán viselkedési komplex és kötődés. Miklósi Ádám, Etológia Tanszék

Humánetológia Humán viselkedési komplex és kötődés. Miklósi Ádám, Etológia Tanszék Humánetológia Humán viselkedési komplex és kötődés Miklósi Ádám, Etológia Tanszék Humán viselkedési komplex (Csányi 1999) Nem szekvenciális, hanem párhuzamos folyamatok az evolúcióban, egymástól részben


Regulációs zavarok kutatása az Egészséges utódokért program keretében

Regulációs zavarok kutatása az Egészséges utódokért program keretében Regulációs zavarok kutatása az Egészséges utódokért program keretében Scheuring N.(1); Danis I.(2); Németh T.(3); Papp E.(1); Czinner Antal Prof.(1) Heim Pál Gyermekkórház, Budapest, Belgyógyászat (1);


Mentális retardáció BNO 10 (F70-79) BNO-10 BNO-10 BNO-10. Mentális retardáció és pszichopatológia

Mentális retardáció BNO 10 (F70-79) BNO-10 BNO-10 BNO-10. Mentális retardáció és pszichopatológia BNO 10 (F70-79) Mentális retardáció Pszichiátriai és Pszichoterápiás Klinika, Pécs Abbamaradt vagy nem teljes mentális fejlődés, amelyre jellemző a különböző készségek romlása, olyan készségeké amelyek


A fő egészségügyi kihívások

A fő egészségügyi kihívások A fő egészségügyi kihívások Öregedés Mentális betegségek Fertőző betegségek Elhízás, diabetes Allergia, asztma Szív- és érbetegségek Autoimmun kórképek Rák Komplex betegségek Rendszerbiológia Bioinformatika,


Cukorbetegek kezelésének alapelvei

Cukorbetegek kezelésének alapelvei Diabétesz 2007. Életmód és kezelés Budapest, 2007. június 2. Mozgásterápia cukorbetegségben Lelovics Zsuzsanna dietetikus, humánkineziológus, szakedző Egészséges Magyarországért Egyesület Cukorbetegek


AZ ÖNGYILKOSSÁG MEGELŐZÉSÉNEK KÉZIKÖNYVE. (Depresszió-felismerés és öngyilkosság megelőzés a háziorvosi gyakorlatban)

AZ ÖNGYILKOSSÁG MEGELŐZÉSÉNEK KÉZIKÖNYVE. (Depresszió-felismerés és öngyilkosság megelőzés a háziorvosi gyakorlatban) AZ ÖNGYILKOSSÁG MEGELŐZÉSÉNEK KÉZIKÖNYVE (Depresszió-felismerés és öngyilkosság megelőzés a háziorvosi gyakorlatban) Szerkesztette: Bitter István M.D, Ph.D., D. Sc. Kalmár M.D.,Ph.D. Németh Attila M.D.
