Epicentre. Epicentre Biotechnologies 5 US BuccalAmp DNA Extraction Kit NGS. Ribo-Zero ScriptSeq V2 EpiGenome NGS
|
|
- Kinga Deákné
- 6 évvel ezelőtt
- Látták:
Átírás
1 Epicentre Epicentre Biotechnologies 5 US BuccalAmp DNA Extraction Kit NGS Ribo-Zero ScriptSeq V2 EpiGenome NGS NGS 3 ~4 3
2 Epicentre biotechnologies
3 A8101 Ampligase DNA Ligase Kit 1,000 5 U/μl 35, A30201 Ampligase DNA Ligase Kit 5,000 5 U/μl 82, A0102K Ampligase DNA Ligase W/Buffer 2, U/μl 52, A0110K Ampligase DNA Ligase W/O Buffer 10, U/μl 134, A32250 Ampligase DNA Ligase W/Buffer U/μl 17, A32750 Ampligase DNA Ligase W/Buffer U/μl 25, A3202K Ampligase DNA Ligase W/Buffer 2,500 5 U/μl 55, A3210K Ampligase DNA Ligase W/O Buffer 10,000 5 U/μl 137, A1905B Ampligase 10X Reaction Buffer 5 ml 12, AAU5202 Aminoallyl-UTP mm 33, AIS107F CopyControl Fosmid Autoinduction Solution 50 ml 15, AP49100 APex Heat-Labile Alkaline Phosphatase 100 Rxns 35, AS3107 AmpliScribe T7 High Yield Transcription Kit 50 Rxns 57, ASB71110 AmpliScribe T7-Flash Biotin-RNA Transcription Kit 10 Rxns 80, ASF3257 AmpliScribe T7-Flash Transcription Kit 25 Rxns 41, ASF3507 AmpliScribe T7-Flash Transcription Kit 50 Rxns 62, AT72250 MasterAmp AmpliTherm DNA Polymerase U/μl 33, BCD0401K RecBCD Nuclease, E.coli 1,000 U 59, BMAX044 BACMAX DNA Purification Kit 1 Kit 41,000 BU6105H Biotin-16-UTP 500 nmole 51, C300C105 TransforMax EPI300 Chemically Competent E.coli 10 x 50 μl 34, C C400CH10 CopyCutter EPI400 Chemically Competent E.coli 10 x 50 μl 35, C C400EL10 CopyCutter EPI400 Electrocompetent E.coli 10 x 50 μl 47, C C90100 E.Coli Core RNA Polymerase 100 U 42, C C90500 E.Coli Core RNA Polymerase 500 U 163, C C905ML Transformation & Storage Solution 5 ml 11, CC02810 TransforMax EC100 Chemically Competent E.coli 10 x 50 μl 26, C RiboShredder RT -20 CCFOS059 CopyControl HTP Fosmid Library Production Kit 1 Kit 149,000 MaxPlax -70, CCFOS110 CopyControl Fosmid Library Production Kit 1 Kit 143,000 MaxPlax -70, 1 2-Mercaptoethanlol 1 2-Mercaptoethanlol CCIS125 CopyControl Induction Solution 25 ml 12, CIS40025 CopyCutter Induction Solution 25 ml 12, CL4111K CircLigase ssdna Ligase 1,000 U 29, CL4115K CircLigase ssdna Ligase 5,000 U 117, CL9021K CircLigase II ssdna Ligase 1,000 Units 29, CL9025K CircLigase II ssdna Ligase 5,000 Units 117, D0605H T4 DNA Polymerase 500 U 38, D '-dNTP (All 4 Mixed) mm ea. 19, D090710K DisplaceAce DNA Polymerase 10, U/μl 60, D1905U 2'-dUTP 5 μmole 10, D '-dNTP (All 4 mixed) 10 μmole 25 mm ea. 19, D5910A 2'-dATP mm 7, D5910C 2'-dCTP mm 7, D5910G 2'-dGTP mm 7, D5910T 2'-dTTP mm 7, D7P9201K T7 R&DNA Polymerase 1, U/μl 26, D7P9205K T7 R&DNA Polymerase 5, U/μl 102, D9905K RNase-Free DNase I 5,000 1 U/μl 30, D9910K RNase-Free DNase I 10,000 1 U/μl 47, DA11101K 5' Deadenylase 1,000 U 14, DB0711K Baseline-ZERO DNase 1,000 U 17, DB0715K Baseline-ZERO DNase 5,000 U 47, DL04082H E.coli DNA Ligase U/μl 13, DP081025K DNA Polymerase I, E.coli 2, U/μl 65, DS DuraScribe T7 Transcription Kit 10 Rxns 66, DS DuraScribe T7 Transcription Kit 25 Rxns 124, E3101K Plasmid-Safe ATP-Dependent DNase 1, U/μl 16, E3105K Plasmid-Safe ATP-Dependent DNase 5, U/μl 48, E3110K Plasmid-Safe ATP-Dependent DNase 10, U/μl 83, E70100 E.Coli Endonuclease IV 100 U 40, EC02T110 TransforMax EPI300 -T1 R Electrocompetent E.coli 10 x 100 μl 77, C EC10010 TransforMax EC100 Electrocompetent E.coli 10 x 100 μl 55, C EC TransforMax EPI300 Electrocompetent E.coli 10 x 100 μl 58, C EC TransforMax EPI300 Electrocompetent E.coli 5 x EC , C
4 EC6P095H TransforMax EC100D pir-116 Electrocomp E.coli 5 x 100 μl 38, C ECP09500 TransforMax EC100D pir+ Electrocomp E.coli 5 x 100 μl 38, C EN Exonuclease VII U/μl 45, ER0720 End-It DNA End-Repair Kit 20 Rxns 21, ER81050 End-It DNA End-Repair Kit 50 Rxns 45, ERT12910K EpiScript Reverse Transcriptase 10,000 U 18, ERT12925K EpiScript Reverse Transcriptase 25,000 U 32, EX4425K Exonuclease III 25, U/μl 41, Mercaptoethanlol EZI011RK EZ-Tn5 <R6K y ori / KAN-2> Insertion Kit 10 Rxns 108, EZI03T7 EZ-Tn5 <T7 / KAN-2> Promoter Insertion Kit 10 Rxns 108, EZI04KN EZ-Tn5 In-Frame Linker Insertion Kit 10 Rxns 108, EZI912D EZ-Tn5 <DHFR-1> Insertion Kit 10 Rxns 102, EZI921T EZ-Tn5 <TET-1> Insertion Kit 10 Rxns 102, EZI982K EZ-Tn5 <KAN-2> Insertion Kit 10 Rxns 102, F72500 MasterAmp Tfl DNA Polymerase U/μl 46, F7205K MasterAmp Tfl DNA Polymerase 5,000 1 U/μl 386, FMAX046 FosmidMAX DNA Purification Kit 1 Kit 42, FOS0901 EpiFOS Fosmid Library Production Kit 1 Kit 138,000 MaxPlax -70, 1 2-Mercaptoethanlol FS99060 FailSafe PCR PreMix Selection Kit 1 Kit 22, FS99100 FailSafe PCR System 100 U 27, FS99250 FailSafe PCR System 250 U 62, FS9901K FailSafe PCR System 1,000 U 219, FSP995A FailSafe PCR 2X PreMix A 2.5 ml 9, FSP995B FailSafe PCR 2X PreMix B 2.5 ml 9, FSP995C FailSafe PCR 2X PreMix C 2.5 ml 9, FSP995D FailSafe PCR 2X PreMix D 2.5 ml 9, FSP995E FailSafe PCR 2X PreMix E 2.5 ml 9, FSP995F FailSafe PCR 2X PreMix F 2.5 ml 9, FSP995G FailSafe PCR 2X PreMix G 2.5 ml 9, FSP995H FailSafe PCR 2X PreMix H 2.5 ml 9, FSP995I FailSafe PCR 2X PreMix I 2.5 ml 9, FSP995J FailSafe PCR 2X PreMix J 2.5 ml 9, FSP995K FailSafe PCR 2X PreMix K 2.5 ml 9, FSP995L FailSafe PCR 2X PreMix L 2.5 ml 9, FSE51100 FailSafe Enzyme Mix Only (No PreMixes) 100 U 25, FSE5101K FailSafe Enzyme Mix Only (No PreMixes) 1,000 U 209, G09200 GELase Agarose Gel-Digesting Prep U/μl 56, G31200 GELase Agarose Gel-Digesting Prep U/μl 56, GT11500 T4 Beta-glucosyltransferase U/μl 14, GT T4 Beta-glucosyltransferase 2, U/μl 62, H39100 Hybridase Thermostable RNase H U/μl 21, H39500 Hybridase Thermostable RNase H U/μl 70, KL11101K Exo-Minus Klenow DNA Polymerase (D355A, E357A) 1, U/μl 45, KP8100K Klenow DNA Polymerase 1,000 5 U/μl 45, L0820H T4 DNA Ligase, Cloned 2,000 2 U/μl 66, LE032K Lambda Exonuclease 2,500 U 38, LH820H T4 DNA Ligase, Cloned 2, U/μl 66, LK0750H Fast-Link DNA Ligation Kit 50 Lig. 30, LK6201H Fast-Link DNA Ligation Kit 100 Lig. 50, LR2D1132K T4 RNA Ligase 2, Deletion Mutant 2, U/μl 12, LR2D11310K T4 RNA Ligase 2, Deletion Mutant 10, U/μl 51, LT44200 Lambda Terminase U/μl 42, MB MessageBOOSTER cdna Synthesis Kit for qpcr 24 Rxns 150,000 MB100BR MasterAmp Buccal Swab Brushes-Hard Pack Brush 100 Brushes 30,000 MB100SP MasterAmp Buccal Swab Brushes-Soft Pack Brush 100 Brushes 18,000 MB MasterPure DNA Purification Kit for Blood, Version II 400 ml of Whole Blood 90,000 MB7901S MasterAmp Buccal Swab DNA Extraction Soln 50 ml 59, MBCL90310 MessageBOOSTER cdna Synthesis from Cell Lysates Kit 10 Rxns 88,000 MC89010 MasterPure Complete DNA & RNA Purif Kit 10 Purif 13, MC85200 MasterPure Complete DNA & RNA Purif Kit 200 Purif 75, MCD85201 MasterPure DNA Purification Kit 200 Purif 55, MCR85102 MasterPure RNA Purification Kit 100 Purif 53, ME81205 MasterAmp 10X PCR Enhancer 5 ml 34, ME81210 MasterAmp 10X PCR Enhancer 10 ml 53, MGD08420 Metagenomic DNA Isolation Kit for Water 20 Purif 36, NRK Total RNA Control NRK Total RNA Control
5 MGN0910 Meta-G-Nome DNA Isolation Kit 10 Purif 33,000 MPC Protein Precipitation Reagent, Proteinase K, Fosmid Control DNA, Ready-Lyse Lysozyme Solution RNase A -20 MGP04100 MasterPure Gram Positive DNA Purification Kit 100 Purif 54, MHF9220 MasterAmp Extra-Long PCR Kit 50 Rxns 52, MHF925A MasterAmp Extra-Long 2X PCR Premix 1 5 ml 14, MHF925B MasterAmp Extra-Long 2X PCR Premix 2 5 ml 14, MHF925C MasterAmp Extra-Long 2X PCR Premix 3 5 ml 14, MHF925D MasterAmp Extra-Long 2X PCR Premix 4 5 ml 14, MHF925E MasterAmp Extra-Long 2X PCR Premix 5 5 ml 14, MHF925F MasterAmp Extra-Long 2X PCR Premix 6 5 ml 14, MHF925G MasterAmp Extra-Long 2X PCR Premix 7 5 ml 14, MHF925H MasterAmp Extra-Long 2X PCR Premix 8 5 ml 14, MHF925I MasterAmp Extra-Long 2X PCR Premix 9 5 ml 14, MM MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit 50 Rxns 44, MMP03750 MPC Protein Precipitation Solution 50 ml 15, C MMP095H MPC Protein Precipitation Solution 500 ml 129, C MOD0602 MOD1503 EZ-Tn5 pmod -2 <MCS> Transposon Construction. Vector EZ-Tn5 pmod -3 <R6Ky ori / MCS> Transposon Const. Vector 20 μg 27, μg 27, MO7201 MasterAmp PCR Optimization Kit 60 Temp 44, MO7205A MasterAmp 2X PCR PreMix A 5 ml 14, MO7205B MasterAmp 2X PCR PreMix B 5 ml 14, MO7205C MasterAmp 2X PCR PreMix C 5 ml 14, MO7205D MasterAmp 2X PCR PreMix D 5 ml 14, MO7205E MasterAmp 2X PCR PreMix E 5 ml 14, MO7205F MasterAmp 2X PCR PreMix F 5 ml 14, MO7205G MasterAmp 2X PCR PreMix G 5 ml 14, MO7205H MasterAmp 2X PCR PreMix H 5 ml 14, MO7205I MasterAmp 2X PCR PreMix I 5 ml 14, MO7205J MasterAmp 2X PCR PreMix J 5 ml 14, MO7205K MasterAmp 2X PCR PreMix K 5 ml 14, MO7205L MasterAmp 2X PCR PreMix L 5 ml 14, MP5105 MaxPlax Lambda Packaging Extract 5 Ext 38, C MP5110 MaxPlax Lambda Packaging Extract 10 Ext 62, C MP5120 MaxPlax Lambda Packaging Extract 20 Ext 102, C MPP92100 MasterPure Plant Leaf DNA Purification Kit 100 Purif 42,000 MPR09100 MasterPure Plant RNA Purification Kit 100 Purif 93,000 RNase-Free DNase I, Proteinase K, RiboGuard RNase Inhibitor, DTT DNase Buffer -20 MPRK092 Proteinase K 2 ml 27, MPS04050 ArrayPure Nano-scale RNA Purification Kit 50 Purif 46, MPY03100 MasterPure Yeast RNA Purification Kit 100 Purif 63,000 MPY80200 MasterPure Yeast DNA Purification Kit 200 Purif 67,000 MRC0912H Red Cell Lysis Solution 1200 ml 24,000 MRNA092 RNase A 2 ml 15, MS MonsterScript 1st-Strand cdna Synthesis Kit 50 Rxns 60, MTC085H 2X T & C Lysis Buffer 500 ml 48,000 MTC096H Tissue & Cell Lysis Solution 600 ml 48,000 MTE0970 TE Buffer 70 ml 8,000 N6901K RNase I 1,000 U 20, N6905K RNase I 5,000 U 76, NT09500K Ribonuclease T1 (RNase T1) 500,000 U 43, OC7850K OmniCleave Endonuclease 50,000 U 53, P0503K T4 Polynucleotide Kinase, Cloned 3,000 U 37, PAP5104H Poly(A) Polymerase Tailing Kit 50 Rxns 39, Proteinase K RNase-Free DNase I PC8805 pweb Cosmid Cloning Kit 1 Kit 140,000 MaxPlax -70, PP RepliPHI Phi29 DNA Polymerase (High Concentration) 10 1 μg/μl 29, PP RepliPHI Phi29 DNA Polymerase (Low Concentration) μg/μl 29, Q82100 MasterAmp Taq DNA Polymerase U/μl 14, Q82500 MasterAmp Taq DNA Polymerase U/μl 46, Q8201K MasterAmp Taq DNA Polymerase 1,000 5 U/μl 87, Q8205K MasterAmp Taq DNA Polymerase 5,000 5 U/μl 384, QE0905T QuickExtract DNA Extraction Solution ml 9, QE09050 QuickExtract DNA Extraction Solution ml 58, QEB0905T QuickExtract Bacterial DNA Extraction Kit 5 ml 16, QEB09050 QuickExtract Bacterial DNA Extraction Kit 50 ml 111,000-20
6 QEC091H Catch-All Sample Collection Swabs-Hard Pack Swab 100 Swabs 31,000 QEC89100 Catch-All Sample Collection Swabs-Soft Pack Swab 100 Swabs 15,000 QEF81805 QuickExtract FFPE DNA Extraction Kit 5 ml 10, QEF81050 QuickExtract FFPE DNA Extraction Kit 50 ml 58, QEP80705 QuickExtract Plant DNA Extraction Solution 5 ml 9, QEP70750 QuickExtract Plant DNA Extraction Solution 50 ml 57, QER09015 QuickExtract RNA Extraction Kit 5 ml 16, QER QuickExtract RNA Extraction Kit 50 ml 102, QES08095T QuickExtract Seed DNA Extraction Solution 50 Extractions 10, QES QuickExtract Seed DNA Extraction Solution 500 Extractions 57, QFR82805 QuickExtract FFPE RNA Extraction Kit 5 ml 12, QFR82050 QuickExtract FFPE RNA Extraction Kit 50 ml 67, QU92500 MasterAmp Extra-Long DNA Polymerase Mix U/μl 96, QU9201K MasterAmp Extra-Long DNA Polymerase Mix 1, U/μl 172, R0601K E.coli RNase H 1, U/μl 33, R1802M Ready-Lyse Lysozyme Solution 2,000,000 U 22, R1804M Ready-Lyse Lysozyme Solution 4,000,000 U 39, R1810M Ready-Lyse Lysozyme Solution 10,000,000 U 75, R2F110C 2'-F-dCTP Solution 1 μmole 23, R2F110U 2'-F-dUTP Solution 1 μmole 23, RA02825 ATP mm 13, RC441MG rec A Protein 1 5 μg/μl 48, RG90925 RiboGuard RNase Inhibitor 2,500 U 22, RG90910K RiboGuard RNase Inhibitor 10,000 U 56, RH RepliPHI Phi29 Reagent Set (High Concentration) 10 μg 35, RH RepliPHI Phi29 Reagent Set (Low Concentration) 10 μg 35, RJ Rec J Exonuclease U/μl 54, RN02825 NTP's (A, C, G, U-Separate tubes) mm each 41, RN02950 RNase III, E.coli 50 1 U/μl 12, RNR07250 Ribonuclease R (RNase R) 250 U 40, RP03750 EasyLyse Bacterial Protein Extraction Solution 500 Rxns 24, C RP8092H RNA 5' Polyphosphatase 200 U 23, RS12500 RiboShredder RNase Blend 500 U 35, RT80125K MMLV High Performance Reverse Transcriptase 25,000 U 27, RTS11100 Pvu Rts1I Endonuclease U/μl 44, S90050 E.Coli Holo RNA Polymerase 50 U 30, C S90250 E.Coli Holo RNA Polymerase 250 U 118, C SSB02200 Single-Strand DNA Binding Protein 200 μg 30, T5E4111K T5 Exonuclease 1, U/μl 14, TA X TA Buffer 6 ml 14, TAA1R4924 TargetAmp 1-Round Aminoallyl-aRNA Amplification Kit Rxns 254, C TAA2R4924 TargetAmp 2-Round Aminoallyl-aRNA Amplification Kit Rxns 565, C TAB1R80524 TargetAmp 1-Round Biotin-aRNA Amplification Kit Rxns 187, C TAB2R71010 TargetAmp 2-Round Biotin-aRNA Amplification Kit Rxns 294, C TAB2R71024 TargetAmp 2-Round Biotin-aRNA Amplification Kit Rxns 561, C TAN07924 TAN TAP TAP TargetAmp -Nano Labeling Kit for Illumina Expression BeadChip TargetAmp -Nano Labeling Kit for Illumina Expression BeadChip TargetAmp -Pico Labeling Kit for Illumina Expression BeadChip TargetAmp -Pico Labeling Kit for Illumina Expression BeadChip 24 Rxns 156, C 96 Rxns 498, C 10 Rxns 294, C 24 Rxns 561, C TAU1R5124 TargetAmp 1-Round arna Amplification Kit Rxns 203, C TAU2R51224 TargetAmp 2-Round arna Amplification Kit Rxns 475, C TDT11725K Terminal Deoxynucleotidyl Transferase, Recombinant 2, U/μl 50, TE661K T4 Endonuclease V 1,000 U 36, TER51020 Terminator 5'-Phosphate-Dependent Exonuclease 40 1 U/μl 41, TH950K T7 RNA Polymerase 50,000 1,000 U/μl 104, TM910K T7 RNA Polymerase 10, U/μl 33, TNP10622 TNP10623 EZ-Tn5 Custom Transposome Construction Kit (w / pmod- 1 Kit 2 Vector) 135, EZ-Tn5 Custom Transposome Construction Kit (w / pmod- 1 Kit 3 Vector) 135, TRL8101K Thermostable RNA Ligase 1, U/μl 28, TSM08KR EZ-Tn5 <R6Kyori / KAN-2> Tnp Transposome Kit 10 Rxns 106,000-20
7 TSM99D1 EZ-Tn5 <DHFR-1> Tnp Transposome Kit 10 Std Rxns 100, TSM99K2 EZ-Tn5 <KAN-2> Tnp Transposome Kit 10 Std Rxns 100, TTH72250 MasterAmp Tth DNA Polymerase U/μl 27, TXP78001 TAQXpedite PCR System (end-point) 1, μl Rxns 185, TY0261H TypeOne Restriction Inhibitor μg/μl 36, UEM04100 Uracil-DNA Excision Mix 100 Rxns 35, UG13100 Uracil N-Glycosylase (UNG) 100 U 29, UG131K Uracil N-Glycosylase (UNG) 1,000 U 235, W7350ML Sterile Nuclease-Free Water 50 ml 8,000 WEBC931 pweb-tnc Cosmid Cloning Kit 1 Kit 146,000 MaxPlax -70, 1 2-Mercaptoethanlol X40505K Exonuclease I 5,000 U 23, X40520K Exonuclease I 20,000 U 57,000-20
8 MB MessageBOOSTER cdna Synthesis MBWT80510 MessageBOOSTER Whole Transcriptome Kit EC TransforMax EPI300 Electrocompetent cells G09100 GELase Enzyme Prep 100 U BQ0901SBS BuccalAmp DNA Extraction Kit with MasterAmp Brush Soft Pack 1 Kit (BQ0901S x 1 + SWABBS) BQ0901SCR BuccalAmp DNA Extraction Kit with Catch-All Hard Pack Buccal Swab 1 Kit (BQ0901S x 1 + SWAB) BQ0901SRB BuccalAmp DNA Extraction Kit with MasterAmp Brush Hard Pack 1 Kit (BQ0901S x 1 + SWABRB) BQ0901SSC BuccalAmp DNA Extraction Kit with Catch-All Soft Pack Buccal Swab 1 Kit (BQ0901S x 1 + SWABSC) BQ0908SBS BuccalAmp DNA Extraction Kit with MasterAmp Brush Soft Pack (BQ0901S x 8 + SWABBS x 8) BQ0908SCR BuccalAmp DNA Extraction Kit with Catch-All Hard Pack Buccal Swab (BQ0901S x 8 + SWAB x 8) BQ0908SRB BuccalAmp DNA Extraction Kit with MasterAmp Brush Hard Pack (BQ0901S x 8 + SWABRB x 8) BQ0908SSC BuccalAmp DNA Extraction Kit with Catch-All Soft Pack Buccal Swab (BQ0901S x 8 + SWABSC x 8) BQ0916SBS BuccalAmp DNA Extraction Kit with MasterAmp Brush Soft Pack (BQ0901S x 16 + SWABBS x 16) BQ0916SCR BuccalAmp DNA Extraction Kit with Catch-All Hard Pack Buccal Swab (BQ0901S x 16 + SWAB x 16) BQ0916SRB BuccalAmp DNA Extraction Kit with MasterAmp Brush Hard Pack (BQ0901S x 16 + SWABRB x 16) BQ0916SSC BuccalAmp DNA Extraction Kit with Catch-All Soft Pack Buccal Swab (BQ0901S x 16 + SWABSC x 16) FD05025 ExtractMaster Fecal DNA Extraction Kit FOS84596 Direct Lysis Fosmid96 DNA Purification Kit MB MasterPure DNA Purif Kit for Blood SM02050 SoilMaster DNA Extraction Kit TSCD12924 TotalScript(TM) cdna Kit, 24 rxn TSCD1296 TotalScript(TM) cdna Kit, 6 rxn kit TSIDX12910 TotalScript(TM) Index Kit TSLP12924 TotalScript(TM) Library Prep Kit TSLP1296 TotalScript(TM) Library Prep Kit TSRNA12924 TotalScript RNA-Seq Kit 24 Rxns (TSLP TSCD12924) TSRNA1296 TotalScript RNA-Seq Kit 6 Rxns (TSLP TSCD1296) ASBHMR1212 5X Mammalian Polysome Buffer ASBYSC1212 5X Yeast Polysome Buffer ASFT1212 Filter Tubes ASLPA1212 ARTseq(TM) Ribosome Profiling BB1206 ScriptSeq Complete Kit (Bacteria) 6 Rxns (RZMB MRZ116C + SSV21106) BB1224 ScriptSeq Complete Kit (Bacteria) 24 Rxns (RZMB MRZ11124C + SSV21124) BEP1206 ScriptSeq Complete Gold Kit (Epidemiology) 6 Rxns (RZE MRZ116C + SSV21106) BEP1224 ScriptSeq Complete Gold Kit (Epidemiology) 24 Rxns (RZE MRZ11124C + SSV21124) BG1206 ScriptSeq Complete Gold Kit (Human/Mouse/Rat) 6 Rxns (RZHM MRZ116C + SSV21106) BG1224 ScriptSeq Complete Gold Kit (Human/Mouse/Rat) 24 Rxns (RZG MRZ11124C + SSV21124) BGGB1306 ScriptSeq Complete Gold Kit (Blood) 6 Rxns (GZRR MRZ116C + SSV21106) BGGB1324 ScriptSeq Complete Gold Kit (Blood) 24 Rxns (GZRR MRZ11124C + SSV21124) BGY1306 ScriptSeq Complete Gold Kit (Yeast) 6 Rxns (RZY MRZ116C + SSV21106) BGY1324 ScriptSeq Complete Gold Kit (Yeast) 24 Rxns (RZY MRZ11124C + SSV21124) BHMR1205 ScriptSeq Complete Kit (Human/Mouse/Rat) 6 Rxns (RZH MRZ116C + SSV21106) BHMR1224 ScriptSeq Complete Kit (Human/Mouse/Rat) 24 Rxns (RZH MRZ11124C + SSV21124) BPL1205 ScriptSeq Complete Kit (Plant Leaf) 6 Rxns (RZPL MRZ116C + SSV21106) BPL1224 ScriptSeq Complete Kit (Plant Leaf) 24 Rxns (RZPL MRZ11124C + SSV21124) BSR1206 ScriptSeq Complete Kit (Plant Seed/Root) 6 Rxns (RZSR MRZ116C + SSV21106) GZG1206 Globin-Zero Gold Kit 6 Rxns (MRZ116C + GZRR1306) GZG1224 Globin-Zero Gold Kit 24 Rxns (MRZ11124C + GZRR1324) GZLI1224 Globin-Zero Gold Reagents GZLI1306 Globin-Zero Gold Reagents GZRR1306 Globin-Zero Gold Reagents GZRR1324 Globin-Zero Gold Reagents LIB1206 LIB1224 LIE1206 LIE1224 LIG1206 Ribo-Zero Gold Reagents (H/M/R) LIG1224 LIH1206 LIH1224 LIMC1204 Magnetic Core Kit-Low Input LIMC126 Magnetic Core Kit-Low Input LIPL1206 LISR1206 Ribo-Zero Removal Reagents (Plant) MRZ11124C Magnetic Core Kit, 24 Rxns MRZ116C Magnetic Core Kit, 6 Rxns MRZ48CHT Magnetic Core Kit-HT 48 Reaction RPHMR12126 ARTseq Ribosome Profiling Kit - Mammalian 12 Rxns (ASBHMR ASFT ASLPA SMIP2124) RPYSC12116 ARTseq Ribosome Profiling Kit - Yeast 12 Rxns (ASBYSC ASFT ASLPA SMIP2124) RSBC10948 ScriptSeq Index PCR Primers (Set 1) RZE1206 RZE1224 RZG1224 (Human/Mouse/Rat) RZGHT48 RZH1046 Ribo-Zero rrna-removal Kit (Human/Mouse/Rat) RZH Ribo-Zero rrna-removal Kit (Human/Mouse/Rat) RZHM11106 Ribo-Zero Gold Kit (Human/Mouse/Rat) RZMB11086 RZMB12324 RZNB1056 RZPB10106 RZPL11016 RZPL1224 RZSR11036 RZY1306 RZY1324 SCL24B ScriptSeq Complete Kit (Bacteria) Low Input 24 Rxns (LIB LIMC SSV21124) SCL24EP ScriptSeq Complete Gold Kit (Epidemiology) Low Input 24 Rxns (LIE LIMC SSV21124) SCL24G ScriptSeq Complete Gold Kit (Human/Mouse/Rat) Low Input 24 Rxns (LIG LIMC SSV21124) SCL24GBL ScriptSeq Complete Gold Kit (Blood) Low Input 24 Rxns (GZLI LIMC SSV21124) SCL24H ScriptSeq Complete Kit (Human/Mouse/Rat) Low Input 24 Rxns (LIH LIMC SSV21124) SCL6B ScriptSeq Complete Kit (Bacteria) Low Input 6 Rxns (LIB LIMC126 + SSV21106) SCL6EP ScriptSeq Complete Gold Kit (Epidemiology) Low Input 6 Rxns (LIE LIMC126 + SSV21106) SCL6G ScriptSeq Complete Gold Kit (Human/Mouse/Rat) Low Input 6 Rxns (LIG LIMC126 + SSV21106) SCL6GBL ScriptSeq Complete Gold Kit (Blood) Low Input 6 Rxns (GZLI LIMC126 + SSV21106) SCL6H ScriptSeq Complete Kit (Human/Mouse/Rat) Low Input 6 Rxns (LIH LIMC126 + SSV21106) SCL6PL ScriptSeq Complete Kit (Plant Leaf) Low Input 6 Rxns (LIPL LIMC126 + SSV21106) SCL6SR ScriptSeq Complete Kit (Plant Seed/Root) Low Input 6 Rxns (LISR LIMC126 + SSV21106) SMIP2124 ARTseq Index PCR Primers (1-12)
9 SSIP1202 ScriptSeq Index PCR Primers (Set 2) SSIP1203 ScriptSeq Index PCR Primers (Set 3) SSIP1204 ScriptSeq Index PCR Primers (Set 4) SSIP1234 ScriptSeq Index PCR Primers (Sets 1-4) SSV21106 ScriptSeq v2 RNA-Seq Library Prep Kit SSV21124 ScriptSeq v2 RNA-Seq Library Prep Kit MRZB12424 Ribo-Zero Magnetic Kit (Bacteria) 24 Rxns (MRZ11124C + RZMB12324) MRZE706 Ribo-Zero Magnetic Gold Kit (Epidemiology) 6 Rxns (MRZ116C + RZE1206) MRZE724 Ribo-Zero Magnetic Gold Kit (Epidemiology) 24 Rxns (MRZ11124C + RZE1224) MRZG12324 Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat) 24 Rxns (MRZ11124C + RZG1224) MRZG126 Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat) 6 Rxns (MRZ116C + RZHM11106) MRZGN126 Ribo-Zero Magnetic Kit (Gram-Negative Bacteria) 6 Rxns (MRZ116C + RZNB1056) MRZGP126 Ribo-Zero Magnetic Kit (Gram-Positive Bacteria) 6 Rxns (MRZ116C + RZPB10106) MRZH11124 Ribo-Zero Magnetic Kit (Human/Mouse/Rat) 24 Rxns (MRZ11124C + RZH110424) MRZH116 Ribo-Zero Magnetic Kit (Human/Mouse/Rat) 6 Rxns (MRZ116C + RZH1046) MRZMB126 Ribo-Zero Magnetic Kit (Bacteria) 6 Rxns (MRZ116C + RZMB11086) MRZPL116 Ribo-Zero Magnetic Kit (Plant Leaf) 6 Rxns (MRZ116C + RZPL11016) MRZPL1224 Ribo-Zero Magnetic Kit (Plant Leaf) 24 Rxns (MRZ11124C + RZPL1224) MRZSR116 Ribo-Zero Magnetic Kit (Plant Seed/Root) 6 Rxns (MRZ116C + RZSR11036) MRZY1306 Ribo-Zero Magnetic Gold Kit (Yeast) 6 Rxns (MRZ116C + RZY1306) MRZY1324 Ribo-Zero Magnetic Gold Kit (Yeast) 24 Rxns (MRZ11124C + RZY1324) EGIDX81312 EpiGnome Index PCR Primers EGMK81312 EpiGnome Methyl-Seq Kit 12 Reaction EGMK91324 EpiGnome Methyl-Seq Kit 24 Reaction EGMK91396 EpiGnome Methyl-Seq Kit 96 Reaction ( 2 ) TEL FAX ( ) TEL FAX
Új temékek az UD- GenoMed Kft. kínálatában!
Új temékek az UD- GenoMed Kft. kínálatában! Szolgáltatásaink: Medical Genomic Technologies Kft. Betegtoborzás és biobanking Bioinformatika o Adatelemzés/adatbányászás o Integrált adatbázis készítés Sejtvonal
Új temékek az UD-GenoMed Kft. kínálatában!
Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai
Téli kedvezményes ajánlataink
Téli kedvezményes ajánlataink Ajánlataink 2017 január 31-ig érvényesek! BIOBASE műszerek a NucleotestBio Kft. kínálatában! Steril box-ok, lamináris box-ok: Hűtők, fagyasztók, ultramélyhűtők, autoklávok,
2016 év eleji ajánlatok. Speciális áraink 2016 május 31-ig érvényesek!
2016 év eleji ajánlatok Speciális áraink 2016 május 31-ig érvényesek! BIOBASE műszerek a NucleotestBio Kft. kínálatában! Steril box-ok, lamináris box-ok: Hűtők, fagyasztók, ultramélyhűtők, autoklávok,
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
SOLiD Technology. library preparation & Sequencing Chemistry (sequencing by ligation!) Imaging and analysis. Application specific sample preparation
SOLiD Technology Application specific sample preparation Application specific data analysis library preparation & emulsion PCR Sequencing Chemistry (sequencing by ligation!) Imaging and analysis SOLiD
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
Supporting Information
Supporting Information Plasmid Construction DNA cloning was carried out according to standard protocols. The sequence of all plasmids was confirmed by DNA sequencing and amplified using the E. coli strain
A cell-based screening system for RNA Polymerase I inhibitors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information A cell-based screening system for RNA Polymerase I inhibitors Xiao Tan,
pjnc-pgluc Codon-optimized Gaussia luciferase (pgluc) Vector backbone: JM83 pjnc-pgluc is resistant to ampicillin and neomycin High or low copy:
pjnc-pgluc Gene/Insert name: Codon-optimized Gaussia luciferase (pgluc) Vector backbone: pcmv-jnc Vector type: Mammalian cells Backbone size w/o insert (bp): 5375 Bacterial resistance: Ampicillin and neomycin
DEK-213_A KTIA_NAP_13-1-2013-0001 azonosító számú projekt ellátásához szükséges diagnosztikumok beszerzése-eredménytáj.
DEK-213_A KTIA_NAP_13-1-2013-0001 azonosító számú projekt ellátásához szükséges diagnosztikumok beszerzése-eredménytáj. Közbeszerzési Értesítő száma: 2015/67 Beszerzés tárgya: Árubeszerzés Hirdetmény típusa:
Sejt- és szövetkultúra
Sejt- és szövetkultúra Subline Innenteil 14pt TC Tested Tested Cryo Performance Sterile/ DNA-/ DNase-/ RNase-/ Pyrogen-free/ non-cytotoxic CE/ IVD/ Sterile/ Pyrogen-free/ non-cytotoxic/ non-mutagenic Come
Modular Optimization of Hemicellulose-utilizing Pathway in. Corynebacterium glutamicum for Consolidated Bioprocessing of
[Supplementary materials] Modular Optimization of Hemicellulose-utilizing Pathway in Corynebacterium glutamicum for Consolidated Bioprocessing of Hemicellulosic Biomass Sung Sun Yim 1, Jae Woong Choi 1,
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
University of Bristol - Explore Bristol Research
Al-Salihi, S. A. A., Scott, T. A., Bailey, A. M., & Foster, G. D. (2017). Improved vectors for Agrobacterium mediated genetic manipulation of Hypholoma spp. and other homobasidiomycetes. Journal of Microbiological
A népszerű DreamTaq termékek az év végéig 30% kedvezménnyel!
Hírlevél 33. szám 2011. november LABORATÓRIUMI SZOLGÁLTATÓ KFT - 6726 SZEGED TEMESVÁRI KRT 62 TEL: 62 / 599 750 FAX: 62 / 321 658 WEB: HTTP://WWW.BIOCENTER.HU NOVEMBER VÉGÉIG MÉG TART AZ AKCIÓ! Fermentas,
Whole mount in situ hybridization, sectioning, and immunostaining Ribonuclease protection assay (RPA) Collagen gel tube formation assay
Whole mount in situ hybridization, sectioning, and immunostaining In situ hybridization for tie-1 and lncrna tie-1as and sectioning of ISH stained embryos were performed according to previously published
Rendeljen Phusion, Phire és Taq polimerázokat akciósan! KETTŐT FIZET, HÁRMAT KAP! Hírlevél 34. / szeptember
Hírlevél 34. / 2012. szeptember LABORATÓRIUMI SZOLGÁLTATÓ KFT - 6726 SZEGED TEMESVÁRI KRT 62 TEL: 62 / 599 750 FAX: 62 / 321 658 WEB: HTTP://WWW.BIOCENTER.HU HIGH QUALITY COSTS LESS! Molekuláris biológiai
pleics-06 Amp pleics-13 Amp/Zeo N-His 10/ 3 x
Protease Sequence primers Vector Name AR Tag/Flag cleavage Tag and linker pleics-01 Amp N-His 6 TEV Extra SM His6-SSGVDLGT-TEV site-1 T7 Promoter pleics-01-seq-r pleics-02 Amp N-GST TEV Extra SM GST-SS-TEV
1. - Esztrich- és betontermékek
1. - Esztrich- és betontermékek Adalékszerek DM 40 Beton- és habarcstömítő adalékszer 1 kg m. flakon 6 db 378 db 9002689371663 37166 2 704 / kg 3 434 5 kg m. kanna - 84 db 9002689271666 27166 1 329 / kg
DEK-592 Vegyszer és fogyóeszköz beszerzése
DEK-592 Vegyszer és fogyóeszköz beszerzése Közbeszerzési Értesítő száma: 2018/245 Beszerzés tárgya: Hirdetmény típusa: Eljárás fajtája: Árubeszerzés Ajánlati/Részvételi felhívás/2015 EUHL Nyílt eljárás
Sejt- és szövettenyésztés
Sejt- és szövettenyésztés Subline Innenteil 14pt TC Tested Tested Cryo Performance Sterile/ DNA-/ DNase-/ RNase-/ Pyrogen-free/ non-cytotoxic CE/ IVD/ Sterile/ Pyrogen-free/ non-cytotoxic/ non-mutagenic
Suppl. Materials. Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids. Germany
Suppl. Materials Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids Stephanie Bresan 1, Anna Sznajder 1, Waldemar Hauf 2, Karl Forchhammer 2, Daniel Pfeiffer 3 and Dieter Jendrossek 1 1 Institute
mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6
Agilent 2100 Bioanalyzer mikrokapilláris gélelektroforézis rendszer G2943CA 2100 Bioanalyzer system forgalmazó: Kromat Kft. 1112 Budapest Péterhegyi u. 98. t:36 (1) 248-2110 www.kromat.hu bio@kromat.hu
Könyvtárak, szekvenálás, mutagenezis
Könyvtárak, szekvenálás, mutagenezis GÉNKÖNYVTÁRAK GENOMIÁLIS KÖNYVTÁR (könyvtár rendelésre: pl. Stratagene) vektor: -fág (helyettesítő), kozmid, YAC, PAC, BAC méret: N = ln(1-p)/ln[1-(i/g)] klónok száma
Glyma10g15850 aagggatccattctggaaccatatcttgctgtg ttgggtacccttggatgcaggatgacacg AtMKK6, AT5g56580
Supplemental table 1. Soybean MAPK, MAPKK, and MAPKKK genes and primers for VIGS cloning Gene_ID Forward Primer Reverse Primer Arabidopsis Ortholog Glyma04g03210 aagggatcctgcagcaagaaccagttcat ttgggtaccctaatggatgcgcattaggataaag
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
BIOHIT DIGITÁLIS PIPETTÁK
BIOHIT DIGITÁLIS PIPETTÁK BIOHI PROLINE mechanikus Egycsatornás, állítható térfogatú Négy csatornás, Nyolc csatornás, Tizenkét csatornás, Egycsatornás, 720 005 0.1-2.5 0.05 1 720 000 0.5-10 0.10 720 080
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
Salt-Enabled Visual Detection of DNA
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information for Salt-Enabled Visual Detection of DNA Xilong Wang, Xun Chen, Sha Sun,
Supplemental Information. Investigation of Penicillin Binding Protein. (PBP)-like Peptide Cyclase and Hydrolase
Cell Chemical Biology, Volume upplemental Information Investigation of Penicillin Binding Protein (PBP)-like Peptide Cyclase and ydrolase in urugamide on-ribosomal Peptide Biosynthesis Yongjun Zhou, Xiao
cobas TaqScreen MPX Test for use on the cobas s 201 system
cobas TaqScreen MPX Test for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test MPX 96 Tests P/N: 04584244 190 cobas TaqScreen MPX Control Kit MPX CTL 6 Sets P/N: 04626290
Expression analysis of PIN genes in root tips and nodules of Lotus japonicus
Article Expression analysis of PIN genes in root tips and nodules of Lotus japonicus Izabela Sańko-Sawczenko 1, Dominika Dmitruk 1, Barbara Łotocka 1, Elżbieta Różańska 1 and Weronika Czarnocka 1, * 1
Akce platí od do Do objednávky uveďte kód akce CLON16.
Média Lonza se slevou 25-30% Seznam produktů se slevou, konkrétní cenovou nabídku žádejte na eastport@eastport.cz nebo tel. 721 867 038. Akce platí od 1.10.2016 do 31.12. 2016. Do objednávky uveďte kód
Supplemental Information. RNase H1-Dependent Antisense Oligonucleotides. Are Robustly Active in Directing RNA Cleavage
YMTHE, Volume 25 Supplemental Information RNase H1-Dependent Antisense Oligonucleotides Are Robustly Active in Directing RNA Cleavage in Both the Cytoplasm and the Nucleus Xue-Hai Liang, Hong Sun, Joshua
Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and
WT sham Trpv4 -/- sham Saline 10µM GSK1016709A P value Saline 10µM GSK1016709A P value Number 10 10 8 8 Intercontractile interval (sec) 143 (102 155) 98.4 (71.4 148) 0.01 96 (92 121) 109 (95 123) 0.3 Voided
E F O P
E g y ü t t m z k ö d é s i a j á n l a t K ö z ö s é r t é k e i n k s o k s z í n z t á r s a d a l o m E F O P - 1.3.4-1 6 P á l y á z a t i t e r v e z e t 2. 0 ( F o r r á s : w w w. p a l y a z a
ÁRLISTA 2015 EUREKA E36. with 12V-80Ah AKKUMULÁTOR, BEÉPÍTETT TÖLTŐ ÉS PPL KEFE. 649 440 Ft. E36 C cable powepiros 220-230V ÉS PPL KEFE.
ÁRLISTA 2015 EUREKA E36 E36 B with 12V-80Ah AKKUMULÁTOR, BEÉPÍTETT TÖLTŐ ÉS PPL KEFE 649 440 Ft E36 C cable powepiros 220-230V ÉS PPL KEFE 524 160 Ft * AUTOMATIC MEGHAJTÁS * FEDÉLZETI AKKUMULÁTOR TÖLTŐ
COBAS AMPLICOR IN VITRO DIAGNOSZTIKAI CÉLRA.
COBAS AMPLICOR Chlamydia trachomatis Test CT IN VITRO DIAGNOSZTIKAI CÉLRA. Rendelési információ AMPLICOR CT/NG CT/NG PREP 100 Tests P/N: 20759414 122 Specimen Preparation Kit ART: 07 5941 4 US: 83315 AMPLICOR
Mock Orc2. NPE sperm pre-rc replication
Time (min): HSS + M13 0 30 50 70 Orc2 HSS NPE sperm pre-rc repliction c % Repliction 60 40 20 0 HSS + sp NPE Orc2 Fig. S1: M13 ssdna-induced destruction of does not require ORC. S1: M13 ssdna ws incuted
DNS-szekvencia meghatározás
DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer
Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites
Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites Selwyn Quan *, Ole Skovgaard, Robert E. McLaughlin, Ed T. Buurman,1, and Catherine L. Squires * Department
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
LEGYEN MÁS A SZENVEDÉLYED!
E g y ü t t m z k ö d é s i a j á n l a t L E G Y E N M Á S A S Z E N V E D É L Y E D! 2. E F O P - 1. 8. 9-1 7 P á l y á z a t i t e r v e z e t 3. 0 ( F o r r á s : w w w. p a l y a z a t. g o v. h u
Kezdőlap > Termékek > Szabályozó rendszerek > EASYLAB és TCU-LON-II szabályozó rendszer LABCONTROL > Érzékelő rendszerek > Típus DS-TRD-01
Típus DS-TRD FOR EASYLAB FUME CUPBOARD CONTROLLERS Sash distance sensor for the variable, demand-based control of extract air flows in fume cupboards Sash distance measurement For fume cupboards with vertical
Készült a Gazdasági Versenyhivatal Versenykultúra Központjának támogatásával. 2010. november
A 2 -e g y b e n, 3-e g y b e n c s o m a g a j á n l a t o k f o g y a s z t ó i m e g í t é l é s e é s h a t áv se a r s a e n y r e a h í r k ö z l é s i p i a c o n Készült a Gazdasági Versenyhivatal
AKCIÓS KATALÓGUS 2013 / 3
Minden gépünkre 1+2 év kiterjesztett garanciát biztosítunk internetes regisztrálást követően. Az akció érvényes: 2013. szeptember 1-jétől visszavonásig, illetve a készlet erejéig. Az esetleges nyomdai
A kábelszerelés világából Bevizsgált FAM szerszámok Bázis termékcsalád. Brutto-árlista 2008. Érvényes 2008.01.01-től. ... megoldások, melyek meggyőzik
HU A kábelszerelés világából Bevizsgált FAM szerszámok Bázis termékcsalád Brutto-árlista 2008 Érvényes 2008.01.01-től Kábelvágó ollók Kábelvágó Kábelvágó Vágópisztoly 20 02 10 35-ig 550 1 32,99 20 02 11
cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system
cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test, v2.0 MPX v2.0 96 Tests P/N: 05969492 190 cobas TaqScreen MPX Control Kit,
ZELIO TIME időrelék. Katalógus RE11, RE48
ZELIO IME időrelék Katalógus 2005 E11, E48 artalom Zelio ime idõrelék E 11 moduláris relék szilárdtest kimenettel eferenciaszámok, méretek, bekötési sémák...2. és 3. oldal Karakterisztikák...4. és 5. oldal
1. Legfontosabb tulajdonságok. 2. A lejátszó leírása
1. Legfontosabb tulajdonságok 1,5 colos TFT képernyő MP3, WMA, FLAC, APE audio formátumok támogatása MPEG-4 (AVI) video formátum támogatása Beépített FM rádió A zeneszámok szövegének egyidejű kijelzése
cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system
cobas TaqScreen MPX Test, version 2.0 for use on the cobas s 201 system IN VITRO DIAGNOSZTIKAI CÉLRA. cobas TaqScreen MPX Test, v2.0 MPX v2.0 96 Tests P/N: 05969492 190 cobas TaqScreen MPX Control Kit,
Rácsok Exkluzív széria
Rácsok Exkluzív széria átmérő jellemző Megnevezés a b x y NA háló zárható Nettó ár Bruttó ár TX1 150 150 190 190 x 680 Ft 864 Ft TX2 150 150 190 190 x x 772 Ft 980 Ft TX3 150 220 190 260 x 770 Ft 978 Ft
Új CITROËN JUMPY furgon
Új CITROËN JUMPY furgon 1000 COMFORT 1200 COMFORT L1H1 L1H1 L1H1 L1H1 L2H1 L2H1 L2H1 L2H2 Raktér térfogata (m3) / terhelhetőség (kg) 5 / 988 5 / 1000 5 / 1188 5 / 1200 6 / 1188 6 / 1200 6 / 1200 7 / 1200
Magas kifolyócsöves mosogató csaptelepek High spout sink mixers
Magas kifolyócsöves mosogató csaptelepek High sink mixers IC 915 IC 915 33.915.02.00 IC 915 I (inox) Rozsdamentes acél felület IC 915 I (inox) Stainless Steel Finish 33.915.02.0I 106 KOYHAI CSAPTELEPEK
FLEX KITCHEN TOOLS. Key features
2 0 1 5 FLEX KITCHEN TOOLS Key features solid 18/8 stainless steel spring steel core Flexible silicone head for easy scraping Spring steel core for better stirring results Noiseless during use Will not
Oncogenic stress sensitizes murine cancers to hypomorphic suppression of ATR
Oncogenic stress sensitizes murine cancers to hypomorphic suppression of ATR David W. Schoppy 1, Ryan L. Ragland 1, Oren Gilad 1, Nishita Shastri 1, Ashley A. Peters 1, Matilde Murga 2, Oscar Fernandez-Capetillo
TAVASZI AKCIÓK 2009 ÚJDONSÁGAI
TÉLI-TAVASZI TAVASZI AKCIÓK 2009 ÚJDONSÁGAI 2009.01.22.-2009.03.31. 1 MACHEREY NAGEL NucleoBond Xtra Midi /Maxi /EF Új generációs ioncserélıs cserélıs Plazmid tisztító kit Save up to 68% of your time,
ÚJ CITROËN JUMPER FURGON ÁRLISTA
ÚJ CITROËN JUMPER FURGON ÁRLISTA Nettó listaár Bruttó listaár ÚJ JUMPER FURGON 28 L1H1 2.2 HDI 110 2CU91BHDP604A0C0 5 326 000 6 764 020 30 L1H1 2.2 HDI 110 2CU91DHDP604A0C0 5 451 000 6 922 770 30 L1H1
Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia
Fehérje expressziós rendszerek Gyógyszerészi Biotechnológia Expressziós rendszerek Cél: rekombináns fehérjék előállítása nagy tisztaságban és nagy mennyiségben kísérleti ill. gyakorlati (therapia) felhasználásokra
Kutatási célú vegyszerek GINOP
Kutatási célú vegyszerek GINOP-2.3.2-15-2015-00021 Közbeszerzési Értesítő száma: 2018/183 Beszerzés tárgya: Árubeszerzés Hirdetmény típusa: Ajánlati/Részvételi felhívás/2015 EUHL Eljárás fajtája: Nyílt
THS710A, THS720A, THS730A & THS720P TekScope Reference
THS710A, THS720A, THS730A & THS720P TekScope Reference 070-9741-01 Getting Started 1 Connect probes or leads. 2 Choose SCOPE 3 or METER mode. Press AUTORANGE. Copyright Tektronix, Inc. Printed in U.S.A.
SZABÁLYSÉRTÉSI IRATOK ÜGYKEZELÉSI SZABÁLYZATA
BELÜGYMINISZTÉRIUM TITKÁRSÁGA 10 2 4 9 2 / 1 9 74. BELSŐ HASZNÁLATRA! 19 Sorszám: SZABÁLYSÉRTÉSI IRATOK ÜGYKEZELÉSI SZABÁLYZATA 1975 ÁBTL - 4.2-10 - 2492/1974 /1 BELÜGYMINISZTÉRIUM TITKÁRSÁGA 10-2492/
cobas 4800 CT/NG Test
cobas 4800 CT/NG Test IN VITRO DIAGNOSZTIKAI CÉLRA. cobas 4800 System Sample Preparation Kit c4800 SMPL PREP 960 Tests P/N: 05235804190 240 Tests P/N: 05235782190 cobas 4800 CT/NG Amplification/Detection
A fehérjék harmadlagos vagy térszerkezete. Még a globuláris fehérjék térszerkezete is sokféle lehet.
A fehérjék harmadlagos vagy térszerkezete Még a globuláris fehérjék térszerkezete is sokféle lehet. A ribonukleáz redukciója és denaturálódása Chrisian B. Anfinsen A ribonukleáz renaturálódása 1972 obel-díj
Átlagtermés és rekordtermés 8 növénykultúrában
Átlagtermés és rekordtermés 8 növénykultúrában Növény Rekord termés * Átlag termés * Veszteség típusa Biotikus Abiotikus Abiotikus stressz okozta kiesés (% a rekord terméshez képest) Kukorica 19300 4600
Dräger X-am 5100 Egygáz érzékelésére alkalmas eszköz
Dräger X-am 5100 Egygáz érzékelésére alkalmas eszköz Petrolkémiai termékek, aszeptikus csomagolások vagy rakéta üzemanyag kezeléséhez: a Dräger X-am 5100 egycsatornás hordozható gázérzékelő garantálja,
M Sulyok Gábor A HUMANITÁRIUS INTERV ENC IÓ EL MÉ L ETE É S G Y AK O RL ATA P h.d. é r t e k e z é s t é z i s e i i s k o l c 2 0 0 3. M I. A KUTATÁSI FELADAT A k u t a t á s a h u ma n i t á r i u s
kpis(ppk20) kpis(ppk46)
Table S1. C. elegans strains used in this study Strains carrying transgenes Strain Transgene Genotype Reference IT213 tcer-1 prom:tcer-1orf:gfp:tcer-1 3'utr unc-119(ed3) III; kpis(ppk6) This study IT283
Limitations and challenges of genetic barcode quantification
Limitations and challenges of genetic barcode quantification Lars hielecke, im ranyossy, ndreas Dahl, Rajiv iwari, Ingo Roeder, Hartmut eiger, Boris Fehse, Ingmar lauche and Kerstin ornils SUPPLEMENRY
!" #$%& ' % '( ) # # '( KLMNO!./0 1 5 H `a )5,) ) ( ;E ) \ J& ] ) 1.^ <B5 ` A) c HE )`7? ; ^ ) : ;;/,!] ) 1.` A ^ N0< ;:)I >? 7) >S,-Q 1. M "2 1.` A M
!" #$%& ' % '( ) # # '( KLMNO!./0 1 5 H `a )5,) ) ( ;E ) \ J& ] ) 1.^ ? 7) >S,-Q 1. M "2 1.` A M ^!"#$ :011%&' 11% $. */*-.*: 7 D] " @ W$ Z? ) ) b
therascreen BRAF Pyro Kit Kézikönyv 24
Március 2015 therascreen BRAF Pyro Kit Kézikönyv 24 2. kiadás In vitro diagnosztikai használatra 971470 QIAGEN GmbH, QIAGEN Strasse 1, 40724 Hilden, NÉMETORSZÁG R2 1074213HU Sample & Assay Technologies
Mapping Sequencing Reads to a Reference Genome
Mapping Sequencing Reads to a Reference Genome High Throughput Sequencing RN Example applications: Sequencing a genome (DN) Sequencing a transcriptome and gene expression studies (RN) ChIP (chromatin immunoprecipitation)
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Supplementary Figure S1.
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Sheila I. Jensen 1*, Rebecca M. Lennen 1, Markus J. Herrgård 1, Alex T. Nielsen 1*
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
Diagnosztikai célú molekuláris biológiai vizsgálatok
Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai
HUSQVARNA ÁRLISTA 2016 Január 04-től (visszavonásig)
HUSQVARNA ÁRLISTA Január 04-től (visszavonásig) Nettó listaár Elektromos láncfűrészek 321 Electric/ KIFUTÓ MODELL 967 54 71-66 77 600 Ft 61 102 Ft 420 Electric/ várhatóan május végétől érhető el 967 20
LTI Rendszerek Dinamikus Analízise és Szabályozásának Alapjai
Diszkrét és hibrid diagnosztikai és irányítórendszerek LTI Rendszerek Dinamikus Analízise és Szabályozásának Alapjai Hangos Katalin Közlekedésautomatika Tanszék Rendszer- és Irányításelméleti Kutató Laboratórium
UFS Productspecification
Page 1 of 5 General Information Dry mix for 'Potato Flakes with Milk' - the mixture contains skimmed milk powder - solely water is necessary for the preparation of the potato mash - bulk density 380-420
Az árváltoztatás jogát fenntartjuk. www.betamax.hu
Az árváltoztatás jogát fenntartjuk. www.betamax.hu Rendkívüli ajánlat! www.betamax.hu 1 www.betamax.hu 1946A RENDKÍVÜLI AJÁNLAT 1946A Vákuumos levegős popszegecshúzó - Cserélhető 2.4-3.2-4.0-4.8 mm-es
Mikroökonómia 11. elıadás
Mikroökonómia 11. elıadás ÁLTALÁNOS EGYENSÚLY ELMÉLET - folytatás Bacsi, 11. ea. 1 A TERMELÉS ÉS CSERE ÁLT. EGYENSÚLYA ÁRAK NÉLKÜL/1 termelés: hatékony input allokáció csere: hatékony output allokáció
1: Idõ(tartam), frekvencia (gyakoriság) mérés
MÉRÉSTECHNIKA tárgy Villamosmérnöki szak, nappali II. évf. 4. szem. (tavaszi félév) Fakultatív gyakorlat (2. rész) A pdf file-ok olvasásához Adobe Acrobat Reader szükséges. További feladatokat a jegyzet:
Musto kollekciónk Utolsó frissités 2013. június 17. hétfõ 15:51
kollekciónk Utolsó frissités 2013. június 17. hétfõ 15:51 Aktuális MUSTO ÁRLISTA Kollekciónkból: URAKNAK HÖLGYEKNEK UNISEX Maritime hajósbolt - Lowrance halradar - hajó alkatrész és hajó felszerelés KIEGÉSZÍTÕK
ÁRLISTA. INOX - Magasan ötvözött, rozsda és saválló acélokra, Rm 1000Mpa szakítószilárdságig. HSSCo5 FÚRÓ
INOX - Magasan ötvözött, rozsda és saválló acélokra, Rm 1000Mpa szakítószilárdságig csúcsszög δ=130 ; Tűrés:h8 w2-101811-0100 DIN-338 1,00 HSSCo5 INOX w2-101811-0110 DIN-338 1,10 HSSCo5 INOX w2-101811-0120
MIKROÖKONÓMIA I. Készítette: K hegyi Gergely és Horn Dániel. Szakmai felel s: K hegyi Gergely. 2010. június
MIKROÖKONÓMIA I. Készült a TÁMOP-4.1.2-08/2/a/KMR-2009-0041 pályázati projekt keretében Tartalomfejlesztés az ELTE TáTK Közgazdaságtudományi Tanszékén az ELTE Közgazdaságtudományi Tanszék az MTA Közgazdaságtudományi
Energia automatizálás
Energia automatizálás "Smart Metering" tapasztalatok és megoldások a Siemenstől Smart metering és smart grid összefüggő vagy különböző dolog??? Rendszer áttekintés AMIS (Automated Metering and Information
Általános tudnivalók. Rendszerfelépítés
Általános tudnivalók A 3G3JV típusú inverter miniatőr frekvencia-átalakító, a felhasználónak lehetısége van választani sok beállítható paraméter közül. A táplálás speciális megoldásának köszönhetıen az
List of publications.
1 List of publications. 1. Venetianer,P., Ullmann,A. and Straub,F.B.: Die Rolle der Ribonukleinsaure bei der Pankreasamylasesynthese. Acta Physiol. Acad. Sci. Hung. Suppl. XVI. (1959) 58. 2. Straub,F.B.,
Egyéb kiegészítők Árlista Clean & Green Natural 500ml Ft / db A Clean & Green Active 500ml Ft / db A
Tisztítószerek 407716 Clean & Green Natural 500ml 3 880 Ft / db A 407717 Clean & Green Active 500ml 3 880 Ft / db A 409472 clean & green aqua oil - int.first/intensive care oiled surfaces 1 L 20 690 Ft
The role of aristolochene synthase in diphosphate activation
Supporting information for The role of aristolochene synthase in diphosphate activation Juan A. Faraldos, Verónica González and Rudolf K. Allemann * School of Chemistry, Cardiff University, Main Building,
The beet R locus encodes a new cytochrome P450 required for red. betalain production.
The beet R locus encodes a new cytochrome P450 required for red betalain production. Gregory J. Hatlestad, Rasika M. Sunnadeniya, Neda A. Akhavan, Antonio Gonzalez, Irwin L. Goldman, J. Mitchell McGrath,
SZŰRŐFORGATÓ BERENDEZÉSEK/ FILTRATION UNITS, PUMPS, VALVES, ACCESSORIES
SZŰRŐFORGATÓ BERENDEZÉSEK/ HOMOKSZUROS BERENDEZESEK / SANOF1LTER SETS U SE-T0P325 Tetőzelepe zűrőberendezéek / Top valve filter unit Top zűrőzett: zivattyú, üvegzálerőítée ÜPP tetőzelepe tartály alaplappal,
!"#$% % &' ()! &!BH# E.$ < < ^!"# ' c &! "! &! L Z 4S Z T\!T F E<6 6"+ #- : $1 -. F E< " (%!F &+" ' `!GF +'!" & &!G & (F V &!G +)%!* +", F &+ M#-. (/-
!"#$%% &' ()! &!BH# E.$ < < ^!"# ' c &!"! &!LZ 4S Z T\!T F E * 5 /(-,(/1 ( 6 9
A bioinformatika gyökerei
A bioinformatika gyökerei 1944: Avery a transforming principle a DNS 1952: Hershey és Chase perdöntő bizonyíték: a bakteriofágok szaporodásakor csak a DNS jut be a sejtbe 1953: Watson és Crick a DNS szerkezete
Mágneses adattárolás:
Mágneses adattárolás: Mágnesszalag, ferritgyűrű, buborékmemória ÁDÁM PÉTER ANYAGTUDOMÁNY MSC BUDAPEST, 2015.04.22. Miről is lesz szó? 2 Mágnesszalag- Rég- és közelmúlt - Vissza a jövőbe : 3 Mágnesszalag-
K 3 Home. K 3 Home, 1.601-813.0, 2016-06-24
A K3 Home típus Home Kit készlettel ideális magasnyomású mosó alkalomszerű használatra kisebb szennyeződések eltávolításához a ház körül. Ezen kívül nagy segítség kerékpárok, kerítések és motorkerékpárok
Fizikai alapú közelítő dinamikus modellek
P C R G Fizikai alapú közelítő dinamikus modellek a Paksi Atomerőmű primerkörével kapcsolatos feladatokra Hangos Katalin Folyamatirányítási Kutató Csoport MTA SzTAKI Publikációs Díjazottak Előadása 2006
Spontaneitás, entrópia
Spontaneitás, entrópia 6-1 Spontán folyamat 6-2 Entrópia 6-3 Az entrópia kiszámítása 6-4 Spontán folyamat: a termodinamika második főtétele 6-5 Standard szabadentalpia változás, ΔG 6-6 Szabadentalpia változás
CSAPTELEPEK & ZUHANYOK. Wir Bäder. www.teka.com
CSAPTELEPEK & ZUHANYOK Wir Bäder www.teka.com ÚJ - EXTRA ÁRAMLÁS V Í Z KŐ M E N T E S ZUHANYRENDSZEREK 46 cm 100-117 cm 104 cm Universe Pro zuhanyrendszer 79.002.72.00 EGYSZERŰ SZERELÉS EASY INSTALLATION
MEDENCEK, POTFOLIAK /
MEDENCEK, POTFOLAK / POOLNERS FUTURE-POOL FÉM-FÓLÁS MEDENCÉK/ FUTURE POOL METÁL WALL POOLS WTH LNER FUTURE-POOL medence Ovális alakú medencék / Óval swimmingpools FUTURE POOL Ovális alakú medence 0,6 m