Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig

Save this PDF as:
 WORD  PNG  TXT  JPG

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig"

Átírás

1 Transzgénikus technológiák az orvostudományban A kövér egerektől a reumás betegségek gyógyításáig ELTE TTK Biológiai Intézet Budapest, okt. 7. Dr. Mócsai Attila Semmelweis Egyetem ÁOK Élettani Intézet

2 Az orvosbiológiai kutatás egyik legfontosabb kérdése: Mi az egyes gének funkciója?

3 Egyiptomi hieroglifák a Holtak könyvéből (i. e. 1240) (forrás: Az emberi inzulint kódoló gén nukleotid-sorrendje ATGGCCCTGTGGATGCGCCTCCT GCCCCTGCTGGCGCTGCTGGCCC TCTGGGGACCTGACCCAGCCGCA GCCTTTGTGAACCAACACCTGTG CGGCTCACACCTGGTGGAAGCTC TCTACCTAGTGTGCGGGGAACGA GGCTTCTTCTACACACCCAAGAC CCGCCGGGAGGCAGAGGACCTGC AGGTGGGGCAGGTGGAGCTGGGC GGGGGCCCTGGTGCAGGCAGCCT GCAGCCCTTGGCCCTGGAGGGGT CCCTGCAGAAGCGTGGCATTGTG GAACAATGCTGTACCAGCATCTG CTCCCTCTACCAGCTGGAGAACT ACTGCAACTAG (forrás:

4 Az ob/ob egértörzs

5 Az ob/ob mutáció a leptin-génben Vad típus GAG AAT CTC CGA GAC CTC CTC Glu Asn Leu Arg Asp Leu Leu ob/ob GAG AAT CTC TGA GAC CTC CTC Glu Asn Leu Stop Csonka, működésképtelen fehérje

6 Leptinhiány emberben

7 A spontán mutációk fontos adatokkal szolgálnak a szervezet működéséről Tudunk-e célzott mutációkat létrehozni?

8 Transzgénikus technológia Élő szervezetek genomjának módosítása (idegen genetikai állomány bevitele) Például: Vörösen fluoreszkáló egerek előállítása

9 Transzgénikus technológia Élő szervezetek genomjának módosítása (idegen genetikai állomány bevitele) Például: Vörösen fluoreszkáló egerek előállítása

10 Genetikailag módosított egértörzsek Egerek genomiális DNS-ének célzott módosítása minden sejtben azonos; öröklődik Legfontosabb: Knockout Gén teljes törlése

11 Orvosi Nobel-díj 2007 Mario Capecchi (USA) szül. 1937, Olaszország Martin Evans (Nagy-Britannia) szül. 1941, Nagy-Britannia Oliver Smithies (USA) szül. 1925, Nagy-Britannia (forrás:

12 A knockout egerek létrehozása

13 Géntörléses (knockout) egerek Egyes gének célzott vizsgálata Betegségek megértése, gyógyítása

14 A rheumatoid arthritis Aggresszív autoimmun ízületi gyulladás Súlyos, krónikus betegség A népesség 1-2%-át érinti Pathomechanizmus nem teljesen ismert Terápia nem megoldott

15 Autoantitest-indukált arthritis egerekben Control Arthritis Jakus et al., J Exp Med 2009 Jakus et al., Arthritis Rheum 2010 Kovács et al., J Exp Med 2014

16 Mi történik itt?

17 Az integrinek működése fehérvérsejtekben Adhesion, spreading Src-family kinases Blood IS 2 -integrins Transmigration

18 Hipotézis Blood Transmigration IS Src-family kinases

19 Az ízület szövettani vizsgálata WT Control 3 SFK KO Arthritis Control Arthritis Kovács et al., J Exp Med 2014

20 A CD18-függő migráció károsodása? 160 Intact mice Cells in synovium (thousand cells/paw) Control Arthritic 0 WT CD18 KO 3 SFK KO WT PMN KO PMN Mixed bone marrow chimeras WT + KO (competitive migration) Ly6G CD45.2 Kovács et al., J Exp Med 2014

21 A CD18-függő migráció károsodása? 160 Intact mice Cells in synovium (thousand cells/paw) Control Arthritic 0 WT CD18 KO 3 SFK KO Mixed bone marrow chimeras WT + KO (competitive migration) Relative migration (WT CD45.1 = 1) 2 1 NINCS intrinsic migrációs károsodás! 0 WT CD18 KO 3 SFK KO Kovács et al., J Exp Med 2014

22 A sejtvándorlás feltételei A sejtek migrációs képessége A migrációt irányító kemotaktikus grádiens

23 Src-kinázok hiányában csökken a szinoviális térben a MIP-2 és az LTB 4 szintje MIP-2 (pg/limb) Control Arthritic LTB4 (pg/limb) Control Arthritic 0 WT 3 SFK KO 0 WT 3 SFK KO Kovács et al., J Exp Med 2014

24 Src-kinázok hiányában károsodik a neutrofil granulociták MIP-2 és LTB 4 leadása MIP-2 (pg/10 6 cells) Control IC LTB4 (ng/10 6 cells) Control IC 0 WT 3 SFK KO 0 WT 3 SFK KO Kovács et al., J Exp Med 2014

25 Javasolt mechanizmus Blood Transmigration IS Src-family kinases MIP-2 LTB 4... Src-family kinases Kovács et al., J Exp Med 2014

26 Sejt/molekuláris biológus vs. egér biológus Cell/molecular biologist Mouse biologist

27 A labor tagjai Jakus Zoltán Balázs Bálint Kertész Zsuzsa Győri Dávid Futosi Krisztina Simon Edina Kovács Miklós Németh Tamás Duleba Mónika

28 Támogatók

A genetikai lelet értelmezése monogénes betegségekben

A genetikai lelet értelmezése monogénes betegségekben A genetikai lelet értelmezése monogénes betegségekben Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika A ~20 ezer fehérje-kódoló gén a 23 pár kromoszómán A kromoszómán található bázisok száma: 250M

Részletesebben

Jelátviteli folyamatok vizsgálata neutrofil granulocitákban és az autoimmun ízületi gyulladás kialakulásában

Jelátviteli folyamatok vizsgálata neutrofil granulocitákban és az autoimmun ízületi gyulladás kialakulásában Jelátviteli folyamatok vizsgálata neutrofil granulocitákban és az autoimmun ízületi gyulladás kialakulásában Doktori tézisek Dr. Németh Tamás Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola

Részletesebben

Az Src-típusú tirozin-kinázok nélkülözhetetlenek az autoantitest-függő gyulladásos betegségek kialakulásához

Az Src-típusú tirozin-kinázok nélkülözhetetlenek az autoantitest-függő gyulladásos betegségek kialakulásához Az Src-típusú tirozin-kinázok nélkülözhetetlenek az autoantitest-függő gyulladásos betegségek kialakulásához Doktori tézisek dr. Kovács Miklós Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola

Részletesebben

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal Intelligens Rendszerek Elmélete Dr. Kutor László Párhuzamos keresés genetikus algoritmusokkal http://mobil.nik.bmf.hu/tantargyak/ire.html login: ire jelszó: IRE0 IRE / A természet általános kereső algoritmusa:

Részletesebben

BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA I. RHEUMATOID ARTHRITIS. origamigroup. www.origami.co.hu

BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA I. RHEUMATOID ARTHRITIS. origamigroup. www.origami.co.hu BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA I. RHEUMATOID ARTHRITIS origamigroup www.origami.co.hu I. Rheumatoid arthritis Sokat hallunk napjainkban az immunrendszernek az egészség

Részletesebben

A Proteoglycanok Szerepe a Spondylitis Ankylopoeticaban TEMATIKUS OTKA PÁLYÁZAT Szakmai zárójelentés

A Proteoglycanok Szerepe a Spondylitis Ankylopoeticaban TEMATIKUS OTKA PÁLYÁZAT Szakmai zárójelentés A Proteoglycanok Szerepe a Spondylitis Ankylopoeticaban TEMATIKUS OTKA PÁLYÁZAT 2004 2007 Szakmai zárójelentés Az autoimmunitás kutatásában az állatmodellek használata felbecsülhetetlen értéket képviselnek,

Részletesebben

1. Bevezetés. Integrinek, Fc-receptorok és G-fehérje-kapcsolt receptorok jelátvitelének mechanizmusa neutrofil granulocitákban

1. Bevezetés. Integrinek, Fc-receptorok és G-fehérje-kapcsolt receptorok jelátvitelének mechanizmusa neutrofil granulocitákban Integrinek, Fc-receptorok és G-fehérje-kapcsolt receptorok jelátvitelének mechanizmusa neutrofil granulocitákban Doktori tézisek Dr. Jakus Zoltán Semmelweis Egyetem Molekuláris Orvostudományok Doktori

Részletesebben

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal. A genetikus algoritmus működése. Az élet információ tárolói

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal. A genetikus algoritmus működése. Az élet információ tárolói Intelligens Rendszerek Elmélete dr. Kutor László Párhuzamos keresés genetikus algoritmusokkal http://mobil.nik.bmf.hu/tantargyak/ire.html login: ire jelszó: IRE07 IRE 5/ Természetes és mesterséges genetikus

Részletesebben

Semmelweis Egyetem VIII. Infektológiai Továbbképző Tanfolyam

Semmelweis Egyetem VIII. Infektológiai Továbbképző Tanfolyam 2015. március 20 21. Fókuszban az antibiotikum terápia PROGRAM 2015. MÁRCIUS 20. PÉNTEK 07.30 09.00 Regisztráció 09.00 09.30 Antibiotikum kezelés jelene és jövője 09.30 10.00 10.00 10.30 Prof. Dr. Ludwig

Részletesebben

Coeliakia: A klinikus szemével. Dr. Arató András egyetemi tanár, az MTA doktora SE I. Gyermekklinika

Coeliakia: A klinikus szemével. Dr. Arató András egyetemi tanár, az MTA doktora SE I. Gyermekklinika Coeliakia: A klinikus szemével Dr. Arató András egyetemi tanár, az MTA doktora SE I. Gyermekklinika Őstörténet Emberszabásúak: ~ 3 millió éve Homo sapiens: ~ 100,000 éve vadászok, halászok, gyűjtögetők:

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

Mit tud a genetika. Génterápiás lehetőségek MPS-ben. Dr. Varga Norbert

Mit tud a genetika. Génterápiás lehetőségek MPS-ben. Dr. Varga Norbert Mit tud a genetika Génterápiás lehetőségek MPS-ben Dr. Varga Norbert Oki terápia Terápiás lehetőségek MPS-ben A kiváltó okot gyógyítja meg ERT Enzimpótló kezelés Őssejt transzplantáció Genetikai beavatkozások

Részletesebben

A preventív vakcináció lényege :

A preventív vakcináció lényege : Vakcináció Célja: antigénspecifkus immunválasz kiváltása a szervezetben A vakcina egy olyan készítmény, amely fokozza az immunitást egy adott betegséggel szemben (aktiválja az immunrendszert). A preventív

Részletesebben

A kemotaxis jelentősége a. betegségek kialakulásában

A kemotaxis jelentősége a. betegségek kialakulásában A kemotaxis jelentősége a betegségek kialakulásában A kemotaxis jelentősége fertőzések esetén (1) Akut bőrsérülések citokin (IL-8)) felszabadulás TNF ill. IL-6 6 NEM szabadul fel Pseudomonas aeruginosa

Részletesebben

EGYETEMI TANÁRI ÁLLÁSPÁLYÁZAT. Dr. Mócsai Attila

EGYETEMI TANÁRI ÁLLÁSPÁLYÁZAT. Dr. Mócsai Attila EGYETEMI TANÁRI ÁLLÁSPÁLYÁZAT Semmelweis Egyetem Általános Orvostudományi Kar Élettani Intézet 1. sz. egyetemi tanári állás Dr. Mócsai Attila egyetemi docens Semmelweis Egyetem Általános Orvostudományi

Részletesebben

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté!

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté! Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában Kiss Máté! Magreceptor Kutató Laboratórium Biokémiai és Molekuláris Biológiai Intézet Debreceni Egyetem, Általános Orvostudományi

Részletesebben

Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása.

Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása. Növények klónozása Klónozás Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása. Görög szó: klon, jelentése: gally, hajtás, vessző. Ami

Részletesebben

Rheumatoid arthritis - reumás ízületi gyulladás (RA)

Rheumatoid arthritis - reumás ízületi gyulladás (RA) Rheumatoid arthritis - reumás ízületi gyulladás (RA) Ízületvédelem Az ízületekre károsan ható erők lehetőség szerinti kikapcsolása. Feladata: izmok erejének gazdaságos felhasználása biomechanika, struktúra,

Részletesebben

Doktori értekezés tézisei. A komplementrendszer szerepe EAE-ben (Experimental Autoimmune Encephalomyelitis), a sclerosis multiplex egérmodelljében

Doktori értekezés tézisei. A komplementrendszer szerepe EAE-ben (Experimental Autoimmune Encephalomyelitis), a sclerosis multiplex egérmodelljében Doktori értekezés tézisei A komplementrendszer szerepe EAE-ben (Experimental Autoimmune Encephalomyelitis), a sclerosis multiplex egérmodelljében Készítette: Terényi Nóra Témavezető: Prof. Erdei Anna Biológia

Részletesebben

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk.

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A genetikai betegségek mellett, génterápia alkalmazható szerzett betegségek, mint

Részletesebben

Férfi Ifjúsági Szerbajnokság Apparatus Finals

Férfi Ifjúsági Szerbajnokság Apparatus Finals Apparatus Finals Name / Név Team / Egyesület Floor 1 Boncsér Krisztián FTC Ybl Tervező Kerekes Zsombor, Deák Zoltán 5,6 8,900 14,500 Talaj 2 Kiss Balázs BHSE Fazakas Csaba 4,7 8,300 13,000 3 Vida Kornél

Részletesebben

Az omnipotens kutatónak, Dr. Apáti Ágotának ajánlva, egy hálás ex-őssejtje

Az omnipotens kutatónak, Dr. Apáti Ágotának ajánlva, egy hálás ex-őssejtje 1 Az omnipotens kutatónak, Dr. Apáti Ágotának ajánlva, egy hálás ex-őssejtje Írta és rajzolta: Hargitai Zsófia Ágota Munkában részt vett: Dr. Sarkadi Balázs, Dr. Apáti Ágota A szerkesztésben való segítségért

Részletesebben

A harkányi gyógyvízzel végzett vizsgálataink eredményei psoriasisban között. Dr. Hortobágyi Judit

A harkányi gyógyvízzel végzett vizsgálataink eredményei psoriasisban között. Dr. Hortobágyi Judit A harkányi gyógyvízzel végzett vizsgálataink eredményei psoriasisban 2007-2011 között Dr. Hortobágyi Judit Pikkelysömörre gyakorolt hatása 2007-től 2009-ig 1. Lokális hatása 2. Szisztémás hatása 3. Állatkísérlet

Részletesebben

Spondylitis ankylopoeticahoz társuló osteoporosis

Spondylitis ankylopoeticahoz társuló osteoporosis Spondylitis ankylopoeticahoz társuló osteoporosis Szántó Sándor DE OEC, Reumatológiai Tanszék 2013.11.05. Szeminárium Csontfelszivódás és csontképzés SPA-ban egészséges előrehaladott SPA Spondylitis ankylopoetica

Részletesebben

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök:

Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008. november 20., csütörtök, 15:55 eszközök: Otthonápolás Cégegészség Fogorvos Homeopátia Online gyógyszertár RSS Iratkozzon fel RSS-csatornáinkra! KÖNYVAJÁNLÓ Személyre szabott kezelés leukémiás gyermekeknek Magyarországon [origo] egészség 2008.

Részletesebben

2003. 12. 06. szombat Budapest, Mexikói út Nytsz: 411/A 1201 S e r d ü l ő O r s z á g o s B a j n o k s á g Légpuska 40 lövés, serdülő fiú egyéni 1 Tóth Ádám 89 Komárom VSE 94 96 97 91 378 2 Gábli Sándor

Részletesebben

VEDAC Esti verseny

VEDAC Esti verseny VEDAC Esti verseny 2015.07.31 Férfi 100 m - Időfutam 1. Kása Tibor 1987 HVSE 1. 10,92 2. Pozsgai Dániel 1993 FTC 1. 10,97 3. Orosz Zoltán 1992 TFSE 1. 10,98 4. Pázmándi Zsolt 1995 GEAC 1. 11,17 5. Molnár

Részletesebben

módosított, akkor meg az a baj

módosított, akkor meg az a baj Ha genetikailag il módosított, tt az a baj, ha nem genetikailag módosított, akkor meg az a baj Kovári Zoltán Kovári és Társai Szabadalmi és Védjegy Iroda Kft. MIE Szeged MIE Szeged 2012. május 10 11. Science,

Részletesebben

ALKÍMIA MA Az anyagról mai szemmel, a régiek megszállottságával. www.chem.elte.hu/pr

ALKÍMIA MA Az anyagról mai szemmel, a régiek megszállottságával. www.chem.elte.hu/pr ALKÍMIA MA Az anyagról mai szemmel, a régiek megszállottságával www.chem.elte.hu/pr Kvíz az előző előadáshoz 1) Mikor kapott Paul Ehrlich orvosi Nobel-díjat? A) Idén. B) Pont 100 éve, 1908-ban. C) Nem

Részletesebben

100 m női Kezdés: 19,00 Név Sz.év Klub Hely Eredmény

100 m női Kezdés: 19,00 Név Sz.év Klub Hely Eredmény VEDAC-2015.07.31. 100 m női Kezdés: 19,00 Név Sz.év Klub Hely Eredmény Budai Alexandra 1994 GEAC 1 12,41 Torma Evelin 1994 GEAC 2 12,56 Baráti Patrícia 1997 GEAC 3 12,61 Fülöp Virág 1998 VEDAC 4 13,23

Részletesebben

Molekuláris Medicina

Molekuláris Medicina Molekuláris Medicina Molekuláris Medicina Őssejt terápia Génterápia Tumor terápia Immunterápia Egyéb terápiák Vakcinák Genetikai diagnosztika Orvosi genomika Terápiák Diagnosztikák Orvostudomány: régi

Részletesebben

REUMATOLÓGIA BETEGTÁJÉKOZTATÓ. Sokízületi gyulladás

REUMATOLÓGIA BETEGTÁJÉKOZTATÓ. Sokízületi gyulladás REUMATOLÓGIA BETEGTÁJÉKOZTATÓ Reumatoid artitisz Sokízületi gyulladás Mi is az a reuma? A köznyelv a reuma kifejezésen lényegében a mozgásszervi megbetegedéseket érti. A reumatológiai vagy reumás kórképek

Részletesebben

Baranya 25-50-75-100 kerékpáros túra. Négy Évszak Futás (tavasz) Négy Évszak Futás (nyár) 2012 másodperces. DÖKE 25-50-75 kerékpáro s túra

Baranya 25-50-75-100 kerékpáros túra. Négy Évszak Futás (tavasz) Négy Évszak Futás (nyár) 2012 másodperces. DÖKE 25-50-75 kerékpáro s túra Tó- s - Ádám Kriszt nincs nincs Ambrus Norbert X nincs nincs Asszonyi Veronika X X nincs nincs Balla Antal nincs nincs Balogh Bettina X X X X X X X X X ezüst arany Balogh János X X nincs nincs Balogh Judit

Részletesebben

4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program

4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program 4. sz. Mentális Egészségtudományok Doktori Iskola 4/1.sz. Pszichiátria Program Kurzusvezetö és kurzuscím 4101-K A magatartás modellezése neurokémiája és gyógyszeres befolyásolása. (magyar) (Dr. Bagdy György)

Részletesebben

A CD44 ellenes monoklonális antitest kezelés hatásmechanizmusa kísérletes artritiszben. Doktori értekezés. Dr. Hutás Gábor

A CD44 ellenes monoklonális antitest kezelés hatásmechanizmusa kísérletes artritiszben. Doktori értekezés. Dr. Hutás Gábor A CD44 ellenes monoklonális antitest kezelés hatásmechanizmusa kísérletes artritiszben. Doktori értekezés Dr. Hutás Gábor Semmelweis Egyetem Molekuláris Orvostudományi Doktori Iskola Témavezető: Dr. Gergely

Részletesebben

ei ranglista 1993-ban születtek 25 m-es

ei ranglista 1993-ban születtek 25 m-es 50 m-es férfi gyorsúszás 1 Csütörtöki Marcell 1993 BVSC-Zugló 0:24.08 2 Nagy Milán 1993 Szegedi UE 0:24.54 3 Bohus Richárd 1993 Bcs. Elore 0:24.63 4 Vörös Benjamin 1993 Dunaf-DVSI 0:24.76 5 Füzesy Dávid

Részletesebben

Mi lenne ha az MPS is része lenne az újszülöttkori tömegszűrésnek?

Mi lenne ha az MPS is része lenne az újszülöttkori tömegszűrésnek? Mi lenne ha az MPS is része lenne az újszülöttkori tömegszűrésnek? Dr. Jávorszky Eszter, Kánnai Piroska Dr. Szőnyi László Semmelweis Egyetem, I. Gyermekklinika, Budapest Anyagcsere szűrőközpont 2 Ritka

Részletesebben

Dr. Herényi Levente egyetemi docens Biofizikai és Sugárbiológiai Intézet 1094 Budapest, Tűzoltó u. 37-47.

Dr. Herényi Levente egyetemi docens Biofizikai és Sugárbiológiai Intézet 1094 Budapest, Tűzoltó u. 37-47. I. évfolyam MATEMA TIKA BIOFIZIKA ÁLTALÁNOS ÉS SZERVETLEN KÉMIA GYÓGYSZERÉSZI NÖVÉNYTAN BIOLÓGIA TUDOMÁNYTÖRTÉNE T ÉS PROPEDEUTIKA, a 2. félévben heti 1 óra Dr. Gergó Lajos egyetemi docens 1092 Budapest,

Részletesebben

Eredménylista Fürkész verseny, körzeti szakasz,

Eredménylista Fürkész verseny, körzeti szakasz, Eredménylista Fürkész verseny, körzeti szakasz, 2016-2017 Megye: KOLOZS Körzet: Kolozsvár, Bálványosváralja és Szék 5. osztály 1. Bajnóczi Zsolt Bucur Tünde János Zsigmond Unitárius Kollégium Kolozsvár

Részletesebben

Az étrend-kiegészítő készítmények hatásossága és biztonságossága. Horányi Tamás MÉKISZ

Az étrend-kiegészítő készítmények hatásossága és biztonságossága. Horányi Tamás MÉKISZ Az étrend-kiegészítő készítmények hatásossága és biztonságossága Horányi Tamás MÉKISZ KÖTELEZŐ SZAKMACSOPORTOS TOVÁBBKÉPZÉS GYÓGYSZERTÁRI ELLÁTÁS SZAKMACSOPORT 2014. április 25. Egészségre vonatkozó állítások

Részletesebben

EREDMÉNYEK. Budapest, november 11. Helyezés Név Intézmény Időeredmény Pontszám 1. Cseh László Budapesti Műszaki Egyetem 24,04 7 p

EREDMÉNYEK. Budapest, november 11. Helyezés Név Intézmény Időeredmény Pontszám 1. Cseh László Budapesti Műszaki Egyetem 24,04 7 p EREDMÉNYEK Budapest, 2007. november 11. 50 m férfi gyorsúszás 1. Cseh László Budapesti Műszaki Egyetem 24,04 7 p Takács Krisztián Dunaújvárosi Főiskola 24,11 5 p 3. Molnár Dávid Budapesti Műszaki Egyetem

Részletesebben

A Magyar Tudományos Akadémia Természettudományi Kutatóközpontja

A Magyar Tudományos Akadémia Természettudományi Kutatóközpontja A Magyar Tudományos Akadémia Természettudományi Kutatóközpontja Keserű György Miklós gy.keseru@ttk.mta.hu www.ttk.mta.hu Az MTA TTK küldetése: multidiszciplináris kutatások komplex rendszereken Ember Anyagtudomány

Részletesebben

Rituximab. Finanszírozott indikációk:

Rituximab. Finanszírozott indikációk: Rituximab Finanszírozott indikációk: 1. Súlyos rheumatoid arthritis kezelésére, amennyiben előzetes, legalább három hónapig tartó TNF-alfa gátló terápia ellenére a betegség aktivitása megfelelően nem csökken

Részletesebben

Rekombináns Géntechnológia

Rekombináns Géntechnológia Rekombináns Géntechnológia Tartalom: 1 1. Biotechnológia, géntechnológia, társadalom 2. Genetikai rekombináció 3. Génbevitel tenyésztett sejtekbe 4. Genetikailag módosított szervezetek (GMO-k) 4a. Transzgénikus

Részletesebben

1.sz.pár 101 Bálint Balázs 599 Wellner Péter

1.sz.pár 101 Bálint Balázs 599 Wellner Péter 1.sz.pár 101 Bálint Balázs 599 Wellner Péter 1 1 2016.04.11 17:45-18:50 1NS 2 Arató Péter II - Mihály Tibor 1-8 1 2 2016.04.11 18:55-20:00 1NS 3 Macskásy Judit - Reich Ágnes 9-16 1 3 2016.04.11 20:05-21:10

Részletesebben

II. Tisza-tó Maraton - MTB Felnőtt Férfi

II. Tisza-tó Maraton - MTB Felnőtt Férfi II. Tisza-tó Maraton - MTB Felnőtt Férfi 1. II. Tisza-tó Maraton - MTB Felnőtt Férfi 1 83 Csire Sándor - 01:40:30 00:00:00 2 59 Németh Miklós Sólyom Team 01:40:31 00:00:00 3 145 Jakab Csaba - 01:41:38

Részletesebben

Név Évjárat Engedély Egyesület

Név Évjárat Engedély Egyesület 0 m. Légpisztoly 0 pont Kisbakonyi János 9 767 Győri PLE 80 Sass László 95 6 Écs LK 7 Kovács Bálint István 98 00 Soproni PLE 7 Horváth László 960 08 Győri PLE 6 5 Gelencsér Dávid 978 Soproni PLE 6 6 G.

Részletesebben

Lipidek anyagcseréje és az ateroszklerózis (érelmeszesedés)

Lipidek anyagcseréje és az ateroszklerózis (érelmeszesedés) Lipidek anyagcseréje és az ateroszklerózis (érelmeszesedés) Rácz Olivér Miskolci Egyetem Egészségügyi Kar 22.9.2009 ateromisk.ppt 1 Az érelmeszesedés csak a XIX. évszázad második felétől orvosi probléma

Részletesebben

Vizsgaszervező intézmény: Wigner Jenő Műszaki, Informatikai Középiskola és Kollégium (Eger, Rákóczi út 2) tel./fax: (36) , Fax:

Vizsgaszervező intézmény: Wigner Jenő Műszaki, Informatikai Középiskola és Kollégium (Eger, Rákóczi út 2) tel./fax: (36) , Fax: Vizsgaszervező intézmény: Wigner Jenő Műszaki, Informatikai Középiskola és Kollégium (Eger, Rákóczi út 2) tel./fax: (36) 311-211, 515-115 Fax: 515-116 Tisztelt Vizsgázó! Ezúton tájékoztatjuk, hogy a(z)

Részletesebben

II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI. origamigroup BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA

II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI. origamigroup BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA BETEGTÁJÉKOZTATÓ RHEUMATOID ARTHRITISBEN SZENVEDŐ BETEGEK SZÁMÁRA II. A RHEUMATOID ARTHRITIS KEZELÉSÉNEK ÁLTALÁNOS ELVEI origamigroup www.origami.co.hu II. A rheumatoid arthritis kezelésének általános

Részletesebben

II. Tisza-tó Maraton - Abszolút Férfi

II. Tisza-tó Maraton - Abszolút Férfi II. Tisza-tó Maraton - Abszolút Férfi 1. II. Tisza-tó Maraton - Abszolút Férfi 1 174 Vígh Zoltán - 01:34:30 00:00:00 2 139 Nagy Gyula Alföld KS 01:34:32 00:00:01 3 152 Vízer Barnabás Team Katay 01:36:57

Részletesebben

Makó Csenge 1. Baky Boglárka Makó Csenge 2. Hegyi Petra Szűcs Helga 21:08 3. Rétháti Lili Kiss Fanni Dóra Makó Csenge 4. Makó Csenge Kiss Fanni 21:16

Makó Csenge 1. Baky Boglárka Makó Csenge 2. Hegyi Petra Szűcs Helga 21:08 3. Rétháti Lili Kiss Fanni Dóra Makó Csenge 4. Makó Csenge Kiss Fanni 21:16 Makó Csenge 1. Baky Boglárka Makó Csenge 2. Hegyi Petra Szűcs Helga 21:08 3. Rétháti Lili Kiss Fanni Dóra Makó Csenge 4. Makó Csenge Kiss Fanni 21:16 5.-6. Kiss Fanni Kovács Debóra 21:14 Kiss Fanni 5.-6.

Részletesebben

Rajtlista m fiú vegyes m lány vegyes m fiú pillangó m lány pillangó. pálya név születési év egyesület nevezési idő.

Rajtlista m fiú vegyes m lány vegyes m fiú pillangó m lány pillangó. pálya név születési év egyesület nevezési idő. Rajtlista pálya név születési év egyesület nevezési idő 1 80 m fiú vegyes 1 Tornyi Barna 2005 AUKE 01:28,17 2 Kovács Marcell 1998 AUKE 01:08,60 3 Kiss Róbert 1999 AUKE 01:02,82 4 Forgó Dániel 2005 AUKE

Részletesebben

Fiú 100m síkfutás V. Kcs. Szül.dát. Iskola Eredmény 1. Móricz Bálint PREG 11,2 2. Bagnár Dániel

Fiú 100m síkfutás V. Kcs. Szül.dát. Iskola Eredmény 1. Móricz Bálint PREG 11,2 2. Bagnár Dániel Fiú 100m síkfutás V. Kcs. 1. Móricz Bálint 1995 PREG 11,2 2. Bagnár Dániel 1995 GÉP 11,5 3. Koszti Dániel 1995 BOLYG 11,7 4. Pernyesz Marcell 1995 BOLYG 11,8 5. Mecseki Ádám 1995 NLG 11,9 6. Fáró Jenő

Részletesebben

Semmelweis Egyetem, Budapest, Onkológiai Tanszék, Országos Onkológiai Intézet, 1122 Ráth Gy. u. 7-9.

Semmelweis Egyetem, Budapest, Onkológiai Tanszék, Országos Onkológiai Intézet, 1122 Ráth Gy. u. 7-9. Semmelweis Egyetem, Budapest, Onkológiai Tanszék, Országos Onkológiai Intézet, 1122 Ráth Gy. u. 7-9. Tanszékvezető: Prof. dr. Polgár Csaba, egyetemi tanár Tel.: +36-1-224-8690 E-mail: polgar@oncol.hu Web-site:

Részletesebben

Az élettani alapfogalmak ismétlése

Az élettani alapfogalmak ismétlése Anaemia - vérszegénység Rácz Olivér Miskolci Egyetem Egészségügyi kar 27.9.2009 hematmisk1.ppt Oliver Rácz 1 Az élettani alapfogalmak ismétlése A vér összetétele, vérplazma Hematopoézis A vvs-ek tulajdonsága

Részletesebben

Eredmények: 3 km-es távon: 1996-ban és utána születetek: Lány: 1. hely Fózer Tímea Gyóni Géza Ált. Iskola. 2. hely Hende Helga Gyóni Géza Ált.

Eredmények: 3 km-es távon: 1996-ban és utána születetek: Lány: 1. hely Fózer Tímea Gyóni Géza Ált. Iskola. 2. hely Hende Helga Gyóni Géza Ált. Eredmények: 3 km-es távon: 1996-ban és utána születetek: 1. hely Fózer Tímea Gyóni Géza Ált. Iskola 2. hely Hende Helga Gyóni Géza Ált. Iskola 3. hely Ritka Viktória Kossuth Lajos Ált. Iskola 1. hely Pap

Részletesebben

1. A OSZTÁLY Bogdán Dániel Bogdán Edina Bogdán György Bogdán György Bogdán Krisztián Bogdán László Bogdán Richárd Czimmerman Patrik Horváth Dorotina

1. A OSZTÁLY Bogdán Dániel Bogdán Edina Bogdán György Bogdán György Bogdán Krisztián Bogdán László Bogdán Richárd Czimmerman Patrik Horváth Dorotina 1. A OSZTÁLY Bogdán Dániel Bogdán Edina Bogdán György Bogdán György Bogdán Krisztián Bogdán László Bogdán Richárd Czimmerman Patrik Horváth Dorotina Hörcsöki Alíz Kovács Antónia M. Kovács Dávid Kovács

Részletesebben

A születéskor gyűjthető. őssejtekről, felhasználási. lehetőségükről, valamint a KRIO Intézet. szolgáltatásairól

A születéskor gyűjthető. őssejtekről, felhasználási. lehetőségükről, valamint a KRIO Intézet. szolgáltatásairól A születéskor gyűjthető őssejtekről, felhasználási lehetőségükről, valamint a KRIO Intézet szolgáltatásairól krio Családi Őssejtbank A KRIO Intézet Sejt- és Szövetbank Zrt. 2004 óta végzi köldökzsinórvér

Részletesebben

Helyezések-B kategória

Helyezések-B kategória Helyezések-B kategória Helyezés Név Megjegyzés I-kcs. fiú Boros Gergely (2001) Bolyai János Általános Iskola Érd Kis Kasza Miklós (2004) Batthyány Általános Iskola és Sportiskola Érd Pintér Olivér (2001)

Részletesebben

EREDMÉNYEINK. 2012/2013 tanév KULTURÁLIS TEVÉKENYSÉG. - II. helyezés Benczenleitner Tárkány É/2. cs. Felkészítő: Friedrich-Mészáros E.

EREDMÉNYEINK. 2012/2013 tanév KULTURÁLIS TEVÉKENYSÉG. - II. helyezés Benczenleitner Tárkány É/2. cs. Felkészítő: Friedrich-Mészáros E. EREDMÉNYEINK 2012/2013 tanév KULTURÁLIS TEVÉKENYSÉG Felfénylő szavak Szavalóverseny Regionális Döntő Iregszemcse - I. helyezés Benczenleitner Tárkány É/2. cs. Felkészítő: Friedrich-Mészáros E. - I. helyezés

Részletesebben

Atlétika 2013. 10. 03. Pécs PVSK

Atlétika 2013. 10. 03. Pécs PVSK SPORTEREDMÉNYEK TANAK 2013/2014. tanév Atlétika 2013. 10. 03. Pécs PVSK Tordai Miklós I. helyezett 100 m síkfutás I. helyezett 200 m síkfutás I. helyezett Hegedűs Péter II. helyezett magasugrás I. helyezett

Részletesebben

Várgesztesi Terepfutás május 12, vasárnap

Várgesztesi Terepfutás május 12, vasárnap Várgesztesi Terepfutás 2013. május 12, vasárnap 500 m 1. 7 Vámos András f 2007-1 2:38 2. 6 Ujhelyi Balázs f 2007-2 2:42 3. 3 Takács-Lissai Máté f 2007-3 2:52 4. 2 Kusztván Menyhért f 2007-4 3:18 5. 1 Miksa

Részletesebben

A mesenchymális őssejtek regeneratív és immunmoduláló hatása

A mesenchymális őssejtek regeneratív és immunmoduláló hatása A mesenchymális őssejtek regeneratív és immunmoduláló hatása Kiss Judit A DOKTORI ÉRTEKEZÉS TÉZISEI ELTE TTK Biológia Doktori Iskola Strukturális és funkcionális biológia Doktori Program A Doktori Iskola

Részletesebben

Hármascsapat országos bajnokság

Hármascsapat országos bajnokság 40 km - ABSZOLÚT 1 1 NAGY ZOLTÁN RÓKA TIBOR ZSUPOS SÁNDOR 2 2 Révész Gábor Nagy András Szabó Lajos 1 3 NAGY GYULA HAJDÚ BARNA MAGAS DÁVID 2 4 Hacsi Ákos Balázs Attila Szűcs Richárd 3 5 Árva Mihály Petró

Részletesebben

TÖBB SEJT. NAGYOBB BIZTONSÁG Miért válassza a Cord Blood Center őssejtbankot?

TÖBB SEJT. NAGYOBB BIZTONSÁG Miért válassza a Cord Blood Center őssejtbankot? TÖBB SEJT NAGYOBB BIZTONSÁG Miért válassza a Cord Blood Center őssejtbankot? Kedves Leendő Szülők! A folyamatosan fejlődő őssejtkutatás bebizonyította, hogy a köldökzsinórvérben rendkívül értékes őssejtek

Részletesebben

Hemopoetikus eredetű sejtek jelátvitele egészséges és kóros körülmények között. Dr. Mócsai Attila

Hemopoetikus eredetű sejtek jelátvitele egészséges és kóros körülmények között. Dr. Mócsai Attila MTA DOKTORI ÉRTEKEZÉS TÉZISEI Hemopoetikus eredetű sejtek jelátvitele egészséges és kóros körülmények között Dr. Mócsai Attila SEMMELWEIS EGYETEM Budapest 2011 A címlapon a Syk (vörös) és a CD18 (zöld)

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

VERSENYEREDMÉNYEK Tagintézmény. Pék- cukrász OSZKTV Szakma Kiváló Tanulója. Lótenyésztő OSZKTV Szakma Kiváló Tanulója

VERSENYEREDMÉNYEK Tagintézmény. Pék- cukrász OSZKTV Szakma Kiváló Tanulója. Lótenyésztő OSZKTV Szakma Kiváló Tanulója VERSENYEREDMÉNYEK Tagintézmény 2003. Vadász-Ember Andrea 9/E birkózás Orbán Barbara 12/KÉ Gödri Zoltán 13/PC Szalai Dávid 13/PC Horváth Annamária 12/L Pacsi Terézia 12/L Boros Mónika 12/KÉ Takács Szelina

Részletesebben

Forg-Tech Kupa Mezeifutó Magyar Liga 1. forduló Valamint amatőr mezei és cross verseny Békéscsaba, Póstelek 2015. október 24.

Forg-Tech Kupa Mezeifutó Magyar Liga 1. forduló Valamint amatőr mezei és cross verseny Békéscsaba, Póstelek 2015. október 24. Férfi Mezei futás Mezei Magyar Liga 1. Gregor László 1992 Békéscsabai AC 19:56 2. Kovács Benjámin Ádám 1995 UTE 20:20 3. Király István 1994 Mogyi SE Baja 20:35 4. Juhász Balázs 1996 DSC-SI 20:51 5. Szemeti

Részletesebben

2007/2008. TANÉV MEZEIFUTÓ DIÁKOLIMPIA ORSZÁGOS DÖNTŐ VÉGEREDMÉNY

2007/2008. TANÉV MEZEIFUTÓ DIÁKOLIMPIA ORSZÁGOS DÖNTŐ VÉGEREDMÉNY 2007/2008. TANÉV MEZEIFUTÓ DIÁKOLIMPIA ORSZÁGOS DÖNTŐ III. korcsoport - FIÚ EGYÉNI (1995-1996) Hely Név Szül Település Iskola Megye 48 Horváth Ákos 1995 Püspökladány Ált. Isk., Előkészítő Szakiskola, AMI,

Részletesebben

2010. évi Budapesti Egyetemi Atlétikai Bajnokság jegyzőkönyve

2010. évi Budapesti Egyetemi Atlétikai Bajnokság jegyzőkönyve 2010. évi Budapesti Egyetemi Atlétikai Bajnokság jegyzőkönyve Időpont: 2010. április 24. Helyszín: BEAC- XI. Ker. Bogdánffy u. 10 Rendező: ELTE ADSK Résztvevő intézmények: Eötvös Loránd Tudományegyetem

Részletesebben

Graboplast Győri Vízisport Egyesület évi Magyar Bajnoki Eredményei

Graboplast Győri Vízisport Egyesület évi Magyar Bajnoki Eredményei Verseny Versenyszám Korosztály Táv Hely Név Gyermek, Kölyök, Serdülő Magyar Bajnokság C-2 serdülő 4000 m 1 Balla Levente Gellért U23, Ifjúsági Magyar Bajnokság C-1 ifi 3x200 m 1 Balla Levente Gellért U23,

Részletesebben

Dr. Simicskó István, Magyarország honvédelemi minisztere, és Bozó Tibor dandártábornok parancsnok

Dr. Simicskó István, Magyarország honvédelemi minisztere, és Bozó Tibor dandártábornok parancsnok Kivonat Magyarország honvédelemi miniszterének 186/2016. számú határozatából, valamint a MH Altiszti Akadémia parancsnokának 750/2016. számú parancsából a személyi állományra vonatkozóan. A határozatokat,

Részletesebben

Hepatitis C vírus és cryoglobulinaemia

Hepatitis C vírus és cryoglobulinaemia Hepatitis C vírus és cryoglobulinaemia Dr Petrovicz Edina 2012.11.10. ESZISZL Kh. és Rendelőintézet Hepatitis C vírus (HCV) Flaviviridae család Hepacivirus nemzetség egyszálú RNS vírus Choo és Kuo 1989.

Részletesebben

KONTAWIG Műszaki és Üzlettudományi Szakképző Iskola (3300 Eger, II. Rákóczi Ferenc u. 2) tel./fax: tel:36/515-115, fax:36/515-116

KONTAWIG Műszaki és Üzlettudományi Szakképző Iskola (3300 Eger, II. Rákóczi Ferenc u. 2) tel./fax: tel:36/515-115, fax:36/515-116 Vizsgaszervező intézmény: KONTAWIG Műszaki és Üzlettudományi Szakképző Iskola (3300 Eger, II. Rákóczi Ferenc u. 2) tel./fax: tel:36/515-115, fax:36/515-116 Tisztelt Vizsgázó! Ezúton tájékoztatjuk, hogy

Részletesebben

XV. Országos JáróbetegSzakellátási Konferencia és X. Országos JáróbetegSzakdolgozói Konferencia. Balatonfüred, 2013. szeptember 12-14.

XV. Országos JáróbetegSzakellátási Konferencia és X. Országos JáróbetegSzakdolgozói Konferencia. Balatonfüred, 2013. szeptember 12-14. XV. Országos JáróbetegSzakellátási Konferencia és X. Országos JáróbetegSzakdolgozói Konferencia Balatonfüred, 2013. szeptember 12-14. Gellai Nándor gyógytornász-fizioterapeuta Dr. Berecz Zsuzsanna reumatológus

Részletesebben

II EGYES F Ő T Á B L A

II EGYES F Ő T Á B L A Ny-Magyarország területi ÚJONC Győr 5.5.3. II EGYES F Ő T Á B L A. 483 6 Balogh Bence Fastron Aszt. Club Tolna 6 Balogh Bence. 66 3 Marton Bálint Szombathelyi Haladás VSE 3 / 6 Balogh Bence 3. 675 9 Straubinger

Részletesebben

Szinoviális szarkómák patogenezisében szerepet játszó szignálutak jellemzése szöveti multiblokk technika alkalmazásával

Szinoviális szarkómák patogenezisében szerepet játszó szignálutak jellemzése szöveti multiblokk technika alkalmazásával Szinoviális szarkómák patogenezisében szerepet játszó szignálutak jellemzése szöveti multiblokk technika alkalmazásával Fónyad László 1, Moskovszky Linda 1, Szemlaky Zsuzsanna 1, Szendrői Miklós 2, Sápi

Részletesebben

X. IJKA Nyílt Országos Karate Stílus Bajnokság

X. IJKA Nyílt Országos Karate Stílus Bajnokság X. IJKA Nyílt Országos Karate Stílus Bajnokság Oroszlány, 2015. október 10. Hivatalos E r e d m é n y j e g y z é k KATA 6-7 éves lány kata 1. Pál Alexandra Budoka SE, Edző: Pál Tibor 2. Németh Júlia Jánossomorjai

Részletesebben

Klasszikus jóga színpad 50 perces bemutatóórák

Klasszikus jóga színpad 50 perces bemutatóórák Klasszikus jóga színpad 50 perces bemutatóórák 09.00 Astanga jóga Gauranga Das - Atma Center 10.00 Vinyasa Flow Herczeg Angelika - Atma Center 11.00 Yoga Synergy Lenkefi Mónika - Ízisz Jóga Stúdió 12.00

Részletesebben

GLUTÉN-SZŰRÉS Vízöntő Gyógyszertár 2015.10.19.

GLUTÉN-SZŰRÉS Vízöntő Gyógyszertár 2015.10.19. LISZTÉRZÉKENYSÉG (COELIAKIA) SZŰRÉS (GLUTÉN-SZŰRÉS) VÍZÖNTŐ GYÓGYSZERTÁR MI A LISZTÉRZÉKENYSÉG? A lisztérzékenység a kalászos gabonák fogyasztásával provokált autoimmun betegség, mely a bélrendszer és

Részletesebben

Ny-Magyarország területi ÚJONC Győr /0 2 / 3 0 / 3 0 / / 3 3 / / 3 3 / 0 3 / 0 ÚJONC FIÚ 11 EGYES SELEJTEZŐ CSOPORT

Ny-Magyarország területi ÚJONC Győr /0 2 / 3 0 / 3 0 / / 3 3 / / 3 3 / 0 3 / 0 ÚJONC FIÚ 11 EGYES SELEJTEZŐ CSOPORT Ny-Magyarország területi ÚJONC Győr 5.5. EGYES SELEJTEZŐ CSOPORT Match Time Table. CSOPORT - 3 6 Balogh Bence Fastron Aszt. Club To. 3 / 3 / - 4 483-6 Kerti Botond Szombathelyi Aszt. K. / 3 3 / 3-4 6894-4

Részletesebben

Az Élettani Intézetben védett szakdolgozatok

Az Élettani Intézetben védett szakdolgozatok Az Élettani Intézetben védett szakdolgozatok 2016. Farkas János: Az oszteoklasztok fejlődését és működését szabályozó jelátviteli folyamatok Témavezető: Dr. Mócsai Attila, Dr. Győri Dávid Jakab Géza: Ambulánsan

Részletesebben

GIMNÁZIUM I. Név Osztály Iskola Felkészítő tanár Összesen Helyezés Megjegyzés

GIMNÁZIUM I. Név Osztály Iskola Felkészítő tanár Összesen Helyezés Megjegyzés GIMNÁZIUM I. 1. Kovács András 10. Révai Győr 5 4 7 1 7 24 2. Stelczer Ádám 10. Révai Győr 7 0 3 5 5 20 3. Góger Szabolcs 9. Szent Orsolya Sopron Márk Tímea 7 3 5 0 4 19 4. Szaksz Bence 9. Kazinczy Győr

Részletesebben

A köpenysejtes limfómákról

A köpenysejtes limfómákról A köpenysejtes limfómákról Dr. Schneider Tamás Országos Onkológiai Intézet Lymphoma Centrum Limfóma Világnap 2014. szeptember 15. Limfómám van! Limfómám van! Igen? De milyen típusú? Gyógyítható? Nem gyógyítható?

Részletesebben

A félévi munka értékelése az felső tagozaton Dicséretet kaptak Jó tanulmányi munkáért Példamutató magatartásért Szorgalmáért Közösségi munkáért Kiváló sportteljesítményért 5.a Rátkai Péter Udvarhelyi Benedek

Részletesebben

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)

Részletesebben

Evolúció ma: az antibiotikum rezisztencia a baktériumoknál

Evolúció ma: az antibiotikum rezisztencia a baktériumoknál Evolúció ma: az antibiotikum rezisztencia a baktériumoknál Dr. Jakab Endre, adjunktus Magyar Biológia és Ökológia Intézet, Babeş-Bolyai Tudományegyetem ejakab@hasdeu.ubbcluj.ro Tartalom az antibiotikum

Részletesebben

3. II. kcs. 50m fiú gyorsúszás. 4. II. kcs. 50m lány gyorsúszás. 5. I. kcs. 50m fiú hátúszás

3. II. kcs. 50m fiú gyorsúszás. 4. II. kcs. 50m lány gyorsúszás. 5. I. kcs. 50m fiú hátúszás Jegyzőkönyv 1. I. kcs. 50m fiú gyorsúszás 1. Bordás Levente 2005 Kodály 00:37,44 2. Takács Dani 2004 Móra 00:38,38 3. Fekete Máté 2004 Móra 00:44,79 4. Zuppán Zsolt 2004 Móra 00:49,87 5. Kerpics Martin

Részletesebben

Serdülõ I. Ranglista. Férfi Kajak

Serdülõ I. Ranglista. Férfi Kajak Serdülõ I. Ranglista Az összetett verseny állása 2004.nov..10 Férfi Kajak 1 2 3 4 5 Németh Tamás Varga Kálmán Soós Péter Péter Kristóf Mészáros Zsolt 4121 MULTI Sportegyesület 75.70 2 8 19.20 339 Lágymányosi

Részletesebben

Az immunológia alapjai

Az immunológia alapjai Az immunológia alapjai 8. előadás A gyulladásos reakció kialakulása: lokális és szisztémás gyulladás, leukocita migráció Berki Timea Lokális akut gyulladás kialakulása A veleszületeh és szerzeh immunitás

Részletesebben

370.000 HUF 1.000 HUF 10.000 HUF 3.000 HUF 6.000 HUF 25.000 HUF 40.000 HUF 9.999 HUF

370.000 HUF 1.000 HUF 10.000 HUF 3.000 HUF 6.000 HUF 25.000 HUF 40.000 HUF 9.999 HUF Támogatóink Bodoky Tamás Maróy Ákos Urbán Ágnes Vay Márton Scheiring Gábor (ogy. képviselo, LMP) Bohus Csaba Gervai Péter Pogány Anikó Földes Balázs Dr. Szilágyi Péter Zoltán (ogy. képviselo, LMP) Nemes

Részletesebben

KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR

KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR KIHÍVÁSOK ÉS LEHETŐSÉGEK AZ ÉLELMISZER INNOVÁCIÓBAN TECHNOLÓGIA, TUDÁS, TÁRSADALOM GYIMES ERNŐ SZTE MÉRNÖKI KAR MAI MENÜ Táplálkozás funkciói és hibái Egészség és táplálkozás Társadalmi igények Táplálkozás

Részletesebben

INNOVATÍV TUDOMÁNY. Bálint Béla: Őssejtek biológiai alaptulajdonságok és. terápiai alkalmazás

INNOVATÍV TUDOMÁNY. Bálint Béla: Őssejtek biológiai alaptulajdonságok és. terápiai alkalmazás INNOVATÍV TUDOMÁNY A Vajdasági Magyar Akadémiai Tanács tudományos tanácskozása nemzetközi részvétellel Színhely: Magyar Tannyelvű Tanítóképző Kar, I. emeleti díszterem, Szabadka, Strossmayer u. 11. Időpont:

Részletesebben

KAPOSI MÓR ORTOPÉDIAI NAPOK III. Kaposvár, 2015. május 8-9.

KAPOSI MÓR ORTOPÉDIAI NAPOK III. Kaposvár, 2015. május 8-9. KAPOSI MÓR ORTOPÉDIAI NAPOK III. Kaposvár, 2015. május 8-9. A Somogy Megyei Kaposi Mór Oktató Kórház Ortopédiai Osztályának, a Magyar Váll- és Könyöksebészek Egyesületének és a Magyar Gyógytornász-Fizioterapeuták

Részletesebben

B-sejtek szerepe az RA patológiás folyamataiban

B-sejtek szerepe az RA patológiás folyamataiban B-sejtek szerepe az RA patológiás folyamataiban Erdei Anna Biológiai Intézet Immunológiai Tanszék Eötvös Loránd Tudományegyetem Immunológiai Tanszék ORFI, Helia, 2015 április 17. RA kialakulása Gary S.

Részletesebben

A genomiális medicina szép új világa

A genomiális medicina szép új világa A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012 2014 2015. ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet A medicina

Részletesebben

Úszott idő. Úszott idő

Úszott idő. Úszott idő Diákolimpia IV. korcsoport 100 m fiú gyors A Diákolimpia IV. korcsoport 100 m leány gyors A 1. 1,00,19 Novoszáth Noel 2000 Radnóti 1. 1,05,57 Bonecz Boglárka 2000 Karolina 2. 1,02,15 Molnár Bálint 1999

Részletesebben