Körte tájfajták jellemzése mikroszatellit alapú molekuláris markerezéssel Anyag és módszer 164

Save this PDF as:
 WORD  PNG  TXT  JPG

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Körte tájfajták jellemzése mikroszatellit alapú molekuláris markerezéssel Anyag és módszer 164"

Átírás

1 Kocsisné M. Gitta 1 Bolla Dávid 2 Ulrike Anhalt 3 Astrid Forneck 3 Körte tájfajták jellemzése mikroszatellit alapú molekuláris markerezéssel Pear cultivars characterization of microsatellite-based molecular marker 1 Pannon Egyetem, Georgikon Kar, Növénytudományi és Biotechnológiai Tanszék, egyetemi docens 2 Pannon Egyetem, Georgikon Kar, egyetemi hallgató 3 Universität für Bodenkultur Wien Department für Nutzpflanzenwissenschaften Abteilung Wein- und Obstbau Magyarországon a körte mindig jelentős gyümölcsfajnak számított. A hagyományos, népi termesztésben lévő, változatos ökológiai viszonyokhoz alkalmazkodó tájfajták a XX. század közepén lassan visszaszorultak. Helyüket átvették a Nyugat-Európából származó, páraigényes fajták. Termesztett fajtáink változatosságát, tűrőképességét és minőségét a génbankokban őrzött növényanyagra támaszkodva tudjuk növelni. Emiatt elengedhetetlen a növényanyag genetikai és pomológiai tulajdonságainak pontos ismerete. YAMAMOTO et al. (2001) almából izolált mikroszatellitek primerek körténél való alkalmazhatóságát vizsgálta. A méréseket P. communis, P. bretschneideri, P. ussuriensis, P. pyrifolia és P. calleryana fajok több fajtája, valamint a P. communis és P. pyrifolia két hibridje bevonásával végezte. Valahány primer jól elkülöníthető fragmenseket sokszorosított az összes mintánál. KIMURA et al. (2002) hat Pyrus fajról származó hatvan mintát vizsgált kilenc SSR marker segítségével. A vizsgálat során százharminchárom vélt allélt találtak. Ötvennyolc fajtát tudtak sikeresen megkülönböztetni, két minta klónnak bizonyult. GASI et al. (2013) hatvannégy körte genotípust vizsgált meg, melyek között a srebreniki génbankból származó hagyományos bosznia-hercegovinai, nemzetközi standard és Szarajevó környékén gyűjtött, feltételezett tájfajták is szerepeltek. Előbbi kettő csoport között szignifikáns genetikai különbséget állapítottak meg, míg a génbanki fajták és a begyűjtött tételek közt ilyen különbség nem állt fenn. Ez alapján a hazai állomány értékes génforrásnak bizonyult. STRACIERI et al. (2015) tizenkilenc brazíliai fajtát huszonegy SSR marker segítségévelt vizsgált. Segítségükkel egyértelműen elkülöníthetők voltak a P. communis, P. pyrifolia és P. betulaefolia fajtái, valamint ezek hibridjei. ERFANI et al. (2012) P. pyrifolia, P. communis és P. bretschneideri fajoktól származó negyvenhét genotípus, valamint a P. salicifolia és P. mazandaranica vad fajok rokonságát és diverzitását értékelte huszonnyolc mikroszatellit primer pár segítségével. A Pannon Egyetem Georgikon Kar keszthelyi körte génbankjában több, mint 200 fajta körte található. Köztük számos hazai tájfajta, melyeknek sem eredetét, származását, sem rokonsági kapcsolatait nem ismerjük. Vizsgálatainknál körtefajtákat jellemeztünk mikroszatellit alapú molekuláris markerezés segítségével. Anyag és módszer A vizsgálni kívánt genotípusok kiválasztásakor szempont volt, hogy legtöbbjük hazai tájfajta legyen, emellett legyen köztük néhány nemzetközi standard fajta az összehasonlításhoz. 81 saját mintánk mellett a BOKU saját telepéről származó 7 standard fajtát is bevontunk a vizsgálatba. A vizsgált fajták a következők voltak: 164

2 Magyar tájfajta Régi külföldi fajta Korai szagos, Kiss Margit, Fehérvári körte 1., Nyári körte Dunaföldvár, Piros nyári körte Bicske, Köcsög körte VK 3, Szűcsi II., Csákvári nyári 010, Őszi körte Leányfalu, Mézes körte, Citrom körte, Köcsög VK 2, Bikácsi nagy szegfű, Révész Bálint A, Köcsög körte, Nyári zöld kobak, Zsámbéki 214, Magyar kobak, Selmeci körte II., Fehérvári körte, Szentendrei császár, Császár körte, Leányfalusi piros, Macskafej, Szűcsi IV., Szűcsi szegfű típus, Szűcsi körte Bore típus, Erdélyi II., 1/7 Ráckeve, Őszi császár körte Törökbálint, Mandula vajkörte, Nagy szegfű körte, 395 Zöld Magdolna, Mezőkövesdi 3, Téli Kálmán, Nyári király körte, Móri császár, Erdélyi III., Fertődi rozsdás, Szűcsi III., Őszi pálinka, Szobi legkorábbi, Solymári cukor, Mezőkövesdi 2, Mosolygó, Miklós, Fujtós körte, Mogyoródi óriás, Piroska Hertich Bergamottja, Árpával érő, Nyári Kálmán, Bella di Giugno,,, Hóka, Nyári esperes, Tarjáni körte, Mária Lujza,, Totyakos császár, Favrené, Aromata de Bistrica, Amanlis vaj Pákozd, Melló bárónő, Pittmastoni hercegnő, Miniszter Lucius, Drouard elnök, Stössel Tábornok, Marianna hercegnő, Pap körte igen bőtermő Sárospatak, Orient, Moon Geon, Izambert, Malinéri Jozefin Standard fajta a Georgikonról Standard fajta a BOKU-ról 1. táblázat. A vizsgálatba vont körtefajták Bosc kobakja, Vilmos, Beurré d' Anjou, Hosui Abbe Fetel, Williams, Uta 12a, Packham s Triumph, Alexander Lucas, Bosc Flaschenbirne, Gute Louise A génbank 81 fajtájáról április 21-én gyűjtöttünk levélmintát, fajtánként db levelet. Fontos volt, hogy a mintagyűjtés rügyfakadáskor történjen, mivel a fiatal levelek tartalmazzák a legtöbb intakt DNS-t. A területen hűtött táskába kerültek a bezacskózott és megjelölt levélminták, majd a laborban folyékony nitrogénnel (-196 C) sokkfagyasztottuk őket. A feldolgozás megkezdéséig a mintákat -70 C-on tároltuk. Az előkészítés első lépéseként a minták mindegyikét liofilizáltuk (CHRIST Beta 2-4 LD plus LT). A fagyasztva szárítás megkönnyítette a minták további feldolgozását, mivel így a levelek DNS tartalma hűtés nélkül is stabil maradt. A minták örlését golyós malommal (RETSCH MM 400) végeztük. Az így kapott őrleményből a DNS kivonáshoz kb. 50 mg mennyiséget 1,5 ml-es mikrocsőbe töltöttem. A DNS kivonás sikerességét és a DNS becsült mennyiségét agaróz gélelektroforézissel 1% 1 TBE agaróz gélen ellenőriztük. A DNS méretének becsléséhet DNS-létraként 1 kb GeneRulert (Thermo Fisher Scientific, Waltham, USA) használtunk. A mintákat ez alapján 2:3 arányban felhígítottam 0.05 TE pufferral, annak érdekében, hogy a PCR sikeres legyen. A PCR terméket 1%-os agaróz gélen, 100 bp GeneRuler létrával, előzetesen teszteltük. A fragmentumok detektálását Fragment Analyzer (Advanced Analytical, Heidelberg, Németország) géppel végeztem. 165

3 Marker Kapcsoltsági csoport forward szekvencia reverse szekvencia CH01d09 2 GCCATCTGAACAGAATGTGC CCCTTCATTCACATTTCCAG CH03d12 3 GCCCAGAAGCAATAAGTAAACC ATTGCTCCATGCATAAAGGG CH03g07 1a AATAAGCATTCAAAGCAATCCG TTTTTCCAAATCGAGTTTCGTT CH04e03 3 TTGAAGATGTTTGGCTGTGC TGCATGTCTGTCTCCTCCAT CH05c06 1b ATTGGAACTCTCCGTATTGTGC ATCAACAGTAGTGGTAGCCGGT EMPc11 1b GCGATTAAAGATCAATAAACCCATA AAGCAGCTGGTTGGTGAAAT EMPc117 1b GTTCTATCTACCAAGCCACGCT CGTTTGTGTTTTTACGTGTTG GD147 3 TCCCGCCATTTCTCTGC AAACCGCTGCTGCTGAAC 2. táblázat. A felhasznált markerek EREDMÉNYEK ÉS ÉRTÉKELÉSÜK 88 körtefajtát 8 SSR marker segítségével vizsgáltunk, így 8 88=704 kiértékelendő eredményt kaptunk. Ebből mindössze 11 nem volt értékelhető. Abban az esetben, ha csak egy fragmentumot tudtunk azonosítani, homozigótának tekintettük a fajtát az adott lókuszon. Mivel a null allélok jelenléte nem zárható ki, előfordulhat, hogy a heterozigótaság értékeket alábecsültük. A nyolc primerpárral összesen 216 polimorf fragmentumot amplifikáltunk. Az átlagos allélszám 27/lókusz. A legkevesebb allélt (11) a CH04e03 primerpárral kaptuk, míg a legtöbbet (44) a CH03g07-tel. A várt heterozigótaság (He) 0,72 (CH04e03) és 0,95 (CH03g07) között alakult, míg az átlag 0,88. A megfigyelt heterozigótaság (Ho) 0,01 (CH04e03) és 1,00 (GD147) között alakult, az átlag 0,80 volt. A null allélok becsült gyakorisága 3 lókusznál (CH04e03, CH03d12, CH03g07) adott pozitív értéket, ez azonban csak a null allélok jelenlétének lehetőségét mutatja, és nem szükségszerű jelenlétüket. SEHIC et al. (2012), GASI et al. (2013) és QUEIROZ et al. (2014) hasonló markereket alkalmazva eltérő eredményre jutottak az allélok száma tekintetében. A talált allélok száma esetükben 104, 159 és 68, az átlagos lókuszonkénti allélszám 10,4, 14,5 illetve 11,3. A várt heterozigótaság átlaga 0,78 és 0,806 (Gasi et al. nem adta meg) és a megfigyelt heterozigótaság átlaga 0,74, 0,81 és 0,852. A kapott allélméret intervallumokat PUSKÁS et al. (2015) munkájának értékeivel összehasonlítva látjuk, hogy négy lókusz (EMPc11, EMPc117, CH05c06, CH01d09) esetében hasonló értékeket kaptunk. A másik négy lókusznál (CH03g07, CH03d12, GD147, CH04e03) nagyobb eltérések tapasztalhatók. Lókusz Allélok száma Allélméret intervallumok Saját PUSKÁS et al. He Ho n CH04e CH03d GD EMPc

4 CH05c EMPc CH01d CH03g táblázat. A nyolc SSR lókusz jellemzése 88 fajta alapján; az intervallumok összehasonlítása A mért fragmentumhosszok lókuszonkénti gyakoriságát is megfigyeltük. A legnagyobb gyakoriságú allél vagy allélok tekinthetők vad típusnak, a többi allél valószínűleg ezekből alakulhatott ki mutációval. A nagy, 0,1 feletti gyakoriságú allélokat kiemeltük. A nyolc lókuszon detektált allélok gyakoriságát négy kategóriába soroltuk. A nagyon gyakori kategóriába (0,2 és a feletti gyakoriságú) csak 6 (2,8%) allél tartozik. Gyakorinak a 0,05 és 0,2 közötti allél gyakoriságot tekintettük, amely kategóriába 40 allél (18,5%) tartozik. A 0,01 és 0,05 közötti gyakoriságkategóriába összesen 109 allél (50,5%) került, ezeket ritkának tekintettük A 261 polimorfizmus közül 68 allél egyedi volt, azaz összesen csak egyszer fordult elő. Ide soroljuk a 0,01 gyakoriság alatti, nagyon ritkának tekintett allélokat, melyek száma 61 (28,2%), illetve a CH04e03 lókusz esetében a 7 darab ritka allélt. Az egyedi allélok lókuszonkénti száma 3 és 20 között változik. SEHIC et al. (2012) munkájában 86 minta 10 markerrel való vizsgálata során 20 egyedi allélt talált. Az egyedi és ritka allélok nagy száma, és a fajták dendrogramon látható nagy távolsága alátámasztják, hogy a vizsgált fajták nagy értékkel bírnak a genetikai diverzitás szempontjából. Lókusz Nagyon gyakori (0,2=<) Gyakori (0,05-0,2) Ritka (0,01-0,05) Nagyon (0,01=>) EMPc GD CH03d CH04e CH05c EMPc CH01d CH03g Összesen % 2,8 18,5 50,5 28,2 4. táblázat. A lókuszok gyakorisága A lókuszonként egy vagy kettő fragmentumot amplifikáló fajtákat diploidnak tekintettük. Ennek a feltételnek, mind a nyolc lókusz esetében, csupán 29 fajta felelt meg. Az allélösszetétele alapján 59 fajta mutatkozott triploidnak. Ezeknél 1-4 számú lókuszon három különböző allélt detektáltunk. A lókuszonkénti kettőnél több allél jelenléte nem feltétlenül jelenti azt, hogy a fajta poliploid. Ez adódhat mérési hibából és kiméra jelenlétéből is. A ploidszint pontos meghatározásához további vizsgálatok lennének szükségesek. ritka 167

5 A vizsgálat során mind a 88 genotípust eltérő allél-összetételűnek találtuk. Az értékelést, a fajták összehasonlítását a következő csoportosításban végeztük: o Standard fajták összevetése más szakirodalom adataival, illetve a két, mindkét egyetem standardja közt megtalálható fajta pár összevetése ( Vilmos - Williams ; Bosc kobakja - Bosc Flaschenbirne ) o Azonos nevű fajták összevetése: Korai szagos A és B, Melló bárónő A és B, Nyári esperes A és B, Fehérvári körte A és B, Császár körte A és B. o Fajtakörön belüli fajták összehasonlítása: Császár körte, Köcsög körte típusok. o Azok a fajták, melyek nevében a származási hely, vagy valamilyen más tulajdonság megnevezése közös. Ilyen megnevezések az erdélyi, mezőkövesdi, szűcsi, leányfalusi illetve szegfű. A dendrogram elágazásai a fajták egymáshoz viszonyított rokonságát fejezik ki, az egyes fajták törzstől való eltérő távolsága pedig azt, hogy az adott fajta mennyiben változott meg a közös őshöz viszonyítva, mennyiben különbözik attól. Minél távolabb van egy adott fajta a törzstől, annál több mutáció ment végbe benne így annál kevesebb allélja közös a többi fajtával. A dendrogram alatt található mérce ezt a különbözőséget mutatja. Így pl. megállapítható, hogy méréseink szerint a Nyári körte Dunaföldvár, amely a legtávolabb helyezkedik el a törzstől, alléljainak már csak hozzávetőlegesen 50%-a egyezik meg a közös ős alléljaival. Ugyanígy a többi fajta távolsága is leolvasható. A dendrogram három fő ágból épül fel, mindegyik fő ágban egyaránt megtalálhatók a magyar, a külföldi és a standard fajták is. A BOKU-ról származó standard fajták allélhosszait összevetettük PUSKÁS et al. (2015) adataival, és 1-9 bp különbséget tapasztaltunk. Ez az eltérő gyártótól származó vegyszerek és műszerek használatából adódhat. A későbbiekben ezeket a fajtákat belső standardként használtam, hogy a méréseimben szereplő allélhosszaikat összevessem a már ismert adatokkal. Méréseim hitelesnek mondhatók, mivel a belső standardhoz képest, egyes lókuszok 1-3 bp-os különbségével, azonos eredményeket kaptam. A magyar és az osztrák standard fajták közül két pár azonos fajtanévvel rendelkezett. A Williams Christ és a Vilmos allélösszetétele 1 bp-os különbségekkel azonosnak mutatkozik, közeli rokonságuk a dendrogramon is látható. Különbség a két fajta között, hogy a Vilmos esetében egy lókuszon egyel kevesebb, egy lókuszon pedig egyel több allélt találtam. Utóbbi kiértékelési hiba lehet, mivel utóbbi esetében triploid lenne a Vilmos. A Bosc kobakja és a Bosc Flaschenbirne alléljai is egyezést mutatnak, itt azonban három lókusznál találtam egyel több allélt. A dendrogramon közeli rokonságot mutatnak. A Korai szagos fajta két változata közt szoros rokonságot állapíthatunk meg a dendrogram alapján, alléljaik közt egy alkalommal 1 bp eltérés látható. Valószínűleg azonos fajtáról van szó, az eltérés oka az A változat két lókuszának hiányzó értéke. A Nyári esperes, a Melló bárónő és a Császár körte A és B változatainál is hasonló 1 bp-os eltéréseket tapasztalunk. Az 1 és 2 bp eltérés mérés közbeni csúszás eredménye. Ez az eltérés annyira jelentéktelen, hogy e fajták változatait azonos fajtának tekinthetjük. A Fehárvári körte A és B változata viszont a dendrogram két külön főcsoportjába tartoznak, a B változat három lókuszon is 1 bp-nál nagyobb eltéréseket mutat, és két lókuszon három alléllal rendelkezik. Azért ezek a változatok külön fajtának tekintendők. A Császár körte mind a hat változata a dendrogam ugyanazon fő ágába tartozik. Szoros rokonság állapítható meg a Császár körte a Móri császár és a Szentendrei császár között. Ezektől eltérő mellékágon található a másik két szoros rokonságban lévő fajta, a Totyakos császár és az Őszi császár körte Törökbálint. SZANI (2015) szerint a Császár körte megnevezés régi keletű, az évszázadok során a jó minőségű körte márkajegyévé vált, ilyen módon számos fajtára használt név. A Köcsög körte három fajtája is szoros rokonságot mutat, eltérés köztük csak két lókusz esetében az allélok számában mutatkozott. Az Erdélyi körte II. és az Erdélyi körte III. a dendrogram két külön fő ágában foglalnak helyet, így szoros rokonság nem áll fenn köztük. A Mezőkövesdi 2 és Mezőkövesdi 3 bár ugyanabban a fő ágban található, távolságuk nagyobb, közös alléljaik száma kevesebb, mint a két Erdélyi körte esetében, így rokonságuk 168

6 távolabbi. A szűcsi megnevezésű fajták közül a Szűcsi II., Szűcsi III. és Szűcsi szegfű típus egyazon főágban található, rokonságuk közeli. A Szűcsi IV. és a Szűcsi körte Bore típus a fa egy-egy külön fő ágában található, ezért ezek rokonság sem egymással, sem az első három fajtával nem mondható közelinek. A két leányfalusi fajta nem közeli rokon, mivel két külön főágban helyezkednek el. A szegfű típusú körték közül a Bikácsi nagy szegfű és a Nagy szegfű körte egymás mellett foglal helyet, rokonságuk szoros. A Szűcsi szegfű típus egy másik fő ágban található, ezekkel kevéssé rokon fajta. Szokatlan eredmény, hogy a Hosui fajta nem képez külön csoportot a dendrogramban, annak ellenére, hogy nem a P. communis, hanem a P. pyrifolia fajtája. 169

7 1. ábra A fajták rokonsági viszonyai az SSR fragmentumok súlyozatlan Neighbor -Joining módszer elemzése által. Forrás: Bolla Szentendrei császár Császár körte B Fehérvári körte B Császár körte A Móri császár Alexander Lucas Miniszter Lucius Moon Geon Gute Louise Szucsi szegfu típus Leányfalusi piros Mogyoródi óriás Szucsi II Orient Erdélyi II Totyakos császár Vilmos Fertodi rozsdás Williams Oszi császár körte Törökbálint Szucsi III Selmeci körte II Mezokövesdi 2 Aromata de Bistrica Mária Lujza Nyári esperes B Nyári esperes A Beurré d' Anjou Amanlis vaj Pákozd Mandula vajkörte Mezokövesdi 3 1/7 Ráckeve Köcsög körte VK 3 Csákvári nyári 010 Köcsög körte Köcsög VK 2 Hóka Zsámbéki 214 Kiss Margit Erdélyi III Izambert Bosc kobakja Szucsi körte Bore típus Bosc Flaschenbirne Fehérvári körte A Fehérvári körte 1 Korai szagos B Korai szagos A Árpával éro Téli Kálmán Mosolygós Hertich Bergamottja Szobi legkorábbi Fujtós körte Mézes körte Révész Bálint A Solymári cukor Nagy szegfu körte Hosui Bikácsi nagy szegfu Piroska Nyári zöld kobak Stössel Tábornok Melló báróno B Uta 12a Melló báróno A 395 Zöld Magdolna Oszi körte Leányfalu Oszi pálinka Drouard elnök Marianna hercegno Abbe Fetel Favrené Malinéri Jozefin Packham's Triumph Citrom körte Szucsi IV. Pittmastoni hercegno Miklós Piros nyári körte Bicske Bella di Giugno Macskafej Magyar kobak Nyári király körte Tarjáni körte Pap körte igen botermo Sárospatak Nyári Kálmán Nyári körte Dunaföldvár 170

8 KÖVETKEZTETÉSEK A markeranalízis során tapasztalt ritka és igen ritka allélok nagy száma mutatja, hogy a régi fajták óriási értékkel bírnak a genetikai diverzitás szempontjából. Ezeket a régi fajtákat, mint génforrásokat, fel lehet és fel kell használni a fajtanemesítés során, mivel a fajtahasználat beszűkülése a termesztésben ökológiai katasztrófához vezethet. A pontos eredmények elérése érdekében célszerű lenne a vizsgálat biológiai és technikai megismétlése. Előbbi alatt egy fajta két különböző egyedéről történő mintavételt, utóbbi alatt ugyanazon minta kétszeri bemérését értjük. Javasoljuk a genetikai markerezés eredményeit a fajták pomológiai vizsgálatának eredményeivel összevetni. A fajták fenológiai és morfológiai tulajdonságai az UPOV számkulcsos módszerével értékelhetőek és statisztikai módszerekkel összehasonlíthatók. Az UPOV és SSR eredmények korrelációja is megállapítható. A fajták ploidszintjének pontos meghatározásához flow citometriás vizsgálat elvégzése javasolt. Ugyanehhez a pomológiai leírások is segítségül szolgálnak, mivel a késői érés, a nagy gyümölcs és a léha magvak jelenléte a triploid fajták jellemzői. Irodalom 1. Erfani, J., Ebadi, A., Abdollahi, H., Fatahi, R. (2012): Genetic Diversity of Some Pear Cultivars and Genotypes Using Simple Sequence Repeat (SSR) Markers. Plant Molecular Biology Reporter. 30: Gasi, F., Kurtovic, M., Kalamujic. B., Pojskic, N., Grahic, J., Kaiser, C., Meland, M. (2013): Assessment of European pear (Pyrus communis L.) genetic resources in Bosnia and Herzegovina using microsatellite markers. Scientia Horticulturae. 157: Kimura, T., Shi, Y. Z., Shoda, M., Kotobuki, K., Matsuta, N., Hayashi, T., Ban, Y., Yamamoto, T. (2002): Identification os Asian pear varieties by SSR Analysis. Breeding Science 52: Puskás, M., Höfer, M., Sestraş, R. E., Peil, A., Sestraş, A. F., Hanke M-V., Flachowsky, H. (2015): Molecular and flow cytometric evaluation of pear (Pyrus L.) genetic resources of the German and Romanian national fruit collections. Genet. Resour. Crop Evol. pp Queiroz, A., Assuncao, A., Ramadas, I., Viegas, W., Veloso, M. M. (2015): Molecular characterization of Portuguese pear landraces (Pyrus communis L.) using SSR markers. Scientia Horticulturae 183: Queiroz, A., Assuncao, A., Ramadas, I., Viegas, W., Veloso, M. M. (2015): Molecular characterization of Portuguese pear landraces (Pyrus communis L.) using SSR markers. Scientia Horticulturae 183: Stracieri, J., Magalhaes H. M., Resende, L. V., Carvalho, L. C. C. (2015): Simple sequence repeat (SSR) markers are effective for identifying pear cultivars and selections. African Journal of Biotechnology. 14: Szani, Zs. (2012): Főbb tájfajtáink. in: Nyéki, J., Szabó, T., Soltész, M. (szerk.): Körtefajták vizsgálata génbankokban. Debreceni Egyetem AGTC MÉK Kertészettudományi Intézet, Debrecen. p Yamamoto, T., Kimura, T., Sawamura, Y., Kotobuki, K., Ban, Y., Hayashi, T., Matsuta, N. (2001): SSRs isolated from apple can identify polymorphism and genetic diversity in pear. Theoretical and Applied Genetics. 102: