Körte tájfajták jellemzése mikroszatellit alapú molekuláris markerezéssel Anyag és módszer 164

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Körte tájfajták jellemzése mikroszatellit alapú molekuláris markerezéssel Anyag és módszer 164"

Átírás

1 Kocsisné M. Gitta 1 Bolla Dávid 2 Ulrike Anhalt 3 Astrid Forneck 3 Körte tájfajták jellemzése mikroszatellit alapú molekuláris markerezéssel Pear cultivars characterization of microsatellite-based molecular marker 1 Pannon Egyetem, Georgikon Kar, Növénytudományi és Biotechnológiai Tanszék, egyetemi docens 2 Pannon Egyetem, Georgikon Kar, egyetemi hallgató 3 Universität für Bodenkultur Wien Department für Nutzpflanzenwissenschaften Abteilung Wein- und Obstbau Magyarországon a körte mindig jelentős gyümölcsfajnak számított. A hagyományos, népi termesztésben lévő, változatos ökológiai viszonyokhoz alkalmazkodó tájfajták a XX. század közepén lassan visszaszorultak. Helyüket átvették a Nyugat-Európából származó, páraigényes fajták. Termesztett fajtáink változatosságát, tűrőképességét és minőségét a génbankokban őrzött növényanyagra támaszkodva tudjuk növelni. Emiatt elengedhetetlen a növényanyag genetikai és pomológiai tulajdonságainak pontos ismerete. YAMAMOTO et al. (2001) almából izolált mikroszatellitek primerek körténél való alkalmazhatóságát vizsgálta. A méréseket P. communis, P. bretschneideri, P. ussuriensis, P. pyrifolia és P. calleryana fajok több fajtája, valamint a P. communis és P. pyrifolia két hibridje bevonásával végezte. Valahány primer jól elkülöníthető fragmenseket sokszorosított az összes mintánál. KIMURA et al. (2002) hat Pyrus fajról származó hatvan mintát vizsgált kilenc SSR marker segítségével. A vizsgálat során százharminchárom vélt allélt találtak. Ötvennyolc fajtát tudtak sikeresen megkülönböztetni, két minta klónnak bizonyult. GASI et al. (2013) hatvannégy körte genotípust vizsgált meg, melyek között a srebreniki génbankból származó hagyományos bosznia-hercegovinai, nemzetközi standard és Szarajevó környékén gyűjtött, feltételezett tájfajták is szerepeltek. Előbbi kettő csoport között szignifikáns genetikai különbséget állapítottak meg, míg a génbanki fajták és a begyűjtött tételek közt ilyen különbség nem állt fenn. Ez alapján a hazai állomány értékes génforrásnak bizonyult. STRACIERI et al. (2015) tizenkilenc brazíliai fajtát huszonegy SSR marker segítségévelt vizsgált. Segítségükkel egyértelműen elkülöníthetők voltak a P. communis, P. pyrifolia és P. betulaefolia fajtái, valamint ezek hibridjei. ERFANI et al. (2012) P. pyrifolia, P. communis és P. bretschneideri fajoktól származó negyvenhét genotípus, valamint a P. salicifolia és P. mazandaranica vad fajok rokonságát és diverzitását értékelte huszonnyolc mikroszatellit primer pár segítségével. A Pannon Egyetem Georgikon Kar keszthelyi körte génbankjában több, mint 200 fajta körte található. Köztük számos hazai tájfajta, melyeknek sem eredetét, származását, sem rokonsági kapcsolatait nem ismerjük. Vizsgálatainknál körtefajtákat jellemeztünk mikroszatellit alapú molekuláris markerezés segítségével. Anyag és módszer A vizsgálni kívánt genotípusok kiválasztásakor szempont volt, hogy legtöbbjük hazai tájfajta legyen, emellett legyen köztük néhány nemzetközi standard fajta az összehasonlításhoz. 81 saját mintánk mellett a BOKU saját telepéről származó 7 standard fajtát is bevontunk a vizsgálatba. A vizsgált fajták a következők voltak: 164

2 Magyar tájfajta Régi külföldi fajta Korai szagos, Kiss Margit, Fehérvári körte 1., Nyári körte Dunaföldvár, Piros nyári körte Bicske, Köcsög körte VK 3, Szűcsi II., Csákvári nyári 010, Őszi körte Leányfalu, Mézes körte, Citrom körte, Köcsög VK 2, Bikácsi nagy szegfű, Révész Bálint A, Köcsög körte, Nyári zöld kobak, Zsámbéki 214, Magyar kobak, Selmeci körte II., Fehérvári körte, Szentendrei császár, Császár körte, Leányfalusi piros, Macskafej, Szűcsi IV., Szűcsi szegfű típus, Szűcsi körte Bore típus, Erdélyi II., 1/7 Ráckeve, Őszi császár körte Törökbálint, Mandula vajkörte, Nagy szegfű körte, 395 Zöld Magdolna, Mezőkövesdi 3, Téli Kálmán, Nyári király körte, Móri császár, Erdélyi III., Fertődi rozsdás, Szűcsi III., Őszi pálinka, Szobi legkorábbi, Solymári cukor, Mezőkövesdi 2, Mosolygó, Miklós, Fujtós körte, Mogyoródi óriás, Piroska Hertich Bergamottja, Árpával érő, Nyári Kálmán, Bella di Giugno,,, Hóka, Nyári esperes, Tarjáni körte, Mária Lujza,, Totyakos császár, Favrené, Aromata de Bistrica, Amanlis vaj Pákozd, Melló bárónő, Pittmastoni hercegnő, Miniszter Lucius, Drouard elnök, Stössel Tábornok, Marianna hercegnő, Pap körte igen bőtermő Sárospatak, Orient, Moon Geon, Izambert, Malinéri Jozefin Standard fajta a Georgikonról Standard fajta a BOKU-ról 1. táblázat. A vizsgálatba vont körtefajták Bosc kobakja, Vilmos, Beurré d' Anjou, Hosui Abbe Fetel, Williams, Uta 12a, Packham s Triumph, Alexander Lucas, Bosc Flaschenbirne, Gute Louise A génbank 81 fajtájáról április 21-én gyűjtöttünk levélmintát, fajtánként db levelet. Fontos volt, hogy a mintagyűjtés rügyfakadáskor történjen, mivel a fiatal levelek tartalmazzák a legtöbb intakt DNS-t. A területen hűtött táskába kerültek a bezacskózott és megjelölt levélminták, majd a laborban folyékony nitrogénnel (-196 C) sokkfagyasztottuk őket. A feldolgozás megkezdéséig a mintákat -70 C-on tároltuk. Az előkészítés első lépéseként a minták mindegyikét liofilizáltuk (CHRIST Beta 2-4 LD plus LT). A fagyasztva szárítás megkönnyítette a minták további feldolgozását, mivel így a levelek DNS tartalma hűtés nélkül is stabil maradt. A minták örlését golyós malommal (RETSCH MM 400) végeztük. Az így kapott őrleményből a DNS kivonáshoz kb. 50 mg mennyiséget 1,5 ml-es mikrocsőbe töltöttem. A DNS kivonás sikerességét és a DNS becsült mennyiségét agaróz gélelektroforézissel 1% 1 TBE agaróz gélen ellenőriztük. A DNS méretének becsléséhet DNS-létraként 1 kb GeneRulert (Thermo Fisher Scientific, Waltham, USA) használtunk. A mintákat ez alapján 2:3 arányban felhígítottam 0.05 TE pufferral, annak érdekében, hogy a PCR sikeres legyen. A PCR terméket 1%-os agaróz gélen, 100 bp GeneRuler létrával, előzetesen teszteltük. A fragmentumok detektálását Fragment Analyzer (Advanced Analytical, Heidelberg, Németország) géppel végeztem. 165

3 Marker Kapcsoltsági csoport forward szekvencia reverse szekvencia CH01d09 2 GCCATCTGAACAGAATGTGC CCCTTCATTCACATTTCCAG CH03d12 3 GCCCAGAAGCAATAAGTAAACC ATTGCTCCATGCATAAAGGG CH03g07 1a AATAAGCATTCAAAGCAATCCG TTTTTCCAAATCGAGTTTCGTT CH04e03 3 TTGAAGATGTTTGGCTGTGC TGCATGTCTGTCTCCTCCAT CH05c06 1b ATTGGAACTCTCCGTATTGTGC ATCAACAGTAGTGGTAGCCGGT EMPc11 1b GCGATTAAAGATCAATAAACCCATA AAGCAGCTGGTTGGTGAAAT EMPc117 1b GTTCTATCTACCAAGCCACGCT CGTTTGTGTTTTTACGTGTTG GD147 3 TCCCGCCATTTCTCTGC AAACCGCTGCTGCTGAAC 2. táblázat. A felhasznált markerek EREDMÉNYEK ÉS ÉRTÉKELÉSÜK 88 körtefajtát 8 SSR marker segítségével vizsgáltunk, így 8 88=704 kiértékelendő eredményt kaptunk. Ebből mindössze 11 nem volt értékelhető. Abban az esetben, ha csak egy fragmentumot tudtunk azonosítani, homozigótának tekintettük a fajtát az adott lókuszon. Mivel a null allélok jelenléte nem zárható ki, előfordulhat, hogy a heterozigótaság értékeket alábecsültük. A nyolc primerpárral összesen 216 polimorf fragmentumot amplifikáltunk. Az átlagos allélszám 27/lókusz. A legkevesebb allélt (11) a CH04e03 primerpárral kaptuk, míg a legtöbbet (44) a CH03g07-tel. A várt heterozigótaság (He) 0,72 (CH04e03) és 0,95 (CH03g07) között alakult, míg az átlag 0,88. A megfigyelt heterozigótaság (Ho) 0,01 (CH04e03) és 1,00 (GD147) között alakult, az átlag 0,80 volt. A null allélok becsült gyakorisága 3 lókusznál (CH04e03, CH03d12, CH03g07) adott pozitív értéket, ez azonban csak a null allélok jelenlétének lehetőségét mutatja, és nem szükségszerű jelenlétüket. SEHIC et al. (2012), GASI et al. (2013) és QUEIROZ et al. (2014) hasonló markereket alkalmazva eltérő eredményre jutottak az allélok száma tekintetében. A talált allélok száma esetükben 104, 159 és 68, az átlagos lókuszonkénti allélszám 10,4, 14,5 illetve 11,3. A várt heterozigótaság átlaga 0,78 és 0,806 (Gasi et al. nem adta meg) és a megfigyelt heterozigótaság átlaga 0,74, 0,81 és 0,852. A kapott allélméret intervallumokat PUSKÁS et al. (2015) munkájának értékeivel összehasonlítva látjuk, hogy négy lókusz (EMPc11, EMPc117, CH05c06, CH01d09) esetében hasonló értékeket kaptunk. A másik négy lókusznál (CH03g07, CH03d12, GD147, CH04e03) nagyobb eltérések tapasztalhatók. Lókusz Allélok száma Allélméret intervallumok Saját PUSKÁS et al. He Ho n CH04e CH03d GD EMPc

4 CH05c EMPc CH01d CH03g táblázat. A nyolc SSR lókusz jellemzése 88 fajta alapján; az intervallumok összehasonlítása A mért fragmentumhosszok lókuszonkénti gyakoriságát is megfigyeltük. A legnagyobb gyakoriságú allél vagy allélok tekinthetők vad típusnak, a többi allél valószínűleg ezekből alakulhatott ki mutációval. A nagy, 0,1 feletti gyakoriságú allélokat kiemeltük. A nyolc lókuszon detektált allélok gyakoriságát négy kategóriába soroltuk. A nagyon gyakori kategóriába (0,2 és a feletti gyakoriságú) csak 6 (2,8%) allél tartozik. Gyakorinak a 0,05 és 0,2 közötti allél gyakoriságot tekintettük, amely kategóriába 40 allél (18,5%) tartozik. A 0,01 és 0,05 közötti gyakoriságkategóriába összesen 109 allél (50,5%) került, ezeket ritkának tekintettük A 261 polimorfizmus közül 68 allél egyedi volt, azaz összesen csak egyszer fordult elő. Ide soroljuk a 0,01 gyakoriság alatti, nagyon ritkának tekintett allélokat, melyek száma 61 (28,2%), illetve a CH04e03 lókusz esetében a 7 darab ritka allélt. Az egyedi allélok lókuszonkénti száma 3 és 20 között változik. SEHIC et al. (2012) munkájában 86 minta 10 markerrel való vizsgálata során 20 egyedi allélt talált. Az egyedi és ritka allélok nagy száma, és a fajták dendrogramon látható nagy távolsága alátámasztják, hogy a vizsgált fajták nagy értékkel bírnak a genetikai diverzitás szempontjából. Lókusz Nagyon gyakori (0,2=<) Gyakori (0,05-0,2) Ritka (0,01-0,05) Nagyon (0,01=>) EMPc GD CH03d CH04e CH05c EMPc CH01d CH03g Összesen % 2,8 18,5 50,5 28,2 4. táblázat. A lókuszok gyakorisága A lókuszonként egy vagy kettő fragmentumot amplifikáló fajtákat diploidnak tekintettük. Ennek a feltételnek, mind a nyolc lókusz esetében, csupán 29 fajta felelt meg. Az allélösszetétele alapján 59 fajta mutatkozott triploidnak. Ezeknél 1-4 számú lókuszon három különböző allélt detektáltunk. A lókuszonkénti kettőnél több allél jelenléte nem feltétlenül jelenti azt, hogy a fajta poliploid. Ez adódhat mérési hibából és kiméra jelenlétéből is. A ploidszint pontos meghatározásához további vizsgálatok lennének szükségesek. ritka 167

5 A vizsgálat során mind a 88 genotípust eltérő allél-összetételűnek találtuk. Az értékelést, a fajták összehasonlítását a következő csoportosításban végeztük: o Standard fajták összevetése más szakirodalom adataival, illetve a két, mindkét egyetem standardja közt megtalálható fajta pár összevetése ( Vilmos - Williams ; Bosc kobakja - Bosc Flaschenbirne ) o Azonos nevű fajták összevetése: Korai szagos A és B, Melló bárónő A és B, Nyári esperes A és B, Fehérvári körte A és B, Császár körte A és B. o Fajtakörön belüli fajták összehasonlítása: Császár körte, Köcsög körte típusok. o Azok a fajták, melyek nevében a származási hely, vagy valamilyen más tulajdonság megnevezése közös. Ilyen megnevezések az erdélyi, mezőkövesdi, szűcsi, leányfalusi illetve szegfű. A dendrogram elágazásai a fajták egymáshoz viszonyított rokonságát fejezik ki, az egyes fajták törzstől való eltérő távolsága pedig azt, hogy az adott fajta mennyiben változott meg a közös őshöz viszonyítva, mennyiben különbözik attól. Minél távolabb van egy adott fajta a törzstől, annál több mutáció ment végbe benne így annál kevesebb allélja közös a többi fajtával. A dendrogram alatt található mérce ezt a különbözőséget mutatja. Így pl. megállapítható, hogy méréseink szerint a Nyári körte Dunaföldvár, amely a legtávolabb helyezkedik el a törzstől, alléljainak már csak hozzávetőlegesen 50%-a egyezik meg a közös ős alléljaival. Ugyanígy a többi fajta távolsága is leolvasható. A dendrogram három fő ágból épül fel, mindegyik fő ágban egyaránt megtalálhatók a magyar, a külföldi és a standard fajták is. A BOKU-ról származó standard fajták allélhosszait összevetettük PUSKÁS et al. (2015) adataival, és 1-9 bp különbséget tapasztaltunk. Ez az eltérő gyártótól származó vegyszerek és műszerek használatából adódhat. A későbbiekben ezeket a fajtákat belső standardként használtam, hogy a méréseimben szereplő allélhosszaikat összevessem a már ismert adatokkal. Méréseim hitelesnek mondhatók, mivel a belső standardhoz képest, egyes lókuszok 1-3 bp-os különbségével, azonos eredményeket kaptam. A magyar és az osztrák standard fajták közül két pár azonos fajtanévvel rendelkezett. A Williams Christ és a Vilmos allélösszetétele 1 bp-os különbségekkel azonosnak mutatkozik, közeli rokonságuk a dendrogramon is látható. Különbség a két fajta között, hogy a Vilmos esetében egy lókuszon egyel kevesebb, egy lókuszon pedig egyel több allélt találtam. Utóbbi kiértékelési hiba lehet, mivel utóbbi esetében triploid lenne a Vilmos. A Bosc kobakja és a Bosc Flaschenbirne alléljai is egyezést mutatnak, itt azonban három lókusznál találtam egyel több allélt. A dendrogramon közeli rokonságot mutatnak. A Korai szagos fajta két változata közt szoros rokonságot állapíthatunk meg a dendrogram alapján, alléljaik közt egy alkalommal 1 bp eltérés látható. Valószínűleg azonos fajtáról van szó, az eltérés oka az A változat két lókuszának hiányzó értéke. A Nyári esperes, a Melló bárónő és a Császár körte A és B változatainál is hasonló 1 bp-os eltéréseket tapasztalunk. Az 1 és 2 bp eltérés mérés közbeni csúszás eredménye. Ez az eltérés annyira jelentéktelen, hogy e fajták változatait azonos fajtának tekinthetjük. A Fehárvári körte A és B változata viszont a dendrogram két külön főcsoportjába tartoznak, a B változat három lókuszon is 1 bp-nál nagyobb eltéréseket mutat, és két lókuszon három alléllal rendelkezik. Azért ezek a változatok külön fajtának tekintendők. A Császár körte mind a hat változata a dendrogam ugyanazon fő ágába tartozik. Szoros rokonság állapítható meg a Császár körte a Móri császár és a Szentendrei császár között. Ezektől eltérő mellékágon található a másik két szoros rokonságban lévő fajta, a Totyakos császár és az Őszi császár körte Törökbálint. SZANI (2015) szerint a Császár körte megnevezés régi keletű, az évszázadok során a jó minőségű körte márkajegyévé vált, ilyen módon számos fajtára használt név. A Köcsög körte három fajtája is szoros rokonságot mutat, eltérés köztük csak két lókusz esetében az allélok számában mutatkozott. Az Erdélyi körte II. és az Erdélyi körte III. a dendrogram két külön fő ágában foglalnak helyet, így szoros rokonság nem áll fenn köztük. A Mezőkövesdi 2 és Mezőkövesdi 3 bár ugyanabban a fő ágban található, távolságuk nagyobb, közös alléljaik száma kevesebb, mint a két Erdélyi körte esetében, így rokonságuk 168

6 távolabbi. A szűcsi megnevezésű fajták közül a Szűcsi II., Szűcsi III. és Szűcsi szegfű típus egyazon főágban található, rokonságuk közeli. A Szűcsi IV. és a Szűcsi körte Bore típus a fa egy-egy külön fő ágában található, ezért ezek rokonság sem egymással, sem az első három fajtával nem mondható közelinek. A két leányfalusi fajta nem közeli rokon, mivel két külön főágban helyezkednek el. A szegfű típusú körték közül a Bikácsi nagy szegfű és a Nagy szegfű körte egymás mellett foglal helyet, rokonságuk szoros. A Szűcsi szegfű típus egy másik fő ágban található, ezekkel kevéssé rokon fajta. Szokatlan eredmény, hogy a Hosui fajta nem képez külön csoportot a dendrogramban, annak ellenére, hogy nem a P. communis, hanem a P. pyrifolia fajtája. 169

7 1. ábra A fajták rokonsági viszonyai az SSR fragmentumok súlyozatlan Neighbor -Joining módszer elemzése által. Forrás: Bolla Szentendrei császár Császár körte B Fehérvári körte B Császár körte A Móri császár Alexander Lucas Miniszter Lucius Moon Geon Gute Louise Szucsi szegfu típus Leányfalusi piros Mogyoródi óriás Szucsi II Orient Erdélyi II Totyakos császár Vilmos Fertodi rozsdás Williams Oszi császár körte Törökbálint Szucsi III Selmeci körte II Mezokövesdi 2 Aromata de Bistrica Mária Lujza Nyári esperes B Nyári esperes A Beurré d' Anjou Amanlis vaj Pákozd Mandula vajkörte Mezokövesdi 3 1/7 Ráckeve Köcsög körte VK 3 Csákvári nyári 010 Köcsög körte Köcsög VK 2 Hóka Zsámbéki 214 Kiss Margit Erdélyi III Izambert Bosc kobakja Szucsi körte Bore típus Bosc Flaschenbirne Fehérvári körte A Fehérvári körte 1 Korai szagos B Korai szagos A Árpával éro Téli Kálmán Mosolygós Hertich Bergamottja Szobi legkorábbi Fujtós körte Mézes körte Révész Bálint A Solymári cukor Nagy szegfu körte Hosui Bikácsi nagy szegfu Piroska Nyári zöld kobak Stössel Tábornok Melló báróno B Uta 12a Melló báróno A 395 Zöld Magdolna Oszi körte Leányfalu Oszi pálinka Drouard elnök Marianna hercegno Abbe Fetel Favrené Malinéri Jozefin Packham's Triumph Citrom körte Szucsi IV. Pittmastoni hercegno Miklós Piros nyári körte Bicske Bella di Giugno Macskafej Magyar kobak Nyári király körte Tarjáni körte Pap körte igen botermo Sárospatak Nyári Kálmán Nyári körte Dunaföldvár 170

8 KÖVETKEZTETÉSEK A markeranalízis során tapasztalt ritka és igen ritka allélok nagy száma mutatja, hogy a régi fajták óriási értékkel bírnak a genetikai diverzitás szempontjából. Ezeket a régi fajtákat, mint génforrásokat, fel lehet és fel kell használni a fajtanemesítés során, mivel a fajtahasználat beszűkülése a termesztésben ökológiai katasztrófához vezethet. A pontos eredmények elérése érdekében célszerű lenne a vizsgálat biológiai és technikai megismétlése. Előbbi alatt egy fajta két különböző egyedéről történő mintavételt, utóbbi alatt ugyanazon minta kétszeri bemérését értjük. Javasoljuk a genetikai markerezés eredményeit a fajták pomológiai vizsgálatának eredményeivel összevetni. A fajták fenológiai és morfológiai tulajdonságai az UPOV számkulcsos módszerével értékelhetőek és statisztikai módszerekkel összehasonlíthatók. Az UPOV és SSR eredmények korrelációja is megállapítható. A fajták ploidszintjének pontos meghatározásához flow citometriás vizsgálat elvégzése javasolt. Ugyanehhez a pomológiai leírások is segítségül szolgálnak, mivel a késői érés, a nagy gyümölcs és a léha magvak jelenléte a triploid fajták jellemzői. Irodalom 1. Erfani, J., Ebadi, A., Abdollahi, H., Fatahi, R. (2012): Genetic Diversity of Some Pear Cultivars and Genotypes Using Simple Sequence Repeat (SSR) Markers. Plant Molecular Biology Reporter. 30: Gasi, F., Kurtovic, M., Kalamujic. B., Pojskic, N., Grahic, J., Kaiser, C., Meland, M. (2013): Assessment of European pear (Pyrus communis L.) genetic resources in Bosnia and Herzegovina using microsatellite markers. Scientia Horticulturae. 157: Kimura, T., Shi, Y. Z., Shoda, M., Kotobuki, K., Matsuta, N., Hayashi, T., Ban, Y., Yamamoto, T. (2002): Identification os Asian pear varieties by SSR Analysis. Breeding Science 52: Puskás, M., Höfer, M., Sestraş, R. E., Peil, A., Sestraş, A. F., Hanke M-V., Flachowsky, H. (2015): Molecular and flow cytometric evaluation of pear (Pyrus L.) genetic resources of the German and Romanian national fruit collections. Genet. Resour. Crop Evol. pp Queiroz, A., Assuncao, A., Ramadas, I., Viegas, W., Veloso, M. M. (2015): Molecular characterization of Portuguese pear landraces (Pyrus communis L.) using SSR markers. Scientia Horticulturae 183: Queiroz, A., Assuncao, A., Ramadas, I., Viegas, W., Veloso, M. M. (2015): Molecular characterization of Portuguese pear landraces (Pyrus communis L.) using SSR markers. Scientia Horticulturae 183: Stracieri, J., Magalhaes H. M., Resende, L. V., Carvalho, L. C. C. (2015): Simple sequence repeat (SSR) markers are effective for identifying pear cultivars and selections. African Journal of Biotechnology. 14: Szani, Zs. (2012): Főbb tájfajtáink. in: Nyéki, J., Szabó, T., Soltész, M. (szerk.): Körtefajták vizsgálata génbankokban. Debreceni Egyetem AGTC MÉK Kertészettudományi Intézet, Debrecen. p Yamamoto, T., Kimura, T., Sawamura, Y., Kotobuki, K., Ban, Y., Hayashi, T., Matsuta, N. (2001): SSRs isolated from apple can identify polymorphism and genetic diversity in pear. Theoretical and Applied Genetics. 102:

KÁRPÁT-MEDENCEI ALMAFAJTÁK JELLEMZÉSE POMOLÓGIAI VIZSGÁLATOKKAL ÉS MIKROSZATELLIT ALAPÚ MOLEKULÁRIS MARKEREZÉSSEL. Király Ildikó

KÁRPÁT-MEDENCEI ALMAFAJTÁK JELLEMZÉSE POMOLÓGIAI VIZSGÁLATOKKAL ÉS MIKROSZATELLIT ALAPÚ MOLEKULÁRIS MARKEREZÉSSEL. Király Ildikó Doktori (PhD) értekezés tézisei KÁRPÁT-MEDENCEI ALMAFAJTÁK JELLEMZÉSE POMOLÓGIAI VIZSGÁLATOKKAL ÉS MIKROSZATELLIT ALAPÚ MOLEKULÁRIS MARKEREZÉSSEL Király Ildikó Témavezető: Dr. Tóth Magdolna, DSc egyetemi

Részletesebben

A SZIE, MKK GENETIKA ÉS BIOTECHNOLÓGIAI INTÉZETÉNEK EREDMÉNYEI A NÖVÉNYNEMESÍTÉS TUDOMÁNYOKBAN ÉS A NEMESÍTÉS UTÁNPÓTLÁS NEVELÉSBEN

A SZIE, MKK GENETIKA ÉS BIOTECHNOLÓGIAI INTÉZETÉNEK EREDMÉNYEI A NÖVÉNYNEMESÍTÉS TUDOMÁNYOKBAN ÉS A NEMESÍTÉS UTÁNPÓTLÁS NEVELÉSBEN A SZIE, MKK GENETIKA ÉS BIOTECHNOLÓGIAI INTÉZETÉNEK EREDMÉNYEI A NÖVÉNYNEMESÍTÉS TUDOMÁNYOKBAN ÉS A NEMESÍTÉS UTÁNPÓTLÁS NEVELÉSBEN Heszky László és Kiss Erzsébet Keszthely 2013 PARADIGMAVÁLTÁS AZ ÉLETTUDOMÁNYOKBAN

Részletesebben

Nagy Emese: Polimorfizmus és rokonsági körök vizsgálata kukoricában (Zea mays) Témavezetők: Cs. L. Marton G Gyulai

Nagy Emese: Polimorfizmus és rokonsági körök vizsgálata kukoricában (Zea mays) Témavezetők: Cs. L. Marton G Gyulai Nagy Emese: Polimorfizmus és rokonsági körök vizsgálata kukoricában (Zea mays) Témavezetők: Cs. L. Marton G Gyulai BEVEZETÉS A molekuláris biológiai és genetikai módszerek gyors fejlődése egyre inkább

Részletesebben

MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN

MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN Molnár Tamás 1, Lanszki József 1, Magyary István 1, Jeney Zsigmond 2, Lehoczky István 2 1 Kaposvári Egyetem Állattudományi Kar,

Részletesebben

ÁLLATTENYÉSZTÉSI TUDOMÁNYOK DOKTORI ISKOLA Doktori Iskola vezető: Dr. Bánszki Tamás, MTA doktora. Témavezetők: mezőgazdaság-tudomány kandidátusa

ÁLLATTENYÉSZTÉSI TUDOMÁNYOK DOKTORI ISKOLA Doktori Iskola vezető: Dr. Bánszki Tamás, MTA doktora. Témavezetők: mezőgazdaság-tudomány kandidátusa DEBRECENI EGYETEM AGRÁRTUDOMÁNYI CENTRUM MEZŐGAZDASÁGTUDOMÁNYI KAR ÁLLATTENYÉSZTÉS- ÉS TAKARMÁNYOZÁSTANI TANSZÉK ÁLLATTENYÉSZTÉSI TUDOMÁNYOK DOKTORI ISKOLA Doktori Iskola vezető: Dr. Bánszki Tamás, MTA

Részletesebben

2011. január április 10. IPK Gatersleben (Németország) május 17. Kruppa Klaudia

2011. január április 10. IPK Gatersleben (Németország) május 17. Kruppa Klaudia 2011. január 10. 2011. április 10. IPK Gatersleben (Németország) Gatersleben (G-life) Country State District Town Administration Germany Saxony-Anhalt Salzlandkreis Seeland Basic statistics Area 16.00

Részletesebben

BEVEZETÉS CÉLKITŰZÉS

BEVEZETÉS CÉLKITŰZÉS BEVEZETÉS A molekuláris biológiai és genetikai módszerek gyors fejlődése egyre inkább tért hódít a növénynemesítés különböző területein, így a kukoricanemesítésben is. A növényi fenotípusos jellemzők és

Részletesebben

Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 468 EGYEDAZONOSÍTÁS ÉS SZÁRMAZÁSELLENİRZÉS HIPERPOLIMORF MIKROSZATELLITA

Részletesebben

Intézmény neve Székhely Génmegőrzési téma

Intézmény neve Székhely Génmegőrzési téma Intézmény neve Székhely Génmegőrzési téma Ceglédi Gyümölcstermesztési Kutató-Fejlesztő Vírusmentes gyümölcs törzsültetvények a Fás gyümölcs géngyűjteményi tételek megőrzése Intézet Kht. Cegléd (kajszi,

Részletesebben

ALMAFAJTÁK MOLEKULÁRIS ELKÜLÖNÍTÉSE ÉS

ALMAFAJTÁK MOLEKULÁRIS ELKÜLÖNÍTÉSE ÉS Szent István Egyetem Gödöllő Növénytudományi Doktori Iskola Doktori Iskola vezetője: Dr. Heszky László Növénynemesítés genetikai és biotechnológiai módszerekkel Programvezető: Dr. Heszky László DOKTORI

Részletesebben

PANNON EGYETEM GEORGIKON KAR, KESZTHELY. Növénytermesztési és Kertészeti Tudományok Doktori Iskola. Iskolavezető: Dr. Kocsis László egyetemi tanár

PANNON EGYETEM GEORGIKON KAR, KESZTHELY. Növénytermesztési és Kertészeti Tudományok Doktori Iskola. Iskolavezető: Dr. Kocsis László egyetemi tanár PANNON EGYETEM GEORGIKON KAR, KESZTHELY Növénytermesztési és Kertészeti Tudományok Doktori Iskola Iskolavezető: Dr. Kocsis László egyetemi tanár Témavezető: Dr. KOCSIS LÁSZLÓ egyetemi tanár Dr. KOZMA PÁL

Részletesebben

NYÁR GENOTÍPUSOK AZONOSÍTÁSA DNS UJJLENYOMATUK ALAPJÁN

NYÁR GENOTÍPUSOK AZONOSÍTÁSA DNS UJJLENYOMATUK ALAPJÁN 1. évfolyam 1. szám 2 011 107 114 oldal NYÁR GENOTÍPUSOK AZONOSÍTÁSA DNS UJJLENYOMATUK ALAPJÁN Cseke Klára, Benke Attila és Borovics Attila Erdészeti Tudományos Intézet Kivonat Kutatásunk célja a nyár

Részletesebben

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2.

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2. BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február 1. Az IPK bemutatása 2. A TILLING módszer Hol található az IPK? Gatersleben Általános adatok az IPK-ról Leibniz

Részletesebben

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Szántó-Egész Réka 1, Mohr Anita 1, Sipos Rita 1, Dallmann Klára 1, Ujhelyi Gabriella 2, Koppányné Szabó Erika

Részletesebben

KÁRPÁT-MEDENCEI ALMAFAJTÁK JELLEMZÉSE POMOLÓGIAI VIZSGÁLATOKKAL ÉS MIKROSZATELLIT ALAPÚ MOLEKULÁRIS MARKEREZÉSSEL. Király Ildikó

KÁRPÁT-MEDENCEI ALMAFAJTÁK JELLEMZÉSE POMOLÓGIAI VIZSGÁLATOKKAL ÉS MIKROSZATELLIT ALAPÚ MOLEKULÁRIS MARKEREZÉSSEL. Király Ildikó Doktori (PhD) értekezés KÁRPÁT-MEDENCEI ALMAFAJTÁK JELLEMZÉSE POMOLÓGIAI VIZSGÁLATOKKAL ÉS MIKROSZATELLIT ALAPÚ MOLEKULÁRIS MARKEREZÉSSEL Király Ildikó Témavezető: Dr. Tóth Magdolna, DSc egyetemi tanár

Részletesebben

Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon

Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon Rövid tanulmányút 2011. 01.03-03. 30., John Inn Centre, Dept. of Crop Genetics, Norwich Research Park, Norwich NR4 7UH, UK Supervisor:

Részletesebben

Többgénes jellegek. 1. Klasszikus (poligénes) mennyiségi jellegek. 2.Szinte minden jelleg több gén irányítása alatt áll

Többgénes jellegek. 1. Klasszikus (poligénes) mennyiségi jellegek. 2.Szinte minden jelleg több gén irányítása alatt áll Többgénes jellegek Többgénes jellegek 1. 1. Klasszikus (poligénes) mennyiségi jellegek Multifaktoriális jellegek: több gén és a környezet által meghatározott jellegek 2.Szinte minden jelleg több gén irányítása

Részletesebben

Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL

Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL Doktori (Ph.D) értekezés tézisei Bodzsár Nóra Gödöllő 2012 A

Részletesebben

A PE AC SzBKI, Badacsony 2009. évi szakmai és pénzügyi beszámolója

A PE AC SzBKI, Badacsony 2009. évi szakmai és pénzügyi beszámolója A PE AC SzBKI, Badacsony 2009. évi szakmai és pénzügyi beszámolója 1. Szervezeti keretek: Az átszervezésekkel teli korábbi évek után a 2009-es évünk, szervezeti szempontból a stabilitás évének nevezhető.

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

A Genetikai polimorfizmus és földrajzi variabilitás kárpát-medencei endemikus lepke taxonok populációiban c. OTKA pályázat (T ) zárójelentése

A Genetikai polimorfizmus és földrajzi variabilitás kárpát-medencei endemikus lepke taxonok populációiban c. OTKA pályázat (T ) zárójelentése A Genetikai polimorfizmus és földrajzi variabilitás kárpát-medencei endemikus lepke taxonok populációiban c. OTKA pályázat (T 046612) zárójelentése A pályázat célkitűzése az antropogén hatások eredményeként

Részletesebben

III. ATK Tudományos Nap

III. ATK Tudományos Nap Magyar Tudományos Akadémia Agrártudományi Kutatóközpont III. ATK Tudományos Nap Összefoglalók Szerkesztette JANDA TIBOR 2014. november 13. Martonvásár Kiadja a Magyar Tudományos Akadémia Agrártudományi

Részletesebben

Néhány horvátországi pontyfajta genetikai jellemzése és visszatelepítése eredeti tógazdaságaikba. Kivonat. Bevezető

Néhány horvátországi pontyfajta genetikai jellemzése és visszatelepítése eredeti tógazdaságaikba. Kivonat. Bevezető Halászatfejlesztés 32 Fisheries & Aquaculture Development (2009) 32:79-85 ISBN 978-963-7120-30-5 HAKI 2009 Néhány horvátországi pontyfajta genetikai jellemzése és visszatelepítése eredeti tógazdaságaikba

Részletesebben

A Növényi Diverzitás Központ tevékenységei

A Növényi Diverzitás Központ tevékenységei A Növényi Diverzitás Központ tevékenységei Ponicsánné Gyovai Ágnes Kollár Zsuzsanna, Simon Attila, Baktay Borbála Növényi Diverzitás Központ Tápiószele A NöDiK főbb tevékenységei Génforrások felkutatása,

Részletesebben

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor,

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, 1 A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, (Debreceni Egyetem Állattenyésztéstani Tanszék) A bármilyen

Részletesebben

Doktori értekezés tézisei

Doktori értekezés tézisei Budapesti Corvinus Egyetem CSERESZNYEFAJTÁK TERMÉKENYÜLÉSI SAJÁTOSSÁGAINAK VIZSGÁLATA HAGYOMÁNYOS ÉS MOLEKULÁRIS MÓDSZEREKKEL Doktori értekezés tézisei Békefi Zsuzsanna Budapest, 2005. 1 1. A MUNKA ELŐZMÉNYEI,

Részletesebben

Oktatói önéletrajz Dr. Pedryc Andrzej Piotr

Oktatói önéletrajz Dr. Pedryc Andrzej Piotr egyetemi tanár Kertészettudományi Kar Genetika és Növénynemesítés Tanszék Karrier Felsőfokú végzettségek: 1975-1980 Kertészeti Egyetem, Termesztési Kar, Budapest, Okleveles kertészmérnök Tudományos fokozatok,

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

T sz. OTKA-projekthez kapcsolódó nemzetközi kiegészítő támogatás ZÁRÓJELENTÉSE. és genetikai változékonysága

T sz. OTKA-projekthez kapcsolódó nemzetközi kiegészítő támogatás ZÁRÓJELENTÉSE. és genetikai változékonysága T046841. sz. OTKA-projekthez kapcsolódó nemzetközi kiegészítő támogatás ZÁRÓJELENTÉSE Nemzetközi projekt címe: Nemzetközi projekt : Időtartam: OTKA támogatás: Résztvevő kutatók: A parlagfű (Ambrosia artemisiifolia)

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben

Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben Duleba Mónika Környezettudományi Doktori Iskola I.

Részletesebben

Szent István Egyetem. Az ivarérés idejét maghatározó QTL-ek genetikai térképezése tyúkban. Szabó Gyula Doktori értekezés

Szent István Egyetem. Az ivarérés idejét maghatározó QTL-ek genetikai térképezése tyúkban. Szabó Gyula Doktori értekezés Szent István Egyetem Az ivarérés idejét maghatározó QTL-ek genetikai térképezése tyúkban Szabó Gyula Doktori értekezés Gödöllő 2004 A doktori iskola Neve: Állattenyésztés-tudományi Doktori Iskola Tudományága:

Részletesebben

Populációgenetikai. alapok

Populációgenetikai. alapok Populációgenetikai alapok Populáció = egyedek egy adott csoportja Az egyedek eltérnek egymástól morfológiailag, de viselkedésüket tekintve is = genetikai különbségek Fenotípus = külső jellegek morfológia,

Részletesebben

DOKTORI (Ph.D.) ÉRTEKEZÉS TÉZISEI VESZPRÉMI EGYETEM GEORGIKON MEZGAZDASÁGTUDOMÁNYI KAR KESZTHELY

DOKTORI (Ph.D.) ÉRTEKEZÉS TÉZISEI VESZPRÉMI EGYETEM GEORGIKON MEZGAZDASÁGTUDOMÁNYI KAR KESZTHELY DOKTORI (Ph.D.) ÉRTEKEZÉS TÉZISEI VESZPRÉMI EGYETEM GEORGIKON MEZGAZDASÁGTUDOMÁNYI KAR KESZTHELY NÖVÉNYTERMESZTÉSI ÉS KERTÉSZETI TUDOMÁNYOK DOKTORI ISKOLA ALTERNARIA FAJOK ÖSSZEHASONLÍTÓ ELEMZÉSE KÉSZÍTETTE:

Részletesebben

Hazai méhészeti genomikai és genetikai vizsgálatok

Hazai méhészeti genomikai és genetikai vizsgálatok AKÁCKÖRÚTON Hazai méhészeti genomikai és genetikai vizsgálatok Előző cikkünkben arról írtunk, milyen új eszköztárral rendelkezünk a XXI. században a genetikai vizsgálatok területén, és mit adhat a molekuláris

Részletesebben

Ökológiai igény. Növekedési sajátosságok. Birs fajtakutatás. Táplálkozásbiológiai érték Konstantinápolyi

Ökológiai igény. Növekedési sajátosságok. Birs fajtakutatás. Táplálkozásbiológiai érték Konstantinápolyi Birsfajták megfigyelése génbankokban Összeállította: Dr. Szabó Tibor Tápiószele 2014. 10. 21. Ökológiai igény Elő- és Közép-Ázsiából származik Meleg- és fényigényes gyümölcsfaj Téli lehűlésektől (-20 -

Részletesebben

A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish.

A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish. OTKA K67808 zárójelentés 2012. A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish. A fluoreszcens in situ hibridizáció (FISH) olyan technikai fejlettséget ért

Részletesebben

Baktay Borbála, igazgató

Baktay Borbála, igazgató Baktay Borbála, igazgató Tápiószele, 2014. november 27. Pannon Magbank Life+ program záró rendezvénye 1920-as évek: Nicolai Vavilov, 1940-es évektől hűtött magtárolás, ENSZ konferencia az emberi környezetről,

Részletesebben

Sebes pisztráng ivadékok Myxobolus cerebralis (Myxozoa) okozta kergekórra való fogékonysága a tenyészállomány genetikai diverzitásának függvényében

Sebes pisztráng ivadékok Myxobolus cerebralis (Myxozoa) okozta kergekórra való fogékonysága a tenyészállomány genetikai diverzitásának függvényében Sebes pisztráng ivadékok Myxobolus cerebralis (Myxozoa) okozta kergekórra való fogékonysága a tenyészállomány genetikai diverzitásának függvényében Eszterbauer Edit, Forró Barbara, Tolnai Zoltán, Guti

Részletesebben

Országos kompetenciamérés eredményeinek kiértékelése 6. és 8. évfolyamokon 2012

Országos kompetenciamérés eredményeinek kiértékelése 6. és 8. évfolyamokon 2012 Országos kompetenciamérés eredményeinek kiértékelése 6. és 8. évfolyamokon 2012 A hatodik osztályban 12 tanulóból 11 írta meg az országos kompetenciamérést. Ebből 1 fő SNI-s, 3 fő BTMN-es tanuló. Mentesítést

Részletesebben

Régi gyümölcsfajták szerepe a biodiverzitás fenntartásában

Régi gyümölcsfajták szerepe a biodiverzitás fenntartásában 2015.10.09. Régi gyümölcsfajták szerepe a biodiverzitás fenntartásában Összeállította: Dr. Szabó Tibor Tájfajták kialakulása Kultúrnövényeink nem Európai eredetűek A legtöbb fajtőshonosnak kell mondanunk

Részletesebben

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013 Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz

Részletesebben

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan fehérjét (FC-1 killer toxint) választ ki a tápközegbe, amely elpusztítja az opportunista patogén Cryptococcus neoformans-t.

Részletesebben

DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer

Részletesebben

Scan 1200 teljesítmény-értékelés evaluation 1/5

Scan 1200 teljesítmény-értékelés evaluation 1/5 evaluation 1/5 interscience Feladat Összefoglalónk célja a Scan 1200 teljesítmény-értékelése manuális és automata telepszámlálások összehasonlításával. Az összehasonlító kísérleteket Petri-csészés leoltást

Részletesebben

Természetvédelmi biológia

Természetvédelmi biológia Természetvédelmi biológia 1. A természetvédelmi biológia meghatározása, a biológiai sokféleség értelmezése A természetvédelmi biológia (konzervációbiológia) fı céljai 1. Az emberi tevékenység fajok populációra,

Részletesebben

Mezőgazdasági biotechnológus MSc szak. dr. Kiss Erzsébet. SZIE Mezőgazdaság- és Környezettudományi Kar Genetika és Biotechnológiai Intézet

Mezőgazdasági biotechnológus MSc szak. dr. Kiss Erzsébet. SZIE Mezőgazdaság- és Környezettudományi Kar Genetika és Biotechnológiai Intézet Mezőgazdasági biotechnológus MSc szak dr. Kiss Erzsébet SZIE Mezőgazdaság- és Környezettudományi Kar Genetika és Biotechnológiai Intézet Mezőgazdasági biotechnológus MSc szak Szakvezető Dr. Kiss Erzsébet

Részletesebben

Doktori tézisek. Sedlák Éva. Semmelweis Egyetem Gyógyszertudományok Doktori Iskola

Doktori tézisek. Sedlák Éva. Semmelweis Egyetem Gyógyszertudományok Doktori Iskola A lignánok elválasztása, azonosítása és mennyiségi meghatározása natív növényi mintákban és a lignántermelés fokozása Forsythia in vitro sejttenyészetben Doktori tézisek Sedlák Éva Semmelweis Egyetem Gyógyszertudományok

Részletesebben

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel Gyakorlat helye: BIOMI Kft. Gödöllő, Szent-Györgyi A. u. 4. (Nemzeti Agrárkutatási és Innovációs Központ épülete volt

Részletesebben

A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése. Kiss Erzsébet Kovács László

A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése. Kiss Erzsébet Kovács László A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése Kiss Erzsébet Kovács László Bevezetés Nagy gazdasági gi jelentıségük k miatt a gyümölcs lcsök, termések fejlıdésének mechanizmusát

Részletesebben

A VÁGÁSI KOR, A VÁGÁSI SÚLY ÉS A ROSTÉLYOS KERESZTMETSZET ALAKULÁSA FEHÉR KÉK BELGA ÉS CHAROLAIS KERESZTEZETT HÍZÓBIKÁK ESETÉBEN

A VÁGÁSI KOR, A VÁGÁSI SÚLY ÉS A ROSTÉLYOS KERESZTMETSZET ALAKULÁSA FEHÉR KÉK BELGA ÉS CHAROLAIS KERESZTEZETT HÍZÓBIKÁK ESETÉBEN A vágási kor, a vágási súly és a rostélyos keresztmetszet alakulása fehér kék belga és charolais keresztezett hízóbikák esetében 1 () A VÁGÁSI KOR, A VÁGÁSI SÚLY ÉS A ROSTÉLYOS KERESZTMETSZET ALAKULÁSA

Részletesebben

A Kárpát-medencében régóta termesztett gyümölcsfajták szerepe napjainkban

A Kárpát-medencében régóta termesztett gyümölcsfajták szerepe napjainkban A Kárpát-medence A Kárpát-medencében régóta termesztett gyümölcsfajták szerepe napjainkban Összeállította: Dr. Szabó Tibor Tápiószele, 2015. 10. 20. Európa legrégibb kultúrája növénytermesztés 8 000 év

Részletesebben

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6 Agilent 2100 Bioanalyzer mikrokapilláris gélelektroforézis rendszer G2943CA 2100 Bioanalyzer system forgalmazó: Kromat Kft. 1112 Budapest Péterhegyi u. 98. t:36 (1) 248-2110 www.kromat.hu bio@kromat.hu

Részletesebben

MIKROSZKÓPIKUS GOMBÁK MIKOTOXIN-BONTÓ KÉPESSÉGÉNEK. Péteri Adrienn Zsanett DOKTORI ÉRTEKEZÉS TÉZISEI

MIKROSZKÓPIKUS GOMBÁK MIKOTOXIN-BONTÓ KÉPESSÉGÉNEK. Péteri Adrienn Zsanett DOKTORI ÉRTEKEZÉS TÉZISEI DOKTORI ÉRTEKEZÉS TÉZISEI MIKROSZKÓPIKUS GOMBÁK MIKOTOXIN-BONTÓ KÉPESSÉGÉNEK VIZSGÁLATA Péteri Adrienn Zsanett Témavezetők: Dr. Varga János, Egyetemi docens Dr. Vágvölgyi Csaba, Tanszékvezető egyetemi

Részletesebben

Zárójelentés. Állati rotavírusok összehasonlító genomvizsgálata. c. OTKA kutatási programról. Bányai Krisztián (MTA ATK ÁOTI)

Zárójelentés. Állati rotavírusok összehasonlító genomvizsgálata. c. OTKA kutatási programról. Bányai Krisztián (MTA ATK ÁOTI) Zárójelentés Állati rotavírusok összehasonlító genomvizsgálata c. OTKA kutatási programról Bányai Krisztián (MTA ATK ÁOTI) 2012 1 Az Állati rotavírusok összehasonlító genomvizsgálata c. programban azt

Részletesebben

SZAKMAI ZÁRÓJELENTÉS

SZAKMAI ZÁRÓJELENTÉS SZAKMAI ZÁRÓJELENTÉS a Solanum stoloniferum alapú PVY immunitás gén (Rysto) molekuláris genetikai vizsgálata című tematikus OTKA pályázatról Nyilvántartási szám: TO37827 Keszthely 2002-2005. Zárójelentés

Részletesebben

1975-1980 Kertészeti Egyetem, Termesztési Kar, Budapest, Okleveles kertészmérnök

1975-1980 Kertészeti Egyetem, Termesztési Kar, Budapest, Okleveles kertészmérnök Dr. Pedryc Andrzej Piotr egyetemi tanár Kertészettudományi Kar Genetika és Növénynemesítés Tanszék Karrier Felsőfokú végzettségek: 1975-1980 Kertészeti Egyetem, Termesztési Kar, Budapest, Okleveles kertészmérnök

Részletesebben

A PE AC SzBKI, Badacsony évben megjelentett, előadott publikációinak listája

A PE AC SzBKI, Badacsony évben megjelentett, előadott publikációinak listája A PE AC SzBKI, Badacsony 2009. évben megjelentett, előadott publikációinak listája 1.) JAHNKE G. - MÁJER J., LAKATOS A. - GYÖRFFYNÉ MOLNÁR J. - DEÁK E., - STEFANOVITSNÉ BÁNYAI É. - VARGA P. (2009): Isoenzyme

Részletesebben

A fontosabb kukorica hibridek minőségi tulajdonságainakai akulása földrajzi tájanként

A fontosabb kukorica hibridek minőségi tulajdonságainakai akulása földrajzi tájanként Földrajzi Értesítő XXXIX. évf. 1990.1-4. füzet, pp. 196 205. A fontosabb kukorica hibridek minőségi tulajdonságainakai akulása földrajzi tájanként PROKSZÁNÉ PAPLÓGÓ ZSUZSANNA SZÁNIEL IMRE Napjainkban a

Részletesebben

A PE AC SzBKI, Badacsony 2008. évi szakmai és pénzügyi beszámolója

A PE AC SzBKI, Badacsony 2008. évi szakmai és pénzügyi beszámolója A PE AC SzBKI, Badacsony 2008. évi szakmai és pénzügyi beszámolója 1. Szervezeti kérdések: Intézetünk 2008. március 15-ig FVM fenntartású, önállóan gazdálkodó, teljes jogkörű költségvetési intézményként

Részletesebben

Téma 2: Genetikai alapelvek, a monogénes öröklődés -hez szakirodalom: (Plomin: Viselekedésgenetika 2. fejezet) *

Téma 2: Genetikai alapelvek, a monogénes öröklődés -hez szakirodalom: (Plomin: Viselekedésgenetika 2. fejezet) * Téma 2: Genetikai alapelvek, a monogénes öröklődés -hez szakirodalom: (Plomin: Viselekedésgenetika 2. fejezet) * A mendeli öröklődés törvényei A Huntington-kór (HD) kezdetét személyiségbeli változások,

Részletesebben

A doktori értekezés tézisei. A növényi NRP fehérjék lehetséges szerepe a hiszton defoszforiláció szabályozásában, és a hőstressz válaszban.

A doktori értekezés tézisei. A növényi NRP fehérjék lehetséges szerepe a hiszton defoszforiláció szabályozásában, és a hőstressz válaszban. A doktori értekezés tézisei A növényi NRP fehérjék lehetséges szerepe a hiszton defoszforiláció szabályozásában, és a hőstressz válaszban. Bíró Judit Témavezető: Dr. Fehér Attila Magyar Tudományos Akadémia

Részletesebben

DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN

DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN DOKTORI (PhD) ÉRTEKEZÉS TÉZISEI PANNON EGYETEM GEORGIKON MEZŐGAZDASÁGTUDOMÁNYI KAR Állattudományi és Állattenyésztéstani Tanszék Tanszékvezető Dr. Husvéth Ferenc egyetemi tanár, az MTA doktora Készült

Részletesebben

Bokor faiskola évi őszi ajánlata

Bokor faiskola évi őszi ajánlata Bokor faiskola 2017. évi őszi ajánlata http://www.bokorfaiskola.hu (Készült: 2017.12.23 08:30:26) ELŐZETES RENDELÉSEKET FOLYAMATOSAN FELVESZÜNK! ---- GYÜMÖLCSFÁK --- 1 köteg 10 darab fát tartalmaz. ALMA

Részletesebben

Készítette: Pintér Zsuzsanna (Biológia környezettan V.)

Készítette: Pintér Zsuzsanna (Biológia környezettan V.) A hazai földalatti gombák elterjedésének természetvédelmi megítélése és a Gautieria nemzetséghez tartozó néhány faj ITS régiójának szekvenciaanalízise faj ITS régiójának szakdolgozat Készítette: Pintér

Részletesebben

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár

Részletesebben

cím: emailcím, telefonszám:

cím: emailcím, telefonszám: nettó egységár (Ft) készlet db 11.11.-én megrendelt db visszaigazolt db érték Ft megrendelő neve : cím: emailcím, telefonszám: NAIK Gyümölcstermesztési Kutatóintézet Érdi Állomás 2014 őszi oltvány nagykereskedelmi

Részletesebben

Fiatal kutatói beszámoló

Fiatal kutatói beszámoló Talajbiológiai- és biokémiai osztály Fiatal kutatói beszámoló Gazdag Orsolya tudományos segédmunkatárs Témavezető: Dr. Ködöböcz László 2013.12.03. Témacím: Különböző gazdálkodási módok hatása a talaj baktérium-közösségeinek

Részletesebben

A Leuce szekcióba tartozó hazai nyárak dunántúli természetes eredetű állományainak populációgenetikai vizsgálata

A Leuce szekcióba tartozó hazai nyárak dunántúli természetes eredetű állományainak populációgenetikai vizsgálata Nyugat-magyarországi Egyetem Erdőmérnöki Kar Doktori (PhD) értekezés tézisei A Leuce szekcióba tartozó hazai nyárak dunántúli természetes eredetű állományainak populációgenetikai vizsgálata Benke Attila

Részletesebben

Fogyatékossággal élő emberek életminősége és ellátási költségei különböző lakhatási formákban

Fogyatékossággal élő emberek életminősége és ellátási költségei különböző lakhatási formákban Fogyatékossággal élő emberek életminősége és ellátási költségei különböző lakhatási formákban Zárótanulmány a VP/2013/013/0057 azonosítószámú New dimension in social protection towards community based

Részletesebben

A genetikai lelet értelmezése monogénes betegségekben

A genetikai lelet értelmezése monogénes betegségekben A genetikai lelet értelmezése monogénes betegségekben Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika A ~20 ezer fehérje-kódoló gén a 23 pár kromoszómán A kromoszómán található bázisok száma: 250M

Részletesebben

1) MÁJER J. LAKATOS A. GYÖRRFYNÉ JAHNKE G: (2007): A Furmint fajta helyzete Magyarországon. Borászati Füzetek 2007/2, Kutatási rovat 1-4. p.

1) MÁJER J. LAKATOS A. GYÖRRFYNÉ JAHNKE G: (2007): A Furmint fajta helyzete Magyarországon. Borászati Füzetek 2007/2, Kutatási rovat 1-4. p. Publikációs és oktatási tevékenységünk: Lektorált folyóiratban megjelent publikációk: 1) MÁJER J. LAKATOS A. GYÖRRFYNÉ JAHNKE G: (2007): A Furmint fajta helyzete Magyarországon. Borászati Füzetek 2007/2,

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

A nappali tagozatra felvett gépészmérnök és műszaki menedzser hallgatók informatikai ismeretének elemzése a Budapesti Műszaki Főiskolán

A nappali tagozatra felvett gépészmérnök és műszaki menedzser hallgatók informatikai ismeretének elemzése a Budapesti Műszaki Főiskolán A nappali tagozatra felvett gépészmérnök és műszaki menedzser hallgatók informatikai ismeretének elemzése a Budapesti Műszaki Főiskolán Kiss Gábor BMF, Mechatronikai és Autótechnikai Intézet kiss.gabor@bgk.bmf.hu

Részletesebben

Őszi búzafajták magas hozamának megőrzése környezeti stressz hatása alatt

Őszi búzafajták magas hozamának megőrzése környezeti stressz hatása alatt Őszi búzafajták magas hozamának megőrzése környezeti stressz hatása alatt CORNET_6_08_WHEATSTR OM-00887/2009 Beszámolási időszak: 2009. október 1-2010. szeptember 30. Támogatott szervezet: Projectvezető:

Részletesebben

A Hardy Weinberg-modell gyakorlati alkalmazása

A Hardy Weinberg-modell gyakorlati alkalmazása 1 of 6 5/16/2009 2:59 PM A Hardy Weinberg-modell gyakorlati alkalmazása A genotípus-gyakoriság megoszlásának vizsgálata 1. ábra. A Hardy Weinberg-egyensúlyi genotípus-gyakoriságok az allélgyakoriság Számos

Részletesebben

2. Fotometriás mérések II.

2. Fotometriás mérések II. 2. Fotometriás mérések II. 2008 október 31. 1. Ammónia-nitrogén mérése alacsony mérési tartományban és szabad ammónia becslése 1.1. Háttér A módszer alkalmas kis ammónia-nitrogén koncentrációk meghatározására;

Részletesebben

Szakmai zárójelentés A kutyaszemélyiség mint az emberi személyiségvizsgálatok modellje: etológiai, pszichológiai és genetikai megközelítés

Szakmai zárójelentés A kutyaszemélyiség mint az emberi személyiségvizsgálatok modellje: etológiai, pszichológiai és genetikai megközelítés Szakmai zárójelentés A kutyaszemélyiség mint az emberi személyiségvizsgálatok modellje: etológiai, pszichológiai és genetikai megközelítés Bevezetés Korábbi támogatott pályázatok etológiai kutatatásai

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

Rugalmas állandók mérése

Rugalmas állandók mérése KLASSZIKUS FIZIKA LABORATÓRIUM 2. MÉRÉS Rugalmas állandók mérése Mérést végezte: Enyingi Vera Atala ENVSAAT.ELTE Mérés időpontja: 2011. november 16. Szerda délelőtti csoport 1. A mérés rövid leírása Mérésem

Részletesebben

Adatok statisztikai értékelésének főbb lehetőségei

Adatok statisztikai értékelésének főbb lehetőségei Adatok statisztikai értékelésének főbb lehetőségei 1. a. Egy- vagy kétváltozós eset b. Többváltozós eset 2. a. Becslési problémák, hipotézis vizsgálat b. Mintázatelemzés 3. Szint: a. Egyedi b. Populáció

Részletesebben

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Dr. Nagy Bálint az MTA doktora fokozat megszerzéséhez a fenti címen nyújtott be a

Részletesebben

A évi országos kompetenciamérés iskolai eredményeinek elemzése

A évi országos kompetenciamérés iskolai eredményeinek elemzése A 2015. évi országos kompetenciamérés iskolai eredményeinek elemzése Matematika 6. osztály A szignifikánsan jobban, hasonlóan, illetve gyengébben teljesítő telephelyek száma és aránya (%) A tanulók képességeloszlása

Részletesebben

y ij = µ + α i + e ij

y ij = µ + α i + e ij Elmélet STATISZTIKA 3. Előadás Variancia-analízis Lineáris modellek A magyarázat a függő változó teljes heterogenitásának két részre bontását jelenti. A teljes heterogenitás egyik része az, amelynek okai

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

A 2014.évi országos kompetenciamérés értékelése Kecskeméti Bolyai János Gimnázium

A 2014.évi országos kompetenciamérés értékelése Kecskeméti Bolyai János Gimnázium A 2014.évi országos kompetenciamérés értékelése Kecskeméti Bolyai János Gimnázium Iskolánkban a 10 évfolyamban mérik a szövegértés és a matematikai logika kompetenciákat. Minden évben azonos korosztályt

Részletesebben

Régi gyümölcsfajták szerepe a biodiverzitás fenntartásában

Régi gyümölcsfajták szerepe a biodiverzitás fenntartásában Régi gyümölcsfajták szerepe a biodiverzitás fenntartásában Összeállította: Dr. Szabó Tibor Biodiverzitás Az élőlények sokféleségét jelenti Agrobiodiverzitás alatt a termesztett növények sokféleségét értjük

Részletesebben

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai Kar: TTK Tantárgy: CITOGENETIKA Kód: AOMBCGE3 ECTS Kredit: 3 A tantárgyat oktató intézet: TTK Mikrobiális Biotechnológiai és Sejtbiológiai Tanszék A tantárgy felvételére ajánlott félév: 3. Melyik félévben

Részletesebben

Árendás Tamás MTA ATK Mezőgazdasági Intézet, Martonvásár

Árendás Tamás MTA ATK Mezőgazdasági Intézet, Martonvásár Kukorica hibridek alkalmazkodóképességének jellemzése termésstabilitás vizsgálatokkal a Magyar Kukorica Klub TOP20 kísérleteinek 2015. évi eredményei alapján Árendás Tamás MTA ATK Mezőgazdasági Intézet,

Részletesebben

A SZENT ISTVÁN EGYETEM NÖVÉNYGENETIKAI ÉS -NEMESÍTÉSI TUDOMÁNYOS ISKOLA EREDMÉNYEI ( ) HESZKY LÁSZLÓ ÉS KISS ERZSÉBET

A SZENT ISTVÁN EGYETEM NÖVÉNYGENETIKAI ÉS -NEMESÍTÉSI TUDOMÁNYOS ISKOLA EREDMÉNYEI ( ) HESZKY LÁSZLÓ ÉS KISS ERZSÉBET A SZENT ISTVÁN EGYETEM NÖVÉNYGENETIKAI ÉS -NEMESÍTÉSI TUDOMÁNYOS ISKOLA EREDMÉNYEI (1993-2018) HESZKY LÁSZLÓ ÉS KISS ERZSÉBET Szent István Egyetem, Genetikai, Mikrobiológiai és Biotechnológiai Intézet,

Részletesebben

Az állományon belüli és kívüli hőmérséklet különbség alakulása a nappali órákban a koronatér fölötti térben május és október közötti időszak során

Az állományon belüli és kívüli hőmérséklet különbség alakulása a nappali órákban a koronatér fölötti térben május és október közötti időszak során Eredmények Részletes jelentésünkben a 2005-ös év adatait dolgoztuk fel. Természetesen a korábbi évek adatait is feldolgoztuk, de a terjedelmi korlátok miatt csak egy évet részletezünk. A tárgyévben az

Részletesebben

AZ ŐSHONOS KENDERMAGOS MAGYAR TYÚK TARTÁSA HÓDMEZŐVÁSÁRHELYEN A SZEGEDI TUDOMÁNYEGYETEM MEZŐGAZDASÁGI FŐISKOLAI KARÁNAK TANÜZEMÉBEN

AZ ŐSHONOS KENDERMAGOS MAGYAR TYÚK TARTÁSA HÓDMEZŐVÁSÁRHELYEN A SZEGEDI TUDOMÁNYEGYETEM MEZŐGAZDASÁGI FŐISKOLAI KARÁNAK TANÜZEMÉBEN AZ ŐSHONOS KENDERMAGOS MAGYAR TYÚK TARTÁSA HÓDMEZŐVÁSÁRHELYEN A SZEGEDI TUDOMÁNYEGYETEM MEZŐGAZDASÁGI FŐISKOLAI KARÁNAK TANÜZEMÉBEN Főiskolai Karunk 1977 óta foglalkozik a kendermagos magyar tyúk fajtafenntartó

Részletesebben

A Hardy-Weinberg egyensúly. 2. gyakorlat

A Hardy-Weinberg egyensúly. 2. gyakorlat A Hardy-Weinberg egyensúly 2. gyakorlat A Hardy-Weinberg egyensúly feltételei: nincs szelekció nincs migráció nagy populációméret (nincs sodródás) nincs mutáció pánmixis van allélgyakoriság azonos hímekben

Részletesebben

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem Tisztelt Hölgyem, Tisztelt Uram! Örömmel jelentjük be Önöknek, hogy a Genomikai Medicina és Ritka Betegségek Intézetének egyik új projektje azon betegségek genetikai hátterének feltérképezésére irányul,

Részletesebben

Zárójelentés. OTKA NK72913 sz. pályázat

Zárójelentés. OTKA NK72913 sz. pályázat Zárójelentés OTKA NK79 sz. pályázat A hőmérséklet szerepe a gabonafélék kalászolási idejének szabályozásában Témavezető: Dr. Karsai Ildikó 008 0 Martonvásár OTKA NK79 zárójelentés. Bevezetés Kontrollált

Részletesebben

Kontrol kártyák használata a laboratóriumi gyakorlatban

Kontrol kártyák használata a laboratóriumi gyakorlatban Kontrol kártyák használata a laboratóriumi gyakorlatban Rikker Tamás tudományos igazgató WESSLING Közhasznú Nonprofit Kft. 2013. január 17. Kis történelem 1920-as években, a Bell Laboratórium telefonjainak

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

Doktori (PhD) értekezés tézisei BETEGSÉG-ELLENÁLLÓ ALMAFAJTÁK ÉS FAJTAJELÖLTEK VIRÁGZÁS-FENOLÓGIAI ÉS TERMÉKENYÜLÉS-BIOLÓGIAI SAJÁTOSSÁGAI

Doktori (PhD) értekezés tézisei BETEGSÉG-ELLENÁLLÓ ALMAFAJTÁK ÉS FAJTAJELÖLTEK VIRÁGZÁS-FENOLÓGIAI ÉS TERMÉKENYÜLÉS-BIOLÓGIAI SAJÁTOSSÁGAI Doktori (PhD) értekezés tézisei BETEGSÉG-ELLENÁLLÓ ALMAFAJTÁK ÉS FAJTAJELÖLTEK VIRÁGZÁS-FENOLÓGIAI ÉS TERMÉKENYÜLÉS-BIOLÓGIAI SAJÁTOSSÁGAI Bodor Péter Témavezető: Dr. Tóth Magdolna, DSc egyetemi tanár

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott

Részletesebben