Molekuláris diagnosztika

Save this PDF as:
 WORD  PNG  TXT  JPG

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Molekuláris diagnosztika"

Átírás

1 CE-IVD LightCycler System Real-time PCR - as flexible as you are Molekuláris diagnosztika Becságh Péter Roche Magyarország Kft MOLSZE

2 BIOKÉMIA: az élet molekuláris logikája MOLEKULÁRIS BIOLÓGIA: (biokémia + genetika +sejtbiológia) koncepció, stílus, "az amivel a molekuláris biológusok foglalkoznak" (F. Crick) Az élet bonyolultságát (komplexitás) az információs makromolekulák adják.

3

4 DNS mint örökítıanyag (RNS vírusok, prionok) Információáramlás: DNS «RNS fehérje ( centrális dogma ) Lineáris információ térbeli szerkezet specifitás, funkció

5 VIZSGÁLATI SZINTEK Fehérjék szerkezet és funkció összefüggései; molekuláris kölcsönhatások: szerkezeti biológia Az élı rendszert fenntartó fluxusok; metabolizmus, biokatalízis, reguláció: bioenergetika, anyagcsere biokémia,enzimológia Információ tárolása és feldolgozása: molekuláris biológia Teljes genomok, fehérje készletek, molekuláris interakciós hálózatok: genomika, proteomika, bioinformatika

6 Molekuláris vizsgálati területek DNS minıségi, mennyiségi RNS minıségi, mennyiségi Fehérje, minıségi, mennyiségi

7 DNS (genomi RNS) A természetben elıforduló Legspecifikusabb biomarkere minden élı szervezetnek

8 Molekuláris Diagnosztika Molekuláris diagnosztika a klinikai laboratóriumi diagnosztika azon ága, amely biológiai markerként DNS-t és RNS-t használ a klinikai vizsgálatokhoz.

9 DNS, RNS, Fehérje vizsgálati eljárások ELISA FACS PCR RT PCR Fehérje chip Western blot Chromogene Assay RTS RAPD AFLP LC, GC - MS PCR ELISA Fehérje szekvenálás NMR RTG Kristallográfia RFLP CobasAmplicorPCR Fragment Analízis, Real time PCR Génexpresszió, allél azonosítás, PFGE Microsatellita vizsgálat Northern blot Linear array DDPCR SAGE Southern blot GenChip pyroszekvenálás szekvenálás Micro array

10 Northern, Suthern, Western Blot Real time PCR Differential Display Microarrays Singleplex Multiplex

11 CE-IVD LightCycler System Real-time PCR - as flexible as you are Gyors, valós-idejő PCR rendszer, szepszist okozó mikróbák azonosítására

12 Nukleinsav célpontok baktériumok identifikálásához Virulencia gének toxin gének specifikus genom fragmentek 16S vagy 23S rdns hsp65 gén gyrb gén 16S-23S rdna spacer

13 Ribosomális RNS operon Általános A transzkriptumok a riboszóma fuknkciójához nélkülözhetetlenek Többszörös kópiaszámban fordul elı struktúra : 16S-spacer-23S-spacer-5S trns gének a spaceren helyezkednek el

14 16S-23S rdns spacer tulajdonságai Amplicon hossz : bp általában 500 bp Csoport és/vagy species specifikus különbségeket hordoz

15 Konzervált területek az rrns operonon belől A B C D E F G H I J trns ile trns ala S rrns spacer 23S rrns Gürtler et al., 1996

16 rdns spacer nukleinsav szekvencia illesztés * * * * * * * * * * * * * * LMOB.SEQ TAAGGAAAAGGAAACCTGTGAGTTTTCGTTCTTCTCTATTTGTTCAGTTTTGAGAGGTTACTCTCTTTTATGTCAGATAAAGTATGCAAGGCACTA--TGCT-TGAAGCATCGCGCCACTACATTTTTGACGGGCCTATAGCTCAGCTGG LMOC.SEQ LMOF.SEQ LINB.SEQ...C...G...C...AC G...A... LIVB.SEQ...G...C...AG...C...C...G.GT--...C-.TGG...AA.A...A... LSEB.SEQ...G...G...C...C...GT--...C-.TGG...AA.A...A... LSEC.SEQ...T...G...G...C...C...GT--...C-.TGG...AA.A...A... LWEB.SEQ...T...G...C...TAC.--...C..G...A.T...A... LGRB.SEQ...T...T..C.-T...A C.C..TA...G.-A T..TAT.T..-.T..--..G.GCAGC.A.TC.G.AAA.T... LGRC.SEQ...T...T..C.-T...A C.C..TA...G.-A T..TAT.T..-.T..--..G.GCAGC.A.TC.G.AAA.T... LMUB.SEQ...T...T..C.-T...A C.C..TA...G.-A T..TAT.T..-.T..--..G.GCAGC.A.TC.G.AAA.T * * * * * * * * * * * * * * * LMOB.SEQ TTAGAGCGCACGCCTGATAAGCGTGAGGTCGATGGTTCGAGTCCATTTAGGCCCACTTTTTCTTTCTGACATAAGAAATACAAATAATCATA-CCCTTTTAC---GGGG-CCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGA LMOC.SEQ...GC...-T...T LMOF.SEQ LINB.SEQ...CG.AG..A...TTC...TTA.-TT.C...TA LIVB.SEQ...G...C..----TG.ATA.-..TA...A LSEB.SEQ...G...---C..TTG..C.-T...A...ATAA LSEC.SEQ...G...---C..TTG...-A...A...TTAA LWEB.SEQ...C..AG..A...AT..T..TT...C..A---...G... LGRB.SEQ...A TC.TT..-TATC...T LGRC.SEQ...A TC.TT..-TATC...T LMUB.SEQ...A TC.TT..-TATC...T * * * * * * * * * * * * * * LMOB.SEQ GGTCAGCGGTTCGATCCCGCTAGGCTCCACCAAAATTGTTCTTTGAAAACTAGATAAGAAAGTTAGTAAAGTTAGCATA---GATAATTTAT-TATTTATGACACAAGTAACCGAGAATCATCTGAAAGTGAATCTTTCATCTGATTGGA LMOC.SEQ LMOF.SEQ LINB.SEQ...G A... LIVB.SEQ...---A...GG.A.C-... LSEB.SEQ...---AG..G.A..AC...A...C.. LSEC.SEQ...---AG..G.G..AC...A...C.. LWEB.SEQ G.A..-...A... LGRB.SEQ T..C.AGT..A..C..G.-A A.G...A...CG LGRC.SEQ T...T..C.AGT..A..C..G.-A A.G...A...CG LMUB.SEQ T..C.AGT..A..C..G.-A A.G...A...CG * * * * * * LMOB.SEQ AGTA-TCATCGCTGATACGGAAAATCAGAAAAACAACCTTTACTTCGTAGAAGTAAATT LMOC.SEQ T LMOF.SEQ LINB.SEQ C... LIVB.SEQ A...A.C... LSEB.SEQ C A..C...T...AC... LSEC.SEQ C A..C...T...AC... LWEB.SEQ CA.CG..T...T... LGRB.SEQ...GG...-C..C.G..GA..C...AG GCAA.C.-C...-. LGRC.SEQ...GG...-C..C.G..GA..C...AG GCAA.C.-C...-. LMUB.SEQ...GG...-C..C.G..GA..C...AG GCAA.C.-C...-.

17 Szekvencia illesztés Chlamydia trachomatis és más Chlamydia fajok plasmid szekvenciái Azonos fajba tartozó törzsek vagy izolátumok szekvenciái Közeli fajok szekvenciái

18 Jellemzı Nukleinsav szakasz felsokszorozása, PCR A nukleinsav izolátum kettıs szálú DNS termékének denaturálása hıvel 2. Annealing, rövid, mesterséges nukleinsav darabok (Primerek) bekötıdése a megfelelı, specifikus DNS szakaszra Lánchosszabítás(de novo synthesis)a Taq-Polymerase enzim meghosszabítja a bekötıdött primereket 4. Detektálás specifikus, mesterséges nukleinsav darabokkal a PCR-t követıen (AMPLICOR, COBAS AMPLICOR) vagy a PCR alatt ciklusról ciklusra (LighCycler, COBAS TAQMAN48)

19 P r o b e F x Template x Nukleinsav próba bekötése x 5 x = G:T mismatch = A:C mismatch Temperature ( C)

20 PCR technikával felsokszorozott jellemzı nukleinsav szakasz A specifikus nukleinsav próba lehetıséget ad a PCR végén a keletkezı jellemzı termék rögzítésére és elválasztására, másrészt valós idejő technika alkalmazása esetén a PCR során keletkezı termékek mennyiségének és minıségének folyamatos követésére. conservative high variability Lb2 conservative Lb1 low variability Probe low variability

21 Spacer Technológia 16S ITS (Spacer) 23S Generikus Primerek ( pan bacteria ) Amplifikációs görbe Group (e.g. Enterobacteriaceae) Specifikus nukleinsav próba Olvadáspont analízis E. coli Ent.bacter cloacae Ciklusok Tm

22 Olvadáspont analízis

23 Munkafolyamat

24 Fertızés kimutatása 6 órán belől Minta Teljes Vér (EDTA) Minta Elıkészítés Lízis, Nukleinsav kivonás PCR Analízis Gram (-) Escherichia coli Klebsiella (pneumoniae, oxyt.) Serratia marcescens Enterobacter (cloacae, aerog.) Proteus mirabilis Pseudomonas aeruginosa Acinetobacter baumanii Stenotrophomonas maltophilia Gram (+) Staphylococcus aureus CoNS Streptococcus pneumoniae Streptococcus spp. Enterococcus faecium Enterococcus faecalis MRSA (meca) VRE (van A, B) Fungi Candida albicans Candida tropicalis Candida parapsilosis Candida krusei Candida glabrata Aspergillus fumigatus

25 Hagyományos és Molekuláris Diagnosztika összehasonlítása A PCR korábban ad használható eredményt 1. nap 2. nap 3. nap 4. nap 2-3 nap kezelés hemokultúra Gram Species rezisztencia tenyésztés kezelés 6 h PCR Gram, Species, Rezisztencia (VRE & MRSA) PCR

26 Our approach: PCR speeds up microbiology Példa: Intenz Sepsis in Intensive Care Medicine Expected medical benefit: Improved initial antibiotics therapy Decreased Sepsis severity Reduced resistance of nosocomial pathogens Benefit for the patient: Less risk of complications Economic benefit: Shorter stay in intensive care * Enhanced competitiveness (lower DRG case cost; improved infection statistics) Freed ICU beds available for elective surgery * 26% had incorrect initial empiric antibiotic therapy, with 3,1 additional ICU days on average: Source: M.H.Kollef et al, Inadequate Antimicrobial Treatment of Infections, CHEST 1999, 115:

Nosocomialis infekciókat okozó baktériumok tipizálásának jelentősége a kórházi járványok felderítésében

Nosocomialis infekciókat okozó baktériumok tipizálásának jelentősége a kórházi járványok felderítésében Nosocomialis infekciókat okozó baktériumok tipizálásának jelentősége a kórházi járványok felderítésében Pászti Judit OEK Fágtipizálási és molekuláris epidemiológiai osztály Tipizálás - általában Bakteriológiai

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

Immunszupprimáltak, transzplantáltak és immunkompromittáltak infekciói. ORFI, 2016 Kádár János

Immunszupprimáltak, transzplantáltak és immunkompromittáltak infekciói. ORFI, 2016 Kádár János Immunszupprimáltak, transzplantáltak és immunkompromittáltak infekciói ORFI, 2016 Kádár János Kikről beszélünk malignitás (nem kontrollált) kemo/radioterápia haemopoieticus őssejt / solid szerv átültetés

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

a NAT-1-1476/2006 számú akkreditált státuszhoz

a NAT-1-1476/2006 számú akkreditált státuszhoz Nemzeti Akkreditáló Testület SZÛKÍTETT RÉSZLETEZÕ OKIRAT a számú akkreditált státuszhoz Az Állami Népegészségügyi és Tisztiorvosi Szolgálat Észak-magyarországi Regionális Intézet Kirendeltsége Regionális

Részletesebben

Csecsemı és gyermekkori fertızések diagnosztikája. Kenesei Éva Bókay délután 2011. február 3.

Csecsemı és gyermekkori fertızések diagnosztikája. Kenesei Éva Bókay délután 2011. február 3. Csecsemı és gyermekkori fertızések diagnosztikája Kenesei Éva Bókay délután 2011. február 3. Diagnosztika ciklusa Betegvizsgálat, presumptiv dg. laboratóriumi kérés, mintavétel, mintaszállítás 0-6 óra

Részletesebben

A Nemzeti Nosocomialis Surveillance Rendszer 2008.évi eredményei

A Nemzeti Nosocomialis Surveillance Rendszer 2008.évi eredményei A Nemzeti Nosocomialis Surveillance Rendszer 2008.évi eredményei A 2004 negyedik negyedévében indult, aktív fekvőbeteg intézmények nosocomialis fertőzéseinek monitorozására szolgáló, Nemzeti Nosocomialis

Részletesebben

A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER EREDMÉNYEI (2004. NOVEMBER 2005. OKTÓBER ) EPINFO 2006; 4:49-60.

A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER EREDMÉNYEI (2004. NOVEMBER 2005. OKTÓBER ) EPINFO 2006; 4:49-60. A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER EREDMÉNYEI (4. NOVEMBER 5. OKTÓBER ) EPINFO 6; 4:49-6. A Nemzeti Nosocomialis Surveillance Rendszer (NNSR) 4. november -jén kezdte meg működését. Az NNSR alapvetően

Részletesebben

A tigecyclin in vitro hatékonysága Magyarországon multicentrikus tanulmány 2006

A tigecyclin in vitro hatékonysága Magyarországon multicentrikus tanulmány 2006 A tigecyclin in vitro hatékonysága agyarországon multicentrikus tanulmány 26 Konkoly Thege arianne, Nikolova adka és a ikrobiológiai unkacsoport A POSZTANTIBIOTIKU ÉA BAD BUGS: NO DUGS AZ AIKAI INFKTOLÓGIAI

Részletesebben

Az intravascularis katéterekkel összefüggő infekciók bakteriológiai diagnosztikája

Az intravascularis katéterekkel összefüggő infekciók bakteriológiai diagnosztikája Az intravascularis katéterekkel összefüggő infekciók bakteriológiai diagnosztikája Konkoly Thege Marianne Szent László Kórház, Mikrobiológiai Laboratórium A klinikai és a mikrobiológiai diagnózis nehézségei

Részletesebben

Táplálék intoleranciák laboratóriumi vizsgálata vérből és székletből

Táplálék intoleranciák laboratóriumi vizsgálata vérből és székletből Táplálék intoleranciák laboratóriumi vizsgálata vérből és székletből Dr. Németh Julianna Synlab Hungary KFT Budapest Diagnosztika Központ Immunológiai Laboratóriuma Étkezéssel, emésztéssel összefüggő panaszok

Részletesebben

a NAT-1-1141/2012 nyilvántartási számú akkreditált státuszhoz

a NAT-1-1141/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület RÉSZLETEZÕ OKIRAT a NAT-1-1141/2012 nyilvántartási számú akkreditált státuszhoz A WESSLING Hungary Kft. Mikrobiológiai Laboratórium-FoodMicro (1047 Budapest, Fóti út 56.) akkreditált

Részletesebben

BACTEC Standard/10 Aerobic/F Culture Vials

BACTEC Standard/10 Aerobic/F Culture Vials BACTEC Standard/10 Aerobic/F Culture Vials Magyar HASZNÁLATI JAVASLAT A BACTEC Standard/10 Aerobic/F (dúsított emésztett szója-kazein tápleves CO 2 -vel) típusú BACTEC tenyésztõpalackok aerob vérkultúrákhoz

Részletesebben

Gyógyszerészi feladatok a rezisztens/multirezisztens kórokozók terjedésének mérséklésében

Gyógyszerészi feladatok a rezisztens/multirezisztens kórokozók terjedésének mérséklésében Gyógyszerészi feladatok a rezisztens/multirezisztens kórokozók terjedésének mérséklésében Miseta Ildikó XLVIII. Rozsnyay Emlékverseny 2013. május10-12. Miskolctapolca Bevezetés Előadás vázlata Multirezisztenskórokozók

Részletesebben

Intraabdominális sepsis. Fogas János Szegedi Tudományegyetem, AITI

Intraabdominális sepsis. Fogas János Szegedi Tudományegyetem, AITI Intraabdominális sepsis Fogas János Szegedi Tudományegyetem, AITI SURVIVING SEPSIS CAMPAIGN International guidelines for management of severe sepsis and septic shock Crit Care Med 2004;32:858-873. Intensive

Részletesebben

DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer

Részletesebben

Nemzeti Akkreditáló Testület. MÓDOSÍTOTT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1436/2014 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. MÓDOSÍTOTT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1436/2014 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület MÓDOSÍTOTT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1436/2014 nyilvántartási számú akkreditált státuszhoz A Csongrád Megyei Kormányhivatal Népegészségügyi Főosztály Laboratóriumi Osztály

Részletesebben

a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz

a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület RÉSZLETEZÕ OKIRAT a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz Az Országos Epidemiológiai Központ Bakteriológiai Mikológiai Parazitológiai és Tipizáló fõosztály

Részletesebben

a NAT-1-1141/2009 nyilvántartási számú akkreditált státuszhoz

a NAT-1-1141/2009 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület MÓDOSÍTOTT RÉSZLETEZÕ OKIRAT a NAT-1-1141/2009 nyilvántartási számú akkreditált státuszhoz A FOODMICRO Minõségellenõrzõ, Termékfejlesztõ és Kutató- Mérnöki Szolgáltató Kft.

Részletesebben

I. A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER (NNSR) 2009. ÉVI EREDMÉNYEI

I. A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER (NNSR) 2009. ÉVI EREDMÉNYEI I. A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER (NNSR) 2009. ÉVI EREDMÉNYEI 1. AZ NNSR KÖTELEZŐ JELENTÉSEI 1.A. NOSOCOMIALIS JÁRVÁNYOK Az ÁNTSZ regionális és kistérségi intézetei az OEK Kórházi járványügyi

Részletesebben

Molekuláris biológiai technikák

Molekuláris biológiai technikák Molekuláris biológiai technikák Wunderlich Lívius A Molekuláris biológiai technikák jegyzet igyekszik átfogó képet adni a jövő tudományának, a molekuláris biológiának a módszertanáról. A technikák elméleti

Részletesebben

A mikrobiológiai laboratórium szerepe és részt vállalása az infekciókontrollban Barcs István SE Orvosi Mikrobiológiai Intézet Klinikai Mikrobiológiai Diagnosztika 2008. november 6. Kórházi (nozokomiális)

Részletesebben

A mórahalmi székhelyű SeqOmics Biotechnológia Kft. Élelmiszerbiztonsági Laboratóriuma vállalja

A mórahalmi székhelyű SeqOmics Biotechnológia Kft. Élelmiszerbiztonsági Laboratóriuma vállalja A mórahalmi székhelyű SeqOmics Biotechnológia Kft. Élelmiszerbiztonsági Laboratóriuma vállalja élelmiszerek és környezeti minták, ivóvíz valamint kozmetikai szerek szabványos mikrobiológiai módszerekkel

Részletesebben

Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben

Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben Dr. Kovács Tamás, Kovács Árpád László Kármentesítés Aktuális Kérdései 2013 Budapest, 2013.03.21-22 Bioremediáció során

Részletesebben

VÉDELEM. VÉDELEM JÓ KÖZÉRZET Szárítás Vízszigetelés Hôszigetelés Védelem Dekoráció VÉDELEM JÓ KÖZÉRZET JÓ KÖZÉRZET. Felületképzô rendszer

VÉDELEM. VÉDELEM JÓ KÖZÉRZET Szárítás Vízszigetelés Hôszigetelés Védelem Dekoráció VÉDELEM JÓ KÖZÉRZET JÓ KÖZÉRZET. Felületképzô rendszer ELASTOCOLOR rendszer JÓ KÖZÉRZET Szárítás Vízszigetelés Hôszigetelés Védelem Dekoráció diszperziós elasztomer akrilgyanta bázisú rendszer beton és vasbeton felületek védelmére C.P. MK 705310 (I) 03/2006

Részletesebben

A LightCycler 2.0 készülékhez való használatra (1415001 és nagyobb sorozatszámok)

A LightCycler 2.0 készülékhez való használatra (1415001 és nagyobb sorozatszámok) LightCycler SeptiFast meca Test MG EZEKKEL HASZNÁLHATÓ: A LightCycler 2.0 készülékhez való használatra (1415001 és nagyobb sorozatszámok) FELHASZNÁLÁS CÉLJA A LightCycler SeptiFast meca Test MG egy in

Részletesebben

A széklet nagy úr. Gayerhosz Katalin. Szent László Kórház - Gyermekinfektológiai Osztály Központi Mikrobiológiai Laboratórium.

A széklet nagy úr. Gayerhosz Katalin. Szent László Kórház - Gyermekinfektológiai Osztály Központi Mikrobiológiai Laboratórium. A széklet nagy úr (Liptai Zoltán) Gayerhosz Katalin Szent László Kórház - Gyermekinfektológiai Osztály Központi Mikrobiológiai Laboratórium 4 éves fiúgyermek 1. nap Anamnézisben komoly megbetegedés nem

Részletesebben

A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER (NNSR) EREDMÉNYEI: KÖTELEZŐ JELENTÉSEK: I. MULTIREZISZTENS KÓROKOZÓK ÁLTAL OKOZOTT EPINFO 2006; 7:89-95.

A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER (NNSR) EREDMÉNYEI: KÖTELEZŐ JELENTÉSEK: I. MULTIREZISZTENS KÓROKOZÓK ÁLTAL OKOZOTT EPINFO 2006; 7:89-95. A NEMZETI NOSOCOMIALIS SURVEILLANCE RENDSZER (NNSR) EREDMÉNYEI: KÖTELEZŐ JELENTÉSEK: I. MULTIREZISZTENS KÓROKOZÓK ÁLTAL OKOZOTT NOSOCOMIALIS FERTŐZÉSEK, 2005. JANUÁR 1- DECEMBER 31. EPINFO 2006; 7:89-95.

Részletesebben

Egészségügyi ellátással összefüggő fertőzések, antimikrobiális szerhasználat és infekciókontroll a bentlakásos szociális intézményekben

Egészségügyi ellátással összefüggő fertőzések, antimikrobiális szerhasználat és infekciókontroll a bentlakásos szociális intézményekben Egészségügyi ellátással összefüggő fertőzések, antimikrobiális szerhasználat és infekciókontroll a bentlakásos szociális intézményekben Doktori értekezés Szabó Rita Semmelweis Egyetem Patológiai Tudományok

Részletesebben

BD Vacutainer Molekuláris Diagnosztikai termékei

BD Vacutainer Molekuláris Diagnosztikai termékei BD Vacutainer Molekuláris Diagnosztikai termékei Andrea Süle, PhD Termékspecialista BD Diagnostics, Preanalytical Systems MOLSZE XI. Nagygyőlés, Pécs, 2009 augusztus 27-29. BD A BD egy orvostechnológiai

Részletesebben

A KLASSZIKUS* HÚGYÚTI INFEKCIÓK MIKROBIOLÓGIAI DIAGNOSZTIKÁJA

A KLASSZIKUS* HÚGYÚTI INFEKCIÓK MIKROBIOLÓGIAI DIAGNOSZTIKÁJA A KLASSZIKUS* HÚGYÚTI INFEKCIÓK MIKROBIOLÓGIAI DIAGNOSZTIKÁJA Orvosi Mikrobiológiai Szakmai Kollégium INFEKTOLÓGIA Bevezetés A húgyúti infekciók (HI) kevés kivétellel bakteriális kórképek, az infekcióért

Részletesebben

Invazív mintavételi módszerek helye a nozokómiális pneumóniák diagnosztikájában

Invazív mintavételi módszerek helye a nozokómiális pneumóniák diagnosztikájában Invazív mintavételi módszerek helye a nozokómiális pneumóniák diagnosztikájában Prof. Dr. Nagy Erzsébet SZTE, Klinikai Mikrobiológiai Diagnosztikai Intézet, Szeged Siófok, 2008 november 27-29 Fogalmak

Részletesebben

1. A GYÓGYSZER NEVE 2. MINŐSÉGI ÉS MENNYISÉGI ÖSSZETÉTEL

1. A GYÓGYSZER NEVE 2. MINŐSÉGI ÉS MENNYISÉGI ÖSSZETÉTEL 1. A GYÓGYSZER NEVE Zinacef 250 mg por és oldószer oldatos injekcióhoz Zinacef 750 mg por és oldószer oldatos injekcióhoz Zinacef 250 mg por oldatos injekcióhoz vagy infúzióhoz Zinacef 750 mg por oldatos

Részletesebben

A mikrobiológiai asszisztens szerepe a hatékony infekciókontrollban. kontrollban

A mikrobiológiai asszisztens szerepe a hatékony infekciókontrollban. kontrollban A mikrobiológiai asszisztens szerepe a hatékony infekciókontrollban kontrollban Barcs István Semmelweis Egyetem Orvosi Mikrobiológiai Intézet, Klinikai Mikrobiológiai Diagnosztikai Laboratórium, rium,

Részletesebben

I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS

I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS 1 1. A GYÓGYSZER MEGNEVEZÉSE Doribax 500 mg por oldatos infúzióhoz 2. MINŐSÉGI ÉS MENNYISÉGI ÖSSZETÉTEL 500 mg doripenemnek megfelelő doripenem-monohidrát injekciós üvegenként.

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS

I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS 1 1. A GYÓGYSZER NEVE INVANZ 1 g por oldatos infúzióhoz való koncentrátumhoz 2. MINŐSÉGI ÉS MENNYISÉGI ÖSSZETÉTEL 1,0 g ertapenem injekciós üvegenként. Ismert hatású segédanyag(ok)

Részletesebben

III. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS, CÍMKESZÖVEG ÉS BETEGTÁJÉKOZTATÓ

III. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS, CÍMKESZÖVEG ÉS BETEGTÁJÉKOZTATÓ III. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS, CÍMKESZÖVEG ÉS BETEGTÁJÉKOZTATÓ Megjegyzés: A bizottsági határozat időpontjában ez az alkalmazási előírás, a címkeszöveg és a betegtájékoztató érvényes változata. A

Részletesebben

Tudományos kutatások, állatorvosi információk

Tudományos kutatások, állatorvosi információk Tudományos kutatások, állatorvosi információk Results A kutyák otitisének kialakulásáért felelős összes baktérium- és gombafaj ellen hatékonynak bizonyult az Otodine egy kutyákból izolált 150 kórokozó

Részletesebben

Molekuláris biológiai diagnosztika alkalmazása

Molekuláris biológiai diagnosztika alkalmazása Molekuláris biológiai diagnosztika alkalmazása (HIV, HCV, HBV szabad vírus mennyiség meghatározás) a napi rutin diagnosztikában Reichenberger Anna Mária, Dr. Sárvári Csilla Dr. Ujhelyi Eszter Fıvárosi

Részletesebben

Nosocomialis pneumonia, mint heterogén betegségcsoport. Szalka András Szent Imre Kórház, Budapest

Nosocomialis pneumonia, mint heterogén betegségcsoport. Szalka András Szent Imre Kórház, Budapest Nosocomialis pneumonia, mint heterogén betegségcsoport Szalka András Szent Imre Kórház, Budapest Pneumoniák klasszifikációja negyven - ötven évvel ezelőtt A radio-morfológia alapján Pneumonia lobaris pneumococcus!

Részletesebben

a NAT-1-1280/2013 nyilvántartási számú akkreditált státuszhoz

a NAT-1-1280/2013 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület RÉSZLETEZÕ OKIRAT a NAT-1-1280/2013 nyilvántartási számú akkreditált státuszhoz A Csongrád Megyei Kormányhivatal Népegészségügyi Szakigazgatási Szerve Laboratóriumi Decentrum/Osztály

Részletesebben

Molekuláris biológiai vizsgálatok

Molekuláris biológiai vizsgálatok Molekuláris biológiai vizsgálatok Készítette: Dr. Polgár Beáta Dr. Schneider György 2015 Tartalomjegyzék Általános bevezető 1. Hibridizációs módszerek Szilárd fázisú hibridizáció 1.1. Southern blot 1.2.

Részletesebben

EpinfoNNSR eredmények

EpinfoNNSR eredmények 13. évfolyam 4. szám 2006. február 3. JOHAN BÉLA ORSZÁGOS EPIDEMIOLÓGIAI KÖZPONT EpinfoNNSR eredmények Epidemiológiai Információs Hetilap - Sebfertőzés surveillance 49 - Intenzív terápiás osztályok surveillance-a

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

NEM NEUTROPENIÁS FELNÕTT BETEGEK INVAZÍV CANDIDA-INFEKCIÓJA

NEM NEUTROPENIÁS FELNÕTT BETEGEK INVAZÍV CANDIDA-INFEKCIÓJA NEM NEUTROPENIÁS FELNÕTT BETEGEK INVAZÍV CANDIDA-INFEKCIÓJA Infektológiai Szakmai Kollégium Az invazív (akut hematogén) candidiasis bizonyos kockázati csoportba sorolható betegek körében elõforduló súlyos

Részletesebben

biosanitizer új, környezetbarát, vízbázisú fertõtlenítõ

biosanitizer új, környezetbarát, vízbázisú fertõtlenítõ biosanitizer új, környezetbarát, vízbázisú fertõtlenítõ környezetbarát összetétel, hatóanyagai az alkalmazás során vízre és oxigénre bomlanak, nem tartalmaz alkoholt, illékony szerves vegyületeket (VOC),

Részletesebben

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin A géntechnikák alkalmazási területei leltár Géntechnika 3 Dr. Gruiz Katalin Kutatás Genetikai: genomok feltérképezése: HUGO, mikroorganizmusoké, ujjlenyomatok készítése, jellegzetes szekvenciák keresése

Részletesebben

SZAKKÉPZÉSI KERETTANTERV a(z) 55 725 18 KLINIKAI LABORATÓRIUMI SZAKASSZISZTENS SZAKKÉPESÍTÉS-RÁÉPÜLÉSHEZ

SZAKKÉPZÉSI KERETTANTERV a(z) 55 725 18 KLINIKAI LABORATÓRIUMI SZAKASSZISZTENS SZAKKÉPESÍTÉS-RÁÉPÜLÉSHEZ SZAKKÉPZÉSI KERETTANTERV a(z) 55 725 18 KLINIKAI LABORATÓRIUMI SZAKASSZISZTENS SZAKKÉPESÍTÉS-RÁÉPÜLÉSHEZ I. A szakképzés jogi háttere A szakképzési kerettanterv a nemzeti köznevelésről szóló 2011. évi

Részletesebben

Új temékek az UD-GenoMed Kft. kínálatában!

Új temékek az UD-GenoMed Kft. kínálatában! Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai

Részletesebben

SZÛKÍTETT RÉSZLETEZÕ OKIRAT (1)

SZÛKÍTETT RÉSZLETEZÕ OKIRAT (1) Nemzeti Akkreditáló Testület SZÛKÍTETT RÉSZLETEZÕ OKIRAT (1) a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz Az Országos Epidemiológiai Központ Bakteriológiai, Mikológiai, Parazitológiai

Részletesebben

SZÛKÍTETT RÉSZLETEZÕ OKIRAT (2)

SZÛKÍTETT RÉSZLETEZÕ OKIRAT (2) Nemzeti Akkreditáló Testület SZÛKÍTETT RÉSZLETEZÕ OKIRAT (2) a NAT-1-1254/2008 nyilvántartási számú akkreditált státuszhoz A Szegedi Tudományegyetem Szent-Györgyi Albert Klinikai Központ Klinikai Mikrobiológiai

Részletesebben

EGYETEMI DOKTORI (Ph. D.) ÉRTEKEZÉS. Majoros László. érzékenységének vizsgálata flukonazol, amphotericin B, 5-fluorocitozin. és caspofungin iránt

EGYETEMI DOKTORI (Ph. D.) ÉRTEKEZÉS. Majoros László. érzékenységének vizsgálata flukonazol, amphotericin B, 5-fluorocitozin. és caspofungin iránt EGYETEMI DOKTORI (Ph. D.) ÉRTEKEZÉS Majoros László Candida inconspicua klinikai izolátumok azonosítása és érzékenységének vizsgálata flukonazol, amphotericin B, 5-fluorocitozin és caspofungin iránt DEBRECENI

Részletesebben

Modern diagnosztikai eljárások a klinikai mikrobiológiában - Lehetőségek és értékelésük

Modern diagnosztikai eljárások a klinikai mikrobiológiában - Lehetőségek és értékelésük Modern diagnosztikai eljárások a klinikai mikrobiológiában - Lehetőségek és értékelésük Kristóf Katalin Semmelweis Egyetem, Laboratóriumi Medicina Intézet Klinikai Mikrobiológiai Diagnosztikai Laboratórium

Részletesebben

Az antibiotikum terápia klinikai jelentősége

Az antibiotikum terápia klinikai jelentősége Az antibiotikum terápia klinikai jelentősége Ludwig Endre ESZSZK, Semmelweis Egyetem, Infektológiai Tanszéki Csoport Minimális és maximális célok Minimális: -klinikai gyógyulás Maximális: -klinikai gyógyulás

Részletesebben

Veszélyes rezisztenciatípust hordozó baktériumok térhódítása az újszülött és csecsemı populációban. Kenesei Éva Bókay délután május 7.

Veszélyes rezisztenciatípust hordozó baktériumok térhódítása az újszülött és csecsemı populációban. Kenesei Éva Bókay délután május 7. Veszélyes rezisztenciatípust hordozó baktériumok térhódítása az újszülött és csecsemı populációban Kenesei Éva Bókay délután 2011. május 7. Erısen virulens kórokozók: Streptococcus pyogenes Streptococcus

Részletesebben

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1678/2012 nyilvántartási számú akkreditált státuszhoz Az Országos Epidemiológiai Központ Bakteriológiai, Mikológiai, Parazitológiai

Részletesebben

a NAT /2006 számú akkreditálási ügyirathoz

a NAT /2006 számú akkreditálási ügyirathoz Nemzeti Akkreditáló Testület RÉSZLETEZÕ OKIRAT a számú akkreditálási ügyirathoz Országos Epidemiológiai Központ Bakteriológiai, Mikológiai, Parazitológiai és Tipizáló Fõosztály (1097 Budapest, Gyáli út

Részletesebben

ESBL-termelő Klebsiella pneumoniae molekuláris tipizálása & Egy járvány tanulságai

ESBL-termelő Klebsiella pneumoniae molekuláris tipizálása & Egy járvány tanulságai ESBL-termelő Klebsiella pneumoniae molekuláris tipizálása & Egy járvány tanulságai Damjanova I., Tirczka T., Tóth Á., Hajdú Á.,Dandárné Cs., Bauer E., Pászti J., HajbelVékony G., Németh I., Böröcz K. Országos

Részletesebben

dr Borza Erzsébet Csolnoky Ferenc Kórház, Veszprém Konzulens: dr Bartal Alexandra

dr Borza Erzsébet Csolnoky Ferenc Kórház, Veszprém Konzulens: dr Bartal Alexandra dr Borza Erzsébet Csolnoky Ferenc Kórház, Veszprém Konzulens: dr Bartal Alexandra Tartalomjegyzék Neutropéniás láz definíciója/kritériumai Profilaxis Protokoll szerinti kezelés Kórházi viszonyok bemutatása

Részletesebben

Antibiotikumok a kutyapraxisban

Antibiotikumok a kutyapraxisban Antibiotikumok a kutyapraxisban Antibiotikum választás Bakteriális fertőzés Célzott Empirikus Megelőző Indokolt esetben Ismert betegség kiújulásának megelőzésére Rizikócsoportoknál Mikor ne adjunk? Nem

Részletesebben

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1280/2013 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1280/2013 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1280/2013 nyilvántartási számú akkreditált státuszhoz A Csongrád Megyei Kormányhivatal Népegészségügyi Szakigazgatási Szerve Laboratóriumi

Részletesebben

A vizsgálatok árai tartalmazzák a mintavevőt és a szakmai konzultáció lehetőségét. Az egészségügyi szolgáltatás tárgyi adómentes.

A vizsgálatok árai tartalmazzák a mintavevőt és a szakmai konzultáció lehetőségét. Az egészségügyi szolgáltatás tárgyi adómentes. Bakteriológiai vizsgálatok (tenyésztés, szerológia) Felső légúti váladék (orr-, torok-, külsőfül-, középfülváladék, nasopharyngealis váladék) aerob kórokozó baktérium és gomba tenyésztése, identifikálás,

Részletesebben

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT /2013 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT /2013 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület SZŰKÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1280/2013 nyilvántartási számú akkreditált státuszhoz A Csongrád Megyei Kormányhivatal Népegészségügyi Szakigazgatási Szerve Laboratóriumi

Részletesebben

NANOEZÜST ALAPÚ ANTIBAKTERIÁLIS SZÓRHATÓ SZOL KIFEJLESZTÉSE MŰANYAG FELÜLETEKRE

NANOEZÜST ALAPÚ ANTIBAKTERIÁLIS SZÓRHATÓ SZOL KIFEJLESZTÉSE MŰANYAG FELÜLETEKRE NANOEZÜST ALAPÚ ANTIBAKTERIÁLIS SZÓRHATÓ SZOL KIFEJLESZTÉSE MŰANYAG FELÜLETEKRE Gábor Tamás1, Hermann Zsolt2, Hubai László3 1: PhD, 2: kutató, 3: kutató NANOCENTER Kft. BEVEZETÉS A nanorészecskéket tartalmazó

Részletesebben

REGIONÁLIS BAKTERIOLÓGIAI LABORATÓRIUM. Klinikai bakteriológiai és kórházhigénés részleg

REGIONÁLIS BAKTERIOLÓGIAI LABORATÓRIUM. Klinikai bakteriológiai és kórházhigénés részleg REGIONÁLIS BAKTERIOLÓGIAI LABORATÓRIUM Nemzeti Akkreditáló Testület (NAT) által akkreditált vizsgálólaboratórium (NAT1 1458/2006) Nemzeti Akkreditáló Testület (NAT) által akkreditált vizsgálólaboratórium

Részletesebben

a NAT-1-0834/2008 számú akkreditált státuszhoz

a NAT-1-0834/2008 számú akkreditált státuszhoz Nemzeti Akkreditáló Testület SZÛKÍTETT RÉSZLETEZÕ OKIRAT a NAT-1-0834/2008 számú akkreditált státuszhoz A PHARMAVALID Gyógyszeripari, Méréstechnikai, és Szolgáltató Kft. Mikrobiológiai Laboratórium (1136

Részletesebben

Antibiotikumok I. Selman Abraham Waksman 1888-1973

Antibiotikumok I. Selman Abraham Waksman 1888-1973 Antibiotikumok I. Az antibiotikumok az élő szervezetek elsősorban mikroorganizmusok által termelt úgynevezett másodlagos anyagcseretermékek (szekunder metabolitok) legfontosabb csoportja. Ökológiai szerepük,

Részletesebben

ÚJ GENERÁCIÓS SZEKVENÁLÁS

ÚJ GENERÁCIÓS SZEKVENÁLÁS VÍZMIKROBIOLÓGUSOK XI. ORSZÁGOS KONFERENCIÁJA - 2012 ÚJ GENERÁCIÓS SZEKVENÁLÁS LEHETŐSÉG, VAGY NEHÉZSÉG? MÁRIALIGETI KÁROLY EÖTVÖS LORÁND TUDOMÁNYEGYETEM, BUDAPEST 1953 JAMES D. WATSON, FRANCIS CRICK:

Részletesebben

Baktériumok biokémiai vizsgálata

Baktériumok biokémiai vizsgálata Baktériumok biokémiai vizsgálata Baktériumok jellemzése Mikroszkópos morfológia Biokémia Makroszkópos morfológia Biokémiai identifikálás => baktérium fajra jellemző enzimek kimutatása (bizonyos enzim megléte

Részletesebben

a NAT-1-0834/2008 számú akkreditált státuszhoz

a NAT-1-0834/2008 számú akkreditált státuszhoz Nemzeti Akkreditáló Testület MÓDOSÍTOTT RÉSZLETEZÕ OKIRAT a NAT-1-0834/2008 számú akkreditált státuszhoz A PHARMAVALID Gyógyszeripari, Méréstechnikai, és Szolgáltató Kft. Mikrobiológiai Laboratórium (1136

Részletesebben

Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során

Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során Tipizálási módszerek alkalmazása methicillin-rezisztens Staphylococcus aureus (MRSA) törzsek molekuláris epidemiológiai vizsgálatai során Ungvári Erika, Tóth Ákos Magyar Infektológiai és Klinikai Mikrobiológiai

Részletesebben

SZTE-ELTE PROTEOMIKAI INNOVÁCIÓ: KONCEPCIÓ, EREDMÉNYEK, JÖVŐKÉP

SZTE-ELTE PROTEOMIKAI INNOVÁCIÓ: KONCEPCIÓ, EREDMÉNYEK, JÖVŐKÉP SZTE-ELTE PROTEOMIKAI INNOVÁCIÓ: KONCEPCIÓ, EREDMÉNYEK, JÖVŐKÉP Minden elméletet úgy is meg lehet alkotni, hogy az általa sugallt kísérletek csak magát az elméletet erősítsék meg Konrad Lorenz A SEJTMŰKÖDÉS

Részletesebben

Szűrés és izolálás stratégiája Gram negatív multirezisztens kórokozó okozta fertőzés és hordozás esetén

Szűrés és izolálás stratégiája Gram negatív multirezisztens kórokozó okozta fertőzés és hordozás esetén Szűrés és izolálás stratégiája Gram negatív multirezisztens kórokozó okozta fertőzés és hordozás esetén Dr Böröcz Karolina Kórházi járványügyi osztály 14. Országos Antibiotikum Továbbképző Tanfolyam Siófok

Részletesebben

a NAT /2006 számú akkreditálási ügyirathoz

a NAT /2006 számú akkreditálási ügyirathoz Nemzeti Akkreditáló Testület RÉSZLETEZÕ OKIRAT a számú akkreditálási ügyirathoz Az Állami Népegészségügyi és Tisztiorvosi Szolgálat Dél-alföldi Regionális Intézet Kirendeltsége, Laboratóriumi Osztály Mikrobiológiai

Részletesebben

BD CHROMagar Orientation Medium

BD CHROMagar Orientation Medium HASZNÁLATI UTASÍTÁSOK HASZNÁLATRA KÉSZ TÁPTALAJOK PA-257481.03 Változat: Sep 2011 BD CHROMagar Orientation Medium HASZNÁLATI JAVASLAT A BD CHROMagar Orientation Medium egy nem szelektív táptalaj a húgyúti

Részletesebben

Nozokomiális fertõzéseket okozó multirezisztens baktériumok mikrobiológiai jellemzõi

Nozokomiális fertõzéseket okozó multirezisztens baktériumok mikrobiológiai jellemzõi Nozokomiális fertõzéseket okozó multirezisztens baktériumok mikrobiológiai jellemzõi Doktori tézisek Dr. Kristóf Katalin Semmelweis Egyetem Patológiai Tudományok Interdiszciplináris Doktori Iskola 8/3

Részletesebben

a NAT-1-0834/2012 nyilvántartási számú akkreditált státuszhoz

a NAT-1-0834/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület RÉSZLETEZÕ OKIRAT a NAT-1-0834/2012 nyilvántartási számú akkreditált státuszhoz A PHARMAVALID Gyógyszeripari, Méréstechnikai, és Szolgáltató Kft. Mikrobiológiai Laboratórium

Részletesebben

A karbapenem fogyasztás hatása a karbapenem rezisztens Acinetobacter baumannii epidemiológiájára.

A karbapenem fogyasztás hatása a karbapenem rezisztens Acinetobacter baumannii epidemiológiájára. A karbapenem fogyasztás hatása a karbapenem rezisztens Acinetobacter baumannii epidemiológiájára. Kardos Gábor, Mózes Julianna, Ebrahimi Fatemeh, Gorácz Orsolya, Miszti Cecília (DE, ÁOK, Debrecen) MIFKMT

Részletesebben

Pneumóniák kisded- és gyermekkorban

Pneumóniák kisded- és gyermekkorban Pneumóniák kisded- és gyermekkorban Dr. Póder György Gyermekpulmonológiai továbbképzı 2010. március Budapest A pneumóniák jelentısége, gyakorisága Egészségügyi Világszervezet (WHO) adatai: az

Részletesebben

A komplikált intraabdominális infekciók mikrobiológiai diagnosztikája és kezelése felnőtt betegeknél Intézeti protokoll

A komplikált intraabdominális infekciók mikrobiológiai diagnosztikája és kezelése felnőtt betegeknél Intézeti protokoll A komplikált intraabdominális infekciók mikrobiológiai diagnosztikája és kezelése felnőtt betegeknél Intézeti protokoll Szegedi Tudományegyetem, Aneszteziológiai és Intenzív Terápiás Intézet 2011. Klasszifikáció:

Részletesebben

MÓDOSÍTOTT RÉSZLETEZÕ OKIRAT (1)

MÓDOSÍTOTT RÉSZLETEZÕ OKIRAT (1) Nemzeti Akkreditáló Testület MÓDOSÍTOTT RÉSZLETEZÕ OKIRAT (1) a NAT-1-1449/2010 nyilvántartási számú akkreditált státuszhoz Az OHKI ORSZÁGOS HÚSIPARI KUTATÓINTÉZET Közhasznú Nonprofit Korlátolt Felelõsségû

Részletesebben

mikrobiológiai füzetek 5

mikrobiológiai füzetek 5 mikrobiológiai füzetek 5 A MIKROBIOLÓGIAI EREDMÉNYEK ELEMZÉSE AZ INFEKCIÓKONTROLL ÉS AZ ANTIBIOTIKUM POLITIKA SEGÍTÉSÉRE A Semmelweis Egyetem Egészségtudományi Kar Népegészségtani Intézetének kiadványa

Részletesebben

Normál baktériumflóra Nosocomiális fertőzések. Szabó Judit

Normál baktériumflóra Nosocomiális fertőzések. Szabó Judit Normál baktériumflóra Nosocomiális fertőzések Szabó Judit Normál baktériumflóra Rezidens flóra: állandó flóra Tranziens flóra: átmeneti flóra, környezetből származik pathogének is lehetnek a tagjai kolonizáció

Részletesebben

ESBL. termelő bélbaktériumok okozta infekciók jelentősége. Prof. Dr. Nagy Erzsébet. SZTE, ÁOK, Klinikai Mikrobiológiai Diagnosztikai Intézet, Szeged

ESBL. termelő bélbaktériumok okozta infekciók jelentősége. Prof. Dr. Nagy Erzsébet. SZTE, ÁOK, Klinikai Mikrobiológiai Diagnosztikai Intézet, Szeged ESBL termelő bélbaktériumok okozta infekciók jelentősége Prof. Dr. Nagy Erzsébet SZTE, ÁOK, Klinikai Mikrobiológiai Diagnosztikai Intézet, Szeged Siófok, 2008 november 27-29 Új kihívások az infekciós kórképek

Részletesebben

Normál baktériumflóra. Normál baktériumflóra. őzések. Nosocomiális fertő. Normál flóra a szervezet különböző. ő helyein. Az együttélés formái

Normál baktériumflóra. Normál baktériumflóra. őzések. Nosocomiális fertő. Normál flóra a szervezet különböző. ő helyein. Az együttélés formái Normál baktériumflóra Normál baktériumflóra Nosocomiális fertő őzések Szabó Judit Az együttélés formái Mutualizmus: az együttélés mindkét fél számára hasznos Kommenzalizmus: az együttélés az egyik fél

Részletesebben

A minimális sejt. Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására

A minimális sejt. Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására A minimális sejt Avagy hogyan alkalmazzuk a biológia több területét egy kérdés megválaszolására Anyagcsere Gánti kemoton elmélete Minimum sejt Top down: Meglevő szervezetek genomjából indulunk ki Bottom

Részletesebben

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár

Részletesebben

MÓDOSÍTOTT RÉSZLETEZÕ OKIRAT(2)

MÓDOSÍTOTT RÉSZLETEZÕ OKIRAT(2) Nemzeti Akkreditáló Testület MÓDOSÍTOTT RÉSZLETEZÕ OKIRAT(2) a NAT-1-1007/2008 nyilvántartási számú akkreditált státuszhoz A Budapest Fõváros Kormányhivatala, Népegészségügyi Szakigazgatási Szerve (3),

Részletesebben

I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS

I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS 1 1. A GYÓGYSZER MEGNEVEZÉSE Tygacil 50 mg por oldatos infúzióhoz. 2. MINŐSÉGI ÉS MENNYISÉGI ÖSSZETÉTEL Minden 5 ml-es Tygacil injekciós üveg 50 mg tigeciklint tartalmaz.

Részletesebben

A MIKROORGANIZMUSOK A TERMÉSZETBEN

A MIKROORGANIZMUSOK A TERMÉSZETBEN NYUGAT-MAGYARORSZÁGI EGYETEM Mezőgazdaság- és Élelmiszer-tudományi Kar Mosonmagyaróvár MIKROBIOLÓGIA ELŐADÁS Alapképzési (BSc) szakok A MIKROORGANIZMUSOK A TERMÉSZETBEN Prof. Dr. Varga László egyetemi

Részletesebben

A Legionella jelenlétének kimutatása

A Legionella jelenlétének kimutatása A Legionella jelenlétének kimutatása Diagnosztikai lehetőségek Kari András Budapest 2016. 04.07. Legionella nemzetség: aerob coccoid-pálca Gram (gyengén festődik) kataláz +, oxidáz +, hippurátot hidrulizálja

Részletesebben

Mielőtt továbbmennénk, tegyünk egy kis kitérőt a Nano-technológia ránk vonatkozó világába

Mielőtt továbbmennénk, tegyünk egy kis kitérőt a Nano-technológia ránk vonatkozó világába Ezüstion Technológia Az ezüstöt széleskörűen alkalmazták baktériumok ellen évszázadok óta. Az ezüst természetes biocid, azonban, ha nano-méretű, akkor rendkívül veszélyes! Mielőtt továbbmennénk, tegyünk

Részletesebben

Klinikai kémia. Laboratóriumi diagnosztika. Szerkesztette: Szarka András. Írta: Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis Egyetem

Klinikai kémia. Laboratóriumi diagnosztika. Szerkesztette: Szarka András. Írta: Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis Egyetem Klinikai kémia Laboratóriumi diagnosztika Szerkesztette: Szarka András Írta: Szarka András (1-8, 11-15. fejezet) Keszler Gergely (9, 10. fejezet) Budapesti Műszaki és Gazdaságtudományi Egyetem Semmelweis

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

ANGIOLÓGIA. Elõfordulási gyakoriság. Patofiziológia. Jermendy György: A DIABÉTESZES LÁB

ANGIOLÓGIA. Elõfordulási gyakoriság. Patofiziológia. Jermendy György: A DIABÉTESZES LÁB KÖZLEMÉNYEK KÖZLEMÉNYEK KÖZLEMÉNYEK KÖZLEMÉNYEK KÖZLEMÉNYEK ANGIOLÓGIA Jermendy György: A DIABÉTESZES LÁB Diabéteszes láb néven a cukorbetegség olyan idült lábszövõdményét értjük, amelynek kialakulásában

Részletesebben

9. Az élelmiszer-vizsgálati laboratóriumok szerepe. dr. Nagy Attila, 2016. április 13. nagyattila@nebih.gov.hu

9. Az élelmiszer-vizsgálati laboratóriumok szerepe. dr. Nagy Attila, 2016. április 13. nagyattila@nebih.gov.hu 9. Az élelmiszer-vizsgálati labratóriumk szerepe dr. Nagy Attila, 2016. április 13. nagyattila@nebih.gv.hu NÉBIH szakterületei Talaj Növényegészségügy Peszticid-analitika Állategészségügy Állatgyógyszer,

Részletesebben

Génszerkezet és génfunkció

Génszerkezet és génfunkció Általános és Orvosi Genetika jegyzet 4. fejezetének bővítése a bakteriális genetikával 4. fejezet Génszerkezet és génfunkció 1/ Bakteriális genetika Nem szükséges külön hangsúlyoznunk a baktériumok és

Részletesebben

Várandós nők Streptococcus agalactiaeszűrése

Várandós nők Streptococcus agalactiaeszűrése Várandós nők Streptococcus agalactiaeszűrése MALDI-TOF MS módszerrel Pappné Ábrók Marianna, Arcson Ágnes, Urbán Edit, Deák Judit Szegedi Tudományegyetem, Általános Orvostudományi Kar Klinikai Mikrobiológiai

Részletesebben