Red light-regulated reversible nuclear localization of proteins in mammalian cells and zebrafish

Átírás

1 Red light-regulated reversible nuclear localization of proteins in mammalian cells and zebrafish Hannes M. Beyer,1,2,3,, Samuel Juillot,1,2,3, Kathrin Herbst,4,5, Sophia L. Samodelov 1,2,3, Konrad Müller 1, Wolfgang W. Schamel 1,2,3,6, Winfried Römer 1,2,3, Eberhard Schäfer 1, Ferenc Nagy 1,7, Uwe Strähle 4, Wilfried Weber 1,2,3,8 and Matias D. Zurbriggen 1,2 * 1Faculty of Biology, University of Freiburg, Schänzlestrasse 1, Freiburg, Germany 2BIOSS - Centre for Biological Signalling Studies, University of Freiburg, Schänzlestrasse 18, Freiburg, Germany 3SGBM - Spemann Graduate School of Biology and Medicine (SGBM), University of Freiburg, Albertstrasse 19a, Freiburg, Germany 4Institute of Toxicology and Genetics, Karlsruhe Institute of Technology and University of Heidelberg, D Eggenstein-Leopoldshafen, Germany 5BIF-IGS - BioInterfaces International Graduate School; Hermann-von-Helmholtz-Platz 1; Eggenstein-Leopoldshafen, Germany 6CCI, Centre for Chronic Immunodeficiency, University Clinincs Freiburg; Breisacher Strasse 117; Freiburg, Germany 7Biological Research Centre, Institute of Plant Biology, H-6726 Szeged, Hungary 8ZBSA - Centre for Biosystems Analysis, University of Freiburg, Habsburgerstrasse 49, Freiburg, Germany These authors contributed equally to this work. *Correspondence should be addressed to Matias D. Zurbriggen, matias.zurbriggen@biologie.unifreiburg.de Supplementary Table 1 Detailed description of plasmids used in this study. The genotype and the cloning strategy of the plasmids are described. Supplementary Fig. 1 Additional Information for the characterization of the red lightcontrolled nuclear localization system by confocal microscopy. Supplementary Fig. 2 Red light-induced nuclear import of full-length phytochrome B mediated by PIF3 in mammalian cells. Supplementary Fig. 3 Red light-inducible protein localization with engineered biosynthesis of phycocyanobilin (PCB). Supplementary Fig. 4 Additional kinetic information on live-cell monitoring of red lightinduced nuclear protein import. Supplementary Fig. 5 Additional information on red light-inducible, far-red light-reversible transgene expression based on the light-inducible nuclear localization of transcription factors in mammalian cells. Supplementary Fig. 6 Microscopic analysis of red light-controlled nuclear import in zebrafish embryos. Supplementary Fig. 7 Additional information on red light-inducible, far-red light-reversible transgene expression based on the light-inducible nuclear localization of transcription factors in zebrafish. Supplementary Movie 1 Time-lapse movie of red light-controlled nuclear import in mammalian cells. Supplementary Movie 2 Time-lapse movie of reversible red light-controlled nuclear import and export in mammalian cells. 1

2 Supplementary Table 1. Plasmids used in this study. The genotype and the cloning strategy of the plasmids are described. Abbreviations: IRESPV, polioviral internal ribosome entry site; MTS, mitochondrial targeting signal; pa, polyadenylation signal; PEF1α, human elongation factor 1α promoter; PSV40, simian virus 40 promoter; PT3, T3 bacteriophage promoter; SEAP, human placental secreted alkaline phosphatase; teto, TetR-responsive operator; VP16, Herpes simplex virus-derived transactivation domain; Zip(+), one half of a heterodimerizing antiparallel leucine zipper; Zip(-), corresponding second half of the leucine zipper. Plasmid Description 1858 pgad24- PIF3 1930_pP PO43_ph yb pgemhe -XfA4- megfp Plasmid encoding full-length phytochrome interacting factor 3 (PIF3, Genbank accession No. NM_ ). Kindly provided by Andreas Hiltbrunner. P35S promoter-driven plant expression vector containing the full-length coding sequences of phytochrome B (Genbank accession No. NM_127435) and mcerulean. ). Kindly provided by Andreas Hiltbrunner. Vector for in vitro transcription and expression in Xenopus oocytes containing the coding sequence of monomerizing enhanced GFP (megfp A206K, Genbank accession No. KC896843). Kindly provided by Maximilian Ulbrich. Reference unpublished unpublished Ulbrich et al. 1 pmz300 Plasmid encoding the monomeric red fluorescent protein mcherry (Genbank accession unpublished No. EU855181). pmz333 PSV40 driven mammalian expression vector derived from XbaI/NotI digested psam unpublished pmz348 PSV40::AtPIF3-pA. Full-length AtPIF3 (Genbank accession No. NM_ ) was amplified from 1858 pgad24-pif3 (kindly provided by A. Hiltbrunner, Freiburg) using oligos omz363 (5 - GTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCGAATTGCGGCCGCAGGAGGCGCCACCA TGCCTCTGTTTGAGCTTTTCAGGCTC-3 ) and omz365 (5 -TTATCATGTCTGGATCGAAGCTT GGGCTGCAGGTCGACTCTAGATTATCACGACGATCCACAAAACTGATCAGAAG-3 ). The gene was Gibson-cloned into XbaI/NotI digested pmz333 thereby resulting in a PSV40-driven PIF3 expression vector. pmz354 Plasmid encoding AtPIF3 (Genbank accession No. NM_ ), derived from plasmid unpublished 1858 pgad24-pif3. pmz358 Plasmid encoding AtPHYB (amino acids 1-908, Genbank accession No. NM_127435) and unpublished VP16 (Genbank accession No. CVU89929). pmz701 PSV40::AtPHYB(1-908)-L-mCherry-pA. mcherry was first amplified from pmz300 with oligos omz701 (5 - GATAGTGCTGGTAGTGCTGGTAGTGCTGGTTCCGCGTACAGCATGGTGAGCAAGGGCGAGGAG G-3 ) and omz706 (5 -CTTGTACAGCTCGTCCATGCCGC-3 ), further amplified using the oligos omz704(5 -TATTGGGGCTTTCTGTTTCTTGCAAATCCCGAGCGAATTCGATAGTGCTG GTAGTGCTGGTAGTG-3 ) and omz707 (5 -TCTGGATCGAAGCTTGGGCTGCAGGTCGACTCTA GATTACTACTTGTACAGCTCGTCCATGCCGC-3 ) and Gibson-cloned into XbaI/EcoRI digested pmz358 thereby resulting in a PSV40-driven expression vector for PhyB (amino acids 1-908) fused via a linker (L, EFDSAGSAGSAGSAYS) to mcherry. pmz703 PSV40:: AtPHYB(1-908)-L-mCherry-NES-pA. mcherry was PCR amplified from pmz300 using the oligos omz701/omz706 and then further amplified using omz704/omz708 (5 -GATGGTCAGGGTGCCGAACTTCTTGGTCATC TTGTACAGCTCGTCCATGCCGC-3 ). The product was Gibson-cloned into XbaI/EcoRI digested pmz358 thereby resulting in a PSV40-driven expression vector for PhyB (amino acids 1-908) fused via a linker (L, EFDSAGSAGSAGSAYS) to mcherry and the minute virus of mice derived nuclear export signal (NES, MTKKFGTLTI). pmz725 PSV40::AtPIF3-mEGFP-pA. megfp (Genbank accession No. KC896843), but with the monomerizing pointmutation K207A was first amplified from pgemhe-xfa4-megfp (kindly provided by M. Ulbrich, Freiburg) using oligos omz728 (5 -TTTGTGGATCGTCGGGCAGCATGGTGAGCAAGGGCGAG GAG-3 ) and omz729 (5 -TGCAGGTCGACTCTAGACTATTACTTGTACAGCTCGTCCATGCCG- 3 ). The backbone of pmz354 was amplified with omz726 (5 ACGAGCTGTACAAGTAATAG TCTAGAGTCGACCTGCAGCCCAAG-3 ) and omz727 (5 -TCCTCGCCCTTGCTCACCATGCTGC CCGACGATCCACAAAACTGAT-3 ) and both PCR fragments were joined by Gibson cloning thereby resulting in a PSV40-driven expression vector for PIF3 fused to monomeric EGFP. 2

3 pmz802 teto13 422bp Pmin::Luc pa. Expression vector encoding Firefly luciferase under the control of a modified tetracycline-responsive promoter. phb042 PSV40::PhyB(1-908)-L1-VP16-L2-Zip(+)-pA. VP16 was amplified from pmz358 using oligos ohb089 (5 -GAAAGGTTATTGGGGCTTTCT GTTTCTTGC-3 ) and ohb086 (5 -CCCACCGTACTCGTCAATTCCAAG-3 ). Zip+ was amplified from XW54_Punc_4c_NLS_Q (kindly provided by X. Wei 4 ) using ohb087 (5 -GT TTACCGATGCCCTTGGAATTGACGAGTACGGTGGGGGATCCGGATCTGGATCTGGATCTG-3 ) and ohb088 (5 -CTTATCATGTCTGGATCGAAGCTTGGGCTGCAGGTCGACTCTAGATTACTGA GCCAGTTCTTTCTTCAGTGCC-3 ). The products were Gibson-cloned into XbaI/EcoRI digested pmz358 thereby resulting in a PSV40-driven expression vector for PhyB (amino acids 1-908) fused to VP16 via a linker (L1, EFDSAGSAGSAGSAYSR) and via a second linker (L2, GSGSGSGSGSGS) to the Zip(+) leucine zipper (ALKKELQANKKELAQLKWELQAL KKELAQ). phb043 PSV40::PhyB(1-908)-L3-VP16-NES-L4-Zip(+)-pA. VP16 was amplified from pmz358 using oligos ohb0089 and ohb090 (5 - GATGGTCAGGGTGCCGAACTTCTTGGTCATAGATCCAGATCCCCCACCGTACTCGTCAATTCCA AG-3 ). Zip+ was amplified from XW54_Punc_4c_NLS_Q (kindly provided by Kang Shen 4 ) using ohb091 (5 -GGATCTATGACCAAGAAGTTCGGCACCCTGACCATCGGATCCGGATCTGG ATCTGGATCTG-3 ) and ohb088 thereby attaching the minute virus of mice derived nuclear export signal (NES, MTKKFGTLTI amino acid sequence). The products were Gibson-cloned into XbaI/EcoRI digested pmz358 thereby resulting in a PSV40-driven expression vector for PhyB (amino acids 1-908) fused to VP16 and the minute virus of mice derived nuclear export signal (NES) via a linker (L3, EFDSAGSAGSAGSAYSR) and via a second linker (L4, GSGSGSGSGSGS) to the Zip(+) leucine zipper (ALKKELQANKKELAQLKWELQALKKELAQ). phb045 PSV40::TetR-T7tag-L-Zip(-)-pA. TetR-T7tag was amplified from pww801 5 using oligos ohb094 (5 - GTCTTTTTGTCTTTTATTTCAGGTCCCGGATCGAATTGCGGCCGCAGGAGGCGCCACCATGTCT AGATTAGATAAAAGTAAAGTGATTAACAGCGC-3 ) and ohb095 (5 -CTTTTTCTCGAGAGCC TGGAGTTTCTTCTCCAGCTGCTCGCTGGCGGTACCGGAACCAGATCCAGATCCAGATCCAGATC CCTGGTCGCGACCCATTTGCTGTC-3 ). The product was reamplified using ohb094 and ohb096 (5 -TGTCTGGATCGAAGCTTGGGCTGCAGGTCGACTCTAGATTACTGTGCCAGTTTCT TCTCCAGTGCCTGGTTCTTCCACTCAAGCTGTGCCAGCTTTTTCTCGAGAGCCTGGAGTTTCTT C-3 ) to attach Zip(-). The product was Gibson-cloned into XbaI/NotI digested pmz333 thereby resulting in a PSV40-driven expression vector for the tetracycline repressor TetR fused to the T7tag and via a linker (L, GSGSGSGSGSGT) to the Zip(-) leucine zipper (EQLEKKLQALEKKLAQLEWKNQALEKKLAQ) 4. phb102 PT3::PhyB(1-908)-L1-VP16-L2-Zip(+)-pA. The open reading frame of phb042 was subcloned by Gibson Cloning using PCR with the oligos ohb231 (5 -GATATTGTATATATCGTAACAATAGGAGGTTCAACAATGGTTTCCGGAG TCGGGGG-3 ) and ohb232 (5 -TTAGTGGTAACCAGATCCTAGTCAGTCACTAGCCTATTA CTGAGCCAGTTCTTTCTTCAGTGCC-3 ). The target vector RCIscript-GoldyTALEN was prepared by PCR using the oligos ohb229 (5 -TAGGCTAGTGACTGACTAGGATCTGG-3 ) and ohb230 (5 - TGTTGAACCTCCTATTGTTACGATATATACAATATC-3 ). phb103 PT3::PhyB(1-908)-L3-VP16-NES-L4-Zip(+)-pA. The open reading frame of phb043 was subcloned by Gibson Cloning using PCR with the oligos ohb231 (5 -GATATTGTATATATCGTAACAATAGGAGGTTCAACAATGGTTTCCGGAG TCGGGGG-3 ) and ohb232 (5 -TTAGTGGTAACCAGATCCTAGTCAGTCACTAGCCTATTA CTGAGCCAGTTCTTTCTTCAGTGCC-3 ). The target vector RCIscript-GoldyTALEN was prepared by PCR using the oligos ohb229 (5 -TAGGCTAGTGACTGACTAGGATCTGG-3 ) and ohb230 (5 - TGTTGAACCTCCTATTGTTACGATATATACAATATC-3 ). phb104 PT3::AtPIF3-mEGFP-pA. The open reading frame of pmz725 was subcloned by Gibson Cloning using PCR with the oligos ohb233 (5 -GATATTGTATATATCGTAACAATAGGAGGTTCAACAATGCCTCTGTTTG AGCTTTTCAGGC-3 ) and ohb234 (5 -TTAGTGGTAACCAGATCCTAGTCAGTCACTAGCCTA TTACTTGTACAGCTCGTCCATGCC-3 ). The target vector RCIscript-GoldyTALEN was prepared by PCR using the oligos ohb229 (5 -TAGGCTAGTGACTGACTAGGATCTGG-3 ) and ohb230 (5 - TGTTGAACCTCCTATTGTTACGATATATACAATATC-3 ). Müller et al. 3 3

4 phb107 PT3::TetR-T7tag-L-Zip(-)-pA. The open reading frame of phb045 was subcloned by Gibson Cloning using PCR with the oligos ohb237 (5 - GATATTGTATATATCGTAACAATAGGAGGTTCAACAATGTCTAGATTAG ATAAAAGTAAAGTGATTAACAGCGC-3 ) and ohb238 (5 - TTAGTGGTAACCAGATCCTAGTC AGTCACTAGCCTATTACTGTGCCAGTTTCTTCTCCAGTG-3 ). The target vector RCIscript- GoldyTALEN was prepared by PCR using the oligos ohb229 (5 -TAGGCTAGTGACTGAC TAGGATCTGG-3 ) and ohb230 (5 - TGTTGAACCTCCTATTGTTACGATATATACAATATC- 3 ). pkm006 teto13-422bp-pmin::seap-pa. Expression vector encoding the secreted alkaline phosphatase (SEAP) under the control of a modified tetracycline-responsive promoter. pkm078 teto13-422bp-pmin::mcherry-pa. Expression vector encoding the fluorescent protein mcherry under the control of a modified tetracycline-responsive promoter. pkm087 PEF1α::MTS-PcyA-IRESPV-MTS-HO1-pA Bicistronic vector encoding mitochondria-localized PCB:ferredoxin oxidoreductase (MTS- PcyA) and mitochondria-localized heme oxygenase 1 (MTS-HO1) for PCB biosynthesis RCIscript - GoldyTA- LEN psj025 XW54_Pu nc_4c_nl S_Q Müller et al. 6 Müller et al. 6 Müller et al. 7 under the control of PEF1α. Destination vector for the Golden Gate TALEN kit, for in vitro synthesis of TALEN mrnas. Carlson et al. 8 PSV40::AtPHYB(full-length)-L-mCherry-pA. mcherry was first PCR amplified from pmz300 using oligos omz701(5 - GATAGTGCTGGTAGTGCTGGTAGTGCTGGTTCCGCGTACAGCATGGTGAGCAAGGGCGAGGAG G-3 ) and omz707 (5 -TCTGGATCGAAGCTTGGGCTGCAGGTCGACTCTAGATTACTACTTGT- ACAGCTCGTCCATGCCGC-3 ), PhyB(lull-length) was PCR amplified from 1930_pPPO43_phyB using the oligos omz300 (5 -GTTTAGTCTTTTTGTCTTTTATTTCAGG- TCCCGGATCGAATTGCGGCCGCAGGAGGCGCCACCATGGTTTCCGGAGTCGGGGGTAG-3 ) and osj028 (5 -GCGGAACCAGCACTACCAGCACTACCAGCACTATCATATGGCATCATCAGCATCA- TGTCACCAC-3 ) for Gibson cloning into NotI/XbaI digested pmz333. Punc4C-driven expression vector for Caenorhabditis elegans encoding the Qf transcription factor and the Zip(+) leucine zipper. Kindly provided by Kang Shen. Wei et al. 4 4

5 Supplementary Figure 1. Characterization of the red light-controlled nuclear localization system. (a) Dependence of the nuclear transport on phytochrome-interacting factor 3 (PIF3) and on phycocyanobilin (PCB). NIH/3T3 cells were cotransfected with plasmids pmz701 (PhyB(1-908)-mCherry) and pmz348 (PIF3). 24 h post-transfection, the medium was exchanged with fresh medium supplemented with 15 µm PCB, incubated for 1 h in darkness and subsequently illuminated at 660 nm light (20 µmol m -2 s -1 ) for 30 min prior to fixation, DAPI staining and analysis by confocal microscopy. In control samples, either PIF3 (-PIF3) or PCB (-PCB) were omitted. Scale bar, 5 µm. (b) Plasmids used in (a). Abbreviations: pa, polyadenylation signal; PSV40, simian virus 40 promoter. 5

6 Supplementary Figure 2. Red light-induced nuclear import of full-length phytochrome B mediated by PIF3 in mammalian cells. (a-b) HeLa cells were co-transfected with (a) plasmids psj025 (PhyB-mCherry) and pmz725 (PIF3-mEGFP), or with (b) psj h post-transfection, the medium was exchanged with fresh medium supplemented with 15 µm PCB, incubated for 1 h in darkness and subsequently illuminated at 660 nm light (20 µmol m-2 s-1) for 60 min prior to fixation, DAPI staining and analysis by confocal microscopy. (c) Plasmids used in (a-b). Scale bar, 5 µm. For abbreviations see Supplementary Figure 1. 6

7 Supplementary Figure 3. Red light-inducible protein localization with engineered biosynthesis of phycocyanobilin (PCB). (a) CHO-K1 cells with knocked-down levels of the PCB-degrading enzyme biliverdin reductase A (BVRA) 7 were cotransfected with plasmids pmz701 (PhyB(1-908)-mCherry), pmz725 (PIF3-mEGFP) and pkm087 (PEF1α-MTS-PcyA- IRESPV-MTS-HO1-pA) encoding the biosynthesis pathway from heme to PCB. 53 h post-transfection cells were illuminated at 660 nm light (20 µmol m -2 s -1 ) for 1.5 h prior to fixation and confocal imaging. In control cells, the PCB biosynthesis plasmid pkm087 was omitted (-PCB). Scale bar, 5 µm. (b) Plasmids used in (a). Abbreviations: HO1, heme oxygenase 1; IRES, internal ribosome entry site; MTS, mitochondrial targeting signal; PcyA, PCB:ferredoxin oxidoreductase; PEF1α, human elongation factor 1α. For further abbreviations see Supplementary Figure 1. 7

8 Supplementary Figure 4. Additional live-cell monitoring of red light-induced nuclear protein import. Representative single cell of Fig. 2b. Plasmid pmz703 encoding fluorescently labeled PhyB(1-908) with a C-terminally fused nuclear export sequence was co-transfected with plasmid pmz725 encoding PIF3 into NIH/3T3 cells. Cells were incubated in the presence of 15 µm PCB under 740 nm illumination for 5 min before nuclear import was induced with 660 nm light at time point 0 for 50 min. Confocal microscope images were acquired every 5 min. Scale bar, 5 µm. 8

9 Supplementary Figure 5. Additional information on red light-inducible, far-red light-reversible transgene expression based on the light-inducible nuclear localization of transcription factors in mammalian cells. (a) Light-responsive gene expression in different mammalian cell-lines. The indicated cell-lines were transfected with plasmids phb045 (TetR-Tip-), phb042 (PhyB-VP16-Zip+), pmz725 (PIF3-mEGFP) and pkm006 (SEAP reporter), 24 h post-transfection, the medium was exchanged for fresh medium supplemented with 15 µm PCB, kept for 1 h in the dark and subsequently illuminated at 660 nm (20 µmol m -2 s -1 ) or further kept in the dark for 24 h prior quantifying SEAP production. Absolute SEAP values after 660 nm light illumination were 6.93 U L -1 (CHO-K1), 0.88 U L -1 (NIH/3T3), 0.09 U L -1 (COS-7) and 2.47 U L -1 (HEK-293T). n = 4, error bars represent one standard deviation of the mean. (b) Reversible induction of transgene expression in CHO-K1 cells. CHO-K1 cells were transfected with plasmids phb045, phb042, pmz725 and pkm h post-transfection, the medium was supplemented with 15 µm PCB. Next, the cells were kept in the dark for 1 h and subsequently illuminated with 660 nm light (20 µmol m -2 s -1 ) or with 740 nm light (20 µmol m -2 s -1 ) for 24 h. Subsequently, the medium was replaced by fresh PCB-containing medium and illumination was either continued at the same wavelength or the wavelength was swapped. SEAP production was quantified after the first and the second 24 h illumination cycle. n = 4, error bars represent one standard deviation of the mean. 9

10 Supplementary Figure 6. Protein localization in zebrafish. (a) Red light-inducible nuclear transport in zebrafish embryos. Plasmids pmz703 and pmz725 were injected into single-cell stage zebrafish embryos. 33 h post-fertilization embryos were transferred to E3 medium supplemented with 150 µm PCB overnight prior to illumination at 660 nm (20 µmol m -2 s -1 ) for 1 h. Embryos were fixed and analyzed by confocal microscopy. As a control, embryos grown in the absence of PCB were used. Note microinjection of plasmid DNA results in expression in well-separated cells in the zebrafish embryo. Scale bar, 7 µm. (b) Localization of the analyzed cells in the zebrafish embryo. Scale bar, 100 µm. 10

11 Supplementary Figure 7 Additional information on red light-inducible, far-red light-reversible transgene expression based on the light-inducible nuclear localization of transcription factors in zebrafish. (a-b) Induction of Firefly luciferase expression in (a) 24 h staged, or (b) 48 h staged zebrafish embryos. Single cell stage embryos were injected with plasmid pmz802 (Luc reporter) and mrna transcribed from phb102 (PhyB-VP16-Zip+) or phb103 (PhyB-VP16-NES-Zip+) and pb107 (TetR-Zip-). mrna for PIF3 (derived from phb104) was injected, where indicated. Embryos were soaked in medium containing 150 µm PCB for 2 h in the dark and were subsequently illuminated at 660 nm (20 µmol m -2 s -1 ) or further kept in the dark for additional 2 h before luminescence of individual fish was determined. n = 7-9, error bars indicate one standard error of the mean, non-responsive embryos resulting from an unsuccessful injection were identified statistically, as described elsewhere 9. For abbreviations see Fig

12 Supplementary Movie 1. Time-lapse movie of red light-controlled nuclear import in mammalian cells is available online. Supplementary Movie 2. Time-lapse movie of reversible red light-controlled nuclear import and export in mammalian cells is available online. 12

13 Supplementary References [1] Ulbrich, M. H., and Isacoff, E. Y. (2007) Subunit counting in membrane-bound proteins, Nat. Methods 4, [2] Fussenegger, M., Moser, S., Mazur, X., and Bailey, J. E. (1997) Autoregulated multicistronic expression vectors provide one-step cloning of regulated product gene expression in mammalian cells, Biotechnol. Prog. 13, [3] Müller, K., Siegel, D., Rodriguez Jahnke, F., Gerrer, K., Wend, S., Decker, E. L., Reski, R., Weber, W., and Zurbriggen, M. D. (2014) A red light-controlled synthetic gene expression switch for plant systems, Mol. BioSyst. 10, [4] Wei, X., Potter, C. J., Luo, L., and Shen, K. (2012) Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans, Nat. Methods 9, [5] Weber, W., Stelling, J., Rimann, M., Keller, B., Daoud-El Baba, M., Weber, C. C., Aubel, D., and Fussenegger, M. (2007) A synthetic time-delay circuit in mammalian cells and mice, PNAS 104, [6] Müller, K., Engesser, R., Metzger, S., Schulz, S., Kampf, M. M., Busacker, M., Steinberg, T., Tomakidi, P., Ehrbar, M., Nagy, F., Timmer, J., Zubriggen, M. D., and Weber, W. (2013) A red/far-red light-responsive bi-stable toggle switch to control gene expression in mammalian cells, Nucleic Acids Res. 41, e77. [7] Müller, K., Engesser, R., Timmer, J., Nagy, F., Zurbriggen, M. D., and Weber, W. (2013) Synthesis of phycocyanobilin in mammalian cells, Chem. Commun. 49, [8] Carlson, D. F., Tan, W., Lillico, S. G., Stverakova, D., Proudfoot, C., Christian, M., Voytas, D. F., Long, C. R., Whitelaw, C. B., and Fahrenkrug, S. C. (2012) Efficient TALEN-mediated gene knockout in livestock, PNAS 109, [9] Jacobs, J. L., and Dinman, J. D. (2004) Systematic analysis of bicistronic reporter assay data, Nucleic Acids Res. 32, e