K-vitamin-epoxidreduktáz gén haplocsoport-meghatározása: egy újabb elem az antikoaguláns terápia optimalizálásában

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "K-vitamin-epoxidreduktáz gén haplocsoport-meghatározása: egy újabb elem az antikoaguláns terápia optimalizálásában"

Átírás

1 EREDETI KÖZLEMÉNYEK K-vitamin-epoxidreduktáz gén haplocsoport-meghatározása: egy újabb elem az antikoaguláns terápia optimalizálásában SIPEKY CSILLA MELEGH BÉLA DR. Pécsi Tudományegyetem, Általános Orvostudományi Kar, Orvosi Genetikai és Gyermekfejlődéstani Intézet, Pécs A warfarin és az acenokumarolok a leggyakrabban alkalmazott antikoagulánsok, amelyek szűk terápiás tartománnyal rendelkeznek, a hatásos dózis pedig populáción belül és egyénenként is nagy változatosságot mutat. A kumarinok a K-vitamin-epoxidreduktáz enzim (VKOR) gátlásán keresztül akadályozzák meg a koagulációt. Az enzimet kódoló VKORC1 gén mutációi jelentősen befolyásolják a kumarinok iránti érzékenységet. A VKORC1 gén genetikai variabilitását a *2, *3 és a *4 haplotípusok fedik le a kaukázusi populációban. Antikoaguláns kezelésben részesülő betegek bemutatásán keresztül összefoglaló tanulmányban ismertetjük a VKORC1 gén haplotípusának variabilitását. Munkánkban 28, klinikailag nem szokványos antikoaguláns választ produkáló beteget karakterizáltunk a VKORC1 G-1639A, G9041A és C6009T polimorfizmusokra. Molekuláris módszerként PCR-RFLP technikát és direkt szekvenálást alkalmaztunk. Betegpopulációnkban sikerült kimutatni VKORC1 *1*2, *2*2, *2*3, *1*4, *2*4 és *3*4 haplotípusokat. Vizsgált betegeink körében előfordult a VKORC1 gén haplotípusa alapján közepes dózisigényű (4,9±0,2 mg/nap) A/B haplocsoportú (a vizsgált betegek 61%-a) és magas dózisigényű (6,2±0,3 mg/nap) B haplocsoportú (25%) beteg is. Az antikoaguláns terápia vérzéses szövődményeinek megelőzésében fontos az alacsony warfarindózisú (2,7±0,2 mg/nap) A haplocsoportba tartozó betegek (esetünkben 14%) diagnosztizálása. Eredményeink mutatják, hogy a haplocsoport-vizsgálat se gíti a megfelelő szintű véralvadásgátláshoz szükséges gyógyszerdózis meghatározását és a végzetes vérzési epizódok elkerülését. Kulcsszavak: antikoaguláns terápia, VKORC1 haplotípus, warfarinrezisztencia Haplogroup analysis of vitamin-k epoxide reductase (VKORC1) gene: novel element in the optimization of anticoagulant therapy. Warfarin and acenocoumarols are the most commonly prescribed anticoagulants that is difficult to use because of the wide intra- and interpatient variation in the dose requirements, the narrow therapeutic range and the risk of serious bleeding. Vitamin K epoxide reductase (VKORC1) is the site of inhibition by coumarins. Mutations in the VKORC1 gene affect the sensitivity of the epoxy reductase enzyme for warfarin. The three main haplotypes of VKORC1 gene, *2, *3, *4, explain most of the genetic variability in warfarin dose among Caucasians. In the current paper we focus on this subject in view of our experience gained during molecular genetic tests for the main VKORC1 haplotypes in Hungarian patients with anticoagulant therapy and unusual clinical response. A total of 28 selected cases were characterized for VKORC1 G-1639A, G9041A and C6009T alleles. Genotyping has been carried out by molecular biology techniques, including PCR-RFLP assay and direct sequencing. In patients undergoing anticoagulant therapy we could identify VKORC1 *1*2, *2*2, *2*3, *1*4, *2*4 and *3*4 haplotypes. Patients with A haplotype group (14% of the studied patients) require much lower warfarin doses than other patients (2.7±0.2 mg/day). In our patients we found some with B haplotype group (25%) who require high warfarin dose (6.2±0.3 mg/day). There were also subjects bearing the A/B haplotype group (61%) with intermediate warfarin dose (4.9±0.2 mg/day), estimated by the haplotype analyses of the VKORC1 gene. Results presented here underline the need of VKORC1 haplotyping in anticoagulated patients with unusual clinical anticoagulant response, and the examination can have further therapeutic consequences. Keywords: anticoagulant therapy, VKORC1 haplotype, warfarin resistance (Beérkezett: június 19.; elfogadva: augusztus 4.) Az antikoaguláns terápia alkalmazásával számos betegség esetén megelőzhető a thromboembolia kialakulása [1]. Véralvadásgátlók alkalmazása indokolt akut mélyvénás trombózis, tüdőembólia, pitvarfibrilláció, balszívfél-elégtelenség és szívbillentyű-beültetés esetén [2, 3]. A tartós orális antikoaguláns kezelés bázisgyógyszerei a K-vitaminantagonisták csoportjába tartozó kumarinve gyületek. A warfarin lassabban eliminálódik a keringésből az acenokumarolhoz képest, ezért stabilabb a kívánt mértékű alvadásgátlás [4]. DOI: /OH évfolyam, 39. szám

2 A B C D 1. ábra A VKORC1 gén promoter régiójában talált G-1639A normális allél (A), a 3 régiójában talált G9041A heterozigóta (B) és homozigóta mutáns eltérés (C), valamint a C6009T mutáció (D) az első intronban. Az egyes eltérések helyét nyilak jelzik A warfarin dózisát számos tényező befolyásolja, például a beteg neme, életkora, táplálkozása, felszívódási viszonyok, kísérő betegségek és azok gyógyszerei, és nem utolsósorban a genetikai tényezők. A warfarin szűk terápiás tartománnyal rendelkezik, és a gyógyszerválasz magas fokú interindividuális variabilitással bír [5, 6]. Az alacsony dózisigényű betegeknél túl magas dózis alkalmazása esetén végzetes vérzések léphetnek fel testszerte, bőrnekrózis alakulhat ki, ellenkező esetben azonban elmarad a várt gyógyszerhatás [6]. A warfarin, valamint más kumarintípusú gyógyszerek a májban lévő K-vitamin-epoxidreduktáz enzim (VKOR) gátlásán keresztül akadályozzák meg a koagulációt [7, 8]. Normális esetben a K-vitamin epoxiddá alakul a májban, majd az epoxidreduktáz enzim redukálja. A redukált K-vitamin-epoxid szükséges több véralvadási faktor szintéziséhez, úgymint a trombin, VII., IX., X. faktorok, protein C és S [9]. A VKORC1 gén a VKOR-komplex legnagyobb alegysége. Genetikai variabilitásának 99%-át 3 fő haplotípus fedi le az európai populációban: *2, *3 és *4 variánstípusok (*1 a vad típus) [10]. Az egyes haplotípusok segítségével alacsony (A) és magas (B) dózisú haplocsoportokat különíthetünk el [11]. A G-1639A, G9041A, C6009T SNP-k alkalmasak és elegendőek, hogy elkülönítsük a 4 legfontosabb haplotípust és a 2 haplocsoportot. A G-1639A polimorfizmus a gén promoter régiójában található, M2 markernek nevezik, és a *2 haplotípust determinálja. M23 markerként a gén 3 -régiójában található G9041A SNP ismert, amely a *3 haplotípust határozza meg. Az intron 1-ben található C6009T polimorfizmus (M16 marker) a *4 haplotípust határozza meg. A *2 haplotípus az alacsony dózisú A haplocsoportba tartozik, míg a *3 és a *4 haplo típusok a magas dózisú B haplocsoportot határozzák meg [10]. Vizsgálatunkban antikoaguláns kezelésben részesülő betegek VKORC1 génjének haplotípusát és haplocsoportját határoztuk meg, ezáltal segítve a kívánt antikoaguláns dózis beállítását és a végzetes vérzési események elkerülését. Betegek és módszerek Vizsgált betegpopuláció Vizsgálatunkhoz antikoaguláns kezelésben részesülő betegek EDTA-val alvadásgátolt vénás vérmintáit gyűjtöttük össze. A DNS-minták és a betegek adatainak gyűjtése és használata során a Helsinki Nyilatkozat (1975) irányelveit és szabályozását követtük. Klinikailag jól jellemzett betegpopulációnkat DNS-bankban helyeztük el. Vizsgálatunkban 28 beteg DNS-mintáját genotipizáltuk, amelyből 19 nő és 9 férfi volt. Átlagéletkoruk 51 év volt (SD±12 év). A gyógyszerszedés indikációja betegeink esetében trombózis, pulmonalis embolia, pitvarfibrilláció és hypertoniás krízis volt évfolyam, 39. szám 1840

3 Molekuláris módszerek A betegek mintáinak genotipizálásához polimeráz láncreakció révén felsokszoroztuk a K-vitamin-epoxidreduktáz gén számunkra szükséges szakaszát. A PCR-termék segítségével restrikciós fragmenthossz-polimorfizmus (RFLP) módszert alkalmazva meghatároztuk a VKORC1 gén G-1639A, G9041A, C6009T polimorfizmusait. Primer tervezéshez a GeneBank adatbázisban elhelyezett szekvenciákat használtuk: VKORC1 G-1639A esetén rs , VKORC1 G9041A esetén rs7294, VKORC1 C6009T esetén rs A primer tervezéséhez Primer3 nevű programot alkalmaztunk. A VKORC1 G-1639A polimorfizmust a következő forward primer 5 - ATCCCTCTGGGAAGTCAAGC -3 és reverse primer 5 - CACCTTCAACCTCTCCATCC -3 segítségével határoztuk meg. A VKORC1 G9041A primerek a következők voltak: 5 - TTTAGAGACCCT TCCCAGCA -3 és 5 - AGCTCCAGAGAAGGCAACAC -3. Míg a VKORC1 C6009T SNP esetén a sense primer az 5 -AGGCGTTAGCATAATGACGG -3 és az antisense a 5 -GGGTG GAACCAGGTTAGGAC -3 volt. A PCR-amplifikációt 50 μl végtérfogatban készítettük el, amely 200 μm-t tartalmazott mindegyik dntp-ből, 1 U Taq polimerázt, 5 μl reakciópuffert (10 mm Tris-HCl, ph 9,0, amely 500 mm KCl, 14 mm MgCl 2 ), 0,2 mm-t mindegyik primerből és 1 μg izolált DNS-t. A PCRamplifikációt MJ Research PTC 200 készülékben végeztük. A PCR-kondíciók a következők voltak: elődenaturáció 3 perc 96 ºC-on, amelyet 35 cikluson keresztül 30 s denaturáció követett ugyanezen a hőmérsékleten, majd 30 s annealing 60 ºC-on a G-1639A esetén és 59 ºC a G9041A esetén, valamint 65 ºC-on a C6009T SNP-nél, primer extenzió 30 s-on át 72 ºC-on, végső extenzió 72 ºC 5 percre. A létrejött PCR-terméket 2%- os agarózgélben elektroforetizáltuk, majd etidium-bromid és UV-fény segítségével vizualizáltuk. Az amplikonokat allélspecifikus restrikciós endonukleázokkal emésztettük: 10 μl PCR-terméket 1U restrikciós enzimmel. Az emésztett termékek elválasztására agaróz gélelektroforézist alkalmaztunk (3%). A VKORC1 G-1639A SNP esetén a PCR-terméket BcnI enzimmel, a VKORC1 G9041A esetén SsiI, míg a VKORC1 C6009T polimorfizmusnál FspBI restrikciós endonukleázzal emésztettük. A VKORC1 G-1639 allél esetén a 636 bp nagyságú PCR-terméket a BcnI enzim 50 bp, 114 bp és 472 bp nagyságú fragmentumokra vágta. Az A allél jelenlétében azonban 114 bp és 522 bp hosszúságú termékek keletkeztek. A VKORC1 G9041A polimorfizmus esetén 674 bp hosszú PCR-termék keletkezik, és a GG genotípus 117 bp, 216 bp és 341 bp termékeket eredményez, míg az AA allélok jelenlétében 117 bp és 557 bp termékek keletkeztek. A VKORC1 C6009T SNP PCR terméke 725 bp nagyságú, amelyből az RFLP assay során a normális allél jelenlétében 109 bp és 616 bp termékek, valamint a homozigóta mutáns genotípusnál 109 bp, 133 bp és 483 bp termékek keletkeztek. A módszer ellenőrzésére random kiválasztott betegek VKORC1 génjének bidirekcionális szekvenálását végeztük el ABI PRISM 3100 Avant típusú automata szekvenálókészüléken (1. ábra). Eredmények Alvadásgátló kezelésben részesülő betegeink vizsgálata során számos, a klinikai gyakorlat számára említésre méltó és fontos esetben diagnosztizáltuk genetikai mutáció meglétét. Két betegünknél a K-vitamin-epoxidreduktáz enzim G>A polimorfizmus esetén homozigóta mutáns genotípust, míg a 6009 C>T és a 9041 G>A polimorfizmusa esetén normális allélt találtunk (2.A ábra). A kapott adatok alapján ezek a betegek a VKORC1 *2*2 haplo típusba tartoznak, amely az alacsony warfarindózisú A haplocsoportot határozza meg. A VKORC1 gén haplotípusa alapján alacsonyabb dózis alkalmazása javasolt (2,7±0,2 mg/nap) [5]. Trombózison átesett 58 éves nőbetegnél a VKORC1 gén G>A SNP esetén normális allélt, 9041 G>A SNP esetén homozigóta mutáns genotípust találtunk (2.B ábra). Ebben az esetben a beteg VKORC1 *3*3 haplotípusba tartozik, amely a magas dózisú B haplocsoportot határozza meg. Másik öt betegnél a VKORC G>A polimorfizmusa esetén normális allélt, 9041 G>A és a 6009 C>T SNP esetén heterozigóta genotípust találtunk (2.C ábra). A kapott adatok alapján a betegek a VKORC1*3 és*4 haplotípusba tartoznak, amelyek a magas warfarindózisú B haplocsoportot határozzák meg. A kapott eredmény alapján a kumarinszármazékokat érintő gyógyszer-metabolizmusban eltérés várható, magasabb dózis alkalmazása javasolt (6,2±0,3 mg/nap) [5]. Számos tüdőembólián átesett betegünknél a VKORC G>A és a 9041 G>A polimorfizmusa esetén heterozigóta allélt, valamint a 6009 C>T SNP esetén normális genotípust találtunk (2.D ábra). Ezek alapján a beteg a VKORC1*2 és VKORC1*3 haplotípusba tartozik, amelyek a közepes warfarindózisú A/B haplocsoportot határozzák meg. A kumarinszármazékokból közepes dózis alkalmazása javasolt (4,9±0,2 mg/nap) [5]. Megbeszélés Az antikoaguláns kezelés során az a célunk, hogy a kumarinadag változtatásával olyan mértékű legyen az alvadásgátlás, amely már véd az intravasalis vérrög kialakulása ellen, de még nem okoz jelentős vérzékenységet. A honlapján a jelenleg ajánlott warfarindózis 2 10 mg per nap. A kezdő gyógyszeradag meghatározását egy algoritmus segíti, amely a www. warfarindosing.org címen található meg. A warfarin terápiás dózisát számos tényező befolyásolja, úgymint a VKORC1 polimorfizmusok, testfelületindex (BSA), kor, INR-érték, dohányzás, egyéb gyógyszerek használata, évfolyam, 39. szám

4 *50 bp-os standard létrát alkalmaztunk 2. ábra Vérzékenységre hajlamosító VKORC1 *2*2 haplotípusba tartozó betegek (A), a warfarinrezisztenciára hajlamosító VKORC1 *3*3 (B) és *3*4 (C) haplotípusba tartozó betegek, valamint a közepes warfarindózis-igényű VKORC1 *2*3 haplotípusú betegek (D)* trombózis előfordulása. Meg kell jegyezni, hogy a warfarint a CYP2C9 enzim metabolizálja, így a gén variánsai is jelentősen befolyásolják a terápia kimenetelét. Egyes becslések alapján a VKORC1 gén variabilitása a warfarin dózisváltozásának 15 30%-áért felelős, amely alapján a K-vitamin-epoxidreduktáz gén genotípus-meghatározása jelzi legnagyobb mértékben előre a warfarindózist [5, 6, 11, 12, 13]. A VKORC1 gén promoter régiójában található G>A polimorfizmus az alacsony warfarindózis meghatározója [14]. A G allél aktivitása 44%-kal nagyobb az A allélnál [14]. A -1639A allél homozigóta hordozóinak warfarinkezelését a legalacsonyabb dózissal ajánlott kezdeni, és a legmagasabb a káros mellékhatások rizikója [11]. A G-1639A SNP nem vad típusú variációinak fenotípusos prevalenciája 50% a kaukázusi populációt tekintve. A megnövekedett kumarinszenzitivitású páciensek 93%-a homozigóta a *2 haplotípusra, amelyet a G-1639A polimorfizmus határoz meg [10]. A G/A SNP esetén a mutáns allél számának növekedése egyenesen arányos a hatásos warfarindózis csökkentésével. Homozigóta mutáns (AA) esetén a standard dózisnak (amit GG esetén adnak) a fele ajánlott. Az etnikai csoportok között jelentős eltérés is tapasztalható a -1639G>A variánst tekintve. Az ázsiai populációkban ez a mutáció nagyon gyakori (allélfrekvencia 89 94%) és gyakorinak tekinthető a kaukázusi eredetű emberekben is (allélfrekvencia 37%) [5, 14]. A G-1639A SNP mutációi megakadályozzák a transzkripciós faktorok kötődését a VKORC1 gén promoter régiójában, amely alacsonyabb szintű mrns-transzkriptumot eredményez, és végül kevesebb érett funkcionális VKOR enzim jön létre. A VKOR enzim hiánya limitálja a K-vitamin-epoxid redukált K-vitaminná alakulását, ami elengedhetetlen a véralvadási faktorok működéséhez. A VKORC1 gén G-1639A SNP-re homozigóta mutáns évfolyam, 39. szám 1842

5 betegnél az említett okok miatt nem jön létre elég redukált K-vitamin. A VKORC1 gén 3 -régiójában található G9041A SNP esetében a homozigóta A alléllal rendelkező betegek megnövekedett warfarindózis-igényt mutatnak a G allélra heterozigóta vagy homozigóta betegekhez képest [15, 16]. Európai populációban a mutáns allélfrekvencia 35 39% között van [15, 17], míg a japán populációban ez mindössze 8 17% [18, 19]. A VKORC1 gén 1-es intronjában található C6009T polimorfizmus a *4 haplotípust determinálja, amely a magas dózis meghatározója. Európai populációban az allélfrekvencia 20% körüli [10]. Az általunk vizsgált populációban a G-1639A SNP-t tekintve 75%-ban találtunk mutációt, ebből 10% volt homozigóta mutáns. A mutációt hordozók aránya a G9041A polimorfizmus esetén 61% volt, ebből 12% volt homozigóta mutáns. A C6009T SNP esetén 43%-ban találtunk mutáns allélt, és a betegek 8%-ában volt homozigóta a mutáció. A fent említett mutációk által meghatározott A és B haplocsoport a warfarindózis-változás negyedéért felelős [11]. A warfarinrezisztencia-vizsgálatra küldött betegeink 25%-a a magas dózisú B haplocsoportba tartozik, ami a jó klinikai diagnosztizálást mutatja. Ezeknél a betegeknél, ha elegendően magas gyógyszerdózissal indítjuk a terápiát, elérhetjük a megfelelő szintű antikoagulálást már a terápia kezdetén, és elkerülhető a trombózis kialakulása. A 28 vizsgált beteg közül 4-ben találtunk az átlagos dózishoz képest alacsonyabb warfarinigényre utaló mutációt. Az ő esetükben a VKORC1 haplotípus meghatározásával elkerülhetők a vérzéses szövődmények. Mivel a kumarintípusú antikoagulánsokra igen szűk terápiás dózistartomány jellemző, az antikoaguláns dózis ideális beállítása után továbbra is elengedhetetlenül fontos az INR-érték (international normalized ratio) rendszeres monitorozása és a 2,0 3,0 közötti terápiás tartományban tartása. Az alvadásgátlást akkor tekintjük optimálisnak, ha az INR értéke 2,0 és 3,0 között van. Ha az INR kisebb 2,0-nél, akkor elégtelen az alvadásgátlás, ha viszont az INR 3,0 fölé emelkedik, megnő a vérzés veszélye. Vannak olyan betegségek (például régebbi, mechanikus billentyűk), amelyek esetén indokolt nagyobb véralvadásgátló dózis alkalmazása. Ilyen élesre állított betegeknél az INR 2,5 3,5 közötti értéke az elfogadott. Régebben lezajlott mélyvénás trombózis vagy fokozott vérzésveszély esetén elegendő, ha az INR 1,5 2,0 között van. Az INR-érték stabilitásának jelentőségét klinikai tanulmányok is bizonyítják. Ingadozó INR-érték mellett megnő a stroke veszélye a pitvarfibrillációban szenvedő betegeknél [20]. A vérzés veszélye 5 feletti INR-érték esetén exponenciálisan nő [21]. Az Egyesült Államok Élelmiszer- és Gyógyszerügyi Hivatala (FDA) 2007 augusztusában előírta, hogy a K-vitamin-antagonisták tájékoztatóján tüntessék fel: a CYP2C9 és a VKORC1 gén polimorfizmusai jelentősen befolyásolják az antikoagulánsok optimális dózisát. Ez biztosítja, hogy az orvosok a páciens genetikai profiljának meghatározásával a beteg számára legpontosabb dózist alkalmazzák. Mindezek alapján a módszer alkalmazása határozott lépésnek tekinthető az egyénre szabott gyógyszerterápia eléréséhez. Számos irodalmi adat támasztja alá, hogy a hazánkban alkalmazott acenokumarol esetében a CYP2C9 és a VKORC1 gének polimorfizmusai a dózisigényt hasonlóképpen befolyásolják, mint a warfarin esetében [22, 23, 24]. Köszönetnyilvánítás Köszönetemet fejezem ki Hartung Mártának a DNSelemzés technikai részében nyújtott segítségéért. Irodalom [1] Rettie, A. E., Tai, G.: The pharmacogenomics of warfarin: closing in on personalized medicine. Mol. Interv., 2006, 6, [2] Hirsh, J., Dalen, J. E., Anderson, D. R. és mtsai: Oral anticoagulants: mechanism of action, clinical effectiveness, and optimal therapeutic range. Chest, 1998, 114, 445S 469S. [3] Lip, G. Y., Kamath, S., Hart, R. G.: ABC of antithrombotic therapy: Antithrombotic therapy for cerebrovascular disorders. BMJ, 2002, 325, [4] Bodin, L., Verstuyft, C., Tregouet, D. A. és mtsai: Cytochrome P450 2C9 (CYP2C9) and vitamin K epoxide reductase (VKO- RC1) genotypes as determinants of acenocoumarol sensitivity. Blood, 2005, 106, [5] Obayashi, K., Nakamura, K., Kawana, J. és mtsai: VKORC1 gene variations are the major contributors of variation in warfarin dose in Japanese patients. Clin. Pharmacol. Ther., 2006, 80, [6] Yin, T., Miyata, T.: Warfarin dose and the pharmacogenomics of CYP2C9 and VKO. Thromb. Res., 2007, 120, [7] Rost, S., Fregin, A., Ivaskevicius, V. és mtsai: Mutations in VKO- RC1 cause warfarin resistance and multiple coagulation factor deficiency type 2. Nature, 2004, 427, [8] Li, T., Chang, C. Y., Jin, D. Y. és mtsai: Identification of the gene for vitamin K epoxide reductase. Nature, 2004, 427, [9] Nelsestuen, G. L., Zytkovicz, T. H., Howard, J. B.: The mode of action of vitamin K. Identification of gamma-carboxyglutamic acid as a component of prothrombin. J. Biol. Chem., 1974, 249, [10] Geisen, C., Watzka, M., Sittinger, K. és mtsai: VKORC1 haplotypes and their impact on the inter-individual and inter-ethnical variability of oral anticoagulation. Thromb. Haemost., 2005, 94, [11] Rieder, M. J., Reiner, A. P., Gage, B. F. és mtsai: Effect of VKO- RC1 haplotypes on transcriptional regulation and warfarin dose. N. Engl. J. Med., 2005, 352, [12] Wadelius, M., Chen, L. Y., Eriksson, N. és mtsai: Association of warfarin dose with genes involved in its action and metabolism. Hum. Genet., 2007, 121, [13] Veenstra, D. L., You, J. H., Rieder, M. J. és mtsai: Association of vitamin K epoxide reductase complex 1 (VKORC1) variants with warfarin dose in a Hong Kong Chinese patient population. Pharmacogenet. Genom., 2005, 15, [14] Yuan, H. Y., Chen, J. J., Lee, M. T. és mtsai: A novel functional VKORC1 promoter polymorphism is associated with inter-individual and inter-ethnic differences in warfarin sensitivity. Hum. Mol. Genet., 2005, 14, [15] D'Andrea, G., D'Ambrosio, R. L., Di Perna, P. és mtsai: A polymorphism in the VKORC1 gene is associated with an interindi évfolyam, 39. szám

6 vidual variability in the dose-anticoagulant effect of warfarin. Blood, 2005, 105, [16] Herman, D., Peternel, P., Stegnar, M. és mtsai: The influence of sequence variations in factor VII, gamma-glutamyl carboxylase and vitamin K epoxide reductase complex genes on warfarin dose requirement. Thromb. Haemost., 2006, 95, [17] Li, T., Lange, L. A., Li, X. és mtsai: Polymorphisms in the VKO- RC1 gene are strongly associated with warfarin dosage requirements in patients receiving anticoagulation. J. Med. Genet., 2006, 43, [18] Takahashi, H., Wilkinson, G. R., Nutescu, E. A. és mtsai: Different contributions of polymorphisms in VKORC1 and CYP2C9 to intra- and inter-population differences in maintenance dose of warfarin in Japanese, Caucasians and African-Americans. Pharmacogenet. Genom., 2006, 16, [19] Kimura, R., Miyashita, K., Kokubo, Y. és mtsai: Genotypes of vitamin K epoxide reductase, gamma-glutamyl carboxylase, and cytochrome P450 2C9 as determinants of daily warfarin dose in Japanese patients. Thromb. Res., 2007, 120, [20] Nozawa, T., Asanoi, H., Inoue, H.: Instability of anticoagulation intensity contributes to occurrence of ischemic stroke in patients with non-rheumatic atrial fibrillation. Jpn. Circ. J., 2001, 65, [21] Hung, A., Singh, S., Tait, R. C.: A prospective randomized study to determine the optimal dose of intravenous vitamin K in reversal of over-warfarinization. Br. J. Haematol., 2000, 109, [22] Benusiglio, P. R., Desmeules, J., de Moerloose, P. és mtsai: Oral anticoagulation and pharmacogenetics: importance in the clinical setting. Rev. Med. Suisse, 2007, 3, 2030, , [23] Schalekamp, T., Brasse, B. P., Roijers, J. F. és mtsai: VKORC1 and CYP2C9 genotypes and phenprocoumon anticoagulation status: interaction between both genotypes affects dose requirement. Clin. Pharmacol. Ther., 2007, 81, [24] Montes, R., Ruiz, D. G., Martinez-Gonzalez, M. A. és mtsai: The c.-1639g > A polymorphism of the VKORC1 gene is a major determinant of the response to acenocoumarol in anticoagulated patients. Br. J. Haematol., 2006, 133, (Melegh Béla dr., Pécs, Szigeti u. 12., évfolyam, 39. szám 1844

Új orális véralvadásgátlók

Új orális véralvadásgátlók Új orális véralvadásgátlók XI. Magyar Sürgősségi Orvostani Kongresszus Lovas András, Szegedi Tudományegyetem, Aneszteziológiai és Intenzív Terápiás Intézet Véralvadásgátlók alkalmazási területei posztoperatív

Részletesebben

FARMAKOGENETIKAILAG RELEVÁNS GÉNEK GENETIKAI VARIABILITÁSA ÉS INTERETNIKAI KÜLÖNBSÉGEI ÁTLAG MAGYAR ÉS ROMA POPULÁCIÓS MINTÁKBAN

FARMAKOGENETIKAILAG RELEVÁNS GÉNEK GENETIKAI VARIABILITÁSA ÉS INTERETNIKAI KÜLÖNBSÉGEI ÁTLAG MAGYAR ÉS ROMA POPULÁCIÓS MINTÁKBAN FARMAKOGENETIKAILAG RELEVÁNS GÉNEK GENETIKAI VARIABILITÁSA ÉS INTERETNIKAI KÜLÖNBSÉGEI ÁTLAG MAGYAR ÉS ROMA POPULÁCIÓS MINTÁKBAN PhD értekezés tézisei Sipeky Csilla, M.Sc. PTE ÁOK Orvosi Genetikai Intézet

Részletesebben

A Fraxiparine optimális kiszerelési skálájának köszönhetôen a legjobb hatékonyság/biztonság arányt nyújtja.

A Fraxiparine optimális kiszerelési skálájának köszönhetôen a legjobb hatékonyság/biztonság arányt nyújtja. A Fraxiparine optimális kiszerelési skálájának köszönhetôen a legjobb hatékonyság/biztonság arányt nyújtja. Kiszerelés Dózis Térítési díj 90% kiemelt támogatás esetén (HUF) Fraxiparine 0,2 ml 1 900 NE

Részletesebben

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

REFERENCIA MÉRÉSI RENDSZEREK A GENETIKAI DIAGNOSZTIKÁBAN: DNS-ALAPÚ REFERENCIA ANYAGOK FEJLESZTÉSE. PhD tézis rövid összefoglaló.

REFERENCIA MÉRÉSI RENDSZEREK A GENETIKAI DIAGNOSZTIKÁBAN: DNS-ALAPÚ REFERENCIA ANYAGOK FEJLESZTÉSE. PhD tézis rövid összefoglaló. REFERENCIA MÉRÉSI RENDSZEREK A GENETIKAI DIAGNOSZTIKÁBAN: DNS-ALAPÚ REFERENCIA ANYAGOK FEJLESZTÉSE PhD tézis rövid összefoglaló Márki-Zay János Reference Materials Unit, Institute for Reference Materials

Részletesebben

Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata

Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata Doktori tézisek Dr. Kovács-Nagy Réka Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola Témavezető: Dr. Rónai Zsolt egyetemi adjunktus,

Részletesebben

Dr. Bencze Ágnes Semmelweis Egyetem II.sz. Belgyógyászati Klinika 2015.Március 16

Dr. Bencze Ágnes Semmelweis Egyetem II.sz. Belgyógyászati Klinika 2015.Március 16 Belgyógyászati Tantermi előadás F.O.K. III. évfolyam, II. félév Dr. Bencze Ágnes Semmelweis Egyetem II.sz. Belgyógyászati Klinika 2015.Március 16 1 THROMBOSISOK. ANTI-THROMBOTIKUS KEZELÉS ÉS ENNEK FOGÁSZATI

Részletesebben

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók

Részletesebben

Antikoagulánsok a toxikológus szemszögéből. Zacher Gábor

Antikoagulánsok a toxikológus szemszögéből. Zacher Gábor Antikoagulánsok a toxikológus szemszögéből Zacher Gábor A mázli faktor Az ellátott mérgezett betegek kb. 5%-nál szerepel olyan ágens, mely a véralvadási kaszkádra hatással lehet Szerencsére azonban az

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

Jendrassik Ernő: a belgyógyászat tankönyve 1914

Jendrassik Ernő: a belgyógyászat tankönyve 1914 u A p. irreg.perp. megjelenése tehát nagyon különböző, a legsúlyosabb delirium cordistól a majdnem rytmusos, rendes szaporaságú pulzusig minden átmenet előfordul. Jendrassik Ernő: a belgyógyászat tankönyve

Részletesebben

A Hardy-Weinberg egyensúly. 2. gyakorlat

A Hardy-Weinberg egyensúly. 2. gyakorlat A Hardy-Weinberg egyensúly 2. gyakorlat A Hardy-Weinberg egyensúly feltételei: nincs szelekció nincs migráció nagy populációméret (nincs sodródás) nincs mutáció pánmixis van allélgyakoriság azonos hímekben

Részletesebben

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

mangalica sertésn Prof. dr. Bali Papp Ágnes TÁMOP-4.2.1/B Szellemi, szervezeti és K+F infrastruktúra fejlesztés a Nyugatmagyarországi

mangalica sertésn Prof. dr. Bali Papp Ágnes TÁMOP-4.2.1/B Szellemi, szervezeti és K+F infrastruktúra fejlesztés a Nyugatmagyarországi élelmiszer-előá őshonos mangalica sertésn Prof.dr. Bali Papp Ágnes TÁMOP-4.2.1/B Szellemi, szervezeti és K+F infrastruktúra fejlesztés a Nyugatmagyarországi Egyetemen c. kutatási projekt A SZÁNTÓFÖLDTŐL

Részletesebben

Katasztrófális antifoszfolipid szindróma

Katasztrófális antifoszfolipid szindróma Katasztrófális antifoszfolipid szindróma Gadó Klára Semmelweis Egyetem, I.sz. Belgyógyászati Klinika Antifoszfolipid szindróma Artériás és vénás thrombosis Habituális vetélés apl antitest jelenléte Mi

Részletesebben

Stroke kezelésének alapelvei. Prof. Dr. Komoly Sámuel MTA doktora PTE Neurológiai Klinika igazgatója

Stroke kezelésének alapelvei. Prof. Dr. Komoly Sámuel MTA doktora PTE Neurológiai Klinika igazgatója Stroke kezelésének alapelvei Prof. Dr. Komoly Sámuel MTA doktora PTE Neurológiai Klinika igazgatója Hogyan kezelhetı a stroke? Primer prevenció a stroke rizikójának csökkentése STROKE Akut kezelés Szekunder

Részletesebben

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend)

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) Országos Egészségbiztosítási Pénztár Elemzési, Orvosszakértői és Szakmai Ellenőrzési Főosztály Budapest, 2013. június 26.

Részletesebben

Zárójelentés. A D4-es dopamin receptor gén 5 régiójának haplotípus szerkezete: molekuláris és pszichiátriai vonatkozások (2003 2006) F042730

Zárójelentés. A D4-es dopamin receptor gén 5 régiójának haplotípus szerkezete: molekuláris és pszichiátriai vonatkozások (2003 2006) F042730 Zárójelentés A D4-es dopamin receptor gén 5 régiójának haplotípus szerkezete: molekuláris és pszichiátriai vonatkozások (2003 2006) F042730 Betegségeink kialakításában két f etiológiai faktor, a környezeti

Részletesebben

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1.

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1. Biobankok a Semmelweis Egyetemen Szalai Csaba 2009. július 1. Molnár Mária Judit MD, PhD A Semmelweis Egyetem Molekuláris Neurológiai Klinikai és Kutatási Központ igazgatója SE Molekuláris Neurológiai

Részletesebben

Mélyvénás trombózis és tüdőembólia. Kockázati tényezők, trombofíliák, trombózismegelőzés

Mélyvénás trombózis és tüdőembólia. Kockázati tényezők, trombofíliák, trombózismegelőzés Mélyvénás trombózis és tüdőembólia. Kockázati tényezők, trombofíliák, trombózismegelőzés Véralvadás 30 s 3-7 perc 5-10 perc 48-72 óra Érszűkület Vérlemezkeaktiváció Véralvadék kialakulása Alvadékbontás

Részletesebben

OTKA zárójelentés 2004-2007

OTKA zárójelentés 2004-2007 OTKA zárójelentés 2004-2007 Humán vizsgálatok 2004. Korábban összefüggést találtunk a monocyte chemoattractant protein-1 (MCP-1) távoli szabályozó régiójában található polimorfizmusa és az asztma fokozott

Részletesebben

Utasítások. Üzembe helyezés

Utasítások. Üzembe helyezés HASZNÁLATI ÚTMUTATÓ Üzembe helyezés Utasítások Windows XP / Vista / Windows 7 / Windows 8 rendszerben történő telepítéshez 1 Töltse le az AORUS makróalkalmazás telepítőjét az AORUS hivatalos webhelyéről.

Részletesebben

Nagy áteresztő képességű SNP mérések hasznosítása. Dr. Szalai Csaba

Nagy áteresztő képességű SNP mérések hasznosítása. Dr. Szalai Csaba Nagy áteresztő képességű SNP mérések hasznosítása Dr. Szalai Csaba 1 2 SNP-k SNP = single nucleotide polymorphism = kb. pontmutáció Általában biallélikusak, általában funkcionálisan semlegesek Több mint

Részletesebben

DEOEC, Klinikai Kutató Központ, nappali tagozatos PhD képzés. Marosvásárhelyi Orvosi és Gyógyszerészeti Egyetem, Általános Orvosi Kar

DEOEC, Klinikai Kutató Központ, nappali tagozatos PhD képzés. Marosvásárhelyi Orvosi és Gyógyszerészeti Egyetem, Általános Orvosi Kar SZEMÉLYES ADATOK Név DR. KONCZ ZSUZSA Cím 1135 Budapest Szent László út 80B. III/1. Mobil +36-30-9071895 E-mail koncz_zsuzsa@yahoo.com Állampolgárság MAGYAR Születési idő 1983. május 08. TANULMÁNYOK 2014.09.01-

Részletesebben

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013 Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz

Részletesebben

ZÁRÓ BESZÁMOLÓ a Korszerű módszerek kidolgozása a trombotikus megbetegedések és a vérzékenység diagnosztikájára című támogatott projektről

ZÁRÓ BESZÁMOLÓ a Korszerű módszerek kidolgozása a trombotikus megbetegedések és a vérzékenység diagnosztikájára című támogatott projektről ZÁRÓ BESZÁMOLÓ a Korszerű módszerek kidolgozása a trombotikus megbetegedések és a vérzékenység diagnosztikájára című támogatott projektről A projekt célkitűzései Versenyképes valamint tudományosan megalapozott

Részletesebben

A VÉZETT MUKKA ÉS A MUNKATERV MEGVALÓSTÁSA ÉVENKÉNTI BONTÁSBAN

A VÉZETT MUKKA ÉS A MUNKATERV MEGVALÓSTÁSA ÉVENKÉNTI BONTÁSBAN A VÉZETT MUKKA ÉS A MUNKATERV MEGVALÓSTÁSA ÉVENKÉNTI BONTÁSBAN 2008 1. Beteg minták gyűjtése: megkezdődött a. 264 kontroll egyén, b. 105 feltehetően beta-thalassemiás, c. 76 vitiligos, d. 560 diabeteses

Részletesebben

OTKA T042500 ZÁRÓJELENTÉS (Funkcionális genomikai rendszer kidolgozása gyermekkori ALL-ben) OTKA T042500

OTKA T042500 ZÁRÓJELENTÉS (Funkcionális genomikai rendszer kidolgozása gyermekkori ALL-ben) OTKA T042500 OTKA T042500 FUNKCIONÁLIS GENOMIKAI RENDSZER KIDOLGOZÁSA GYERMEKKORI AKUT LIMFOID LEUKÉMIÁBAN; ÚJ DIAGNOSZTIKUS MARKERGÉNEK, PREDIKCIÓS GÉNPROFILANALÍZIS ÉS ÚJ TERÁPIÁS CÉLPONTOK KIVÁLASZTÁSA SNP- ÉS GÉNEXPRESSZIÓS

Részletesebben

Metotrexát tabletta vagy injekció? Beviteli formák és hatékonyság

Metotrexát tabletta vagy injekció? Beviteli formák és hatékonyság Metotrexát tabletta vagy injekció? Beviteli formák és hatékonyság Dr. Vereckei Edit Országos Reumatológiai és Fizioterápiás Intézet, Budapest Haladás a reumatológia, immunológia és osteológia területén

Részletesebben

A farmakogenetika alkalmazása a gyógyszerkutatásban és az egyénre szabott gyógyításban

A farmakogenetika alkalmazása a gyógyszerkutatásban és az egyénre szabott gyógyításban BIOTECHNOLÓGIA AZ EGÉSZSÉGÜGYBEN A farmakogenetika alkalmazása a gyógyszerkutatásban és az egyénre szabott gyógyításban Tárgyszavak: genomkutatás; gyógyszerkutatás; farmakokinetika; farmakodinamika; farmakogenetika;

Részletesebben

Bemutatkozás Dr. Lehoczky István. 2013. december 4..

Bemutatkozás Dr. Lehoczky István. 2013. december 4.. Bemutatkozás Dr. Lehoczky István 2013. december 4.. A baromfihoz eddig ilyen viszony fűzött Képzettség: 1991 1995. Szinyei Merse Pál Gimnázium, Budapest, Érettségi. 1995 2001. Kaposvári Egyetem, Állattudományi

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

OncotypeDX és más genetikai tesztek emlőrákban és azon túl. Dr. Nagy Zoltán Med Gen-Sol Kft.

OncotypeDX és más genetikai tesztek emlőrákban és azon túl. Dr. Nagy Zoltán Med Gen-Sol Kft. OncotypeDX és más genetikai tesztek emlőrákban és azon túl Dr. Nagy Zoltán Med Gen-Sol Kft. 2 A betegek leggyakoribb kérdései! Kiújul a betegségem?! Kell kemoterápiát kapnom?! A beteg és környezete életét,

Részletesebben

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:

Részletesebben

Antibiotikus kezelési stratégia a Sürgősségi Egységben. Vass Péter, Berényi Tamás Fővárosi Önkormányzat Szent Imre Kórház Budapest SBC-SBE

Antibiotikus kezelési stratégia a Sürgősségi Egységben. Vass Péter, Berényi Tamás Fővárosi Önkormányzat Szent Imre Kórház Budapest SBC-SBE Antibiotikus kezelési stratégia a Sürgősségi Egységben Vass Péter, Berényi Tamás Fővárosi Önkormányzat Szent Imre Kórház Budapest SBC-SBE Antibiotikus kezelés indikációi a Sürgősségi Egységben Súlyos szepszis

Részletesebben

KELET-ÁZSIAI DUPLANÁDAS HANGSZEREK ÉS A HICHIRIKI HASZNÁLATA A 20. SZÁZADI ÉS A KORTÁRS ZENÉBEN

KELET-ÁZSIAI DUPLANÁDAS HANGSZEREK ÉS A HICHIRIKI HASZNÁLATA A 20. SZÁZADI ÉS A KORTÁRS ZENÉBEN Liszt Ferenc Zeneművészeti Egyetem 28. számú művészet- és művelődéstörténeti tudományok besorolású doktori iskola KELET-ÁZSIAI DUPLANÁDAS HANGSZEREK ÉS A HICHIRIKI HASZNÁLATA A 20. SZÁZADI ÉS A KORTÁRS

Részletesebben

FOLSAV VAGY MULTIVITAMIN?

FOLSAV VAGY MULTIVITAMIN? FOLSAV VAGY MULTIVITAMIN? Dr. Czeizel Endre Genetikai Ártalmak Társadalmi Megelőzése Alapítvány, Budapest Idegcső-záródási rendellenességek (Anencephalia-Encephalocele-Spina bifida = AES) Megnyilvánulás

Részletesebben

A vérzékeny betegek fogorvosi ellátása

A vérzékeny betegek fogorvosi ellátása A vérzékeny betegek fogorvosi ellátása A Magyar Arc-, Állcsont és Szájsebészeti Társaság és a Magyar Fogorvosok Implantológiai Társaságának ajánlásával, 2015. Dr. Szalma József PhD, egy. adj., tanszékvez.,

Részletesebben

In the beginning of this project I started to collect unused spaces stuck in transition. Later I continued transforming and completing them with

In the beginning of this project I started to collect unused spaces stuck in transition. Later I continued transforming and completing them with UNDER CONSTRUCTION In the beginning of this project I started to collect unused spaces stuck in transition. Later I continued transforming and completing them with different motifs. I found a lot of abandoned

Részletesebben

Genetikai vonatkozások a szalagsérülések prevenciójában és sportorvoslásában

Genetikai vonatkozások a szalagsérülések prevenciójában és sportorvoslásában Genetikai vonatkozások a szalagsérülések prevenciójában és sportorvoslásában HARSÁNYI Gergely 1,2, SZOKOLAI Viola 1,2, ELBERT Gábor 3, NAGY Zsolt B. 2 1 Pécsi Tudományegyetem Egészségtudományi Kar Egészségtudományi

Részletesebben

A Lynch szindróma molekuláris genetikai háttere Magyarországon

A Lynch szindróma molekuláris genetikai háttere Magyarországon A Lynch szindróma molekuláris genetikai háttere Magyarországon A doktori értekezés tézisei Kovács Marietta Éva Eötvös Loránd Tudományegyetem Természettudományi Kar Biológiai Doktori Iskola Klasszikus és

Részletesebben

A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában. Derzsy Napok, Sárvár, 2011 Június 2-3.

A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában. Derzsy Napok, Sárvár, 2011 Június 2-3. A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában Pénzes Zoltán PhD, Soós Pál PhD, Nógrády Noémi PhD, Varga Mária, Jorge Chacón PhD, Zolnai Anna PhD, Nagy Zoltán

Részletesebben

Folsav a kardiovaszkuláris kockázat csökkentésére? Nagy András

Folsav a kardiovaszkuláris kockázat csökkentésére? Nagy András Folsav a kardiovaszkuláris kockázat csökkentésére? Nagy András Kardiovaszkuláris (atherothrombotikus) Háttér biztató felvetések Obszervációk: Se - HOMOCISZT ~ ISZB kockázat Teljes lakosságban ISZB betegekben

Részletesebben

Várandós nők Streptococcus agalactiaeszűrése

Várandós nők Streptococcus agalactiaeszűrése Várandós nők Streptococcus agalactiaeszűrése MALDI-TOF MS módszerrel Pappné Ábrók Marianna, Arcson Ágnes, Urbán Edit, Deák Judit Szegedi Tudományegyetem, Általános Orvostudományi Kar Klinikai Mikrobiológiai

Részletesebben

Egyénre szabott terápiás választás myeloma multiplexben

Egyénre szabott terápiás választás myeloma multiplexben Egyénre szabott terápiás választás myeloma multiplexben Dr. Mikala Gábor Főv. Önk. Egy. Szt István és Szent László Kórház Haematológiai és Őssejt-Transzplantációs Osztály Mit kell tudni a myelomáról? Csontvelőből

Részletesebben

Rehabilitációs kezelések, beavatkozások új orális antikoaguláns gyógyszereket szedő, pitvarfibrilláló betegeken

Rehabilitációs kezelések, beavatkozások új orális antikoaguláns gyógyszereket szedő, pitvarfibrilláló betegeken ANTIKOAGULÁNS GYÓGYSZEREK ÉS REHABILITÁCIÓ Rehabilitációs kezelések, beavatkozások új orális antikoaguláns gyógyszereket szedő, pitvarfibrilláló betegeken Borbola József,1 Nagy Judit2 Gottsegen György

Részletesebben

Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai probléma vizsgálata genetikai módszerekkel

Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai probléma vizsgálata genetikai módszerekkel Földtan, őslénytan, flóra, fauna, természetvédelem www.mecsek.gportal.hu 2013.07.01. Szerkesztő: Fazekas Imre E-mail: fazekas.hu@gmail.com Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai

Részletesebben

A SZIE, MKK GENETIKA ÉS BIOTECHNOLÓGIAI INTÉZETÉNEK EREDMÉNYEI A NÖVÉNYNEMESÍTÉS TUDOMÁNYOKBAN ÉS A NEMESÍTÉS UTÁNPÓTLÁS NEVELÉSBEN

A SZIE, MKK GENETIKA ÉS BIOTECHNOLÓGIAI INTÉZETÉNEK EREDMÉNYEI A NÖVÉNYNEMESÍTÉS TUDOMÁNYOKBAN ÉS A NEMESÍTÉS UTÁNPÓTLÁS NEVELÉSBEN A SZIE, MKK GENETIKA ÉS BIOTECHNOLÓGIAI INTÉZETÉNEK EREDMÉNYEI A NÖVÉNYNEMESÍTÉS TUDOMÁNYOKBAN ÉS A NEMESÍTÉS UTÁNPÓTLÁS NEVELÉSBEN Heszky László és Kiss Erzsébet Keszthely 2013 PARADIGMAVÁLTÁS AZ ÉLETTUDOMÁNYOKBAN

Részletesebben

Allergia prevenció újszülött-és csecsemőkorban

Allergia prevenció újszülött-és csecsemőkorban Allergia prevenció újszülött-és csecsemőkorban Dr. Réthy Lajos Attila (MD, PhD) Országos Gyermekegészségügyi Intézet Budapest European Academy of Allergology and Clinical Immunology, Section of Pediatrics

Részletesebben

SZAKDOLGOZAT. Klinikailag jelentős gyógyszerinterakciók: orális antikoaguláns szerek. Semmelweis Egyetem Általános Orvostudományi Kar

SZAKDOLGOZAT. Klinikailag jelentős gyógyszerinterakciók: orális antikoaguláns szerek. Semmelweis Egyetem Általános Orvostudományi Kar Semmelweis Egyetem Általános Orvostudományi Kar SZAKDOLGOZAT Klinikailag jelentős gyógyszerinterakciók: orális antikoaguláns szerek Györgyi Zoltán Péter VI. évfolyam G2 csoport Konzulens: Dr. Kapocsi Judit

Részletesebben

1-ES TÍPUSÚ CUKORBETEGSÉG ÉS EGYPONTOS NUKLEOTID POLIMORFIZMUSOK KÖZÖTTI ÖSSZEFÜGGÉSEK VIZSGÁLATA. Dr. Krikovszky Dóra. Doktori (Ph.D.

1-ES TÍPUSÚ CUKORBETEGSÉG ÉS EGYPONTOS NUKLEOTID POLIMORFIZMUSOK KÖZÖTTI ÖSSZEFÜGGÉSEK VIZSGÁLATA. Dr. Krikovszky Dóra. Doktori (Ph.D. 1-ES TÍPUSÚ CUKORBETEGSÉG ÉS EGYPONTOS NUKLEOTID POLIMORFIZMUSOK KÖZÖTTI ÖSSZEFÜGGÉSEK VIZSGÁLATA Dr. Krikovszky Dóra Doktori (Ph.D.) Értekezés Témavezeto: Prof. Dr. Madácsy László egyetemi tanár Készült

Részletesebben

Can/be able to. Using Can in Present, Past, and Future. A Can jelen, múlt és jövő idejű használata

Can/be able to. Using Can in Present, Past, and Future. A Can jelen, múlt és jövő idejű használata Can/ Can is one of the most commonly used modal verbs in English. It be used to express ability or opportunity, to request or offer permission, and to show possibility or impossibility. A az egyik leggyakrabban

Részletesebben

A Kockázatkezelési Terv Összefoglalója

A Kockázatkezelési Terv Összefoglalója 1 A Kockázatkezelési Terv Összefoglalója Hatóanyag/hatóanyagcsoport paracetamol ATC N02BE01 Érintett készítmény(ek) Magyarországon Paracetamol Teva 10 mg/ml oldatos infúzió (MAH: Teva Gyógyszergyár Zrt.,

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B) 0.1 Member State HU 0.2.1 Species code 1358 0.2.2 Species name Mustela putorius 0.2.3 Alternative species scientific name 0.2.4 Common name házigörény 1. National Level 1.1 Maps 1.1.1 Distribution Map

Részletesebben

Populációgenetika, etnikumok, népesedés

Populációgenetika, etnikumok, népesedés Populációgenetika, etnikumok, népesedés Falus András 2014. augusztus 13-16, Pécs Semmelweis Egyetem Genetikai, Sejt- és Immunbiológiai Intézet EDUVITAL Nonprofit Egészségnevelési Társaság Vázlat A populációs

Részletesebben

Orvosi Genomika. 1. Trendek a modern orvostudományban. 2. Genomika és modern orvostudomány

Orvosi Genomika. 1. Trendek a modern orvostudományban. 2. Genomika és modern orvostudomány 1 1. ORVOSI GENOMIKA Orvosi Genomika 1. Trendek a modern orvostudományban DIA 1 Az emberi genom megfejtése óta eltelt 10 évben rendkívül gyors fejlődés ment végbe a genomikai technikákban, ill. a genomikai

Részletesebben

Átalakul a társadalom, t. módosulnak nyezők. Bakai Judit. Soproni Rehabilitációs Gyógyintézet

Átalakul a társadalom, t. módosulnak nyezők. Bakai Judit. Soproni Rehabilitációs Gyógyintézet Átalakul a társadalom, t módosulnak m a kockázati tényezt nyezők Bakai Judit Soproni Rehabilitációs Gyógyintézet dr. Bucsányi Gyula Az elkényeztetett nyeztetett, agyonevett, önfegyelem nélkülili nép rövidéletű.

Részletesebben

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2.

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2. BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február 1. Az IPK bemutatása 2. A TILLING módszer Hol található az IPK? Gatersleben Általános adatok az IPK-ról Leibniz

Részletesebben

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 Zárójelentés: 2001. május 15.-2004.

Részletesebben

ISCHEMIÁS STROKE AZ INTERVENCIÓS RADIOLÓGIA SZEREPE AZ ISCHÉMIÁS STRO KE PREVENCIÓJÁBAN ÉS KEZ ELÉSÉBEN. Vajda Zsolt STRO KE - TÜNETEK

ISCHEMIÁS STROKE AZ INTERVENCIÓS RADIOLÓGIA SZEREPE AZ ISCHÉMIÁS STRO KE PREVENCIÓJÁBAN ÉS KEZ ELÉSÉBEN. Vajda Zsolt STRO KE - TÜNETEK AZ INTERVENCIÓS RADIOLÓGIA SZEREPE AZ ISCHÉMIÁS STRO KE PREVENCIÓJÁBAN ÉS KEZ ELÉSÉBEN Vajda Zsolt Neurovasz kuláris Intervenciós Egys ég Somogy Megyei Kaposi Mór Oktatókórház ISCHEMIÁS STROKE Magy arorsz

Részletesebben

Savfüggő kórképek és a H. pylori fertőzés aktualitásai. Rácz István Petz Aladár Megyei Oktató Kórház Győr

Savfüggő kórképek és a H. pylori fertőzés aktualitásai. Rácz István Petz Aladár Megyei Oktató Kórház Győr Savfüggő kórképek és a H. pylori fertőzés aktualitásai Rácz István Petz Aladár Megyei Oktató Kórház Győr Az ellátás lépései acut felső GI vérzésekben Labor tesztek, volumen pótlás Urgens endoscopia, vérzéscsillapítás

Részletesebben

Az emlőrák öröklődő kockázata és ennek diagnosztikai lehetőségei

Az emlőrák öröklődő kockázata és ennek diagnosztikai lehetőségei Az emlőrák öröklődő kockázata és ennek diagnosztikai lehetőségei Dr. Oláh Edit Ambassador Nancy G. Brinker Országos Onkológiai Intézet Molekuláris Genetikai Osztály Budapest Ambassador Eleni Tsakopolous

Részletesebben

HEMATOLÓGIAI ÉS IMMUNOLÓGIAI BETEGSÉGEK ÖRÖKLETES TÉNYEZŐINEK VIZSGÁLATA. dr. Tordai Attila

HEMATOLÓGIAI ÉS IMMUNOLÓGIAI BETEGSÉGEK ÖRÖKLETES TÉNYEZŐINEK VIZSGÁLATA. dr. Tordai Attila Akadémiai doktori értekezés HEMATOLÓGIAI ÉS IMMUNOLÓGIAI BETEGSÉGEK ÖRÖKLETES TÉNYEZŐINEK VIZSGÁLATA dr. Tordai Attila Országos Gyógyintézeti Központ, Hematológiai és Immunológiai Intézet Budapest, 2005.

Részletesebben

PrenaTest Újgenerációs szekvenálást és z-score

PrenaTest Újgenerációs szekvenálást és z-score PrenaTest Újgenerációs szekvenálást és z-score számítást alkalmazó, nem-invazív prenatális molekuláris genetikai teszt a magzati 21-es triszómia észlelésére, anyai vérből végzett DNS izolálást követően

Részletesebben

SZEMÉLYRE SZABOTT GYÓGYSZERES TERÁPIA KIALAKÍTÁSÁHOZ SZÜKSÉGES DIAGNOSZTIKAI ELJÁRÁS KIDOLGOZÁSA. A doktori értekezés tézisei

SZEMÉLYRE SZABOTT GYÓGYSZERES TERÁPIA KIALAKÍTÁSÁHOZ SZÜKSÉGES DIAGNOSZTIKAI ELJÁRÁS KIDOLGOZÁSA. A doktori értekezés tézisei SZEMÉLYRE SZABOTT GYÓGYSZERES TERÁPIA KIALAKÍTÁSÁHOZ SZÜKSÉGES DIAGNOSZTIKAI ELJÁRÁS KIDOLGOZÁSA A doktori értekezés tézisei Temesvári Manna okleveles biomérnök ELTE TTK, Biológia Doktori Iskola Szerkezeti

Részletesebben

5. Molekuláris biológiai technikák

5. Molekuláris biológiai technikák 5. Molekuláris biológiai technikák DNS szaporítás kémcsőben és élőben. Klónozás, PCR, cdna, RT-PCR, realtime-rt-pcr, Northern-, Southernblotting, génexpresszió, FISH 5. Molekuláris szintű biológiai technikák

Részletesebben

Terhes nık véralvadási paramétereinek monitorozása, fibrinogén eredmények statisztikai elemzése

Terhes nık véralvadási paramétereinek monitorozása, fibrinogén eredmények statisztikai elemzése Terhes nık véralvadási paramétereinek monitorozása, fibrinogén eredmények statisztikai elemzése Réger Barbara, Füzin ziné Budos Julianna, Litter Ilona Baranya Megyei Kórh rház z Klinikai és Mikrobiológiai

Részletesebben

EGYETEMI DOKTORI (Ph.D.) ÉRTEKEZÉS TÉZISEI A CYP2D6 ENZIM FARMAKOGENETIKÁJA: KLINIKAI JELENTOSÉG A PSZICHIÁTRIAI BETEGEK ANTIPSZICHOTIKUS KEZELÉSÉBEN

EGYETEMI DOKTORI (Ph.D.) ÉRTEKEZÉS TÉZISEI A CYP2D6 ENZIM FARMAKOGENETIKÁJA: KLINIKAI JELENTOSÉG A PSZICHIÁTRIAI BETEGEK ANTIPSZICHOTIKUS KEZELÉSÉBEN EGYETEMI DOKTORI (Ph.D.) ÉRTEKEZÉS TÉZISEI A CYP2D6 ENZIM FARMAKOGENETIKÁJA: KLINIKAI JELENTOSÉG A PSZICHIÁTRIAI BETEGEK ANTIPSZICHOTIKUS KEZELÉSÉBEN Berecz Roland Debreceni Egyetem Orvos és Egészségtudományi

Részletesebben

Társadalmi-gazdasági szempontok Az ipari termelési folyamatok kedvezőbbé tétele és az ipari együttműködési láncok sűrűsége pozitív társadalmi és gazdasági eredmények létrejöttéhez is hozzájárul. A társadalmi

Részletesebben

Hogyan kezeljük az antifoszfolipid szindrómát?

Hogyan kezeljük az antifoszfolipid szindrómát? 1.rész Vénás thrombózis Hogyan kezeljük az antifoszfolipid szindrómát? A cikk áttekinti, hogyan hozzunk orvosilag megfelelő döntést az antifoszfolipid szindróma (APS) változatainak tekintetében, beleértve

Részletesebben

bab.la Cümle Kalıpları: İş Sipariş İngilizce-Macarca

bab.la Cümle Kalıpları: İş Sipariş İngilizce-Macarca bab.la Cümle Kalıpları: İş Sipariş İngilizce-Macarca Sipariş : Verme We are considering the purchase of Gondolkozunk a... vásárlásán. Resmi, çekingen We are pleased to place an order with your company

Részletesebben

bab.la Cümle Kalıpları: İş Sipariş Macarca-İngilizce

bab.la Cümle Kalıpları: İş Sipariş Macarca-İngilizce bab.la Cümle Kalıpları: İş Sipariş Macarca-İngilizce Sipariş : Verme Gondolkozunk a... vásárlásán. We are considering the purchase of Resmi, çekingen Örömmel tudatjuk, hogy szeretnénk Önöktől rendelni...

Részletesebben

A foglalkozás-egészségügyi és a háziorvos együttműködése a foglalkozási eredetű daganatos megbetegedések felderítése és gondozása területén

A foglalkozás-egészségügyi és a háziorvos együttműködése a foglalkozási eredetű daganatos megbetegedések felderítése és gondozása területén A foglalkozás-egészségügyi és a háziorvos együttműködése a foglalkozási eredetű daganatos megbetegedések felderítése és gondozása területén Dr. Sárkány Csaba háziorvos, üzemorvos MIÉRT? TÉNYEK, SZÁMOK,

Részletesebben

VÉNÁK BETEGSÉGEI. 1. ábra. A VTE halálozási arányai Magyarországon 100 000 lakosra számítva.

VÉNÁK BETEGSÉGEI. 1. ábra. A VTE halálozási arányai Magyarországon 100 000 lakosra számítva. 1 VÉNÁK BETEGSÉGEI Új távlatok a trombózisprofilaxisban Írta: DR. SÁNDOR TAMÁS Epidemiológia A vénás tromboembólia (VTE) gyakori, alattomos, súlyos következményekkel járó betegség. A kezelés költségkihatása

Részletesebben

ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY

ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY A feladatsor három részből áll 1. A vizsgáztató társalgást kezdeményez a vizsgázóval. 2. A vizsgázó egy szituációs feladatban vesz részt a

Részletesebben

Súlyos infekciók differenciálása a rendelőben. Dr. Fekete Ferenc Heim Pál Gyermekkórház Madarász utcai Gyermekkórháza

Súlyos infekciók differenciálása a rendelőben. Dr. Fekete Ferenc Heim Pál Gyermekkórház Madarász utcai Gyermekkórháza Súlyos infekciók differenciálása a rendelőben Dr. Fekete Ferenc Heim Pál Gyermekkórház Madarász utcai Gyermekkórháza Miért probléma a lázas gyermek a rendelőben? nem beteg - súlyos beteg otthon ellátható

Részletesebben

Az egészségügyi miniszter 8013/2007. (EüK. 19.) EüM. tájékoztatója

Az egészségügyi miniszter 8013/2007. (EüK. 19.) EüM. tájékoztatója Az egészségügyi miniszter 8013/2007. (EüK. 19.) EüM tájékoztatója az egészségügyi szakellátás társadalombiztosítási finanszírozásának egyes kérdéseirıl szóló 9/1993. (IV. 2.) NM rendelet 2. számú mellékletében

Részletesebben

MAGYAR TUDOMÁNYOS AKADÉMIA A DOKTORI ÉRTEKEZÉS ÖSSZEFOGLALÓJA A MOLEKULÁRIS GENETIKA SZEREPE A SCLEROSIS MULTIPLEX PATOGENEZISÉNEK FELTÁRÁSÁBAN

MAGYAR TUDOMÁNYOS AKADÉMIA A DOKTORI ÉRTEKEZÉS ÖSSZEFOGLALÓJA A MOLEKULÁRIS GENETIKA SZEREPE A SCLEROSIS MULTIPLEX PATOGENEZISÉNEK FELTÁRÁSÁBAN MAGYAR TUDOMÁNYOS AKADÉMIA A DOKTORI ÉRTEKEZÉS ÖSSZEFOGLALÓJA A MOLEKULÁRIS GENETIKA SZEREPE A SCLEROSIS MULTIPLEX PATOGENEZISÉNEK FELTÁRÁSÁBAN DR. KÁLMÁN BERNADETT 2010. 1 I. A TANULMÁNY CÉLKITŰZÉSEI

Részletesebben

Using the CW-Net in a user defined IP network

Using the CW-Net in a user defined IP network Using the CW-Net in a user defined IP network Data transmission and device control through IP platform CW-Net Basically, CableWorld's CW-Net operates in the 10.123.13.xxx IP address range. User Defined

Részletesebben

FÖLDRAJZ ANGOL NYELVEN

FÖLDRAJZ ANGOL NYELVEN Földrajz angol nyelven középszint 1411 ÉRETTSÉGI VIZSGA 2015. május 14. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ EMBERI ERŐFORRÁSOK MINISZTÉRIUMA Paper

Részletesebben

Lujber László és a szerző engedélyé

Lujber László és a szerző engedélyé Allergia genetikai háttere Dr. Szalai Csaba 2012. Szeptember 24. 1 Allergia: multifaktoriális vagy komplex betegség: Genetikai háttér (több száz gén, több ezer genetikai variáció) + környezeti tényezők

Részletesebben

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós Összefoglalás A humángenetika korunk egyik legdinamikusabban fejlődő tudományága. Ennek a fejlődésnek legfőbb mozgatórugója az, hogy a humángenetika,

Részletesebben

A multiplex endokrin neoplasia 1-es típusának klinikai és genetikai vizsgálata

A multiplex endokrin neoplasia 1-es típusának klinikai és genetikai vizsgálata A multiplex endokrin neoplasia 1-es típusának klinikai és genetikai vizsgálata Doktori értekezés Dr. Balogh Katalin Budapest, 2006. Bevezetés A multiplex endokrin neoplasia 1-es típusának (MEN 1 szindróma;

Részletesebben

Dr. Sasvári Péter Egyetemi docens

Dr. Sasvári Péter Egyetemi docens A KKV-k Informatikai Infrastruktúrájának vizsgálata a Visegrádi országokban The Analysis Of The IT Infrastructure Among SMEs In The Visegrád Group Of Countries Dr. Sasvári Péter Egyetemi docens MultiScience

Részletesebben

2. Hatályát veszti az R. 25. (11) bekezdése.

2. Hatályát veszti az R. 25. (11) bekezdése. 50714 M A G Y A R K Ö Z L Ö N Y 2013. évi 71. szám Az emberi erőforrások minisztere 31/2013. (IV. 30.) EMMI rendelete a törzskönyvezett gyógyszerek és a különleges táplálkozási igényt kielégítő tápszerek

Részletesebben

Gyakorlati megfontolások a Xarelto mindennapos használatában. Dr. Varga Csaba

Gyakorlati megfontolások a Xarelto mindennapos használatában. Dr. Varga Csaba Gyakorlati megfontolások a Xarelto mindennapos használatában Dr. Varga Csaba 1920-as évek Heparinok 1950-es évek K Vitamin antagonisták 1980-as évek LMWH 1990-es évek Direkt thrombin inhibitorok 2004 Per

Részletesebben

ható gyógyszerjel Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26.

ható gyógyszerjel Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26. Légzőrendszerre ható gyógyszerjel gyszerjelöltek ltek hatásoss sossága Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26. Tudományos

Részletesebben

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A TM vizsgálatok alapkérdései A vizsgálatok célja, információértéke? Az alkalmazás területei? Hogyan válasszuk ki az alkalmazott

Részletesebben

Diagnosztikai irányelvek Paget-kórban

Diagnosztikai irányelvek Paget-kórban Diagnosztikai irányelvek Paget-kórban Dr. Donáth Judit Országos Reumatológiai és Fizioterápiás Intézet, Budapest HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012-2014 2015. ÁPRILIS 17.

Részletesebben

Az MPS kezelési és követési protokollok változásai. Dr. Varga Norbert Toxikológia és Anyagcsere Osztály

Az MPS kezelési és követési protokollok változásai. Dr. Varga Norbert Toxikológia és Anyagcsere Osztály Az MPS kezelési és követési protokollok változásai Dr. Varga Norbert Toxikológia és Anyagcsere Osztály MPS-k MPS I MPS II MPS III MPS IV MPS VI MPS VII MPS IX Hurler-Scheie Hunter Sanfilippo Morquio Maroteaux

Részletesebben

A DIABETES ÉS A KOMORBID DEPRESSZIÓ GENETIKAI VONATKOZÁSAI

A DIABETES ÉS A KOMORBID DEPRESSZIÓ GENETIKAI VONATKOZÁSAI A DIABETES ÉS A KOMORBID DEPRESSZIÓ GENETIKAI VONATKOZÁSAI Doktori (Ph. D.) értekezés DR. NAGY GÉZA Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Témavezető: Prof. Dr. Somogyi Anikó DSc Hivatalos

Részletesebben

CSALÁDTERVEZ TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE. Dr. Erős s Erika

CSALÁDTERVEZ TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE. Dr. Erős s Erika CSALÁDTERVEZ DTERVEZÉS KÜLÖNÖS TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE Dr. Erős s Erika A családtervez dtervezés s törtt rténete Magyarországon gon Veleszületett letett rendellenességek (CA) Jelenleg

Részletesebben

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN Kötelezı szinten tartó tanfolyam PÉCS 2009. október 14-16. PROGRAMFÜZET Kedves Kollégák! Közel egy évvel ezelıtt, 2008 júniusában

Részletesebben

TÁJÉKOZTATÓ A DAGANATOS BETEG FOKOZOTT VÉNÁS TROMBÓZIS VESZÉLYÉNEK OKAIRÓL ÉS MEGELŐZÉSI LEHETŐSÉGEIRŐL

TÁJÉKOZTATÓ A DAGANATOS BETEG FOKOZOTT VÉNÁS TROMBÓZIS VESZÉLYÉNEK OKAIRÓL ÉS MEGELŐZÉSI LEHETŐSÉGEIRŐL TÁJÉKOZTATÓ A DAGANATOS BETEG FOKOZOTT VÉNÁS TROMBÓZIS VESZÉLYÉNEK OKAIRÓL ÉS MEGELŐZÉSI LEHETŐSÉGEIRŐL 2015 Milyen betegséget nevezünk vénás tromboemboliának? Az izmok között mélyen futó vénák trombózisa

Részletesebben

AZ 5Q31 KROMOSZÓMA LOCUS IBD5 RÉGIÓJÁNAK SZEREPE COLITIS ULCEROSA ÉS CROHN-BETEGSÉG KIALAKULÁSÁBAN MAGYAR POPULÁCIÓS MINTÁKBAN. Dr.

AZ 5Q31 KROMOSZÓMA LOCUS IBD5 RÉGIÓJÁNAK SZEREPE COLITIS ULCEROSA ÉS CROHN-BETEGSÉG KIALAKULÁSÁBAN MAGYAR POPULÁCIÓS MINTÁKBAN. Dr. AZ 5Q31 KROMOSZÓMA LOCUS IBD5 RÉGIÓJÁNAK SZEREPE COLITIS ULCEROSA ÉS CROHN-BETEGSÉG KIALAKULÁSÁBAN MAGYAR POPULÁCIÓS MINTÁKBAN Dr. Lakner Lilla Pécsi Tudományegyetem, Általános Orvosi Kar, Orvosi Genetikai

Részletesebben

Genetikai tanácsadók és laboratóriumok működése, akkreditációja Magyarországon

Genetikai tanácsadók és laboratóriumok működése, akkreditációja Magyarországon Genetikai tanácsadók és laboratóriumok működése, akkreditációja Magyarországon Dr. Melegh Béla PTE, Orvosi Genetikai Intézet DEMIN Debrecen, 2012 május 31. Genetikai tanácsadók és laboratóriumok működése,

Részletesebben

Új antitrombotikus gyógyszerek coronária intervencióban Prof. Keltai Mátyás (Budapest)

Új antitrombotikus gyógyszerek coronária intervencióban Prof. Keltai Mátyás (Budapest) Új antitrombotikus gyógyszerek coronária intervencióban Prof. Keltai Mátyás (Budapest) Anticoaguláns kezelés PCI előtt és alatt Percután coronaria intervenció során a koszorúérbe számos thrombogén eszközt

Részletesebben

A diabetes mellitus laboratóriumi diagnosztikája

A diabetes mellitus laboratóriumi diagnosztikája A diabetes mellitus laboratóriumi diagnosztikája Laborvizsgálatok célja diabetes mellitusban 1. Diagnózis 2. Monitorozás 3. Metabolikus komplikációk kimutatása és követése Laboratóriumi tesztek a diabetes

Részletesebben