K-vitamin-epoxidreduktáz gén haplocsoport-meghatározása: egy újabb elem az antikoaguláns terápia optimalizálásában

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "K-vitamin-epoxidreduktáz gén haplocsoport-meghatározása: egy újabb elem az antikoaguláns terápia optimalizálásában"


1 EREDETI KÖZLEMÉNYEK K-vitamin-epoxidreduktáz gén haplocsoport-meghatározása: egy újabb elem az antikoaguláns terápia optimalizálásában SIPEKY CSILLA MELEGH BÉLA DR. Pécsi Tudományegyetem, Általános Orvostudományi Kar, Orvosi Genetikai és Gyermekfejlődéstani Intézet, Pécs A warfarin és az acenokumarolok a leggyakrabban alkalmazott antikoagulánsok, amelyek szűk terápiás tartománnyal rendelkeznek, a hatásos dózis pedig populáción belül és egyénenként is nagy változatosságot mutat. A kumarinok a K-vitamin-epoxidreduktáz enzim (VKOR) gátlásán keresztül akadályozzák meg a koagulációt. Az enzimet kódoló VKORC1 gén mutációi jelentősen befolyásolják a kumarinok iránti érzékenységet. A VKORC1 gén genetikai variabilitását a *2, *3 és a *4 haplotípusok fedik le a kaukázusi populációban. Antikoaguláns kezelésben részesülő betegek bemutatásán keresztül összefoglaló tanulmányban ismertetjük a VKORC1 gén haplotípusának variabilitását. Munkánkban 28, klinikailag nem szokványos antikoaguláns választ produkáló beteget karakterizáltunk a VKORC1 G-1639A, G9041A és C6009T polimorfizmusokra. Molekuláris módszerként PCR-RFLP technikát és direkt szekvenálást alkalmaztunk. Betegpopulációnkban sikerült kimutatni VKORC1 *1*2, *2*2, *2*3, *1*4, *2*4 és *3*4 haplotípusokat. Vizsgált betegeink körében előfordult a VKORC1 gén haplotípusa alapján közepes dózisigényű (4,9±0,2 mg/nap) A/B haplocsoportú (a vizsgált betegek 61%-a) és magas dózisigényű (6,2±0,3 mg/nap) B haplocsoportú (25%) beteg is. Az antikoaguláns terápia vérzéses szövődményeinek megelőzésében fontos az alacsony warfarindózisú (2,7±0,2 mg/nap) A haplocsoportba tartozó betegek (esetünkben 14%) diagnosztizálása. Eredményeink mutatják, hogy a haplocsoport-vizsgálat se gíti a megfelelő szintű véralvadásgátláshoz szükséges gyógyszerdózis meghatározását és a végzetes vérzési epizódok elkerülését. Kulcsszavak: antikoaguláns terápia, VKORC1 haplotípus, warfarinrezisztencia Haplogroup analysis of vitamin-k epoxide reductase (VKORC1) gene: novel element in the optimization of anticoagulant therapy. Warfarin and acenocoumarols are the most commonly prescribed anticoagulants that is difficult to use because of the wide intra- and interpatient variation in the dose requirements, the narrow therapeutic range and the risk of serious bleeding. Vitamin K epoxide reductase (VKORC1) is the site of inhibition by coumarins. Mutations in the VKORC1 gene affect the sensitivity of the epoxy reductase enzyme for warfarin. The three main haplotypes of VKORC1 gene, *2, *3, *4, explain most of the genetic variability in warfarin dose among Caucasians. In the current paper we focus on this subject in view of our experience gained during molecular genetic tests for the main VKORC1 haplotypes in Hungarian patients with anticoagulant therapy and unusual clinical response. A total of 28 selected cases were characterized for VKORC1 G-1639A, G9041A and C6009T alleles. Genotyping has been carried out by molecular biology techniques, including PCR-RFLP assay and direct sequencing. In patients undergoing anticoagulant therapy we could identify VKORC1 *1*2, *2*2, *2*3, *1*4, *2*4 and *3*4 haplotypes. Patients with A haplotype group (14% of the studied patients) require much lower warfarin doses than other patients (2.7±0.2 mg/day). In our patients we found some with B haplotype group (25%) who require high warfarin dose (6.2±0.3 mg/day). There were also subjects bearing the A/B haplotype group (61%) with intermediate warfarin dose (4.9±0.2 mg/day), estimated by the haplotype analyses of the VKORC1 gene. Results presented here underline the need of VKORC1 haplotyping in anticoagulated patients with unusual clinical anticoagulant response, and the examination can have further therapeutic consequences. Keywords: anticoagulant therapy, VKORC1 haplotype, warfarin resistance (Beérkezett: június 19.; elfogadva: augusztus 4.) Az antikoaguláns terápia alkalmazásával számos betegség esetén megelőzhető a thromboembolia kialakulása [1]. Véralvadásgátlók alkalmazása indokolt akut mélyvénás trombózis, tüdőembólia, pitvarfibrilláció, balszívfél-elégtelenség és szívbillentyű-beültetés esetén [2, 3]. A tartós orális antikoaguláns kezelés bázisgyógyszerei a K-vitaminantagonisták csoportjába tartozó kumarinve gyületek. A warfarin lassabban eliminálódik a keringésből az acenokumarolhoz képest, ezért stabilabb a kívánt mértékű alvadásgátlás [4]. DOI: /OH évfolyam, 39. szám

2 A B C D 1. ábra A VKORC1 gén promoter régiójában talált G-1639A normális allél (A), a 3 régiójában talált G9041A heterozigóta (B) és homozigóta mutáns eltérés (C), valamint a C6009T mutáció (D) az első intronban. Az egyes eltérések helyét nyilak jelzik A warfarin dózisát számos tényező befolyásolja, például a beteg neme, életkora, táplálkozása, felszívódási viszonyok, kísérő betegségek és azok gyógyszerei, és nem utolsósorban a genetikai tényezők. A warfarin szűk terápiás tartománnyal rendelkezik, és a gyógyszerválasz magas fokú interindividuális variabilitással bír [5, 6]. Az alacsony dózisigényű betegeknél túl magas dózis alkalmazása esetén végzetes vérzések léphetnek fel testszerte, bőrnekrózis alakulhat ki, ellenkező esetben azonban elmarad a várt gyógyszerhatás [6]. A warfarin, valamint más kumarintípusú gyógyszerek a májban lévő K-vitamin-epoxidreduktáz enzim (VKOR) gátlásán keresztül akadályozzák meg a koagulációt [7, 8]. Normális esetben a K-vitamin epoxiddá alakul a májban, majd az epoxidreduktáz enzim redukálja. A redukált K-vitamin-epoxid szükséges több véralvadási faktor szintéziséhez, úgymint a trombin, VII., IX., X. faktorok, protein C és S [9]. A VKORC1 gén a VKOR-komplex legnagyobb alegysége. Genetikai variabilitásának 99%-át 3 fő haplotípus fedi le az európai populációban: *2, *3 és *4 variánstípusok (*1 a vad típus) [10]. Az egyes haplotípusok segítségével alacsony (A) és magas (B) dózisú haplocsoportokat különíthetünk el [11]. A G-1639A, G9041A, C6009T SNP-k alkalmasak és elegendőek, hogy elkülönítsük a 4 legfontosabb haplotípust és a 2 haplocsoportot. A G-1639A polimorfizmus a gén promoter régiójában található, M2 markernek nevezik, és a *2 haplotípust determinálja. M23 markerként a gén 3 -régiójában található G9041A SNP ismert, amely a *3 haplotípust határozza meg. Az intron 1-ben található C6009T polimorfizmus (M16 marker) a *4 haplotípust határozza meg. A *2 haplotípus az alacsony dózisú A haplocsoportba tartozik, míg a *3 és a *4 haplo típusok a magas dózisú B haplocsoportot határozzák meg [10]. Vizsgálatunkban antikoaguláns kezelésben részesülő betegek VKORC1 génjének haplotípusát és haplocsoportját határoztuk meg, ezáltal segítve a kívánt antikoaguláns dózis beállítását és a végzetes vérzési események elkerülését. Betegek és módszerek Vizsgált betegpopuláció Vizsgálatunkhoz antikoaguláns kezelésben részesülő betegek EDTA-val alvadásgátolt vénás vérmintáit gyűjtöttük össze. A DNS-minták és a betegek adatainak gyűjtése és használata során a Helsinki Nyilatkozat (1975) irányelveit és szabályozását követtük. Klinikailag jól jellemzett betegpopulációnkat DNS-bankban helyeztük el. Vizsgálatunkban 28 beteg DNS-mintáját genotipizáltuk, amelyből 19 nő és 9 férfi volt. Átlagéletkoruk 51 év volt (SD±12 év). A gyógyszerszedés indikációja betegeink esetében trombózis, pulmonalis embolia, pitvarfibrilláció és hypertoniás krízis volt évfolyam, 39. szám 1840

3 Molekuláris módszerek A betegek mintáinak genotipizálásához polimeráz láncreakció révén felsokszoroztuk a K-vitamin-epoxidreduktáz gén számunkra szükséges szakaszát. A PCR-termék segítségével restrikciós fragmenthossz-polimorfizmus (RFLP) módszert alkalmazva meghatároztuk a VKORC1 gén G-1639A, G9041A, C6009T polimorfizmusait. Primer tervezéshez a GeneBank adatbázisban elhelyezett szekvenciákat használtuk: VKORC1 G-1639A esetén rs , VKORC1 G9041A esetén rs7294, VKORC1 C6009T esetén rs A primer tervezéséhez Primer3 nevű programot alkalmaztunk. A VKORC1 G-1639A polimorfizmust a következő forward primer 5 - ATCCCTCTGGGAAGTCAAGC -3 és reverse primer 5 - CACCTTCAACCTCTCCATCC -3 segítségével határoztuk meg. A VKORC1 G9041A primerek a következők voltak: 5 - TTTAGAGACCCT TCCCAGCA -3 és 5 - AGCTCCAGAGAAGGCAACAC -3. Míg a VKORC1 C6009T SNP esetén a sense primer az 5 -AGGCGTTAGCATAATGACGG -3 és az antisense a 5 -GGGTG GAACCAGGTTAGGAC -3 volt. A PCR-amplifikációt 50 μl végtérfogatban készítettük el, amely 200 μm-t tartalmazott mindegyik dntp-ből, 1 U Taq polimerázt, 5 μl reakciópuffert (10 mm Tris-HCl, ph 9,0, amely 500 mm KCl, 14 mm MgCl 2 ), 0,2 mm-t mindegyik primerből és 1 μg izolált DNS-t. A PCRamplifikációt MJ Research PTC 200 készülékben végeztük. A PCR-kondíciók a következők voltak: elődenaturáció 3 perc 96 ºC-on, amelyet 35 cikluson keresztül 30 s denaturáció követett ugyanezen a hőmérsékleten, majd 30 s annealing 60 ºC-on a G-1639A esetén és 59 ºC a G9041A esetén, valamint 65 ºC-on a C6009T SNP-nél, primer extenzió 30 s-on át 72 ºC-on, végső extenzió 72 ºC 5 percre. A létrejött PCR-terméket 2%- os agarózgélben elektroforetizáltuk, majd etidium-bromid és UV-fény segítségével vizualizáltuk. Az amplikonokat allélspecifikus restrikciós endonukleázokkal emésztettük: 10 μl PCR-terméket 1U restrikciós enzimmel. Az emésztett termékek elválasztására agaróz gélelektroforézist alkalmaztunk (3%). A VKORC1 G-1639A SNP esetén a PCR-terméket BcnI enzimmel, a VKORC1 G9041A esetén SsiI, míg a VKORC1 C6009T polimorfizmusnál FspBI restrikciós endonukleázzal emésztettük. A VKORC1 G-1639 allél esetén a 636 bp nagyságú PCR-terméket a BcnI enzim 50 bp, 114 bp és 472 bp nagyságú fragmentumokra vágta. Az A allél jelenlétében azonban 114 bp és 522 bp hosszúságú termékek keletkeztek. A VKORC1 G9041A polimorfizmus esetén 674 bp hosszú PCR-termék keletkezik, és a GG genotípus 117 bp, 216 bp és 341 bp termékeket eredményez, míg az AA allélok jelenlétében 117 bp és 557 bp termékek keletkeztek. A VKORC1 C6009T SNP PCR terméke 725 bp nagyságú, amelyből az RFLP assay során a normális allél jelenlétében 109 bp és 616 bp termékek, valamint a homozigóta mutáns genotípusnál 109 bp, 133 bp és 483 bp termékek keletkeztek. A módszer ellenőrzésére random kiválasztott betegek VKORC1 génjének bidirekcionális szekvenálását végeztük el ABI PRISM 3100 Avant típusú automata szekvenálókészüléken (1. ábra). Eredmények Alvadásgátló kezelésben részesülő betegeink vizsgálata során számos, a klinikai gyakorlat számára említésre méltó és fontos esetben diagnosztizáltuk genetikai mutáció meglétét. Két betegünknél a K-vitamin-epoxidreduktáz enzim G>A polimorfizmus esetén homozigóta mutáns genotípust, míg a 6009 C>T és a 9041 G>A polimorfizmusa esetén normális allélt találtunk (2.A ábra). A kapott adatok alapján ezek a betegek a VKORC1 *2*2 haplo típusba tartoznak, amely az alacsony warfarindózisú A haplocsoportot határozza meg. A VKORC1 gén haplotípusa alapján alacsonyabb dózis alkalmazása javasolt (2,7±0,2 mg/nap) [5]. Trombózison átesett 58 éves nőbetegnél a VKORC1 gén G>A SNP esetén normális allélt, 9041 G>A SNP esetén homozigóta mutáns genotípust találtunk (2.B ábra). Ebben az esetben a beteg VKORC1 *3*3 haplotípusba tartozik, amely a magas dózisú B haplocsoportot határozza meg. Másik öt betegnél a VKORC G>A polimorfizmusa esetén normális allélt, 9041 G>A és a 6009 C>T SNP esetén heterozigóta genotípust találtunk (2.C ábra). A kapott adatok alapján a betegek a VKORC1*3 és*4 haplotípusba tartoznak, amelyek a magas warfarindózisú B haplocsoportot határozzák meg. A kapott eredmény alapján a kumarinszármazékokat érintő gyógyszer-metabolizmusban eltérés várható, magasabb dózis alkalmazása javasolt (6,2±0,3 mg/nap) [5]. Számos tüdőembólián átesett betegünknél a VKORC G>A és a 9041 G>A polimorfizmusa esetén heterozigóta allélt, valamint a 6009 C>T SNP esetén normális genotípust találtunk (2.D ábra). Ezek alapján a beteg a VKORC1*2 és VKORC1*3 haplotípusba tartozik, amelyek a közepes warfarindózisú A/B haplocsoportot határozzák meg. A kumarinszármazékokból közepes dózis alkalmazása javasolt (4,9±0,2 mg/nap) [5]. Megbeszélés Az antikoaguláns kezelés során az a célunk, hogy a kumarinadag változtatásával olyan mértékű legyen az alvadásgátlás, amely már véd az intravasalis vérrög kialakulása ellen, de még nem okoz jelentős vérzékenységet. A honlapján a jelenleg ajánlott warfarindózis 2 10 mg per nap. A kezdő gyógyszeradag meghatározását egy algoritmus segíti, amely a www. warfarindosing.org címen található meg. A warfarin terápiás dózisát számos tényező befolyásolja, úgymint a VKORC1 polimorfizmusok, testfelületindex (BSA), kor, INR-érték, dohányzás, egyéb gyógyszerek használata, évfolyam, 39. szám

4 *50 bp-os standard létrát alkalmaztunk 2. ábra Vérzékenységre hajlamosító VKORC1 *2*2 haplotípusba tartozó betegek (A), a warfarinrezisztenciára hajlamosító VKORC1 *3*3 (B) és *3*4 (C) haplotípusba tartozó betegek, valamint a közepes warfarindózis-igényű VKORC1 *2*3 haplotípusú betegek (D)* trombózis előfordulása. Meg kell jegyezni, hogy a warfarint a CYP2C9 enzim metabolizálja, így a gén variánsai is jelentősen befolyásolják a terápia kimenetelét. Egyes becslések alapján a VKORC1 gén variabilitása a warfarin dózisváltozásának 15 30%-áért felelős, amely alapján a K-vitamin-epoxidreduktáz gén genotípus-meghatározása jelzi legnagyobb mértékben előre a warfarindózist [5, 6, 11, 12, 13]. A VKORC1 gén promoter régiójában található G>A polimorfizmus az alacsony warfarindózis meghatározója [14]. A G allél aktivitása 44%-kal nagyobb az A allélnál [14]. A -1639A allél homozigóta hordozóinak warfarinkezelését a legalacsonyabb dózissal ajánlott kezdeni, és a legmagasabb a káros mellékhatások rizikója [11]. A G-1639A SNP nem vad típusú variációinak fenotípusos prevalenciája 50% a kaukázusi populációt tekintve. A megnövekedett kumarinszenzitivitású páciensek 93%-a homozigóta a *2 haplotípusra, amelyet a G-1639A polimorfizmus határoz meg [10]. A G/A SNP esetén a mutáns allél számának növekedése egyenesen arányos a hatásos warfarindózis csökkentésével. Homozigóta mutáns (AA) esetén a standard dózisnak (amit GG esetén adnak) a fele ajánlott. Az etnikai csoportok között jelentős eltérés is tapasztalható a -1639G>A variánst tekintve. Az ázsiai populációkban ez a mutáció nagyon gyakori (allélfrekvencia 89 94%) és gyakorinak tekinthető a kaukázusi eredetű emberekben is (allélfrekvencia 37%) [5, 14]. A G-1639A SNP mutációi megakadályozzák a transzkripciós faktorok kötődését a VKORC1 gén promoter régiójában, amely alacsonyabb szintű mrns-transzkriptumot eredményez, és végül kevesebb érett funkcionális VKOR enzim jön létre. A VKOR enzim hiánya limitálja a K-vitamin-epoxid redukált K-vitaminná alakulását, ami elengedhetetlen a véralvadási faktorok működéséhez. A VKORC1 gén G-1639A SNP-re homozigóta mutáns évfolyam, 39. szám 1842

5 betegnél az említett okok miatt nem jön létre elég redukált K-vitamin. A VKORC1 gén 3 -régiójában található G9041A SNP esetében a homozigóta A alléllal rendelkező betegek megnövekedett warfarindózis-igényt mutatnak a G allélra heterozigóta vagy homozigóta betegekhez képest [15, 16]. Európai populációban a mutáns allélfrekvencia 35 39% között van [15, 17], míg a japán populációban ez mindössze 8 17% [18, 19]. A VKORC1 gén 1-es intronjában található C6009T polimorfizmus a *4 haplotípust determinálja, amely a magas dózis meghatározója. Európai populációban az allélfrekvencia 20% körüli [10]. Az általunk vizsgált populációban a G-1639A SNP-t tekintve 75%-ban találtunk mutációt, ebből 10% volt homozigóta mutáns. A mutációt hordozók aránya a G9041A polimorfizmus esetén 61% volt, ebből 12% volt homozigóta mutáns. A C6009T SNP esetén 43%-ban találtunk mutáns allélt, és a betegek 8%-ában volt homozigóta a mutáció. A fent említett mutációk által meghatározott A és B haplocsoport a warfarindózis-változás negyedéért felelős [11]. A warfarinrezisztencia-vizsgálatra küldött betegeink 25%-a a magas dózisú B haplocsoportba tartozik, ami a jó klinikai diagnosztizálást mutatja. Ezeknél a betegeknél, ha elegendően magas gyógyszerdózissal indítjuk a terápiát, elérhetjük a megfelelő szintű antikoagulálást már a terápia kezdetén, és elkerülhető a trombózis kialakulása. A 28 vizsgált beteg közül 4-ben találtunk az átlagos dózishoz képest alacsonyabb warfarinigényre utaló mutációt. Az ő esetükben a VKORC1 haplotípus meghatározásával elkerülhetők a vérzéses szövődmények. Mivel a kumarintípusú antikoagulánsokra igen szűk terápiás dózistartomány jellemző, az antikoaguláns dózis ideális beállítása után továbbra is elengedhetetlenül fontos az INR-érték (international normalized ratio) rendszeres monitorozása és a 2,0 3,0 közötti terápiás tartományban tartása. Az alvadásgátlást akkor tekintjük optimálisnak, ha az INR értéke 2,0 és 3,0 között van. Ha az INR kisebb 2,0-nél, akkor elégtelen az alvadásgátlás, ha viszont az INR 3,0 fölé emelkedik, megnő a vérzés veszélye. Vannak olyan betegségek (például régebbi, mechanikus billentyűk), amelyek esetén indokolt nagyobb véralvadásgátló dózis alkalmazása. Ilyen élesre állított betegeknél az INR 2,5 3,5 közötti értéke az elfogadott. Régebben lezajlott mélyvénás trombózis vagy fokozott vérzésveszély esetén elegendő, ha az INR 1,5 2,0 között van. Az INR-érték stabilitásának jelentőségét klinikai tanulmányok is bizonyítják. Ingadozó INR-érték mellett megnő a stroke veszélye a pitvarfibrillációban szenvedő betegeknél [20]. A vérzés veszélye 5 feletti INR-érték esetén exponenciálisan nő [21]. Az Egyesült Államok Élelmiszer- és Gyógyszerügyi Hivatala (FDA) 2007 augusztusában előírta, hogy a K-vitamin-antagonisták tájékoztatóján tüntessék fel: a CYP2C9 és a VKORC1 gén polimorfizmusai jelentősen befolyásolják az antikoagulánsok optimális dózisát. Ez biztosítja, hogy az orvosok a páciens genetikai profiljának meghatározásával a beteg számára legpontosabb dózist alkalmazzák. Mindezek alapján a módszer alkalmazása határozott lépésnek tekinthető az egyénre szabott gyógyszerterápia eléréséhez. Számos irodalmi adat támasztja alá, hogy a hazánkban alkalmazott acenokumarol esetében a CYP2C9 és a VKORC1 gének polimorfizmusai a dózisigényt hasonlóképpen befolyásolják, mint a warfarin esetében [22, 23, 24]. Köszönetnyilvánítás Köszönetemet fejezem ki Hartung Mártának a DNSelemzés technikai részében nyújtott segítségéért. Irodalom [1] Rettie, A. E., Tai, G.: The pharmacogenomics of warfarin: closing in on personalized medicine. Mol. Interv., 2006, 6, [2] Hirsh, J., Dalen, J. E., Anderson, D. R. és mtsai: Oral anticoagulants: mechanism of action, clinical effectiveness, and optimal therapeutic range. Chest, 1998, 114, 445S 469S. [3] Lip, G. Y., Kamath, S., Hart, R. G.: ABC of antithrombotic therapy: Antithrombotic therapy for cerebrovascular disorders. BMJ, 2002, 325, [4] Bodin, L., Verstuyft, C., Tregouet, D. A. és mtsai: Cytochrome P450 2C9 (CYP2C9) and vitamin K epoxide reductase (VKO- RC1) genotypes as determinants of acenocoumarol sensitivity. Blood, 2005, 106, [5] Obayashi, K., Nakamura, K., Kawana, J. és mtsai: VKORC1 gene variations are the major contributors of variation in warfarin dose in Japanese patients. Clin. Pharmacol. Ther., 2006, 80, [6] Yin, T., Miyata, T.: Warfarin dose and the pharmacogenomics of CYP2C9 and VKO. Thromb. Res., 2007, 120, [7] Rost, S., Fregin, A., Ivaskevicius, V. és mtsai: Mutations in VKO- RC1 cause warfarin resistance and multiple coagulation factor deficiency type 2. Nature, 2004, 427, [8] Li, T., Chang, C. Y., Jin, D. Y. és mtsai: Identification of the gene for vitamin K epoxide reductase. Nature, 2004, 427, [9] Nelsestuen, G. L., Zytkovicz, T. H., Howard, J. B.: The mode of action of vitamin K. Identification of gamma-carboxyglutamic acid as a component of prothrombin. J. Biol. Chem., 1974, 249, [10] Geisen, C., Watzka, M., Sittinger, K. és mtsai: VKORC1 haplotypes and their impact on the inter-individual and inter-ethnical variability of oral anticoagulation. Thromb. Haemost., 2005, 94, [11] Rieder, M. J., Reiner, A. P., Gage, B. F. és mtsai: Effect of VKO- RC1 haplotypes on transcriptional regulation and warfarin dose. N. Engl. J. Med., 2005, 352, [12] Wadelius, M., Chen, L. Y., Eriksson, N. és mtsai: Association of warfarin dose with genes involved in its action and metabolism. Hum. Genet., 2007, 121, [13] Veenstra, D. L., You, J. H., Rieder, M. J. és mtsai: Association of vitamin K epoxide reductase complex 1 (VKORC1) variants with warfarin dose in a Hong Kong Chinese patient population. Pharmacogenet. Genom., 2005, 15, [14] Yuan, H. Y., Chen, J. J., Lee, M. T. és mtsai: A novel functional VKORC1 promoter polymorphism is associated with inter-individual and inter-ethnic differences in warfarin sensitivity. Hum. Mol. Genet., 2005, 14, [15] D'Andrea, G., D'Ambrosio, R. L., Di Perna, P. és mtsai: A polymorphism in the VKORC1 gene is associated with an interindi évfolyam, 39. szám

6 vidual variability in the dose-anticoagulant effect of warfarin. Blood, 2005, 105, [16] Herman, D., Peternel, P., Stegnar, M. és mtsai: The influence of sequence variations in factor VII, gamma-glutamyl carboxylase and vitamin K epoxide reductase complex genes on warfarin dose requirement. Thromb. Haemost., 2006, 95, [17] Li, T., Lange, L. A., Li, X. és mtsai: Polymorphisms in the VKO- RC1 gene are strongly associated with warfarin dosage requirements in patients receiving anticoagulation. J. Med. Genet., 2006, 43, [18] Takahashi, H., Wilkinson, G. R., Nutescu, E. A. és mtsai: Different contributions of polymorphisms in VKORC1 and CYP2C9 to intra- and inter-population differences in maintenance dose of warfarin in Japanese, Caucasians and African-Americans. Pharmacogenet. Genom., 2006, 16, [19] Kimura, R., Miyashita, K., Kokubo, Y. és mtsai: Genotypes of vitamin K epoxide reductase, gamma-glutamyl carboxylase, and cytochrome P450 2C9 as determinants of daily warfarin dose in Japanese patients. Thromb. Res., 2007, 120, [20] Nozawa, T., Asanoi, H., Inoue, H.: Instability of anticoagulation intensity contributes to occurrence of ischemic stroke in patients with non-rheumatic atrial fibrillation. Jpn. Circ. J., 2001, 65, [21] Hung, A., Singh, S., Tait, R. C.: A prospective randomized study to determine the optimal dose of intravenous vitamin K in reversal of over-warfarinization. Br. J. Haematol., 2000, 109, [22] Benusiglio, P. R., Desmeules, J., de Moerloose, P. és mtsai: Oral anticoagulation and pharmacogenetics: importance in the clinical setting. Rev. Med. Suisse, 2007, 3, 2030, , [23] Schalekamp, T., Brasse, B. P., Roijers, J. F. és mtsai: VKORC1 and CYP2C9 genotypes and phenprocoumon anticoagulation status: interaction between both genotypes affects dose requirement. Clin. Pharmacol. Ther., 2007, 81, [24] Montes, R., Ruiz, D. G., Martinez-Gonzalez, M. A. és mtsai: The c.-1639g > A polymorphism of the VKORC1 gene is a major determinant of the response to acenocoumarol in anticoagulated patients. Br. J. Haematol., 2006, 133, (Melegh Béla dr., Pécs, Szigeti u. 12., évfolyam, 39. szám 1844




Új orális véralvadásgátlók

Új orális véralvadásgátlók Új orális véralvadásgátlók XI. Magyar Sürgősségi Orvostani Kongresszus Lovas András, Szegedi Tudományegyetem, Aneszteziológiai és Intenzív Terápiás Intézet Véralvadásgátlók alkalmazási területei posztoperatív






SZEMÉLYRE SZABOTT ORVOSLÁS II. Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 SZEMÉLYRE SZABOTT


Orális antikoaguláns kezelés biztonságos monitorozása kórházi környezetben, elsıdleges betegellátásban és beteg önellenırzés során

Orális antikoaguláns kezelés biztonságos monitorozása kórházi környezetben, elsıdleges betegellátásban és beteg önellenırzés során Orális antikoaguláns kezelés biztonságos monitorozása kórházi környezetben, elsıdleges betegellátásban és beteg önellenırzés során Ajzner Éva Szabolcs-Szatmár-Bereg megyei Jósa András Oktató Kórház, Központi


Doktori (PhD) értekezés tézisek A CITOKRÓM P450 ENZIMRENDSZER FARMAKOGENETIKAILAG MAGYAR ÉS ROMA POPULÁCIÓBAN. Szalai Renáta. Pécsi Tudományegyetem,



HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember


Humán genom variációk single nucleotide polymorphism (SNP)

Humán genom variációk single nucleotide polymorphism (SNP) Humán genom variációk single nucleotide polymorphism (SNP) A genom ~ 97 %-a két különböző egyedben teljesen azonos ~ 1% különbség: SNP miatt ~2% különbség: kópiaszámbeli eltérés, deléciók miatt 11-12 millió


Orális antikoaguláció és vérzéses szövődményei. Dr. Fogas János, Kaposvár

Orális antikoaguláció és vérzéses szövődményei. Dr. Fogas János, Kaposvár Orális antikoaguláció és vérzéses szövődményei Dr. Fogas János, Kaposvár Az új orális antikoagulánsok (NOAC) 1. Direkt thrombin antagonisták dabigatran 2. Direkt Xa antagonisták rivaroxaban apixaban Xa





Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45


Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást


A Fraxiparine optimális kiszerelési skálájának köszönhetôen a legjobb hatékonyság/biztonság arányt nyújtja.

A Fraxiparine optimális kiszerelési skálájának köszönhetôen a legjobb hatékonyság/biztonság arányt nyújtja. A Fraxiparine optimális kiszerelési skálájának köszönhetôen a legjobb hatékonyság/biztonság arányt nyújtja. Kiszerelés Dózis Térítési díj 90% kiemelt támogatás esetén (HUF) Fraxiparine 0,2 ml 1 900 NE


Lipid és glükóz metabolizmust befolyásoló polimorfizmusok vizsgálata elhízott gyermek populációs mintákban. Ph.D.

Lipid és glükóz metabolizmust befolyásoló polimorfizmusok vizsgálata elhízott gyermek populációs mintákban. Ph.D. Lipid és glükóz metabolizmust befolyásoló polimorfizmusok vizsgálata elhízott gyermek populációs mintákban Ph.D. értekezés tézisei Horvatovich Katalin Témavezető: Prof. Dr. Melegh Béla Pécsi Tudományegyetem


TOVÁBBKÉPZÉS. Az acenocumarol és a warfarin hatásossága és biztonságossága a mélyvénás trombózis kezelésében.

TOVÁBBKÉPZÉS. Az acenocumarol és a warfarin hatásossága és biztonságossága a mélyvénás trombózis kezelésében. 1 TOVÁBBKÉPZÉS Az acenocumarol és a warfarin hatásossága és biztonságossága a mélyvénás trombózis kezelésében. Írta: DR. BERNÁT SÁNDOR IVÁN, DR. RÓKUSZ LÁSZLÓ Rövidítések: A = acenocoumarol INR = International


Orális antikoaguláns terápia. Dr. Szökő Éva

Orális antikoaguláns terápia. Dr. Szökő Éva Orális antikoaguláns terápia Dr. Szökő Éva Az antikoagulánsok terápiás indikációi mélyvénás thrombosis és thromboembolia prevenció és kezelés másodlagos szívinfarktus prevenció, a thromboemboliás szövődmények


DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer


A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,


Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon


A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)


A 8.1-es ősi haplotípus és a PAI-1 4G/5G polimorfizmus vizsgálata pneumónia eredetű szepszises betegek körében

A 8.1-es ősi haplotípus és a PAI-1 4G/5G polimorfizmus vizsgálata pneumónia eredetű szepszises betegek körében A 8.1-es ősi haplotípus és a PAI-1 4G/5G polimorfizmus vizsgálata pneumónia eredetű szepszises betegek körében Doktori tézisek Aladzsity István Semmelweis Egyetem Molekuláris Orvostudományi Doktori Iskola


Alvadológiai kezelések. perioperatív irányítása. Dr Rudas László, Szeged, 2013 szeptember 20

Alvadológiai kezelések. perioperatív irányítása. Dr Rudas László, Szeged, 2013 szeptember 20 Alvadológiai kezelések perioperatív irányítása Dr Rudas László, Szeged, 2013 szeptember 20 Vérlemezke Aggregáció Gátlók (TAG) Pucér fém-stent (BMS) Jó tulajdonság: -kivédi az ér visszakonyulását (recoil)


Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai


A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán

A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán Doktori értekezés tézisei Dr. Mayer László Semmelweis Egyetem Mentális Egészségtudományok


A Hardy-Weinberg egyensúly. 2. gyakorlat

A Hardy-Weinberg egyensúly. 2. gyakorlat A Hardy-Weinberg egyensúly 2. gyakorlat A Hardy-Weinberg egyensúly feltételei: nincs szelekció nincs migráció nagy populációméret (nincs sodródás) nincs mutáció pánmixis van allélgyakoriság azonos hímekben





Katasztrófális antifoszfolipid szindróma

Katasztrófális antifoszfolipid szindróma Katasztrófális antifoszfolipid szindróma Gadó Klára Semmelweis Egyetem, I.sz. Belgyógyászati Klinika Antifoszfolipid szindróma Artériás és vénás thrombosis Habituális vetélés apl antitest jelenléte Mi



ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT


Genetikai diagnosztika helye a kardiológiában

Genetikai diagnosztika helye a kardiológiában Genetikai diagnosztika helye a kardiológiában Szelid Zsolt Gén alapú stratégiák a kardiológiában Diagnosztika Monogénesen öröklődő CV betegségek Genetikai rizikófaktorok (pl. SNP) Terápia Gén alapú terápia


CYP2C19 polimorfizmusok szerepe a clopidogrel rezisztencia vizsgálatában iszkémiás stroke-on átesett betegekben

CYP2C19 polimorfizmusok szerepe a clopidogrel rezisztencia vizsgálatában iszkémiás stroke-on átesett betegekben CYP2C19 polimorfizmusok szerepe a clopidogrel rezisztencia vizsgálatában iszkémiás stroke-on átesett betegekben Bádogos Ágnes DE-ÁOK V. évfolyam Témavezető: Dr. Bagoly Zsuzsa Debreceni Egyetem, Általános


Dr. Bencze Ágnes Semmelweis Egyetem II.sz. Belgyógyászati Klinika 2015.Március 16

Dr. Bencze Ágnes Semmelweis Egyetem II.sz. Belgyógyászati Klinika 2015.Március 16 Belgyógyászati Tantermi előadás F.O.K. III. évfolyam, II. félév Dr. Bencze Ágnes Semmelweis Egyetem II.sz. Belgyógyászati Klinika 2015.Március 16 1 THROMBOSISOK. ANTI-THROMBOTIKUS KEZELÉS ÉS ENNEK FOGÁSZATI


A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus


Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben

Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben Dr. Hermann Csaba Doktori (Ph.D.) Értekezés Tézisfüzet Témavezetı: Prof. Dr. Madácsy László egyetemi tanár Programvezetı: Prof. Dr. Tulassay


Szakmai önéletrajz febr.16.

Szakmai önéletrajz febr.16. Szakmai önéletrajz Név: Dr. Milley György Máté Foglalkozás: általános orvos (79874) Beosztás: Ph.D. hallgató Jelenlegi munkahely: Semmelweis Egyetem (SE) Genomikai Medicina és Ritka Betegségek Intézete,


A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85


AKTUÁLIS. Tartós alvadásgátlás tromboembólia után: Miért? Meddig? Mivel?

AKTUÁLIS. Tartós alvadásgátlás tromboembólia után: Miért? Meddig? Mivel? 1 AKTUÁLIS Tartós alvadásgátlás tromboembólia után: Miért? Meddig? Mivel? Írta: DR. SAS GÉZA "Ha ismerjük a kezdeti állapotot, a jövő egyértelműen meghatározható - mondatban nem a következtetés hamis,


Antikoagulánsok a toxikológus szemszögéből. Zacher Gábor

Antikoagulánsok a toxikológus szemszögéből. Zacher Gábor Antikoagulánsok a toxikológus szemszögéből Zacher Gábor A mázli faktor Az ellátott mérgezett betegek kb. 5%-nál szerepel olyan ágens, mely a véralvadási kaszkádra hatással lehet Szerencsére azonban az


Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók


A prokalcitonin prognosztikai értéke

A prokalcitonin prognosztikai értéke A prokalcitonin prognosztikai értéke az első 24 órában Dr. Tánczos Krisztián SZTE Aneszteziológiai és Intenzív Terápiás Intézet Carlet et al. Antimicrobial Resistance and Infection Control 2012, 1:11 Carlet


Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata

Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata Doktori tézisek Dr. Kovács-Nagy Réka Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola Témavezető: Dr. Rónai Zsolt egyetemi adjunktus,





Biológiai variabilitás szerepe

Biológiai variabilitás szerepe Biológiai variabilitás szerepe a laboratóriumi munka során dr. Bekő Gabriella Semmelweis Egyetem, Laboratóriumi Medicina Intézet Központi Laboratórium Budapest, 2011. május 31. Bio-Rad Szimpózium Biológiai


Jendrassik Ernő: a belgyógyászat tankönyve 1914

Jendrassik Ernő: a belgyógyászat tankönyve 1914 u A p. irreg.perp. megjelenése tehát nagyon különböző, a legsúlyosabb delirium cordistól a majdnem rytmusos, rendes szaporaságú pulzusig minden átmenet előfordul. Jendrassik Ernő: a belgyógyászat tankönyve


A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban

A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban Összefoglaló közlemény 21 A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban Bálint Bálint L. 1, Nagy László 1,2 1 Debreceni Egyetem Orvos- és Egészségtudományi Centrum, Biokémiai és


Dr. Ottó Szabolcs Országos Onkológiai Intézet

Dr. Ottó Szabolcs Országos Onkológiai Intézet Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001. Részjelentés: 200. November 0.-2004.



HALLGATÓI KÉRDŐÍV ÉS TESZT ÉRTÉKELÉSE HALLGATÓI KÉRDŐÍV ÉS TESZT ÉRTÉKELÉSE EVALUATION OF STUDENT QUESTIONNAIRE AND TEST Daragó László, Dinyáné Szabó Marianna, Sára Zoltán, Jávor András Semmelweis Egyetem, Egészségügyi Informatikai Fejlesztő


OncotypeDX és más genetikai tesztek emlőrákban és azon túl. Dr. Nagy Zoltán Med Gen-Sol Kft.

OncotypeDX és más genetikai tesztek emlőrákban és azon túl. Dr. Nagy Zoltán Med Gen-Sol Kft. OncotypeDX és más genetikai tesztek emlőrákban és azon túl Dr. Nagy Zoltán Med Gen-Sol Kft. 2 A betegek leggyakoribb kérdései! Kiújul a betegségem?! Kell kemoterápiát kapnom?! A beteg és környezete életét,





A véralvadás zavarai I

A véralvadás zavarai I A véralvadás zavarai I Rácz Olivér Miskolci Egyetem Egészségügyi kar 27.9.2009 koagmisks1.ppt Oliver Rácz 1 A haemostasis (véralvadás) rendszere Biztosítja a vérrög (véralvadék, trombus) helyi keletkezését


Ez az alkalmazási előírás és a betegtájékoztató az előterjesztési eljárás eredménye alapján jött létre.

Ez az alkalmazási előírás és a betegtájékoztató az előterjesztési eljárás eredménye alapján jött létre. II. melléklet Az alkalmazási előírás és a betegtájékoztató módosítása az Európai Gyógyszerügynökség előterjesztésére Ez az alkalmazási előírás és a betegtájékoztató az előterjesztési eljárás eredménye





Stroke kezelésének alapelvei. Prof. Dr. Komoly Sámuel MTA doktora PTE Neurológiai Klinika igazgatója

Stroke kezelésének alapelvei. Prof. Dr. Komoly Sámuel MTA doktora PTE Neurológiai Klinika igazgatója Stroke kezelésének alapelvei Prof. Dr. Komoly Sámuel MTA doktora PTE Neurológiai Klinika igazgatója Hogyan kezelhetı a stroke? Primer prevenció a stroke rizikójának csökkentése STROKE Akut kezelés Szekunder


II. Glukokortikoid receptor gén polimorfizmusok fiziologiás és pathofiziologiás szerepének vizsgálata

II. Glukokortikoid receptor gén polimorfizmusok fiziologiás és pathofiziologiás szerepének vizsgálata 1 A kutatások célpontját a glükokortikoid hatás pre-receptor szabályozásában kulcsszerepet játszó 11β-hidoxiszteroid dehidrogenáz (11β-HSD) enzimet kódoló, illetve a glükokortikoidok hatását közvetítő


Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem Tisztelt Hölgyem, Tisztelt Uram! Örömmel jelentjük be Önöknek, hogy a Genomikai Medicina és Ritka Betegségek Intézetének egyik új projektje azon betegségek genetikai hátterének feltérképezésére irányul,








Hajlamosító gének vizsgálata magyar morbus Crohnos és colitis ulcerosás betegpopulációban. PhD értekezés tézisei. Magyari Lili

Hajlamosító gének vizsgálata magyar morbus Crohnos és colitis ulcerosás betegpopulációban. PhD értekezés tézisei. Magyari Lili Hajlamosító gének vizsgálata magyar morbus Crohnos és colitis ulcerosás betegpopulációban PhD értekezés tézisei Magyari Lili PTE ÁOK Orvosi Genetikai és Gyermekfejlıdéstani Intézet Témavezetı: Dr. Melegh


Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 468 EGYEDAZONOSÍTÁS ÉS SZÁRMAZÁSELLENİRZÉS HIPERPOLIMORF MIKROSZATELLITA








Sarkadi Margit1, Mezősi Emese2, Bajnok László2, Schmidt Erzsébet1, Szabó Zsuzsanna1, Szekeres Sarolta1, Dérczy Katalin3, Molnár Krisztián3,

Sarkadi Margit1, Mezősi Emese2, Bajnok László2, Schmidt Erzsébet1, Szabó Zsuzsanna1, Szekeres Sarolta1, Dérczy Katalin3, Molnár Krisztián3, Sarkadi Margit1, Mezősi Emese2, Bajnok László2, Schmidt Erzsébet1, Szabó Zsuzsanna1, Szekeres Sarolta1, Dérczy Katalin3, Molnár Krisztián3, Rostás Tamás3, Ritter Zsombor4, Zámbó Katalin1 Pécsi Tudományegyetem


Asthma bronchiale és krónikus obstruktív tüdőbetegség együttes megjelenése

Asthma bronchiale és krónikus obstruktív tüdőbetegség együttes megjelenése CSALÁDORVOSI GYAKORLAT Asthma bronchiale és krónikus obstruktív tüdőbetegség együttes megjelenése Müller Veronika dr. Gálffy Gabriella dr. Tamási Lilla dr. Semmelweis Egyetem, Általános Orvostudományi


Vérzéses állapotok a hematológiában Új anticoagulánsok-kontrolljuk és antidotumaik

Vérzéses állapotok a hematológiában Új anticoagulánsok-kontrolljuk és antidotumaik Vérzéses állapotok a hematológiában Új anticoagulánsok-kontrolljuk és antidotumaik Prof Dr Egyed Miklós Somogy Megyei Kaposi Mór Oktató Kórház Hematológiai Osztály VTE prevenció: anticoaguláció, ATE prevenció:


Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS


Mélyvénás trombózis és tüdőembólia

Mélyvénás trombózis és tüdőembólia Mélyvénás trombózis és tüdőembólia dr. Sirák András családorvos Velence Semmelweis Egyetem Családorvosi Tanszék Tanszékvezető: dr. Kalabay László egyetemi tanár Sirák MVT és PE 1 MVT gyakori betegség Legtöbbször


Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis

Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis Factor Analysis Factor analysis is a multiple statistical method, which analyzes the correlation relation between data, and it is for data reduction, dimension reduction and to explore the structure. Aim


Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013 Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz


Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során

Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során Ungvári Erika, Tóth Ákos Magyar Infektológiai és Klinikai Mikrobiológiai





Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott


A "Risk-based" monitoring háttere és elméleti alapja

A Risk-based monitoring háttere és elméleti alapja MAGYAR KLINIKAI FARMAKOLOGUSOK, XV. TOVABBKÉPZŐ NAPOK Debrecen, 2013. december 12 14.. Dr. Szakolczai-Sándor Norbert A "Risk-based" monitoring háttere és elméleti alapja 2011 INC Research, LLC 1 Agenda


Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL



Cukorbetegek hypertoniájának korszerű kezelése. Dr. Balogh Sándor OALI Főigazgató főorvos Budapest

Cukorbetegek hypertoniájának korszerű kezelése. Dr. Balogh Sándor OALI Főigazgató főorvos Budapest Cukorbetegek hypertoniájának korszerű kezelése Dr. Balogh Sándor OALI Főigazgató főorvos Budapest Hypertonia diabetesben 1-es típusú diabetes 2-es típusú diabetes Nephropathia diabetica albuminuria (intermittáló


NOAC-kezelés pitvarfibrillációban. Thrombolysis, thrombectomia és kombinációja. Az ischaemiás kórképek szekunder prevenciója. A TIA új, szöveti alapú

NOAC-kezelés pitvarfibrillációban. Thrombolysis, thrombectomia és kombinációja. Az ischaemiás kórképek szekunder prevenciója. A TIA új, szöveti alapú NOAC-kezelés pitvarfibrillációban. Thrombolysis, thrombectomia és kombinációja. Az ischaemiás kórképek szekunder prevenciója. A TIA új, szöveti alapú meghatározása. (Megj.: a felsorolt esetekben meghatározó


BELGYÓGYÁSZAT. Factor V.Leiden genotípus súlyos, poplitealis restenosissal járó atherosclerosisban

BELGYÓGYÁSZAT. Factor V.Leiden genotípus súlyos, poplitealis restenosissal járó atherosclerosisban BELGYÓGYÁSZAT Factor V.Leiden genotípus súlyos, poplitealis restenosissal járó atherosclerosisban Írta: DR. VALLUS GÁBOR, DR. DLUSTUS BÉLA, DR. NAGY BÁLINT, DR. PAPP ZOLTÁN, DR. ROMICS LÁSZLÓ, DR. KARÁDI





Szívkatéterek hajlékonysága, meghajlítása

Szívkatéterek hajlékonysága, meghajlítása Szívkatéterek hajlékonysága, meghajlítása Összefoglalás A szívkatéter egy olyan intravaszkuláris katéter, amelyet a szívbe vezetnek, ültetnek be diagnosztikus vagy terápiás célból. A katéterek felvezetés/eltávolítás


Antibiotikus kezelési stratégia a Sürgősségi Egységben. Vass Péter, Berényi Tamás Fővárosi Önkormányzat Szent Imre Kórház Budapest SBC-SBE

Antibiotikus kezelési stratégia a Sürgősségi Egységben. Vass Péter, Berényi Tamás Fővárosi Önkormányzat Szent Imre Kórház Budapest SBC-SBE Antibiotikus kezelési stratégia a Sürgősségi Egységben Vass Péter, Berényi Tamás Fővárosi Önkormányzat Szent Imre Kórház Budapest SBC-SBE Antibiotikus kezelés indikációi a Sürgősségi Egységben Súlyos szepszis





Hivatalos bírálat Dr. Antus Balázs: A légúti gyulladás és az oxidatív stressz vizsgálata tüdőbetegségekben című MTA doktori értekezéséről

Hivatalos bírálat Dr. Antus Balázs: A légúti gyulladás és az oxidatív stressz vizsgálata tüdőbetegségekben című MTA doktori értekezéséről Hivatalos bírálat Dr. Antus Balázs: A légúti gyulladás és az oxidatív stressz vizsgálata tüdőbetegségekben című MTA doktori értekezéséről Jelölt a fenti címen MTA doktori értekezést nyújtott be a Magyar


Várandós nők Streptococcus agalactiaeszűrése

Várandós nők Streptococcus agalactiaeszűrése Várandós nők Streptococcus agalactiaeszűrése MALDI-TOF MS módszerrel Pappné Ábrók Marianna, Arcson Ágnes, Urbán Edit, Deák Judit Szegedi Tudományegyetem, Általános Orvostudományi Kar Klinikai Mikrobiológiai


bizonyos variánsai hajlamosítottságot kölcsönöznek ankylosis spondilitis kialakulásának irányába (5), a közleményre relatíve nagyobb citátumot

bizonyos variánsai hajlamosítottságot kölcsönöznek ankylosis spondilitis kialakulásának irányába (5), a közleményre relatíve nagyobb citátumot 1 73430 azonosító számú ''Az 5q31 kromoszóma régió funkcionális variánsai: kapcsolat poligénes betegségek és a karnitin rendszer között" című OTKA pályázat szakmai zárójelentése Valójában nem tudományos


IV. melléklet. Tudományos következtetések

IV. melléklet. Tudományos következtetések IV. melléklet Tudományos következtetések 61 Tudományos következtetések Háttér-információ A ponatinib egy tirozin-kináz inhibitor (TKI), amelyet a natív BCR-ABL, valamint minden mutáns variáns kináz beleértve


Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár


II./3.3.2 fejezet:. A daganatok célzott kezelése

II./3.3.2 fejezet:. A daganatok célzott kezelése II./3.3.2 fejezet:. A daganatok célzott kezelése Kopper László A fejezet célja, hogy megismerje a hallgató a célzott terápiák lehetőségeit és a fejlesztés lényeges lépéseit. A fejezet teljesítését követően



KOAGULÁCIÓS FAKTOROK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 KOAGULÁCIÓS FAKTOROK


Nem-MHC gének jelentősége az immun-mediált reumatológiai betegségekben. Dr. Pazár Borbála

Nem-MHC gének jelentősége az immun-mediált reumatológiai betegségekben. Dr. Pazár Borbála Nem-MHC gének jelentősége az immun-mediált reumatológiai betegségekben Doktori tézisek Dr. Pazár Borbála Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Témavezető: Dr. Poór Gyula egyetemi tanár


A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere

A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere Nagy Szabolcs 1 Benedek Zsuzsanna 2 Polgár J. Péter 3 Magnus Andersson 4 A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere Genetic background of scrotal and inguinal hernia in swine nagy.szabolcs@georgikon.hu


Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon

Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Karancsi Lajos Gábor Debreceni Egyetem Agrár és Gazdálkodástudományok Centruma Mezőgazdaság-, Élelmiszertudományi és Környezetgazdálkodási


GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:


A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend)

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) Országos Egészségbiztosítási Pénztár Elemzési, Orvosszakértői és Szakmai Ellenőrzési Főosztály Budapest, 2013. június 26.


A cukorbetegség közvetlen egészségügyi költségei Magyarországon

A cukorbetegség közvetlen egészségügyi költségei Magyarországon LAM-TUDOMÁNY EREDETI KÖZLEMÉNY A cukorbetegség közvetlen egészségügyi költségei Magyarországon VOKÓ Zoltán, NAGYJÁNOSI László, KALÓ Zoltán BEVEZETÉS A cukorbetegség jelentôs betegségterhet jelent világszerte


A humán papillomavírusok prognosztikai szerepe a méhnyak rákmegel z elváltozásaiban

A humán papillomavírusok prognosztikai szerepe a méhnyak rákmegel z elváltozásaiban Egyetemi doktori (Ph. D.) értekezés tézisei A humán papillomavírusok prognosztikai szerepe a méhnyak rákmegel z elváltozásaiban Sz ke Krisztina Témavezet : Dr. Kónya József Debreceni Egyetem Orvos- és


III. Melléklet az alkalmazási előírás és a betegtájékoztató azonos módosításai

III. Melléklet az alkalmazási előírás és a betegtájékoztató azonos módosításai III. Melléklet az alkalmazási előírás és a betegtájékoztató azonos módosításai Megjegyzés: Ezek az alkalmazási előírásnak és a betegtájékoztatónak a bizottsági határozat idején érvényes módosításai. A


Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes.

Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes. Múlt órán: Lehetséges tesztfeladatok: Kitől származik a variáció-szelekció paradigma, mely szerint az egyéni, javarészt öröklött különbségek között a társadalmi harc válogat? Fromm-Reichmann Mill Gallton


Mélyvénás trombózis és tüdőembólia. Kockázati tényezők, trombofíliák, trombózismegelőzés

Mélyvénás trombózis és tüdőembólia. Kockázati tényezők, trombofíliák, trombózismegelőzés Mélyvénás trombózis és tüdőembólia. Kockázati tényezők, trombofíliák, trombózismegelőzés Véralvadás 30 s 3-7 perc 5-10 perc 48-72 óra Érszűkület Vérlemezkeaktiváció Véralvadék kialakulása Alvadékbontás





Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI

Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance


A homeopátia - hozzáadott érték az egészségügyi ellátásban

A homeopátia - hozzáadott érték az egészségügyi ellátásban A homeopátia - hozzáadott érték az egészségügyi ellátásban Dr.Sal Péter házi gyermekorvos, homeopata Komplementer Medicina szakmai kollégiumi testület tagja Az EU egészségüggyel foglalkozó szakmai intézményeiben


A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi
