Oncogenic stress sensitizes murine cancers to hypomorphic suppression of ATR
|
|
- Marika Pappné
- 5 évvel ezelőtt
- Látták:
Átírás
1 Oncogenic stress sensitizes murine cancers to hypomorphic suppression of ATR David W. Schoppy 1, Ryan L. Ragland 1, Oren Gilad 1, Nishita Shastri 1, Ashley A. Peters 1, Matilde Murga 2, Oscar Fernandez-Capetillo 2, J. Alan Diehl 1 and Eric J. Brown 1,3 1 Abramson Family Cancer Research Institute and the Department of Cancer Biology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 2 Genomic Instability Group, Spanish National Cancer Research Centre (CNIO), Madrid, Spain 3 To whom correspondence should be addressed: Abramson Family Cancer Research Institute and the Department of Cancer Biology, Perelman School of Medicine, University of Pennsylvania, 514 BRB II/III, 421 Curie Boulevard, Philadelphia, PA Phone: (215) Fax: (215) brownej@mail.med.upenn.edu
2 Supplemental Figure 1 Terminator FRT Mouse Intron 7/8 PGK/gb2 promoter End Casette Human Intron 7/8 Mouse Exon 7 FRT NeomycinR Human Exon 8 ATR seckel sequence (2624 bp) CCATAATGTCAAGGATCATCAACACAAATATAAGAAGAAACCTCCAGTAGTAGTAACTTGGATGTCT TTGGATTTTTATACAAAAGTGCTTAAAAGCTGTAGGAGTTTGTTAGAATCTGTTCAGAAACTTGAACT GGAATTAGTCATTGATAGCATGGTGAGAATTTGTGATGCTCTGATGTATATGCAAGgtgagtacaactaagtgat agacgttagtcattgtagatgaaggctttctgtttctgtttcaagtttaaatgcagaagtactgttaatattcagaatattttcaatttttctgttaattaagcttactggtagtttctg agtttcacatttacttgtatagcattttgatttggtcaatagacattcatttgaaacatttaaatgttttggtttgagaatctgaagaacactatgatccatatagatggtatatata aatgcatatggttttaagccacatctgatttcactggcctcacagacttcagcatgggcctggaagtatagctcagtggtagaatacatgttaaatgtgtgcaaggtttgtca cagatcactcccagttaaaacagaagattgtttcttgccctttgtttta aattaaccctcactaaagggcggccgcgaagttcctattctctagaaagtataggaactt cattctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcg cacacattccacatccaccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttccactcctcccctagtcaggaagttcccccccgccc cgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctt tggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcg gggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacc tgcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatgggatcggccattgaacaag atggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacgatcggctgctctgatgccgccgtgttccggct gtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacga cgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcacct tgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcat cgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctc aaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgact gtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgct ttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaataaagaccgaccaagcg acgtctgagagctccctggcgaattcggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgcggaagttcctattctctagaaa gtataggaacttcctcgagccctatagtgagtcgtatta cccgggtcacagacctcagaccatcgtttatagatctctgtgttaagaatttctgcttatccaatgatcatt atgatagtatttcaaatgtctttatttttatttaaaagagatatgattaaggaaaagttataattaatgacttattttgtgcttctgtagtaaacagttcatttgaa GATCATATCCTGGAAGATTTATGTGGTATGCTCTCACTTCCATGGATTTATTCCCATTCTGATGATGG CTGTTTAAAGTTGACCACATTTGCCGCTAATCTTCTAACATTAAGCTGTAGGATTTCAGATAGCTATT CAPS: exon sequence (mouse exon 7 and human exon 8) Lower case: intron sequence (mouse or human) Bold: Targeting Cassette (FRT-PGK-gb2-neo-FRT, GeneBridges), = cassette boundaries Highlighting: Green: FRT; Yellow: Promoter; Blue: Neomycin R; Purple: Neo forward & exon 8 reverse primers Underlined: sequence confirmed by cloning and sequencing Supplemental Figure 1. Illustration and sequence of 5 region of humanized ATR seckel allele. (Top Panel) Illustration of 5 region humanized ATR seckel allele with identification of relevant features. (Bottom Panel) Sequence of region represented in top panel. Sequence confirmed by cloning and sequencing is underlined.
3 Supplemental Figure 2 Supplemental Figure 2. Multiple ATR seckel mrna transcripts and a discriminating qrt-pcr assay to quantify the relative amount of correctly spliced mouse and human ATR in adult tissues. (A) PCR analysis of reverse transcribed RNA isolated from adult bone marrow using non-discriminating primers amplifying exons 8 to 10 of ATR (left panel) and primers amplifying the Neomycin resistance gene to exon 8 in three ATR flox/seckel mice (right panel). In ATR flox/seckel marrow, ATR containing exon 9 (500bp band) is contributed to by both mouse ATR (ATR flox ) and human ATR (ATR seckel ). Mis-spliced ATR lacking exon 9 (300bp band) can be observed below the band representing correctly spliced ATR (left panel). Several transcripts of varying lengths were observed using primers recognizing the Neomycin resistance gene and exon 8 (right panel). The ~550 bp band corresponds to non-terminated transcripts from the Neo cassette (primer binding sites shown in Figure 1). Splicing into and out of Neo-containing cassettes has been well documented (1-4). (B) Diagram of mouse ATR (ATR wt, top) and humanized Seckel ATR (bottom), depicting mouse exons (black boxes) and human exons (blue boxes), and the ATR seckel mutation (*). The horizontal bars above each allele denote the binding location of the discriminating qrt-pcr assays (primer and probe sets) designed to recognize either correctly spliced mouse ATR (blue bar) or correctly spliced human ATR (pink bar). (C) Discriminating qrt-pcr assays as described in (B). (D) PCR analysis of RNA isolated from MEF cultures (left panels) or 293T cultures (right panels) using primers from C. The mouse PCR primer set amplifies mouse ATR but does not detect human ATR, while the human PCR primer set fails to detect mouse ATR but recognizes human ATR. (E) Assessment of the amplification efficiency of the qrt-pcr assays listed in C. Amplification efficiency was calculated from standard curve analysis of RNA isolated from adult bone marrow (n = 5) using the equation E (efficiency) = (10 1/slope - 1) 100, as described in manufacturer s instructions (Applied Biosystems). The amplification of each assay did not differ significantly from the other and amplification efficiency of each assay was consistently 90% across a range of tissues and culture samples.
4 Supplemental Figure 3 Supplemental Figure 3. ATR suppression has no appreciable effect on the representation of lineage-negative bone marrow progenitors. (A) Quantification of correctly-spliced mouse (ATR flox ) and human (ATR seckel ) ATR transcript in sorted adult (6-8 week-old) lineage-negative bone marrow (CD3-negative, B220-negative, Ter119- negative, Mac1-negative). (B) Absolute number of lineage-negative bone marrow cells (CD3-negative, B220-negative, Ter119-negative, Mac1-negative) obtained from 4 hindlimb bones of mice at the indicated time points after initial TAM treatment (n = 5-15 mice per genotype, per time point).
5 Supplemental Figure 4 Supplemental Figure 4. ATR suppression does not overtly affect bone marrow or intestinal homeostasis for extended periods of time. (A) H&E stained sections of the humeral bone from TAM-treated ATR flox/+ Cre-ERT2 + or ATR flox/seckel Cre-ERT2 + mice at 3 months after initial treatment, 200X magnification. (B, C) Absolute number of lineage-negative bone marrow cells (CD3-negative, B220-negative, Ter119-negative, Mac1-negative) or myeloid cells (Mac1 +, Gr1 + ) obtained from 4 hindlimb bones of mice at 3 months after initial TAM treatment (n = 2-5 mice per genotype). (D) Abundance of the ATR flox -recombined allele (ATR Δ ) in the bone marrow of TAM-treated ATR flox/+ Cre- ERT2 + or ATR flox/seckel Cre-ERT2 + mice at 3 months after initial treatment, as determined through qpcr analysis of genomic DNA isolated from each tissue (n = 3-5 mice per genotype). (E) H&E stained sections of intestines from TAM-treated ATR flox/+ Cre-ERT2 + or ATR flox/seckel Cre-ERT2 + mice at 3 months after initial treatment, 200X magnification. (F) Weight of mice at 3 months after initial treatment. (G) Abundance of the ATR flox -recombined allele (ATR Δ ) in the intestinal epithelium of TAM-treated ATR flox/+ Cre-ERT2 + or ATR flox/seckel Cre-ERT2 + mice at 3 months after initial treatment.
6 Supplemental Figure 5 Genotype Post-Tam Status at % Mac1 + Gr1 + Weight % ATR (% ATR-deleted) endpoint (Marrow) (grams) Brain Marrow Intestine Skin ATR flox/seckel Cre-ERT2 + 8 months Alive, well ATR flox/seckel Cre-ERT2 + 8 months Alive, well ATR flox/seckel Cre-ERT2 + 8 months Alive, well ATR flox/seckel Cre-ERT months Alive, well ATR flox/seckel Cre-ERT months Alive, well ATR flox/seckel Cre-ERT months Alive, well N/A ATR flox/seckel Cre-ERT months Alive, well ATR flox/seckel Cre-ERT months Alive, well Supplemental Figure 5. Analysis of ATR flox/seckel Cre-ERT2 + mice at extended time points (8-16 months) following tamoxifen treatment. Determination of Mac1 + Gr1 + and the continued representation of ATR flox -recombined cells over time were performed as described in Methods.
7 Supplemental Figure 6 Supplemental Figure 6. ATR suppression is tolerated in p53-deficient mice. (A,B) Quantification of correctlyspliced ATR transcript in adult marrow (A) and intestinal epithelium (B); n = 5 mice per genotype, per tissue. (C) Number of H2AX-positive cells in adult tissues 10 days following initiation of TAM treatment. n= 3-5 mice and >10 images (200x) per tissue were quantified. (D) Number of Mac1+,Gr1+ cells from 4 hindlimb bones of mice at the indicated time points after TAM; n = 5-15 mice per genotype, per time point. (E) H&E stained sections of intestines from TAM-treated mice, 200X magnification. (F) Abundance of the ATRflox-recombined allele (ATRΔ) in the bone marrow (left) and intestines (right) of TAM-treated mice at the indicated time points.
8 Supplemental Figure 7 Supplemental Figure 7. Derivation of immortalized/transformed murine embryonic fibroblast (MEF) lines. (A) Method used to produce MEF lines used in Figures 4 through 6 of the main text. (B) Representative FACS analysis of MEF lines obtained during cell sorting (isolation of GFP+ cells). (C) Quantification of correctly-spliced mouse (ATR flox ) and human (ATR seckel ) ATR transcript in sorted MEF lines.
9 Supplemental Figure 8 p21 expression Supplemental Figure 8. Moderate expression levels of p53 R175H in p53 +/+ ATR flox/seckel and control cell lines promotes tumor growth in NCr nude mice but does not inhibit DNA damage-induced transcriptional responses. (A) Steady state levels of p53 in cell lines expressing wild-type p53 in the absence (ctrl) or the presence (p53 mut ) of stable ectopic expression of p53 R175H. Expression of p53 R175H was mediated through retrovirus transduction and selection as described in Methods. (B) Nude tumor growth of cell lines in A following transplantation into NCr nude mice. Each point represents the size individual tumors 8 days after transplantation. Transplantation was performed as described in Figure 4 and Methods. (C) DNA damage inducible p53-dependent expression of p21 in p53 R175H - expressing cells. ATR flox/seckel MEF cells lines (ATR expressing; not TAM treated) were exposed to 10 Gy ionizing radiation. Three hours later, cells were harvested and quantified for p21 mrna transcript levels by qrt-pcr. Lines expressing the p53 R175H mutant in a p53 wild-type background are noted (p53 R175H ). Cell lines that lack p53 expression (p53 -/- ) were used as negative controls. Cell lines used for these experiments are among the same lines utilized in Figures 4, 5 and 6.
10 Supplemental Figure 9 Supplemental Figure 9. Low doses of ATR inhibitor stimulate Chk1-S345 phosphorylation. (A) Asynchronous passage-immortalized murine fibroblasts were treated with ATR-45 inhibitor or 5 M aphidicolin for 6 hours. The inhibitory effects of 3 M ATR-45 were readily observed under the saturating levels of replication stress produced by 5 M aphidicolin treatment. In contrast, 1 M ATR-45 stimulated Chk1 phosphorylation in the absence of aphidicolin treatment. (B) The stimulatory effects of 1 M ATR-45 inhibitor (6 hours treatment) on Chk1 phosphorylation were also observed in NIH3T3 stable cell lines (Figure 7 and 8) transduced with empty vector, H-ras G12V or c-mycexpressing retrovirus. Samples in A and B were normalized for total protein prior to loading. Supplemental References 1. Meyers EN, Lewandoski M, Martin GR. An Fgf8 mutant allelic series generated by Cre- and Flpmediated recombination. Nat Genet. 1998;18: Nagy A, et al. Dissecting the role of N-myc in development using a single targeting vector to generate a series of alleles. Curr Biol. 1998;8: Levin SI, Meisler MH. Floxed allele for conditional inactivation of the voltage-gated sodium channel Scn8a (NaV1.6). Genesis. 2004;39: Ragland RL, Arlt MF, Hughes ED, Saunders TL, Glover TW. Mice hypomorphic for Atr have increased DNA damage and abnormal checkpoint response. Mamm Genome. 2009; 20(6):
11 Supplemental Methods Quantitative RT-PCR. RNA was isolated through a TRIzol (Invitrogen) extraction, followed by further purification through an RNeasy Mini Kit (Qiagen) according to manufacturer s instructions. cdna was produced with a High Capacity cdna Reverse Transcription Kit (Applied Biosystems) according to manufacturer s instructions. cdna was then serially diluted and used in quantitative RT-PCR reactions with assays designed to detect either correctly spliced (e.g. containing exon 9) mouse ATR or human ATR, as described in Figure S2. All reactions were performed in triplicate for each sample with TaqMan Universal PCR Master Mix (Applied Biosystems) on the Applied Biosystems 7900HT Sequence Detection System. Histological Analysis. Tissues were fixed in 4% paraformaldehyde (PFA) at 4 o C overnight, dehydrated, and embedded in paraffin. For histological examination, tissues were sectioned and stained with hematoxylin and eosin (H&E) or specific antibodies. γh2ax was detected by immunofluorescence with mouse anti-phospho- H2AX (Ser139)-FITC conjugated antibodies (1:50 dilution, Millipore A). Bone marrow (FACS) analysis. Bone marrow was isolated from 4 hindlimb bones by flushing into cold media and filtering through a nylon mesh strainer. RBCs were lysed using ACK Lysing Buffer (Lonza), and cells were counted with a Coulter Counter (Becton Dickson). Conjugated antibodies used for staining included: Mac1/CD11b-APC (M1/70), Gr1/Ly-6G-PE (8C5), CD3-FITC (2C11), B220-FITC (6B2), and TER119-FITC (TER-119). All antibodies were obtained from ebiosciences. Dead cells were excluded with 7-AAD, cell analysis was performed on a FACSCalibur (Becton Dickson), and data was analyzed using FlowJo version (Tree Star). Quantitative PCR. Genomic DNA was isolated from tissues using a DNeasy Blood and Tissue Kit (Qiagen) as per manufacturer s instructions. DNA was diluted to a concentration of 2ng/μl in nuclease-free water and used directly in subsequent PCR reactions. Sequence-specific primers and probes targeting the conditional
12 region of the ATR flox gene were designed using Primer Express (Applied Biosystems). Primer/probe sequences were: ATR flox forward primer: 5 - CCGCTCGCTCGGTTTAAA ATR flox reverse primer: 5 - TCCCCGCATGCAAGCTT ATR flox probe: 5-6FAM-TCATAACTTCGTATAGCATACA Mouse GAPD (Applied Biosystems) was purchased as a pre-developed TaqMan assay and used as an endogenous control in ΔΔCT analysis. PCR reactions were performed in a final volume of 20μl using TaqMan Universal PCR Master Mix (Applied Biosystems), 8ng of genomic DNA, 0.9μM of each primer and 0.25μM of probe. All reactions were carried out in triplicate for each sample and performed on the Applied Biosystems 7900HT Sequence Detection System. Quantification of S-phase content/apoptosis. Cells were treated with 10μM EdU (Invitrogen), collected 30 minutes later, and fixed in 70% ethanol. EdU incorporation was detected with a Click-iT EdU Alexa Fluor 647 Assay Kit (Invitrogen). For detection of apoptosis, cells were collected, resuspended to a final concentration of 1x10 6 cells per ml in 1X binding buffer (0.1M Hepes, 1.4M NaCl, 25 mm CaCl2, ph 7.4) and stained with Annexin V-APC and 7-AAD (BD Pharmingen) according to manufacturer s instructions. Cell analysis was performed on a FACSCalibur (Becton Dickson).
Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and
WT sham Trpv4 -/- sham Saline 10µM GSK1016709A P value Saline 10µM GSK1016709A P value Number 10 10 8 8 Intercontractile interval (sec) 143 (102 155) 98.4 (71.4 148) 0.01 96 (92 121) 109 (95 123) 0.3 Voided
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
Expression analysis of PIN genes in root tips and nodules of Lotus japonicus
Article Expression analysis of PIN genes in root tips and nodules of Lotus japonicus Izabela Sańko-Sawczenko 1, Dominika Dmitruk 1, Barbara Łotocka 1, Elżbieta Różańska 1 and Weronika Czarnocka 1, * 1
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo Yuma Oka and Thomas N. Sato Supplementary Figure S1. Whole-mount smfish with and without the methanol pretreatment.
(A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5
Fig. S1. Brg1 ablation leads to abnormal villous structure in the duodenum in the perinatal period (A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5 (B, E), and P0.5
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
University of Bristol - Explore Bristol Research
Al-Salihi, S. A. A., Scott, T. A., Bailey, A. M., & Foster, G. D. (2017). Improved vectors for Agrobacterium mediated genetic manipulation of Hypholoma spp. and other homobasidiomycetes. Journal of Microbiological
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
Suppl. Materials. Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids. Germany
Suppl. Materials Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids Stephanie Bresan 1, Anna Sznajder 1, Waldemar Hauf 2, Karl Forchhammer 2, Daniel Pfeiffer 3 and Dieter Jendrossek 1 1 Institute
Flowering time. Col C24 Cvi C24xCol C24xCvi ColxCvi
Flowering time Rosette leaf number 50 45 40 35 30 25 20 15 10 5 0 Col C24 Cvi C24xCol C24xCvi ColxCvi Figure S1. Flowering time in three F 1 hybrids and their parental lines as measured by leaf number
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
Forensic SNP Genotyping using Nanopore MinION Sequencing
Forensic SNP Genotyping using Nanopore MinION Sequencing AUTHORS Senne Cornelis 1, Yannick Gansemans 1, Lieselot Deleye 1, Dieter Deforce 1,#,Filip Van Nieuwerburgh 1,#,* 1 Laboratory of Pharmaceutical
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites
Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites Selwyn Quan *, Ole Skovgaard, Robert E. McLaughlin, Ed T. Buurman,1, and Catherine L. Squires * Department
Modular Optimization of Hemicellulose-utilizing Pathway in. Corynebacterium glutamicum for Consolidated Bioprocessing of
[Supplementary materials] Modular Optimization of Hemicellulose-utilizing Pathway in Corynebacterium glutamicum for Consolidated Bioprocessing of Hemicellulosic Biomass Sung Sun Yim 1, Jae Woong Choi 1,
Supplemental Information. RNase H1-Dependent Antisense Oligonucleotides. Are Robustly Active in Directing RNA Cleavage
YMTHE, Volume 25 Supplemental Information RNase H1-Dependent Antisense Oligonucleotides Are Robustly Active in Directing RNA Cleavage in Both the Cytoplasm and the Nucleus Xue-Hai Liang, Hong Sun, Joshua
Supporting Information
Supporting Information Plasmid Construction DNA cloning was carried out according to standard protocols. The sequence of all plasmids was confirmed by DNA sequencing and amplified using the E. coli strain
A cell-based screening system for RNA Polymerase I inhibitors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information A cell-based screening system for RNA Polymerase I inhibitors Xiao Tan,
The role of aristolochene synthase in diphosphate activation
Supporting information for The role of aristolochene synthase in diphosphate activation Juan A. Faraldos, Verónica González and Rudolf K. Allemann * School of Chemistry, Cardiff University, Main Building,
A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon
A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,
Using the CW-Net in a user defined IP network
Using the CW-Net in a user defined IP network Data transmission and device control through IP platform CW-Net Basically, CableWorld's CW-Net operates in the 10.123.13.xxx IP address range. User Defined
Whole mount in situ hybridization, sectioning, and immunostaining Ribonuclease protection assay (RPA) Collagen gel tube formation assay
Whole mount in situ hybridization, sectioning, and immunostaining In situ hybridization for tie-1 and lncrna tie-1as and sectioning of ISH stained embryos were performed according to previously published
Supplementary Figure 1
Supplementary Figure 1 Plot of delta-afe of sequence variants detected between resistant and susceptible pool over the genome sequence of the WB42 line of B. vulgaris ssp. maritima. The delta-afe values
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
Construction of a cube given with its centre and a sideline
Transformation of a plane of projection Construction of a cube given with its centre and a sideline Exercise. Given the center O and a sideline e of a cube, where e is a vertical line. Construct the projections
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit.
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit. MYB Primer pairs TC AtMYB Forward Reverse TC199266 MYB12 AGGCTCTTGGAGGTCGTTACC CAACTCTTTCCGCATCTCAATAATC
ANNEX V / V, MELLÉKLET
ANNEX V / V, MELLÉKLET VETERINARY CERTIFICATE EMBRYOS OF DOMESTIC ANIMALS OF THE BOVINE SPECIES FOR IMPORTS COLLECTED OR PRODUCED BEFORE 1 st JANUARY 2006 ÁLLAT-EGÉSZSÉGÜGYI BIZONYÍTVÁNY 2006. JANUÁR 1-JE
The beet R locus encodes a new cytochrome P450 required for red. betalain production.
The beet R locus encodes a new cytochrome P450 required for red betalain production. Gregory J. Hatlestad, Rasika M. Sunnadeniya, Neda A. Akhavan, Antonio Gonzalez, Irwin L. Goldman, J. Mitchell McGrath,
Összefoglalás. Summary. Bevezetés
A talaj kálium ellátottságának vizsgálata módosított Baker-Amacher és,1 M CaCl egyensúlyi kivonószerek alkalmazásával Berényi Sándor Szabó Emese Kremper Rita Loch Jakab Debreceni Egyetem Agrár és Műszaki
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Supplementary Figure S1.
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Sheila I. Jensen 1*, Rebecca M. Lennen 1, Markus J. Herrgård 1, Alex T. Nielsen 1*
4 vana, vanb, vanc1, vanc2
77 1) 2) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 12 7 17 4 8 2003 1 2004 7 3 Enterococcus 5 Enterococcus faecalis 1 Enterococcus avium 1 Enterococcus faecium 2 5 PCR E. faecium 1 E-test MIC 256 mg/ml vana MRSA MRSA
FÖLDRAJZ ANGOL NYELVEN
Földrajz angol nyelven középszint 0821 ÉRETTSÉGI VIZSGA 2009. május 14. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ OKTATÁSI ÉS KULTURÁLIS MINISZTÉRIUM Paper
Széchenyi István Egyetem www.sze.hu/~herno
Oldal: 1/6 A feladat során megismerkedünk a C# és a LabVIEW összekapcsolásának egy lehetőségével, pontosabban nagyon egyszerű C#- ban írt kódból fordítunk DLL-t, amit meghívunk LabVIEW-ból. Az eljárás
DECLARATION OF PERFORMANCE No. GST REV 1.03 According to Construction Products Regulation EU No. 305/2011
DECLARATION OF PERFORMANCE No. According to Construction Products Regulation EU No. 305/2011 This declaration is available in the following languages: English Declaration of Performance Page 2-3 Hungarian
Mapping Sequencing Reads to a Reference Genome
Mapping Sequencing Reads to a Reference Genome High Throughput Sequencing RN Example applications: Sequencing a genome (DN) Sequencing a transcriptome and gene expression studies (RN) ChIP (chromatin immunoprecipitation)
Supplementary Figure 1
Supplementary Figure 1 Barcode analysis for the identification of mirnas that break B cell tolerance. (a) Barcode identification method. Genomic DNA samples from purified splenic B cells that escaped tolerance
SOLiD Technology. library preparation & Sequencing Chemistry (sequencing by ligation!) Imaging and analysis. Application specific sample preparation
SOLiD Technology Application specific sample preparation Application specific data analysis library preparation & emulsion PCR Sequencing Chemistry (sequencing by ligation!) Imaging and analysis SOLiD
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis
Factor Analysis Factor analysis is a multiple statistical method, which analyzes the correlation relation between data, and it is for data reduction, dimension reduction and to explore the structure. Aim
Új temékek az UD- GenoMed Kft. kínálatában!
Új temékek az UD- GenoMed Kft. kínálatában! Szolgáltatásaink: Medical Genomic Technologies Kft. Betegtoborzás és biobanking Bioinformatika o Adatelemzés/adatbányászás o Integrált adatbázis készítés Sejtvonal
University of Bristol - Explore Bristol Research
Tan, B. G., Wellesley, F. C., Savery, N. J., & Szczelkun, M. D. (2016). Length heterogeneity at conserved sequence block 2 in human mitochondrial DNA acts as a rheostat for RNA polymerase POLRMT activity.
i1400 Image Processing Guide A-61623_zh-tw
i1400 Image Processing Guide A-61623_zh-tw ................................................................. 1.............................................................. 1.........................................................
FAMILY STRUCTURES THROUGH THE LIFE CYCLE
FAMILY STRUCTURES THROUGH THE LIFE CYCLE István Harcsa Judit Monostori A magyar társadalom 2012-ben: trendek és perspektívák EU összehasonlításban Budapest, 2012 november 22-23 Introduction Factors which
EN United in diversity EN A8-0206/419. Amendment
22.3.2019 A8-0206/419 419 Article 2 paragraph 4 point a point i (i) the identity of the road transport operator; (i) the identity of the road transport operator by means of its intra-community tax identification
vancomycin CFSL cefepime CFPM cefozopran CZOP 4 cephem cefpirome CPR cefoselis Inhibitory Concentration FIC index
vancomycin cephem 1a 2 1 1 2 a : 15 4 15 15 9 5 1999 2 methicillin MRSA12 vancomycinvcm 4 cephem cefpiromecprcefoseliscfslcefepimecfpmcefozopranczop VCM CPR 12 77 75.5CFSL 82.4CFPM 81 79.4 CZOP 76 74.5
Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and
1 2 3 4 5 Journal name: Applied Microbiology and Biotechnology Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and evaluation of its effect on lignocellulosic
FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY
Földrajz angol nyelven középszint 0513 ÉRETTSÉGI VIZSGA 2005. május 18. FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY KÖZÉPSZINTŰ ÍRÁSBELI VIZSGA STANDARD LEVEL WRITTEN EXAMINATION Duration of written examination:
Horizontal gene transfer drives adaptive colonization of apple trees by the fungal pathogen Valsa mali. Zhiyuan Yin, Baitao Zhu, Hao Feng, Lili Huang*
Supplementary Information Horizontal gene transfer drives adaptive colonization of apple trees by the fungal pathogen Valsa mali Zhiyuan Yin, Baitao Zhu, Hao Feng, Lili Huang* State Key Laboratory of Crop
FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY
Földrajz angol nyelven középszint 0612 É RETTSÉGI VIZSGA 2006. október 25. FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA INTERMEDIATE LEVEL WRITTEN EXAM JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ
MELLÉKLET / ANNEX. EU MEGFELELŐSÉGI NYILATKOZAT-hoz for EU DECLARATION OF CONFORMITY
TRACON BUDAPEST KFT. TRACON BUDAPEST LTD. 2120 DUNAKESZI, PALLAG U. 23. TEL.: (27) 540-000, FAX: (27) 540-005 WWW.TRACON.HU EU MEGFELELŐSÉGI NYILATKOZAT, a 79/1997. (XII. 31.) IKIM számú és a 374/2012.
PIACI HIRDETMÉNY / MARKET NOTICE
PIACI HIRDETMÉNY / MARKET NOTICE HUPX DAM Másnapi Aukció / HUPX DAM Day-Ahead Auction Iktatási szám / Notice #: Dátum / Of: 18/11/2014 HUPX-MN-DAM-2014-0023 Tárgy / Subject: Változások a HUPX másnapi piac
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Karancsi Lajos Gábor Debreceni Egyetem Agrár és Gazdálkodástudományok Centruma Mezőgazdaság-, Élelmiszertudományi és Környezetgazdálkodási
Téli kedvezményes ajánlataink
Téli kedvezményes ajánlataink Ajánlataink 2017 január 31-ig érvényesek! BIOBASE műszerek a NucleotestBio Kft. kínálatában! Steril box-ok, lamináris box-ok: Hűtők, fagyasztók, ultramélyhűtők, autoklávok,
On The Number Of Slim Semimodular Lattices
On The Number Of Slim Semimodular Lattices Gábor Czédli, Tamás Dékány, László Ozsvárt, Nóra Szakács, Balázs Udvari Bolyai Institute, University of Szeged Conference on Universal Algebra and Lattice Theory
DECLARATION OF PERFORMANCE CPR-20-IC-040
Page 1 of 4 DECLARATION OF PERFORMANCE CPR-20-IC-040 1. Unique identification code of the product-type: Name: Item Number: UPONOR RENOVIS PANEL PACK 1.2/0.8; 5 M2 1062201 UPONOR RENOVIS PANEL PACK 1.2/0.8;
2016 év eleji ajánlatok. Speciális áraink 2016 május 31-ig érvényesek!
2016 év eleji ajánlatok Speciális áraink 2016 május 31-ig érvényesek! BIOBASE műszerek a NucleotestBio Kft. kínálatában! Steril box-ok, lamináris box-ok: Hűtők, fagyasztók, ultramélyhűtők, autoklávok,
TELJESÍTMÉNY NYILATKOZAT 0832-CPD-1651
E-mail: info@fulleon.co.uk Web: www.cooperfulleon.co m TELJESÍTMÉNY NYILATKOZAT 0832-CPD-1651 Termék azonosító kód: ROLP/SV és ROLP/SV/WP Típus, adagszám vagy gyári szám, illetve bármilyen más elem, amely
Formula Sound árlista
MIXERS FF-6000; FF6000P Formula Sound 160 6 channel dual format DJ mixer with removable fader panel. (Supplied with linear faders) Formula Sound 160P As above but with PRO X crossfade fitted. Formula Sound
RAYMOND RIFE gyógyító frekvenciái
RAYMOND RIFE gyógyító frekvenciái Sárgabarackmag és a B17 vitamin Szerencsére egyre többen hallottak már a regeneráló, gyógyulást segítõ frekvenciákról. Ezeket a készülékeket R. Raymond Rife munkáinak
Contact us Toll free (800) fax (800)
Table of Contents Thank you for purchasing our product, your business is greatly appreciated. If you have any questions, comments, or concerns with the product you received please contact the factory.
(NGB_TA024_1) MÉRÉSI JEGYZŐKÖNYV
Kommunikációs rendszerek programozása (NGB_TA024_1) MÉRÉSI JEGYZŐKÖNYV (5. mérés) SIP telefonközpont készítése Trixbox-szal 1 Mérés helye: Széchenyi István Egyetem, L-1/7 laboratórium, 9026 Győr, Egyetem
Új temékek az UD-GenoMed Kft. kínálatában!
Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai
Cashback 2015 Deposit Promotion teljes szabályzat
Cashback 2015 Deposit Promotion teljes szabályzat 1. Definitions 1. Definíciók: a) Account Client s trading account or any other accounts and/or registers maintained for Számla Az ügyfél kereskedési számlája
FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY
Földrajz angol nyelven középszint 0623 ÉRETTSÉGI VIZSGA 2007. május 15. FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA INTERMEDIATE LEVEL WRITTEN EXAM JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ
Animal welfare, etológia és tartástechnológia
Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 468 EGYEDAZONOSÍTÁS ÉS SZÁRMAZÁSELLENİRZÉS HIPERPOLIMORF MIKROSZATELLITA
USER MANUAL Guest user
USER MANUAL Guest user 1 Welcome in Kutatótér (Researchroom) Top menu 1. Click on it and the left side menu will pop up 2. With the slider you can make left side menu visible 3. Font side: enlarging font
A modern e-learning lehetőségei a tűzoltók oktatásának fejlesztésében. Dicse Jenő üzletfejlesztési igazgató
A modern e-learning lehetőségei a tűzoltók oktatásának fejlesztésében Dicse Jenő üzletfejlesztési igazgató How to apply modern e-learning to improve the training of firefighters Jenő Dicse Director of
FÖLDRAJZ ANGOL NYELVEN
Földrajz angol nyelven középszint 1112 ÉRETTSÉGI VIZSGA 2014. május 15. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ EMBERI ERŐFORRÁSOK MINISZTÉRIUMA Paper
Glyma10g15850 aagggatccattctggaaccatatcttgctgtg ttgggtacccttggatgcaggatgacacg AtMKK6, AT5g56580
Supplemental table 1. Soybean MAPK, MAPKK, and MAPKKK genes and primers for VIGS cloning Gene_ID Forward Primer Reverse Primer Arabidopsis Ortholog Glyma04g03210 aagggatcctgcagcaagaaccagttcat ttgggtaccctaatggatgcgcattaggataaag
Supplementary: A strategy to optimize the generation of stable chromobody cell lines for
Supplementary: A strategy to optimize the generation of stable chromobody cell lines for visualization and quantification of endogenous proteins in living cells Bettina-Maria Keller 1, Julia Maier 1, Melissa
ELEKTRONIKAI ALAPISMERETEK ANGOL NYELVEN
ÉRETTSÉGI VIZSGA 2008. május 26. ELEKTRONIKAI ALAPISMERETEK ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI VIZSGA 2008. május 26. 8:00 Az írásbeli vizsga időtartama: 180 perc Pótlapok száma Tisztázati Piszkozati OKTATÁSI
Márkaépítés a YouTube-on
Márkaépítés a YouTube-on Tv+ Adj hozzá YouTube-ot, Google Ground, 2016 Március 7. Bíró Pál, Google - YouTube 9,000,000 INTERNETTEL BÍRÓ ESZKÖZÖK VOLUMENE GLOBÁLISAN WEARABLES OKOS TV 8,000,000 7,000,000
sikeresnek bizonyult, és ami a legfontosabb az onkoterápiában, hogy a vegyület nem toxikus, ezért igen magas dózissal is eredményesn alkalmazható.
Turmeric Live Extract 30db A teljes kurkuma kivonat hatásának rövid jellemzése A Turmeric Live Extract bonyolult, számos eltérő molekulát tartalmazó összetett hatóanyag. A turmeron/ol különböző formáit,
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
Statistical Inference
Petra Petrovics Statistical Inference 1 st lecture Descriptive Statistics Inferential - it is concerned only with collecting and describing data Population - it is used when tentative conclusions about
Certificate no./bizonyítvány száma: ÉlfF/200-29/2017. ÁLLATEGÉSZSÉGÜGYI BIZONYÍTVÁNY
Certificate no./bizonyítvány száma: ÉlfF/20029/2017. ÁLLATEGÉSZSÉGÜGYI BIZONYÍTVÁNY A. B. Certificate no./bizonyítvány száma: ÉlfF/20029/2017. C. D. Certificate no./bizonyítvány száma: ÉlfF/20029/2017.
TELJESÍTMÉNY NYILATKOZAT 0333-CPD
E-mail: info@fulleon.co.uk TELJESÍTMÉNY NYILATKOZAT 0333-CPD-075441 Termék azonosító kód: Típus, adagszám vagy gyári szám, illetve bármilyen más elem, amely lehetővé teszi az építési termékek azonosítását
TELJESÍTMÉNY NYILATKOZAT 0333-CPD
E-mail: info@ fu leon.co.uk TELJESÍTMÉNY NYILATKOZAT 0333-CPD-075444 Termék azonosító kód: Típus, adagszám vagy gyári szám, illetve bármilyen más elem, amely lehetővé teszi az építési termékek azonosítását
Cluster Analysis. Potyó László
Cluster Analysis Potyó László What is Cluster Analysis? Cluster: a collection of data objects Similar to one another within the same cluster Dissimilar to the objects in other clusters Cluster analysis
General information for the participants of the GTG Budapest, 2017 meeting
General information for the participants of the GTG Budapest, 2017 meeting Currency is Hungarian Forint (HUF). 1 EUR 310 HUF, 1000 HUF 3.20 EUR. Climate is continental, which means cold and dry in February
ELEKTRONIKAI ALAPISMERETEK ANGOL NYELVEN
ÉRETTSÉGI VIZSGA 2013. május 23. ELEKTRONIKAI ALAPISMERETEK ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI VIZSGA 2013. május 23. 8:00 Az írásbeli vizsga időtartama: 180 perc Pótlapok száma Tisztázati Piszkozati EMBERI
THS710A, THS720A, THS730A & THS720P TekScope Reference
THS710A, THS720A, THS730A & THS720P TekScope Reference 070-9741-01 Getting Started 1 Connect probes or leads. 2 Choose SCOPE 3 or METER mode. Press AUTORANGE. Copyright Tektronix, Inc. Printed in U.S.A.
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Nonparametric Tests
Nonparametric Tests Petra Petrovics Hypothesis Testing Parametric Tests Mean of a population Population proportion Population Standard Deviation Nonparametric Tests Test for Independence Analysis of Variance
- Supplementary Data
1 Open Access Asian Australas. J. Anim. Sci. Vol. 29, No. 3 : 321-326 March 2016 http://dx.doi.org/10.5713/ajas.15.0331 www.ajas.info pissn 1011-2367 eissn 1976-5517 Analysis of Swine Leukocyte Antigen
Dr. Ottó Szabolcs Országos Onkológiai Intézet
Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001. Részjelentés: 200. November 0.-2004.
Mock Orc2. NPE sperm pre-rc replication
Time (min): HSS + M13 0 30 50 70 Orc2 HSS NPE sperm pre-rc repliction c % Repliction 60 40 20 0 HSS + sp NPE Orc2 Fig. S1: M13 ssdna-induced destruction of does not require ORC. S1: M13 ssdna ws incuted
Az fmri alapjai BOLD fiziológia. Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika
Az fmri alapjai BOLD fiziológia Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika T2* Az obszervált transzverzális relaxáció (T2*) több különböző komponens összege Many physical effects result
Performance Modeling of Intelligent Car Parking Systems
Performance Modeling of Intelligent Car Parking Systems Károly Farkas Gábor Horváth András Mészáros Miklós Telek Technical University of Budapest, Hungary EPEW 2014, Florence, Italy Outline Intelligent
Ültetési és öntözési javaslatok. Planting and watering instructions
Ültetési és öntözési javaslatok Planting and watering instructions 1 Önöntöző-rendszer Sub-irrigation 2 Kedves növénykedvelő A LECHUZA önöntöző rendszerrel növényeink természetüknél fogva gyönyörű virágokat
Supplemental Information. Investigation of Penicillin Binding Protein. (PBP)-like Peptide Cyclase and Hydrolase
Cell Chemical Biology, Volume upplemental Information Investigation of Penicillin Binding Protein (PBP)-like Peptide Cyclase and ydrolase in urugamide on-ribosomal Peptide Biosynthesis Yongjun Zhou, Xiao
PIAL1 (At1g08910) ORF sequence
PIAL1 (At1g08910) ORF sequence ATGGTTATTCCGGCGACTTCTAGGTTTGGGTTTCGTGCTGAATTCAACACCAAGGAGTTTCAAGCTTCCTGCATCTCTCT! CGCTAATGAAATCGATGCGGCTATTGGGAGAAATGAAGTTCCAGGGAATATTCAAGAGCTCGCTTTAATCCTCAATAATG! TGTGCCGACGTAAATGTGATGATTATCAAACCAGGGCGGTGGTAATGGCGCTGATGATCTCAGTCAAGAGTGCTTGTCAG!
A KELET-BORSODI HELVÉTI BARNAKŐSZÉNTELEPEK TANI VIZSGÁLATA
A KELET-BORSODI HELVÉTI BARNAKŐSZÉNTELEPEK TANI VIZSGÁLATA SZÉNKŐZET JUHÁSZ ANDRÁS* (3 ábrával) Összefoglalás: A szénkőzettani vizsgálatok céljául elsősorban a barnakőszéntelepek várható kiterjedésének
Implementation of water quality monitoring
Joint Ipoly/Ipel Catchment Management HUSK/1101/2.1.1/0153 Implementation of water quality monitoring Dr. Adrienne Clement clement@vkkt.bme.hu Budapest University of Technology and Economics Department
Szundikáló macska Sleeping kitty
Model: Peter Budai 999. Diagrams: Peter Budai 999.. Oda-visszahajtás átlósan. Fold and unfold diagonally. 2. Behajtunk középre. Fold to the center. 3. Oda-visszahajtások derékszögben. Fold and unfold at
Proxer 7 Manager szoftver felhasználói leírás
Proxer 7 Manager szoftver felhasználói leírás A program az induláskor elkezdi keresni az eszközöket. Ha van olyan eszköz, amely virtuális billentyűzetként van beállítva, akkor azokat is kijelzi. Azokkal
IP/09/473. Brüsszel, 2009. március 25
IP/09/473 Brüsszel, 2009. március 25 A mobiltelefon-használat nő, míg a fogyasztói árak csökkennek: a Bizottság jelentése szerint az európai távközlési ágazat ellenáll a gazdasági lassulásnak 2008-ban
STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:
STUDENT LOGBOOK 1 week general practice course for the 6 th year medical students Name of the student: Dates of the practice course: Name of the tutor: Address of the family practice: Tel: Please read
7 th Iron Smelting Symposium 2010, Holland
7 th Iron Smelting Symposium 2010, Holland Október 13-17 között került megrendezésre a Hollandiai Alphen aan den Rijn városában található Archeon Skanzenben a 7. Vasolvasztó Szimpózium. Az öt napos rendezvényen
A magkémia alapjai. Kinetika. Nagy Sándor ELTE, Kémiai Intézet
A magkémia alapjai Kinetika Nagy Sándor ELTE, Kémiai Intézet 09 The Radium Girls Festék világít Néhány egyszerű empirikus fogalomra teszünk egy pár triviális észrevételt. Egyetlen iterációban finomítjuk
Statistical Dependence
Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent