Epigenetikaikutatások pszichiátriai vonatkozásai A modern biológia fejlődése február Falus András. populációk (Darwin)

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "2012.11.19. Epigenetikaikutatások pszichiátriai vonatkozásai 1850. A modern biológia fejlődése. 2001. február 15-16. Falus András. populációk (Darwin)"

Átírás

1 Epigenetikaikutatások pszichiátriai vonatkozásai 1850 populációk (Darwin) A modern biológia fejlődése Egyedek (Mendel) 1900 sejtek tervezett élőlények (szintetikus biológia) kromoszómák gének, DNS modell (molekuláris biológia) modellek (systems biology) összes gén- genom genomika, proteomika Falus András február

2 Genetikai állományunk A genom Minden emberi testi sejtben 2x 23 kromoszóma ~ gén ~ 3.2 milliárd nukleotidbetű ~ 2m DNS sejt 7.7 fénynap!!! 2 m DNA cell 5.9 lightdays Élővilág megismerése evolúció Két fő motiváció Genetika & egészség/betegség A legfőbb orvosi problémák Társadalom öregedése Idegrendszeri betegségek Fertőzéses, gyulladási betegségek Elhízás/ cukorbetegség Allergia, asthma Szív- és érrendszeri betegségek Rák Komplex betegségek systems biology, bioinformatika 8 2

3 Egyesült Királyság Előrebecsült betegségek / lakos Ischaemiás szívhalál 4300 Szívinfarctus (új eset) 8250 Agyvérzéses halál 1100 Agyvérzés (új eset) 4500 Emlőrák (új eset) 6270 Vastagbélrák (új eset) 5410 Prostatarák (új eset) 3290 Cukorbetegség (új eset) %!! A genetika haszna Biotechnológia Diagnosztika Terápia. személyreszabott orvoslás Agyi degeneratív (új eset) 2000 METODIKAI REPERTOIRE TELJES GENOM VIZSGÁLAT Evolúciós és funkcionális elemek az emberi tumorokban GCAATCGATCTGGTACAGTAGCTA GCAATTGATCGGGTACATTAGCTA Hap-Map/ 20 millió pontmutáció GRO-seq FEHÉRJE FIZIKAI TECHNIKÁK Biofizika, nanofizika Nagy László ábrájából ADATBÁZISOK EXPRESSZIÓS MICROARRAY/CHIP NANOTECHNOLÓGIA, Szilárd Fázisú KÉMIA NYELVÉSZET ELJÁRÁSOK BIOINFORMATIKA GÉNHÁLÓZATOK- ÚTVONAL ANALÍZIS 3

4 Hagyományos biológia Rendszer-szemléletű biológia A DNS szekvencia adatok megkétszereződnek 18 havonta A megismert genomok száma duplázódik 18 havonta A szekvenálás költségei a feleződnek 18 havonta Pongor Sándor ábrája 10 év múlva? Személyre szabott orvoslás! Fejlett genetikai diagnosztika Fejlett számítógépes adatelemzés Szoros együttműködés orvos és páciens között Személyre szabott védőoltások 4

5 Genome-wide associations studies December, studies,p<5x markers 1000 genom project NHGRI GWA Catalog 17 Nem várt fejlemények: missing heritability Az emberi DNS elemeinek enciklopédiája Etnikai eltérések Multifaktoriális fenotípusok (betegségek) - hálózati hatások Környezeti hatások (epigenetika)-reverzibilitás Kódoló-nem kódoló Ritka és nagy hatású vs gyakori és kishatású allélek Metagenomika- genomok szimbiózisa (microbiom) 5

6 Fenotípus Fehérje Fenotípus mrns Fehérje mrns Gén DNS Gén Azonos gének különbözó génexpresszió + GWAS- teljes genom megközelítés Környezeti változás Koronária szűkület Több generáción át ható (ártalmas) környezeti hatás Asztma rizikó KOR Anya- 1. generáció Magzat- 2. generáció Magzat reproduktív sejtjei- 3. generáció 23 Li et al. Maternal and grandmaternal smoking patterns are associated with early childhood asthma. Chest 2005;127:

7 heterokromatin CpG-metiláció Hiszton-acetiláció eukromatin Nagymértékben összetekeredett nukleotidszál, kikapcsolt gének Kitekeredett nukleotidszál, bekapcsolt gének 7

8 Biokibernetikai gondolat Metiláció De-acetiláció De-metiláció Acetiláció számítógép REVERZIBILIS FOLYAMAT!! biológiai rendszer Epigenetikai faktorok ontogenesis-anyai hatás táplálkozás gyógyszerek, mérgek fertőzés, besugárzás fizikai aktivitás fény zene stress, magatartási-, lelki-, meditatív hatások Metabolikus fenotípus táplálkozás TÁPLÁLKOZÁSI PROGRAMOZÁS TERHESSÉG ÉS SZOPTATÁS IDEJÉN DNS metiláció, stb) Öröklődik a következő generációban 8

9 EVOLÚCIÓS IRÁNY?? Az eltérő genetikai háttér következményei csak környezeti hatásra (pl. fertőzés) manifesztálódnak veszély-érzékelő receptor endotoxin receptor Lehetséges epigenetikus hatással rendelkező pszichoszociális tényezők Epigenetikus hatású szociális tapasztalatok Szülői magatartás Krónikus stressz Életmód Purebl György ábrája Champagne, F. A. (2010) Dev Psychobiol 52: Purebl György ábrája 9

10 Szülői magatartás - rágcsálók Magas anyai anyai gondoskodás kisebb hippokampális GR1 7 promotor metiláció, erősebb GR expresszió, csökkent stresszelhetőség 1,2 Alacsony gondoskodásnál ERalpha össztrogénreceptor csökkent expressziója, felnőttkorban is - ennek aktivitása készíti részben fel a nőstényt az anyai viselkedésre 3,4 Szülői magatartás - ember Gyermekkori abúzuson átesett öngyilkosok post mortem vizsgálatában alacsonyabb hippocampalis elemezve GR expresszió, magasabb fokú GR1F promotor metiláció 1 Egészséges felnőttek periferiás vér mononukleáris sejtjeiben hasonlították össze a GR response elementet tartalmazó géneket a gyermekkorban alacsony SES-sel rendelkező személyeknél down regulációja 2 A IV BDNF prompotor régióban a prefrontális kéregben emelkedett metiláció, zebularine alkalmazásával (metiláció inhibitor) a BDNF a nem abuzált kölykök szintjére emelhető 5 1 McGowan és mtsai (2009). Nat Neurosci, 12(3), Weaver et al (2004). Nat Neurosci 7(8): Szyf et al (2005). Front Neuroendocrinol 26(3-4): Miller és mtsai (2009). PNAS 106(34), ,4 Champagne et al (2003, 2006) Physioll Behav, 79(3), Biol Psychiat, 59(12), Roth et al (2009). Biol Psychiat, 65(9), Purebl György ábrája Purebl György ábrája Gyermekkori stressz és védettség Szociális izoláció magasabb kortizolszint, gyengült immunológiai fittness rhesusmajmokban 1 Fizikailag és inspiráló ingerekben is gazdag környezet növeli a szinaptikus plaszticitást, csökkenti a szorongásosságot és javítja a gondolkodást 2 Védett és pozitív ingerekben gazdag környezetben a cortizolszint és stressz gátolt szociális viselkedés patkányban javul 3, és javul az anyai viselkedés színvonala is 4,5 A gyermekkori gazdag és inspiratív környezet és felnőttkori egészség: Huntington transzgénikus egerekben késleltette a BDNF csökkenés szintjét és a tünetek kialakulását 6 Felnőttkori epigenetikus hatások a magatartásra Szociális alulmaradási kísérletek (rágcsálók) HPA aktivitás növekedése, depresszió egyik állatkísérletes modaellje 1,2,3 A stresszhatások feltehetően a BDNF transzkripciós aktivitása keresztül érvényesülnek 4 A nc accumbensben a histone H3-K27 dimetilációja és deacetilálódása mint legyőzöttség mind izoláció esetén 5 1 Gordon és mtsai (1992) Physiology and Behav 51(3), Nithianantharajah & Hannan (2006). Nat Rev Neurosci 7(9), ) 3 Morley-Fletcher és mtsai (2003) Eu J Neurosci18(12), ). 4,5 Bredy és mtsai (2003, 2004) Neurosci, 118(2), Eu J Neurosci 20(5), Hockly és mtsai (2002) Ann Neurol 51(2), Purebl György ábrája 1 Meerlo és mtsai (1996) Stress 1(1), Blanchard és mtsai (1993). Behav Brain Res 58(1 2), Keeney és mtsai (2006). J Neuroendocrin 18(5), Tsankova és mtsai (2006) Nat Neurosci, 9(4), Wilkinson és mtsai (2009). J Neurosci 29(24), Purebl György ábrája 10

11 hippocampus Charney: Behavior genetics and postgenomics BEHAVIORAL AND BRAIN SCIENCES (2012) 35: Szociális környezet Szociális jelátvitel betegség/egészség Social processes IL6 mrns DNS CNS function Peripheral neurobiology Gén Cell signal transduction Transcription factors Genome 11

12 FEJLŐDÉSI ÁLLAPOT Waddington, 1942 totipotent pluripotent multipotent unipotent Az egyedfejlődés irreverzibilis? REPROGRAMOZÁS INDUKÁLT PLURIPOTENS ŐSSEJTEK Orvosi Nobel díj, október 8. Sir John B. Gurdon Shinya Yamanaka 12

13 Dolly: szül július Anyai testi sejt Telomerák rövidülése Arthritis Pulmonáris Adenocarcinoma Petesejt Sejtmag átültetés Feb 14, 2003 Dolly elpusztult Dolly egy hatéves juh genetikai anyagát kapta egy petesejtben Az epigenetikai programozási mintázat nem volt megfelelő. Fenotípus Fehérje Fenotípus Fenotípus Fehérje Fenotípus mrns Fehérje mrns mrns Fehérje mrns Gén DNS Gén Gén DNS Gén 13

14 Ornish D, Lin J, Daubenmier J, Weidner G, Epel E, Kemp C, Magbanua MJ, Marlin R, Yglecias L, Carroll PR, Blackburn EH. Department of Medicine, University of California, San Francisco, CA, USA. Increased telomerase activity and comprehensive lifestyle changes: a pilot study. Lancet Oncol Nov;9(11): Epub 2008 Sep 15. Genetika-epigenetika Az öröklődés (hajlam) lényegében irreverzibilis Az epigenetikai hatások nagyrésze reverzibilis AZ ÉLETMÓD VÁLTOZTATÁS ÓRIÁSI JELENTŐSÉGE!!! Küldetés nyilatkozat Prof. Dr. Kopp Mária A magyar társadalom jelenlegi egészségi állapota és távlati kilátásai minden felelősen gondolkodó számára kötelező feladatokat jelölnek ki. Ezért mi, pedagógusok, orvosok, biológusok, pszichológusok, szociológusok, bioetikusok és egészségpolitikai szakemberek életre hívtuk az EDUVITAL Nonprofit Egészségnevelési Társaságot. Folyt. 14

15 PEDAGÓGUSOK biológia-egészségtan, osztályfőnök tanárok, tanítók nevelési tanácsadók Primer célcsoportok LELKÉSZEK EÜ. SZAKEMBEREK védőnők házi/gyerek/orvosok szociális munkások KISEBBSÉGI SZERVEZETEK FIATAL TÁRSADALOM ÚJSÁGÍRÓK EDUVITAL TUDOMÁNYOS TESTÜLET Dr. Antal Emese, táplálkozástudomány, a Magyar Dietetikusok Országos Szövetségének elnöke Dr. Ádány Róza, egyetemi tanár, népegészségtan, WHO "Társadalmi Sebezhetőség és Egészség" Kollaborációs Központ vezetője Dr. Bagdy Emőke professzor emeritus, pszichológia, Károli Gáspár Református Egyetem, Személyiség és Klinikai Pszichológiai Tanszék, pszichológia Dr. Cseh Károly, egyetemi tanár, Semmelweis Egyetem Népegészségtani Intézet, munka- és foglalkozás egészségügy Dr. Falus András, alapító, egyetemi tanár, akadémikus, Semmelweis Egyetem Genetikai, Sejt és Immunbiológiai Intézet, biológus, genetikus, genetika, epigenetika Járóka Lívia, a Roma Education Fund képviselője, EU Parlamenti képviselő, kisebbségi/roma/ ügy Dr. Kalabay László, PhD, egyetemi tanár, Semmelweis Egyetem, Családorvosi Tanszék, családorvoslás Dr. Kopp Mária, alapító, egyetemi tanár, pszichológus, orvos Dr. Madarasi Anna, PhD,, osztályvezető főorvos, Szent János Kórház, gyermekgyógyász Dr. Mészáros Judit, egyetemi tanár, Semmelweis Egyetem Egészségtudományi Kar dékánja, eü.szakdolgozók Dr. Molnár Mária Judit, egyetemi tanár, Semmelweis Egyetem Molekuláris Neurológiai Központ, neurogenetika és ritka betegségek Nagyné Horváth Emília, pedagógus, az Egészségtan oktatás országos koordinátora, egészségtan oktatás Nagy Tímea, olimpiai- és világbajnok párbajtőrvívó, sport, gyógypedagógia Dr. Oberfrank Ferenc, egyetemi tanár, Kísérleti Orvostudományi Kutató Intézet, bioetika Dr. Somhegyi Annamária prevenciós igazgató, testnevelés, mozgás Dr. Tompa Anna, egyetemi tanár, Semmelweis Egyetem, Népegészségtani Intézet, prevenciós orvostudomány, toxikológia, népegészségtan Dr. Túry Ferenc egyetemi tanár, Semmelweis Egyetem, Magatartástudományi Intézet, pszichiátria Dr. Varga Péter Pál, Országos Gerincgyógyászati Központ vezető főorvosa, mozgás-és sporttudomány TEMATIKAI MODULOK I. (és kombinációik) Genetika és epigenetika, örökölt és szerzett tulajdonságok, rendszerbiológia, biológiai hálózatok, evolúciós szemlélet Iskolai környezet-és egészségvédelem, az egészségtan oktatása Közegészségbiológiai és toxikológiai alapfogalmak, prevenció és egészségtudatosság Táplálkozásbiológia, dietetika, evészavarok A testnevelés és a sport szerepe az emberi egészségben A roma-és hátrányos helyzetű közösségek egészségnevelési feladatai, cigánypasztoráció Kábítószerek, alkohol-és drogfüggés, drogprevenció TEMATIKAI MODULOK II. (és kombinációik) Örökletes és szerzett elemek gyermek-és ifjúkori betegségekben, védőoltások, sürgősségi helyzetek A lelki működés alapfogalmai, szülői magatartás, stress Életmód és világnézet, a főbb világvallások és az emberi egészség kapcsolata Testi és mentális higiénia: szezonális biológiai és pszichológiai hatások A szexuálitás, életmód és szexuális nevelés, etika és szociológia A modern biológia és az egészségmegőrzés, bioetikai kihívások Az egészség fogalma és mitosza a közmédiákban 15

16 Ismerje meg az EDUVITAL NET képzéseit, programjait, célkitűzéseit! Csatlakozzon hozzánk! EDUVITAL NET Nonprofit Egészségnevelési Társaság 1089 Budapest, Nagyvárad tér (1) , +36 (1)

A genomiális medicina szép új világa

A genomiális medicina szép új világa A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012 2014 2015. ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet A medicina

Részletesebben

www.eduvital.net "Soha sem késő"! Megoldások a felnőttkori egészségnevelésből Falus András

www.eduvital.net Soha sem késő! Megoldások a felnőttkori egészségnevelésből Falus András www.eduvital.net "Soha sem késő"! Megoldások a felnőttkori egészségnevelésből Falus András Az EDUVITAL koncepció és gyakorlat www.eduvital.net Mit tanít az EDUVITAL csapata? Küldetés nyilatkozat A magyar

Részletesebben

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához?

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Falus András Genetikai, Sejt- és Immunbiológiai Intézet Semmelweis Egyetem Antal Péter Hadadi Éva

Részletesebben

ETK-EDUVITAL ELŐADÁSSOROZAT. Vas utcai délutánok. 2014/2015 II. félév és 2015/2016 I. félév

ETK-EDUVITAL ELŐADÁSSOROZAT. Vas utcai délutánok. 2014/2015 II. félév és 2015/2016 I. félév ETK-EDUVITAL ELŐADÁSSOROZAT Vas utcai délutánok 2015 2014/2015 II. félév és 2015/2016 I. félév Összeállította: Dr. Urbán Veronika főiskolai tanár Semmelweis Egyetem, Egészségtudományi Kar, Alapozó Egészségtudományi

Részletesebben

...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról

...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról ...egy egészségtudatosabb nemzedékért! - Falus András akadémikus az EDUVITAL-ról Nem szeretjük az orvosságokat, nem szeretjük a kést, fejcsóválva állunk a nem túl fényes egészségügyi mutatók felett...

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

Tanárképzés főiskolai és egyetemi szinten. Egészségtan tanár (1995-2005) kb. 1000-1200 fő Egészségfejlesztés-tanár MA ( 2005-) képzés kb 150 fő

Tanárképzés főiskolai és egyetemi szinten. Egészségtan tanár (1995-2005) kb. 1000-1200 fő Egészségfejlesztés-tanár MA ( 2005-) képzés kb 150 fő Tanárképzés főiskolai és egyetemi szinten. Egészségtan tanár (1995-2005) kb. 1000-1200 fő Egészségfejlesztés-tanár MA ( 2005-) képzés kb 150 fő Szakterületi ismeretek Az egészségfejlesztés célja, fogalma,

Részletesebben

12. évfolyam esti, levelező

12. évfolyam esti, levelező 12. évfolyam esti, levelező I. ÖKOLÓGIA EGYED FELETTI SZERVEZŐDÉSI SZINTEK 1. A populációk jellemzése, növekedése 2. A populációk környezete, tűrőképesség 3. Az élettelen környezeti tényezők: fény hőmérséklet,

Részletesebben

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45

Részletesebben

Tudományos program. Fővédnök: Lovász László, az MTA elnöke

Tudományos program. Fővédnök: Lovász László, az MTA elnöke MAGYAR ORVOSTUDOMÁNYI NAPOK 2014. november 5-7 Hotel Novotel Budapest, 1123 Alkotás u. 63-67 Rendező: Magyar Orvostársaságok és Egyesületek Szövetsége (MOTESZ) Tudományos program Fővédnök: Lovász László,

Részletesebben

Dr. Herényi Levente egyetemi docens Biofizikai és Sugárbiológiai Intézet 1094 Budapest, Tűzoltó u. 37-47.

Dr. Herényi Levente egyetemi docens Biofizikai és Sugárbiológiai Intézet 1094 Budapest, Tűzoltó u. 37-47. I. évfolyam MATEMA TIKA BIOFIZIKA ÁLTALÁNOS ÉS SZERVETLEN KÉMIA GYÓGYSZERÉSZI NÖVÉNYTAN BIOLÓGIA TUDOMÁNYTÖRTÉNE T ÉS PROPEDEUTIKA, a 2. félévben heti 1 óra Dr. Gergó Lajos egyetemi docens 1092 Budapest,

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet

Terhesség és emlőrák genetikai szempontok. Kosztolányi György PTE Orvosi Genetikai Intézet erhesség és emlőrák genetikai szempontok Kosztolányi yörgy PE Orvosi enetikai Intézet Előfordulás 1 emlőrák / 3000 várandós fokozódása várható: öröklődő emlőrák diagnózisa családon belül : I. generáció

Részletesebben

4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program

4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program 4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program Kurzusvezetö és kurzuscím 4101-K A magatartás modellezése neurokémiája és gyógyszeres befolyásolása. (magyar) (Dr. Bagdy György)

Részletesebben

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan 11. évfolyam BIOLÓGIA 1. Az emberi test szabályozása Idegi szabályozás Hormonális szabályozás 2. Az érzékelés Szaglás, tapintás, látás, íz érzéklés, 3. Általános egészségügyi ismeretek az egyes témákhoz

Részletesebben

Új utak az antipszichotikus gyógyszerek fejlesztésében

Új utak az antipszichotikus gyógyszerek fejlesztésében Új utak az antipszichotikus gyógyszerek fejlesztésében SCHIZO-08 projekt Dr. Zahuczky Gábor, PhD, ügyvezető igazgató UD-GenoMed Kft. Debrecen, 2010. november 22. A múlt orvostudománya Mindenkinek ugyanaz

Részletesebben

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Magyarósi Szilvia Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem DEMIN 2014. május 22.

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN Kötelezı szinten tartó tanfolyam PÉCS 2009. október 14-16. PROGRAMFÜZET Kedves Kollégák! Közel egy évvel ezelıtt, 2008 júniusában

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5.

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. 0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. Az Élet keletkezése 6. Modellek a biológiában - csak az

Részletesebben

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)

Részletesebben

11. évfolyam esti, levelező

11. évfolyam esti, levelező 11. évfolyam esti, levelező I. AZ EMBER ÉLETMŰKÖDÉSEI II. ÖNSZABÁLYOZÁS, ÖNREPRODUKCIÓ 1. A szabályozás információelméleti vonatkozásai és a sejtszintű folyamatok (szabályozás és vezérlés, az idegsejt

Részletesebben

A domináns öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

A domináns öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 A domináns öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság

Részletesebben

Az egészség fogalma, az egészségi állapotot meghatározó tényezık. A holisztikus egészségszemlélet dimenziói és ezek jellemzıi. /II.

Az egészség fogalma, az egészségi állapotot meghatározó tényezık. A holisztikus egészségszemlélet dimenziói és ezek jellemzıi. /II. Az egészség fogalma, az egészségi állapotot meghatározó tényezık. A holisztikus egészségszemlélet dimenziói és ezek jellemzıi. /II. Tétel/ Ihász Ferenc PhD. Nyugat-magyarországi Egyetem Apáczai Csere János

Részletesebben

Az autonómia és complience, a fogyatékosság elfogadtatásának módszerei

Az autonómia és complience, a fogyatékosság elfogadtatásának módszerei Az autonómia és complience, a fogyatékosság elfogadtatásának módszerei Dr. Kollár János egyetemi adjunktus Debreceni Egyetem Orvos- és Egészségtudományi Centrum, Népegészségügyi Kar Magatartástudományi

Részletesebben

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter

Programtervezet. Vécsei László, az MTA Orvosi Osztály elnöke. Moderátor: Poór Gyula és Sótonyi Péter Magyar Orvostudományi Napok 2013. november 6 8 Hotel Novotel Budapest (Alkotás utca 63 67) Rendező: Magyar Orvostársaságok és Egyesületek Szövetsége (MOTESZ) Programtervezet 2013. november 6. 10.00 Megnyitó

Részletesebben

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök:

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök: Otthonápolás Cégegészség Fogorvos Homeopátia Online gyógyszertár RSS Iratkozzon fel RSS-csatornáinkra! KÖNYVAJÁNLÓ Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008.

Részletesebben

CARDIOMETABOLICA HUNGARICA

CARDIOMETABOLICA HUNGARICA 2011; 4 (SUPPL. 3) CARDIOMETABOLICA HUNGARICA A MAGYAR OBEZITOLÓGIAI ÉS MOZGÁSTERÁPIÁS TÁRSASÁG VII. KONGRESSZUSA AZ ELHÍZÁS KEZELÉSE SZAKMAI IRÁNYELVEINEK AKTUALIZÁLÁSA PROGRAM 2011. OKTÓBER 14. Aesculap

Részletesebben

Apor Vilmos Katolikus Iskolaközpont Helyi tanterv Szabadon választható tantárgy: biológia 11-12. évfolyam

Apor Vilmos Katolikus Iskolaközpont Helyi tanterv Szabadon választható tantárgy: biológia 11-12. évfolyam 1 Apor Vilmos Katolikus Iskolaközpont Helyi tanterv Szabadon választható tantárgy: biológia 11-12. évfolyam 2 Tantárgyi struktúra és óraszámok A tantárgy heti óraszáma A tantárgy éves óraszáma 11. évfolyam

Részletesebben

1. Emlődaganatok neoadjuváns kezelésének hatása a műtéti technikára Témavezető: Dr. Harsányi László PhD egyetemi docens

1. Emlődaganatok neoadjuváns kezelésének hatása a műtéti technikára Témavezető: Dr. Harsányi László PhD egyetemi docens SZAKDOLGOZAT TÉMAJAVASLATOK A 2012/2013 tanévre Semmelweis Egyetem Általános Orvostudományi Kar I. sz. Sebészeti Klinika SEBÉSZET 1. Emlődaganatok neoadjuváns kezelésének hatása a műtéti technikára 2.

Részletesebben

Figyelemhiány/Hiperaktivitás Zavar - ADHD TÁJÉKOZTATÓ FÜZET. ADHD-s gyermekek családjai részére

Figyelemhiány/Hiperaktivitás Zavar - ADHD TÁJÉKOZTATÓ FÜZET. ADHD-s gyermekek családjai részére Figyelemhiány/Hiperaktivitás Zavar - ADHD TÁJÉKOZTATÓ FÜZET ADHD-s gyermekek családjai részére KEZELÉSI TÁJÉKOZTATÓ FÜZET Ezt a tájékoztató füzetet azért készítettük, hogy segítsünk a FIGYELEMHIÁNY/HIPERAKTIVITÁS

Részletesebben

Az első 1000 nap táplálási és gondozási szempontjai a bio-pszicho-szociális modell alapján

Az első 1000 nap táplálási és gondozási szempontjai a bio-pszicho-szociális modell alapján Az első 1000 nap táplálási és gondozási szempontjai a bio-pszicho-szociális modell alapján Dr. Scheuring Noémi Heim Pál Gyermekkórház, Budapest Kávészünet-17 Házi Gyermekorvosok Egyesülete XVII. Tudományos

Részletesebben

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Vezető betegségek Magyarországon. Szív-érrendszeri betegségek és magasvérnyomás Civilizációs ártalmak?

Vezető betegségek Magyarországon. Szív-érrendszeri betegségek és magasvérnyomás Civilizációs ártalmak? Vezető betegségek Magyarországon Szív-érrendszeri betegségek és magasvérnyomás Civilizációs ártalmak? Megválaszolandó Kérdések Melyek azok a betegségek amelyek a ranglistát vezetik? Mennyire vagyunk felelősek

Részletesebben

A FITNESZ SZEKTOR szerepe az egészségfejlesztésben. Dr Zopcsák László

A FITNESZ SZEKTOR szerepe az egészségfejlesztésben. Dr Zopcsák László A FITNESZ SZEKTOR szerepe az egészségfejlesztésben Dr Zopcsák László 2013 Bemutatkozás Dr. Zopcsák László PhD Magyar Fitnesz és Egészségfejlesztési Szövetség (MHESZ) Elnök Európai Egészségfejlesztési és

Részletesebben

Miért válaszd az egészségfejlesztés-tanár mesterszakot a JGYPK-n?

Miért válaszd az egészségfejlesztés-tanár mesterszakot a JGYPK-n? Miért válaszd az egészségfejlesztés-tanár mesterszakot a JGYPK-n? A tanári pálya iránt érdeklődő felvételizőként valószínűleg gondoltál már arra, hogy ehhez a hivatáshoz nemcsak a tudás közvetítése, hanem

Részletesebben

Generációk Központ és a Chili Jóga Római

Generációk Központ és a Chili Jóga Római szombat vasárnap Generációk Központ és a Chili Jóga Római közösségi megnyitója 2013. február 2-3. NEXT 2. oldal szombat Részletes Programterv SZOMBAT Kapunyitás» Ünnepélyes megnyitó» Elôadások» Tanácsadás»

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 Recesszív öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság

Részletesebben

Szorongás és depresszió a reprodukciós problémával küzdő nők körében

Szorongás és depresszió a reprodukciós problémával küzdő nők körében Szorongás és depresszió a reprodukciós problémával küzdő nők körében Lakatos Enikő¹, ², Balog Piroska¹ ¹Semmelweis Egyetem Magatartástudományi Intézet, Budapest ²Semmelweis Egyetem Mentális Egészségtudományok

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

Transzgénikus. nikus állatok. Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk bejuttatott DNS-t t tartalmaz.

Transzgénikus. nikus állatok. Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk bejuttatott DNS-t t tartalmaz. Transzgénikus nikus állatok Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk zremüködéssel bejuttatott DNS-t t tartalmaz. I. A KONKRÉT T GÉNSEBG NSEBÉSZETI SZETI TECHNIKA A beavatkozást

Részletesebben

TÁMOP-6.1.2/LHH/11-A-2012-0010. KÖZÖSSÉGI PSZICHIÁTRIAI PREVENCIÓS PROGRAM MEGVALÓSÍTÁSA A MÁTÉSZALKAI KISTÉRSÉGBEN

TÁMOP-6.1.2/LHH/11-A-2012-0010. KÖZÖSSÉGI PSZICHIÁTRIAI PREVENCIÓS PROGRAM MEGVALÓSÍTÁSA A MÁTÉSZALKAI KISTÉRSÉGBEN TÁMOP-6.1.2/LHH/11-A-2012-0010. KÖZÖSSÉGI PSZICHIÁTRIAI PREVENCIÓS PROGRAM MEGVALÓSÍTÁSA A MÁTÉSZALKAI KISTÉRSÉGBEN Moravcsik-Kornyicki Ágota szakmai vezető Miért szükséges EGÉSZSÉGVÉDELEM program? Három

Részletesebben

A meddőség a páciensek szemszögéből. Borján Eszter Semmelweis Egyetem Egészségtudományi Kar Ápolástan Tanszék

A meddőség a páciensek szemszögéből. Borján Eszter Semmelweis Egyetem Egészségtudományi Kar Ápolástan Tanszék A meddőség a páciensek szemszögéből Borján Eszter Semmelweis Egyetem Egészségtudományi Kar Ápolástan Tanszék Egészség - betegség Az egészség nem csupán a betegség és nyomorékság hiánya, hanem a teljes

Részletesebben

Magyar Gyermeknőgyógyász Társaság XXXI. Kongresszusa 2011. május 13-14. Gyula

Magyar Gyermeknőgyógyász Társaság XXXI. Kongresszusa 2011. május 13-14. Gyula Magyar Gyermeknőgyógyász Társaság XXXI. Kongresszusa 2011. május 13-14. Gyula 2011. május 13. Péntek: 08:0010:00-10:30 Regisztráció Megnyitó, köszöntők Dr. Párducz László a Békés Megyei Pándy Kálmán Kórház

Részletesebben

Budapest, 2005. november 12. SZSÉG. Dr. Badacsonyiné Kassai Krisztina dietetikus, védőnő MDOSZ

Budapest, 2005. november 12. SZSÉG. Dr. Badacsonyiné Kassai Krisztina dietetikus, védőnő MDOSZ Ételed az életed! TáplT plálkozás egészs szség megelőzés Budapest, 2005. november 12. EGÉSZS SZSÉGTUDAT(OSSÁG) G) A TUDÁS S EGÉSZS SZSÉG Dr. Badacsonyiné Kassai Krisztina dietetikus, védőnő MDOSZ ALAPVETŐ

Részletesebben

Egészséggel kapcsolatos nézetek, hiedelmek, modellek, egészségvédő magatartásformák

Egészséggel kapcsolatos nézetek, hiedelmek, modellek, egészségvédő magatartásformák Egészséggel kapcsolatos nézetek, hiedelmek, modellek, egészségvédő magatartásformák Orvosi pszichológia előadás 2. hét Merza Katalin merza.katalin@sph.unideb.hu Egészségmagatartás fogalma Minden olyan

Részletesebben

Joint Action program a depresszió és öngyilkosságok megelőzésére. Dr. Purebl György Prof Dr. Kurimay Tamás Székely András Tóth Mónika

Joint Action program a depresszió és öngyilkosságok megelőzésére. Dr. Purebl György Prof Dr. Kurimay Tamás Székely András Tóth Mónika Joint Action program a depresszió és öngyilkosságok megelőzésére Dr. Purebl György Prof Dr. Kurimay Tamás Székely András Tóth Mónika Joint Action of Mental Health and Well-being Munkacsomagok: Depression,

Részletesebben

Cukorbetegek kezelésének alapelvei

Cukorbetegek kezelésének alapelvei Diabétesz 2007. Életmód és kezelés Budapest, 2007. június 2. Mozgásterápia cukorbetegségben Lelovics Zsuzsanna dietetikus, humánkineziológus, szakedző Egészséges Magyarországért Egyesület Cukorbetegek

Részletesebben

Molekuláris Medicina

Molekuláris Medicina Molekuláris Medicina Molekuláris Medicina Őssejt terápia Génterápia Tumor terápia Immunterápia Egyéb terápiák Vakcinák Genetikai diagnosztika Orvosi genomika Terápiák Diagnosztikák Orvostudomány: régi

Részletesebben

A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában

A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában Budapest, 2014. február 22. Ritka Betegségek Világnapja A genetikai vizsgálatok jelene, jövője a Ritka Betegségek vonatkozásában dr. Kósa János PentaCore Laboratórium, Budapest Semmelweis Egyetem I. sz.

Részletesebben

Állatorvos-tudományi Kar Évfolyam szintű heti órarend 2013/2014-s tanév, 2. félév Biológia BSc képzés: I. Évfolyam

Állatorvos-tudományi Kar Évfolyam szintű heti órarend 2013/2014-s tanév, 2. félév Biológia BSc képzés: I. Évfolyam Biológia BSc képzés: I. Évfolyam NÖVÉNYRENDSZERTAN NÖVÉNYRENDSZERTAN BIOMATEMATIKA HEFOP 2. KÉMIA ÁLLATSZERVEZETTAN ÁLLATSZERVEZETTAN BIOMATEMATIKA Előadás HEFOP 2. KÉMIA FÖLDTUDOMÁNYOK elmélet FIZIKA

Részletesebben

Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter

Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter Ikerregiszterek és egy ikervizsgálat gyakorlati megszervezése Dr. Tárnoki Ádám Domonkos PhD Semmelweis Egyetem, Budapest Radiológiai és Onkoterápiás Klinika Magyar Ikerregiszter 1 Ikerregiszterek Önkéntes

Részletesebben

Babeş Bolyai Tudományegyetem, Kolozsvár Szociológia és Szociális Munka Kar. Egészségpszichológia és közegészségtan dr.

Babeş Bolyai Tudományegyetem, Kolozsvár Szociológia és Szociális Munka Kar. Egészségpszichológia és közegészségtan dr. Babeş Bolyai Tudományegyetem, Kolozsvár Szociológia és Szociális Munka Kar Egészségpszichológia és közegészségtan dr. Dégi László Csaba A tantárgy leírása Tartalmi leírás Az előadás megismerteti a szociális

Részletesebben

Őssejtkezelés kardiovaszkuláris kórképekben

Őssejtkezelés kardiovaszkuláris kórképekben Őssejtkezelés kardiovaszkuláris kórképekben Papp Zoltán Debreceni Egyetem Kardiológiai Intézet Klinikai Fiziológiai Tanszék Megmenthető a károsodott szív őssejtekkel? Funkcionális változások az öregedő

Részletesebben

Acut stroke ellátás a következő 5 év feladatai. Bereczki Dániel SE Neurológiai Klinika BUDAPEST

Acut stroke ellátás a következő 5 év feladatai. Bereczki Dániel SE Neurológiai Klinika BUDAPEST Acut stroke ellátás a következő 5 év feladatai Bereczki Dániel SE Neurológiai Klinika BUDAPEST A 60 ÉV ALATTIAK ARÁNYA 27%!! Százezer lakosra egy év alatt jutó halálestek száma Fél óránként Másfél óránként

Részletesebben

FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre

FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre FELHÍVÁS a XXXI. Országos Tudományos Diákköri Konferencia Orvos- és Egészségtudományi Szekciójában való részvételre A rendezvény helyszíne: Általános Orvostudományi Kar Cím: SZTE ÁOK Dékáni Hivatal 6720

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS

ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS Mi az öregedés? Egyrészről az idő múlásával definiálható, a születéstől eltelt idővel mérhető, kronológiai sajátosságú, Másrészről az idő múlásához köthető biológiai,

Részletesebben

EGÉSZSÉG MAGATARTÁSTAN Egészség - alapismeretek

EGÉSZSÉG MAGATARTÁSTAN Egészség - alapismeretek EGÉSZSÉG MAGATARTÁSTAN Egészség - alapismeretek Dr. Gritz Arnoldné egeszseg@t-online.hu Semmelweis Egyetem Testnevelési és Sporttudományi Kar 2009/2010 FEJEZETEK Az egészség-magatartástan interdisciplináris

Részletesebben

A kötetben szereplő tanulmányok szerzői

A kötetben szereplő tanulmányok szerzői A kötetben szereplő tanulmányok szerzői Dr. Barzó Tímea, egyetemi docens, Miskolci Egyetem, Államés Jogtudományi Kar, Polgári Jogi Tanszék, Miskolc Dr. Barta Judit, egyetemi docens, Miskolci Egyetem, Állam-

Részletesebben

A neurofibromatózis idegrendszeri megnyilvánulása

A neurofibromatózis idegrendszeri megnyilvánulása A neurofibromatózis idegrendszeri megnyilvánulása Molekuláris Medicina Mindenkinek Fókuszban a Neurofibromatózis Varga Edina Tímea SE Genomikai Medicina és Ritka Betegségek Intézete Neurofibromatózis I.

Részletesebben

Magyarországi Evangélikus Egyház Sztehlo Gábor Evangélikus Óvoda, Általános Iskola és Gimnázium

Magyarországi Evangélikus Egyház Sztehlo Gábor Evangélikus Óvoda, Általános Iskola és Gimnázium Témakörök Biológia Osztályozó vizsgákhoz 2012/2013 9. Természettudományos Osztálya-kémia tagozat A növények életműködései Légzés és kiválasztás Gázcserenylások működése Növényi párologtatás vizsgálata

Részletesebben

Populációgenetikai vizsgálatok eredményei hangulatzavarokban. Képalkotó vizsgálatok alkalmazása a neuropszichofarmakológiában

Populációgenetikai vizsgálatok eredményei hangulatzavarokban. Képalkotó vizsgálatok alkalmazása a neuropszichofarmakológiában Populációgenetikai vizsgálatok eredményei hangulatzavarokban Képalkotó vizsgálatok alkalmazása a neuropszichofarmakológiában Juhász Gabriella Semmelweis Egyetem, GYTK, Gyógyszerhatástani Intézet Neuroscience

Részletesebben

CSALÁDTERVEZ TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE. Dr. Erős s Erika

CSALÁDTERVEZ TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE. Dr. Erős s Erika CSALÁDTERVEZ DTERVEZÉS KÜLÖNÖS TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE Dr. Erős s Erika A családtervez dtervezés s törtt rténete Magyarországon gon Veleszületett letett rendellenességek (CA) Jelenleg

Részletesebben

SZERVEZETI HATÉKONYSÁG FEJLESZTÉSE AZ EGÉSZSÉGÜGYI ELLÁTÓRENDSZERBEN TERÜLETI EGYÜTTMŰKÖDÉSEK KIALAKÍTÁSA TÁMOP 6.2.5 B

SZERVEZETI HATÉKONYSÁG FEJLESZTÉSE AZ EGÉSZSÉGÜGYI ELLÁTÓRENDSZERBEN TERÜLETI EGYÜTTMŰKÖDÉSEK KIALAKÍTÁSA TÁMOP 6.2.5 B SZERVEZETI HATÉKONYSÁG FEJLESZTÉSE AZ EGÉSZSÉGÜGYI ELLÁTÓRENDSZERBEN TERÜLETI EGYÜTTMŰKÖDÉSEK KIALAKÍTÁSA TÁMOP 6.2.5 B KONFERENCIA AZ EGÉSZSÉGESEBB EGÉSZSÉGÜGYÉRT 2015 06 30 TÁMOP-6.2.5-B-13/1-2014-0001

Részletesebben

ÉLETMINŐSÉG ÉS KÖLTSÉGEK A KÖZÉP- ÉS SÚLYOS FOKÚ PSORIASISOS BETEGEK KÖRÉBEN

ÉLETMINŐSÉG ÉS KÖLTSÉGEK A KÖZÉP- ÉS SÚLYOS FOKÚ PSORIASISOS BETEGEK KÖRÉBEN ÉLETMINŐSÉG ÉS KÖLTSÉGEK A KÖZÉP- ÉS SÚLYOS FOKÚ PSORIASISOS BETEGEK KÖRÉBEN WÉBER VALÉRIA Vezető asszisztens Zsigmondy Vilmos Harkányi Gyógyfürdőkórház Nonprofit kft. Psoriasis vulgaris Öröklött hajlamon

Részletesebben

A MOTESZ Képzési és Tudományos Bizottsága által 2007. június 15-én minősített rendezvények

A MOTESZ Képzési és Tudományos Bizottsága által 2007. június 15-én minősített rendezvények A MOTESZ Képzési és Tudományos Bizottsága által 2007. június 15-én minősített rendezvények Címe: Hazamentem a PIC-ből II. Kongresszus Szervező: New Instant Bt. Helyszín: Budapest Időpont: 2/10/2007-2/10/2007

Részletesebben

A KOGNITÍV PSZICHOTERÁPIA ALAPJAI 1. Perczel Forintos Dóra Semmelweis Egyetem Klinikai Pszichológia Tanszék 2010

A KOGNITÍV PSZICHOTERÁPIA ALAPJAI 1. Perczel Forintos Dóra Semmelweis Egyetem Klinikai Pszichológia Tanszék 2010 A KOGNITÍV PSZICHOTERÁPIA ALAPJAI 1. Perczel Forintos Dóra Semmelweis Egyetem Klinikai Pszichológia Tanszék 2010 INGER TUDATTALAN KÉSZTETÉS EMÓCIÓ PSZICHOANALITIKUS MODELL Beck, 1974. INGER EMÓCIÓ TANULÁSELMÉLETI

Részletesebben

CASTANEA Egyesület. Középkorúak egészségéért

CASTANEA Egyesület. Középkorúak egészségéért CASTANEA Egyesület Középkorúak egészségéért CASTANEA 2007-ben alapított civil szervezet, melyet Vas megyei értelmiségiek alapítottak - felismerve azt a társadalmi kihívást, mely a lakónépesség egészségi

Részletesebben

H. Özdem Bademci / Dolgozó utcagyerekek Isztambulban / University of Kent, Egyesült Királyság / Online megjelenés: 2012. Január 4.

H. Özdem Bademci / Dolgozó utcagyerekek Isztambulban / University of Kent, Egyesült Királyság / Online megjelenés: 2012. Január 4. Irodalomjegyzék: http://hvg.hu/egeszseg/20120109_depresszio_legolcsobb_gyogymod Sonja Ljubomirszkij / Michella Riba / A legolcsóbb gyógymód a depresszió kezelésére / Medipress / hvg.hu / 2012. 01. 09.

Részletesebben

Gyermek palliatív ellátás otthon és a hospice házban. Dr. Gergely Anita Tábitha Gyermekhospice HázH Magyar Hospice Alapítv

Gyermek palliatív ellátás otthon és a hospice házban. Dr. Gergely Anita Tábitha Gyermekhospice HázH Magyar Hospice Alapítv Gyermek palliatív ellátás otthon és a hospice házban Dr. Gergely Anita Tábitha Gyermekhospice HázH Magyar Hospice Alapítv tvány Gyermek hospice Sister Frances Dominica 1982. Helen House 2004. Douglas House

Részletesebben

ORSZÁGOS DIETETIKAI SZAKMAI TAGOZATVEZETŐI TISZTSÉGRE JELÖLT BEMUTATÁSA. MUNKAHELY: Testnevelési Egyetem (TE) - Sporttudományi Doktori Iskola,

ORSZÁGOS DIETETIKAI SZAKMAI TAGOZATVEZETŐI TISZTSÉGRE JELÖLT BEMUTATÁSA. MUNKAHELY: Testnevelési Egyetem (TE) - Sporttudományi Doktori Iskola, ORSZÁGOS DIETETIKAI SZAKMAI TAGOZATVEZETŐI TISZTSÉGRE JELÖLT BEMUTATÁSA NÉV: DOBÁK ZITA KAMARAI IGAZOLVÁNY SZÁM: 3100295 MUNKAHELY: Testnevelési Egyetem (TE) - Sporttudományi Doktori Iskola, Országos Sportegészségügyi

Részletesebben

Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig

Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig ELTE TTK Biológiai Intézet Budapest, 2015. okt. 7. Dr. Mócsai Attila Semmelweis Egyetem ÁOK Élettani Intézet

Részletesebben

Lujber László és a szerző engedélyé

Lujber László és a szerző engedélyé Allergia genetikai háttere Dr. Szalai Csaba 2012. Szeptember 24. 1 Allergia: multifaktoriális vagy komplex betegség: Genetikai háttér (több száz gén, több ezer genetikai variáció) + környezeti tényezők

Részletesebben

XIII. Budapesti Gyermekgyógyászati Továbbképzô Tanfolyam

XIII. Budapesti Gyermekgyógyászati Továbbképzô Tanfolyam Továbbképzô Tanfolyam Budapest, Kempinski Hotel Corvinus***** 2010. március 5 6. Budapest, Kempinski Hotel Corvinus Továbbképzô Tanfolyam 2010. március 5 6. A továbbképzés elnöke: Prof. Dr. Tulassay Tivadar

Részletesebben

Prof. Dr. Szabad János Tantárgyfelelős beosztása

Prof. Dr. Szabad János Tantárgyfelelős beosztása Tantárgy neve Genetika Tantárgy kódja BIB 1506 Meghírdetés féléve 5 Kreditpont 4 Összóraszám (elmélet + gyakorlat) 3+0 Számonkérés módja Kollokvium Előfeltétel (tantárgyi kód) BIB 1411 Tantárgyfelelős

Részletesebben

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk.

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A genetikai betegségek mellett, génterápia alkalmazható szerzett betegségek, mint

Részletesebben

Regulációs zavarok kutatása az Egészséges utódokért program keretében

Regulációs zavarok kutatása az Egészséges utódokért program keretében Regulációs zavarok kutatása az Egészséges utódokért program keretében Scheuring N.(1); Danis I.(2); Németh T.(3); Papp E.(1); Czinner Antal Prof.(1) Heim Pál Gyermekkórház, Budapest, Belgyógyászat (1);

Részletesebben

A Megelőző orvostan és népegészségtan szakvizsga tételei

A Megelőző orvostan és népegészségtan szakvizsga tételei A Megelőző orvostan és népegészségtan szakvizsga tételei 1. A népegészségügyi ciklus A 2. A természeti és társadalmi környezet szerepe a populáció egészségi állapotának alakulásában 3. Primer, szekunder

Részletesebben

MINIMUM KÖVETELMÉNYEK BIOLÓGIÁBÓL Felnőtt oktatás nappali rendszerű képzése 10. ÉVFOLYAM

MINIMUM KÖVETELMÉNYEK BIOLÓGIÁBÓL Felnőtt oktatás nappali rendszerű képzése 10. ÉVFOLYAM MINIMUM KÖVETELMÉNYEK BIOLÓGIÁBÓL Felnőtt oktatás nappali rendszerű képzése 10. ÉVFOLYAM I. félév Az élőlények rendszerezése A vírusok Az egysejtűek Baktériumok Az eukariota egysejtűek A gombák A zuzmók

Részletesebben

Markusovszky Lajosemlékülés

Markusovszky Lajosemlékülés Markusovszky Lajosemlékülés 2015. május 6. TÁMOGATÓ: Bokor Attila dr., Brubel Réka dr., Lukovich Péter dr., Rigó János Jr. dr.: Mélyen infiltráló colorectalis endometriosis miatt végzett multidiszciplináris

Részletesebben

OSZTÁLYFŐNÖKI TANMENET

OSZTÁLYFŐNÖKI TANMENET OSZTÁLYFŐNÖKI TANMENET Szakiskola 10. évfolyam 2013/2014 Osztályfőnök: Osztály: Nyíregyháza, 2013. szeptember 01. Készítette: Salamonné Bíró Beáta (OFMK. vez.) Engedélyezte:. igazgatóhelyettes 1. Szervezési

Részletesebben

CARDIOMETABOLICA HUNGARICA

CARDIOMETABOLICA HUNGARICA 2012; 5 (SUPPL. 3) S 1 - S 8 CARDIOMETABOLICA HUNGARICA 2012; 5 (SUPPL. 3) S 1 CARDIOMETABOLICA HUNGARICA A MAGYAR OBEZITOLÓGIAI ÉS MOZGÁSTERÁPIÁS TÁRSASÁG IX. KONGRESSZUSA AZ ELHÍZÁS INTERDISCIPLINÁRIS

Részletesebben

ÁNTSZ Országos Gyermekegészségügyi Intézet. Meghívó

ÁNTSZ Országos Gyermekegészségügyi Intézet. Meghívó Meghívó Engedje meg, hogy figyelmébe ajánljuk 2010. június 10-11-én megrendezésre kerülő konferenciánkat, melynek címe: Konferencia a Perikoncepcionális Egészségről és a Veleszületett Rendellenességek

Részletesebben

Az egészségpolitika, társadalom-egészségtan, egészségügyi minőségmenedzsment elmélete dióhéjban

Az egészségpolitika, társadalom-egészségtan, egészségügyi minőségmenedzsment elmélete dióhéjban Szakirodalmi áttekintés II. (Részletek) Az egészségpolitika, társadalom-egészségtan, egészségügyi minőségmenedzsment elmélete dióhéjban 3.1 Az egészségpolitika Az egészségpolitika korszerű értelmezésében

Részletesebben

Egyesületünk sikeres pályázatot nyert, a KAB-PR-07-B-0155 által kiírt pályázatán. A program részletes ismertetése Egészséges Test - Egészséges Gyermek

Egyesületünk sikeres pályázatot nyert, a KAB-PR-07-B-0155 által kiírt pályázatán. A program részletes ismertetése Egészséges Test - Egészséges Gyermek ünk sikeres pályázatot nyert, a KAB-PR-07-B-0155 által kiírt pályázatán A program részletes ismertetése Egészséges Test - Egészséges Gyermek gyermekeinknek átadjuk kromoszómáinkat és génjeinket, személyes

Részletesebben

Juhos Krisztina. Ph.D. hallgató. Hôpital d Hautepierre, Strasbourg. Nouvelle Hôpital Civil, Strasbourg. Hôpital Civil, Strasbourg

Juhos Krisztina. Ph.D. hallgató. Hôpital d Hautepierre, Strasbourg. Nouvelle Hôpital Civil, Strasbourg. Hôpital Civil, Strasbourg Juhos Krisztina Cím: Magyarország, 3532 Miskolc, Újítók utca 9. Telefon: 06 70 431 51 81 Email: juhoskriszta89@gmail.com Neme: Nő Születési dátum: 1989. 12. 05. Állampolgárság: Magyar KERESETT MUNKAKÖR

Részletesebben

PRIMER IMMUNDEFICIENCIA - KOMPLEMENT DEFEKTUS. LABORVIZSGÁLATOK BEMUTATÁSA EGY BETEGÜNK KAPCSÁN

PRIMER IMMUNDEFICIENCIA - KOMPLEMENT DEFEKTUS. LABORVIZSGÁLATOK BEMUTATÁSA EGY BETEGÜNK KAPCSÁN 2014. 1. szám TESZTKÉRDÉSEI: PRIMER IMMUNDEFICIENCIA - KOMPLEMENT DEFEKTUS. LABORVIZSGÁLATOK BEMUTATÁSA EGY BETEGÜNK KAPCSÁN SZILÁGYI ÁGNES 1, VARGA LILIAN 1, PROHÁSZKA ZOLTÁN 1, DÉRFALVI BEÁTA 2 Milyen

Részletesebben

Mindennapi testmozgás-egészséges élet

Mindennapi testmozgás-egészséges élet Mindennapi testmozgás-egészséges élet Dr. Vass Zoltán Ph.D. Magyar Diáksport Szövetség 1948-as megalakulásakor a World Health Organization (WHO) az egészséget a következőképpen definiálta: Az egészség

Részletesebben

Versenyképesség és egészségnyereség

Versenyképesség és egészségnyereség Versenyképesség és egészségnyereség A munkahelyi egészségfejlesztés értéknövelő alternatív megoldásai HR-megoldások a XXI. században - fókuszban a közszféra és a magánszféra nemzetközi tudományos konferencia

Részletesebben

Az egészségpszichológia és az orvosi pszichológia alapjai

Az egészségpszichológia és az orvosi pszichológia alapjai Az egészségpszichológia és az orvosi pszichológia alapjai ORVOSI PSZICHOLÓGIA II. Tisljár Roland Ph.D. tisljar.roland@sph.unideb.hu Vázlat Az egészségpszichológia és az orvosi pszichológia történeti háttere

Részletesebben

B-sejtek szerepe az RA patológiás folyamataiban

B-sejtek szerepe az RA patológiás folyamataiban B-sejtek szerepe az RA patológiás folyamataiban Erdei Anna Biológiai Intézet Immunológiai Tanszék Eötvös Loránd Tudományegyetem Immunológiai Tanszék ORFI, Helia, 2015 április 17. RA kialakulása Gary S.

Részletesebben

Mindennapi pajzsmirigy diagnosztika: antitestek, hormonszintek

Mindennapi pajzsmirigy diagnosztika: antitestek, hormonszintek Mindennapi pajzsmirigy diagnosztika: antitestek, hormonszintek Nagy V. Endre Endokrinológia Tanszék Debreceni Egyetem Orvos- és Egészségtudományi Centrum Belgyógyászati Intézet, I. Belklinika A pajzsmirigybetegségek

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

A nyelv genetikai háttere

A nyelv genetikai háttere A nyelv genetikai háttere Szalontai Ádám ELTE Elméleti Nyelvészeti Doktori Program MTA Nyelvtudományi Intézet 2014. április 29. 1 / 41 Az előadás menete Genetikai bevezető Gének és nyelv elmélet KE család

Részletesebben