The role of PARP-1 induced AKT activation in cytostatic resistance
|
|
- Ödön Bognár
- 7 évvel ezelőtt
- Látták:
Átírás
1 Ph.D. thesis The role of PARP-1 induced AKT activation in cytostatic resistance Árpád Szántó, M.D. Department of Urology Faculty of Medicine University of Pécs Ph.D. Program leader: Prof. Balázs Sümegi, DSc. 2008
2
3 Abbreviations PARP...poly(ADP-ribose) polymerase PAR...poly(ADP-ribose) PARP-DBD...N-terminal DNA binding domain of PARP sirna...small interfering RNA FCS...fetal calf serum BRCA1/2...breast cancer associated gene-1 and -2 FKHR...forkhead homolog rhabdomyosarcoma transcription factors JNK...c-Jun N-terminal kinase GFP...green fluorescent protein Akt/PKB...protein kinase B GSK...glycogen synthase kinase MTT...3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide ECL...enhanced chemiluminescence PAR...poly(ADP-ribose) PI3-kinase...phosphatidylinositol 3-kinase MPT...Mitochondrial Permeability Transition 3
4 Introduction The nuclear enzyme poly(adp-ribose) polymerase-1 (PARP-1) is activated in response to DNA damage (1). Single- and/or double-strand DNA breaks induce the production of branched chain ADP-ribose polymers that are covalently attached to numerous nuclear proteins like histones or the PARP itself and this process represents an early event in DNA repair. Although it is well-documented that inhibition of PARP-1 has cytoprotective effects against oxidative stress (2), there is growing evidence suggesting that inhibition of PARP-1 sensitizes cells to DNA-damaging agents (3). This later effect of PARP-1 inhibition is attributed to the DNA-damage sensing function of PARP-1, namely that it responds to singleand/or double-strand DNA breaks, and facilitates DNA repair and cell survival. Furthermore, it was shown that cells deficient in breast cancer associated gene-1 and -2 (BRCA1/2) are extremely sensitive to PARP inhibition because of defective double-strand DNA break repair (4). Based on these data, PARP inhibition is considered a useful therapeutic strategy not only for the treatment of BRCA mutation-associated tumors, but also for the treatment of a wider range of tumors bearing a variety of deficiencies in the homologous recombination DNA repair pathway (5). However, it has also been shown that inhibition of PARP leads to phosphorylation, and thus activation, of Akt in various tissues (6,7,8). It raises the possibility that application of PARP inhibitors in tumor therapy may activate the phosphatidylinositol-3 kinase (PI-3K)-Akt pathway, which initiates processes like the inactivation of glycogen synthase kinase-3, caspase-9, Bad or forkhead homolog rhabdomyosarcoma (FKHR) transcription factors (9) leading to cytostatic resistance. Paclitaxel (taxol) interferes with the mitotic spindle during mitosis of cells, stabilizing the microtubule by inhibiting tubulin dimerisation and so inhibiting the separation of the sister chromatids (10,11,12). Paclitaxel can affect kinases (13) that play important roles in cell death 4
5 processes, and regulate the expression of tumour suppressor genes and cytokines (14). In addition, paclitaxel can induce cytosolic calcium oscillations (15) and mitochondrial permeability transition, as well as elevated generation of reactive oxygen species predominantly at cytochrome oxidase in tumor cells (16). In the paclitaxel-induced cell death process, activation of c-jun N-terminal kinase (JNK) plays a critical role by suppressing Akt activation and promoting the nuclear accumulation of forkhead-related transcription factor-3a (Foxo3a; 17). Nuclear translocation of Foxo3a can facilitate apoptosis by inducing the expression of Bim, a BH3-only proapoptotic bcl-2 homolog protein (18). It has also been demonstrated that Akt overexpression prevented paclitaxel-induced cell death (19), probably by a mechanism involving Akt dependent phosphorylation of FOXOs that stabilizes their binding to cytosolic protein and so prevents their translocation to the nucleus, resulting in inhibition of transcription of FOXO dependent genes such as Bim (20). In the present paper, we provide evidence that inhibition of PARP-1 activity can indeed cause resistance to paclitaxel induced death in tumor cells, and activation of the PI-3K-Akt pathway is significantly involved in this effect. We specially examined the T24 human urine bladder transitional cancer line. Taxane-based chemotherapy is currently the most used remedy for salvage chemotherapy in transitional cell carcinoma of the urothelium. (21). We provide evidence that Akt dependent Bad phosphorilation and presentation of the integrity of mitochondrial membrane systems is a mechanist significantly involved in paclitacel resistance of T24 human urine bladder transitional cancer line. 5
6 Objectives 1. We wanted to examine the direct effect of Taxol on mitochondria. We studied the relationship between mitochondrial permeability transition, cytochrome-c release, caspase-3 activation, PARP activation and paclitaxel treatment. 2. We wanted to induce paxlitaxel therapy-resistance in different cell lines via direct attenuation of PARP-1 activation. 3. We wanted to examine the possible mechanism of the citoprotecive effects of PAPR inhibition. We studied specially the NAD + and ATP depletion, and the signal transduction pathways. 4. We investigated how important role does the PI3K/Akt signaltrasduction pathway play in paclitaxel resistance in T24 human urine bladder transitional cell line. We looked at the effect of PI3K/Akt pathway activation with reduced PARP level on paclitaxel induced cell death and the effect of PI3K/Akt pathway inhibition with LY on paclitaxel induced cell death. 5. We examined the relationship between the PI3K/Akt signaltrasduction pathway and the mitochondrial apoptotic pathways. We determined the BAD phosphorylation, cytochrome-c release, caspase activation in paclitaxel treated T24 cells. 6
7 Materials and Methods Materials. Phosphatidylinositol-3 kinase (PI-3K) inhibitor LY , poly(adp-ribose) polymerase (PARP-1) inhibitor PJ-34, protease inhibitor cocktail, and all chemicals for cell culture were purchased from Sigma-Aldrich Kft (Budapest, Hungary). The following antibodies were used: anti-akt, anti-phospho-akt, anti-phospho-glycogen synthase kinase-3ß (GSK), anti-phospho Bad, anti-bad (Cell Signalling Technology, Beverly, MA); anti-mouse IgG and anti-rabbit IgG (Sigma-Aldrich Kft, Budapest, Hungary) Animals Wistar rats were purchased from Charles River Hungary Breeding Ltd. (Budapest, Hungary). The animals were kept under standardized conditions; tap water and rat chow were provided ad libitum. Animals were treated in compliance with approved institutional animal care guidelines. Isolation of mitochondria Rats were sacrificed by decapitation and the mitochondria were isolated from the liver and the heart by differential centrifugation as described by a standard protocol (22). The only difference among the organs was in the primary homogenization protocol; the liver was squeezed through a liver press, whereas pooled heart tissue from five rats was minced with a blender. All isolated mitochondria were purified by Percoll gradient centrifuging (22), and the mitochondrial protein concentrations were determined by the biuret method with bovine serum albumin as the standard. Mitochondrial permeability transition The mpt was monitored by following the accompanying large amplitude swelling via the decrease in absorbance at 540 nm (22) measured at room temperature by a Perkin Elmer fluorimeter (London, UK) in reflectance mode. Briefly, mitochondria at the concentration of 1 mg protein/ml were preincubated in the 7
8 assay buffer (70 mm sucrose, 214 mm mannitol, 20 mm N-2-hydroxyethyl piperazine-n -2- ethanesulfonic acid, 5 mm glutamate, 0.5 mm malate, 0.5 mm phosphate) containing the studied substances for 60 s. Mitochondrial permeability transition was induced by the addition of 150 µm Ca 2+ or of paclitaxel at the indicated concentration plus 2.5 µm Ca 2+. Fluorescence intensity changes were detected for 3 min. The results are demonstrated by representative original registration curves from five independent experiments, each repeated three times. Cell culture. T24 human bladder carcinoma cells and Hela human cervical cancer were from American Type Culture Collection (Wesel, Germany). The cells were maintained as monolayer adherent culture in Minimum Essential Eagle s Medium containing 1% antibioticantimycotic solution and 10% fetal calf serum (MEM/FCS) in humid 5% CO 2 atmosphere at 37 C. Cell viability assay. The cells were seeded into 96-well plates at a starting density of 10 4 cells per well and cultured overnight before paclitaxel and PJ-34 or LY were added to the medium at the concentration indicated in the figure-legends for 24 h. The medium was changed to fresh one containing 0.5% of 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT + ) for an additional 3 hours, then the MTT + reaction was terminated by adding HCl to 10 mm final concentration. Amount of blue formasan dye formed from MTT + was proportional to the number of live cells, and was determined with an Anthos Labtech 2010 ELISA reader at 550nm wavelength. All experiments were run in at least 4 parallels and repeated 3 times. 8
9 Western blot analysis. Cells were seeded and treated as for the cell viability assay. After the time indicated, cells were harvested in a chilled lysis buffer containing 0.5 mm sodiummetavanadate, 1 mm EDTA and protease inhibitor cocktail in PBS. Immunoblotting was performed exactly as it was described previously (22). All experiments were repeated 3 times. Caspase-3 activity assay. The cells were treated with paclitaxel in the presence or absence of PJ-34 or the PI3 kinase inhibitor LY for the time indicated. The cells were harvested, and determination of caspase-3 activity was carried out exactly as described previously (22). All experiments were repeated 3 times. Determination of cytochrome-c level by HPLC method. The analysis of cytochrome-c from the cytosol fraction of T24 cells treated with paclitaxel in the presence or absence of PJ- 34 or the PI3 kinase inhibitor LY for 16 h was perfomed exactly as it was described previously (22). Data acquisition was performed from at least three independent experiments. Statistical Analysis. Data were presented as means ± S.E.M. For multiple comparisons of groups, ANOVA was used. Statistical difference between groups was established by paired Student s t test with Bonferroni s correction. 9
10 Conclusions 1. We observed that Paclitaxel induces mitochondrial permeability transition with high level of cytochrome-c release. We also detected intensive caspase-3 activation and PARP-1 activation. All these factors together can result in apoptotic cell death. 2. We provided evidence that suppression of PARP-1 activation protected cells from paclitaxel. In all of the examined concentrations of paclitaxel, the control cells were more sensitive to paclitaxel than the ones with decreased PARP-1 activation. 3. We found evidence for undermining the classical view that cytoprotection by PARP inhibitors relies exclusively on the preservation of NAD + and consequently the ATP stores in paclitaxel therapy. The PARP inhibition-induced Akt activation was very significantly responsible for the cytoprotective property of PARP inhibitors. We established that the benefit of PARP inhibition is mediated through two different processes: the preservation of energetic of cells and activation of PI3K/Akt as a wellknown survival signaltrasduction pathway. 4. Inhibition of Akt activation by specific phosphatidyinositol-3-kinase (PI3K)-Akt inhibitors in a significant extent counteracted the cytoprotective effect of PARP inhibitor, indicating that the PARP-inhibition-induced Akt activation was very significantly responsible for the cytoprotective property of PARP inhibitors. 5. We provide evidence that Akt dependent Bad phosphorylation and preservation of the integrity of mitochondrial membrane systems is a mechanism considerably involved in paclitaxel resistance of T24 human urine bladder transitional cancer cell line. 10
11 References 1. Virag L, Szabo C.: The therapeutic potential of poly(adp-ribose) polymerase inhibitors, Pharmacol. Rev. 2002, 54: Halmosi R, Berente Z, Osz E, Toth K, Literati-Nagy P, Sumegi B.: Effect of poly(adp-ribose) polymerase inhibitors on the ischemia-reperfusion-induced oxidative cell damage and mitochondrial metabolism in Langendorff heart perfusion system, Mo. Pharmacol. 2001, 59: Oliveira NG, Castro MA, Rodrigues S, Goncalves IC, Martins C, Toscano Rico JM, Rueff J.: Effect of poly(adp-ribosyl)ation inhibitors on the genotoxic effects of the boron neutron capture reaction, Muta. Res : De Soto JA, Wang X, Tominaga Y, Wang RH, Cao L, Qiao W, Li C, Xu X, Skoumbourdis AP,. Prindiville SA, Thomas CJ, Deng CX.: The inhibition and treatment of breast cancer with poly (ADP-ribose) polymerase (PARP-1) inhibitors, Int. J. Biol. Sci. 2006,2: Bowman KJ, Newell DR, Calvert AH, Curtin NJ.: Differential effects of the poly (ADP-ribose) polymerase (PARP) inhibitor NU1025 on topoisomerase I and II inhibitor cytotoxicity in L1210 cells in vitro. Br. J. Cancer 2001,84: Veres B, Gallyas Jr. F, Varbiro G, Berente Z, Osz E, Szekeres G, Szabo C, B.Sumegi.: Decrease of the inflammatory response and induction of the Akt/protein kinase B pathway by poly-(adp-ribose) polymerase 1 inhibitor in endotoxin-induced septic shock, Biochem. Pharmacol. 2003,65: Veres B, Radnai B, Gallyas Jr F, Varbiro G, Berente Z, Osz E, Sumegi B.: Regulation of kinase cascades and transcription factors by a poly(adp-ribose) polymerase-1 11
12 inhibitor, 4-hydroxyquinazoline, in lipopolysaccharide-induced inflammation in mice, J. Pharm. Exp. Ther. 2004,310: Tapodi A, Debreceni B, Hanto K, Bognar Z, Wittman I, Gallyas Jr F, Varbiro G, Sumegi B.: Pivotal role of Akt activation in mitochondrial protection and cell survival by poly(adp-ribose)polymerase-1 inhibition in oxidative stress, J. Biol. Chem : Birkenkamp KU, Coffer P.J.: FOXO transcription factors as regulators of immune homeostasis: molecules to die for?, J. Immunol. 2003,171: Torres K, Horwitz S.B.: Mechanisms of Taxol-induced cell death are concentration dependent, Cancer Res. 1998,58: Blagosklonny MV, Fojo T.: Molecular effects of paclitaxel: myths and reality (a critical review), Int. J. Cancer 1999,83: Wang TH, Wang HS, Soong YK.: Paclitaxel-induced cell death: where the cell cycle and apoptosis come together, Cancer 2000,88: McDaid HM, Lopez-Barcons L, Grossman A, Lia M, Keller S, Perez-Soler R, Horwitz SB.:Enhancement of the therapeutic efficacy of taxol by the mitogen-activated protein kinase kinase inhibitor CI-1040 in nude mice bearing human heterotransplants, Cancer Res 2005,65: Sunters S, Fernandez de Mattos, Stahl M, Brosens JJ, Zoumpoulidou G, Saunders CA, Coffer PJ, Medema RH, Coombes RC, Lam EW.: FoxO3a transcriptional regulation of Bim controls apoptosis in paclitaxel-treated breast cancer cell lines, J Biol Chem. 2003,278: Boehmerle W, Splittgerber U, Lazarus MB, McKenzie K, Johnston M, Austin DJ, Ehrlich BE.: Paclitaxel induces calcium oscillations via an inositol 1,4,5-trisphosphate 12
13 receptor and neuronal calcium sensor 1-dependent mechanism, Proc. Natl. Acad Sci. USA 2006,103: Varbiro G, Veres B, Gallyas Jr F, Sumegi.: Direct effect of Taxol on free radical formation and mitochondrial permeability transition, Free Rad. Biol. Med. 2001,31: Sunters PA, Madureira KM, Pomeranz M, Aubert JJ, Brosens SJ, Cook BM, Burgering RC, Lam EW.: Paclitaxel-induced nuclear translocation of FOXO3a in breast cancer cells is mediated by c-jun NH2-terminal kinase and Akt, Cancer Res. 2006,66: Van Der Heide LP, Hoekman MF, Smidt MP.: The ins and outs of FoxO shuttling: mechanisms of FoxO translocation and transcriptional regulation, Biochem J. 2004,380: VanderWeele DJ, Zhou R, Rudin CM.: Akt up-regulation increases resistance to microtubule-directed chemotherapeutic agents through mammalian target of rapamycin, Mol. Cancer Ther. 2004,3: Luhn P, Wang H, Marcus AI, Fu H.: Identification of FAKTS as a novel associated nuclear protein, Proteins 2007,67: Geczi L: Modern chemotherapy of invasive bladder cancer. Magy Onkol 2007,51(2): Bognar Z, Kalai T, Palfi A, Hanto K, Bognar B, Szabo Z, Mark L, Tapodi A, Radnai B, Sarszegi Z, Szanto A, Gallyas Jr F, Hideg K, Sumegi B, Varbiro G.: A novel SODmimetic permeability transition inhibitor agent protects ischemic heart by inhibiting both apoptotic and necrotic cell death, Free Rad. Biol. Med. 2006, 41:
14 Acknowledgements I would like to thank prof. Dr. Balazs Sümegi the support, and guidance I received. I would like to thank Dr. Ferenc Gallyas Jr., associate professor, Dr. Gabor Varbiro assistant professor and Dr. Zita Bognar assistant professor, the cooperation, assistance and advices. I thank to Professor Laszlo Farkas that he supported the time for my researche work. I am grateful to my closest colleagues, and to my colleagues at the department of Biochemistry who assisted me in pursuing my experimental studies: Szabo Aliz, Dr. Antal Tapodi, Dr. Krisztina Kovacs, Zsuzsanna Tucsek, Dr. Laszlo Mark and Dr. Andras Szigeti. I would like to express my thanks to Laszlo Giran, Bertalan Horvath Helena Halasz, and Pasztor Irma for their excellent technical help and to the technicians at the Department of Biochemistry and Medical Chemistry for their kind help. I express my warmest and heartfelt thanks to my wife, my sister in law, my family for their love and encouraging support during my studies and work. 14
15 List of Publications Publications supporting the dissertation: Szanto A., Bognar Z., Szigeti A., Szabo A., Farkas L.,Gallyas Jr.F.:Critical role of BAD phosphorylation by AKT in cytostatic resistance of human bladder cancer cells Anticancer Res. In press Bognar Z, Kalai T, Palfi A, Hanto K, Bognar B, Mark L, Szabo Z, Tapodi A, Radnai B, Sarszegi Z, Szanto A, Gallyas F Jr, Hideg K, Sumegi B, Varbiro G.:A novel SOD-mimetic permeability transition inhibitor agent protects ischemic heart by inhibiting both apoptotic and necrotic cell death. Free Radic Biol Med Sep 1;41(5): Other publications: Hübler J.; Szántó A. Re: malignant extragastrointestinal stromal tumor of bladder. J Urol Mar;171(3):1244 Hübler J.; Szántó A.; Könyves K. Methylene blue as a means of treatment for priapism caused by intracavernous injection to combat erectile dysfunction. Int Urol Nephrol. 2003;35(4): Polyák L., Somogyi L.,Szántó Á.: A hólyagtumor és más szervben fellépı primer daganat együttes elıfordulásáról. Magyar Urológia, 1, 71-73, 1989 Szántó Á., Somogyi L., Polyák L., Baranyai F.:Fiatalkori hólyagtumorok. Magyar Onkológia 34, , Somogyi L., Szántó Á., Polyák L.: Miért késik a primer hólyagtumorok felsimerése? Medicus Universalis, 24, , Somogyi L., Polyák L., Szántó Á.: Tartós, localis BCG kezelés a felületes hólyagtumorok recidiva profilaxisában. Magyar Urológia, 3, , Somogyi L., Szántó Á., Polyák L.: Long-term BCG Immune Therapy of Superficial Bladder Tumors. International Urology and Nephrology, 24, , Somogyi L., Götz F., Polyák L., Szántó Á.: A hólyagnyaki rezekció Korth-trokárral. Magyar Urológia, 4, 77-80, Somogyi L., Szántó Á., Polyák L., Drinóczi.: BCG immunotherápia a felületes hólyagtumorok adjuváns kezelésében., Orvosi Hetilap, 134, , Somogyi L., Szántó Á., Polyák L.: A felületes hólyagtumorok BCG kezelésének kockázata: mewllékhatások és szövıdmények., Lege Artis Medcinae, 3/5, , Szántó Á., Somogyi L., Fábos Z., Polyák L.: A video-tur alkalmazásával szerzett elsı tapasztalataink., Lege Artis Medicinae, 4/2, ,
16 Somogyi L., Polyák L., Szántó Á.: A felületes hólyagtumorok adjuváns kezelése Connaught BCG vaccina alkalmazásával., Magyar Urológia, 8, 62-66, Szántó Á., Somogyi L., Gözt F., Gömöri É.: Retroperitoneális Castelmann tumor Magyar Urológia, 10/3., , Szántó Á.: A katéterezés javallata, technikája, módszerei. Családorvosi Vademecum Urológia, POTE Továbbképzı Központ 1997, Szántó Á.: A leggyakoribb ambulanter elvégezhetı urológiai mőtétek és beavatkozások. Családorvosi Vademecum- Urológia, POTE Továbbképzı Központ 1997, Abstracts, posters and presentations supporting the dissertation: Szabó A.; Bognár Z.; Szántó Á.; Hocsák E.; Hantó K.; Pandur E.; Nagy J.; Poór V.; Sümegi B. Induction of NfKB dependent COX-2 expression in Iiver cells by amiodarone 36. Membrán-transzport Konferencia, Sümeg, Május Szántó Á.; Szabó A.; Bognár Z.; Tapodi A., Jakus P.; Vetı S.; Tucsek Zs.; Poór V., Sümegi B. Inhibition of P ARP influence the taxol induced cell death in cultu red cells 36. Membrántranszport Konferencia - Sümeg, Május Szántó Á.; Bognár Z.; Hantó K.; Szabó A.; Németh V.; Tapodi A.; Hideg K.; Várbíró G.; Ifj. Gallyas F.; Sümegi B. The protection of post-ischemic hearts by H03538, a potent amiodarone analogue through inhibition of the mitocondrial apoptotic pathway 14.Euroconference on Apoptosis - Szardínia szept 29- okt. 4 Bognár Z.; Szántó Á.; Szabó A.; Hantó K.; Ifj. Gallyas F.; Sümegi B. Egy módosított amiodarone analóg és az amiodarone szerep ének összehasonlítása apoptotikus és nekrotikus sejthalálban Biokémiai vándorgyőlés Pécs szept Szabó A.; Bognár Z.; Szántó Á.; Tapodi A.; Solti I.; Kovács K.; ifj. Gallyas F.; Sümegi B Ho- 3538, egy új SOD mimetikus mpt inhibitor amiodarone analóg molekula Magyar Szabadgyök-Kutató Társaság IV. Konferenciája, Pécs Tapodi A.; Bognar Z.; Szabo A.; Bognar E.; Szanto A.; Gallyas F.Jr.; Sumegi B. Role of MAP kinases and Akt in the cytoprotective effect of PARP-1 inhibition and the regulation of Oxidative Stress induced necrotic cell death. 15.Euroconference on Apoptosis- Portoroz okt Bognar Z.; Szanto A.; Hanto K.; Szabo A.; Tapodi A.; Radnai B.; Gallyas F Jr.; Kovacs K.; Bognar R.; Sumegi B. Development of the prototype of SOD mimetic mpt inhibitors 15.Euroconference on Apoptosis- Portoroz okt Szanto A.; SzaboA.; Bognar Z.; Bognar R.; Tucsek Zs.; Solti I.; BognarE.; Tapodi A.; Debreceni B.; Gallyas F Jr.; Sumegi B. PARP-1 inhibition-induced activation of PI-3-kinase- Akt pathway by treatment of Taxol15.Euroconference on Apoptosis- Portoroz okt
17 Other abstracts, posters and presentations Szántó Á., Jávor A., Somogyi L.,Götz F.: A C reaktiv protein( CRP) jelentısége az urológiai infekciók és posztoperatív szövıdmények korai felismerésében. MUT ( Magyar Urológusok Társasága) IX. Kongresszus, Budapest, Szántó Á., Somogyi L., Fábos Z.,Polyák L.: A video-tur, MUT IX. Kongresszus, Budapest, 1994.( video) Szántó Á.; Somogyi L.;Götz F.: A video-tur, elınyök hátrányok MUT Továbbképzı Konferencia- Budapest, Szántó Á.; Somogyi L;Götz F.: A video-tur alkalmazásával szerzett tapasztalataink Magyar Endourológusok Társasága Továbbképzı Konferencia- Budapest, Szántó Á., Málovics I.,Raut E., Götz F.: Egy éves infekciókontroll program tapasztalatai a POTE Urológiai Klinikán, VII. Kecskeméti Urológus Napok, Szántó Á, Götz F.Somogyi L.: Video-endoszkópia, eszközök, elınyök, hátrányok Szakorovosi Felkészítı Program Budapest, HIETE, 2000 Szántó Á..: Uroinfekciók: klinikum és tapasztalatok, korszerü kezelési elvek Interdiszciplinaris Fórum az Infekciókról. Pécs, Szántó Á., Farkas L., Török A.,Székely J.: Felelıtlenség szülte szövıdmény pénisz protézis implantációt követıen, MUT 11. Kongresszus, Pécs 2000.( poszter) Szántó Á., Farkas L., Fábos Z.: Tazocin alkalamzásával szerzett klinikai tapasztalataink MUT 11. Kongresszus, Pécs Szántó Á.: Sürgısségi betegellátás az Urológiában Családorvosi Továbbképzı Program Pécs, Szántó Á.: Alfa-blokkolók- új tudományos felvetések, terápiás lehetıségek Bajai Kórház Ünnepi Tudományos Ülése- Baja, Szántó Á.: Infektológiai történetek az alsó hugyutakból Szakmai Nap az Infekciókontroll jegyében, Pécs, Szántó Á.: Alfa blokkolók, a doxazosin klinikuma Akadály nélkül a BPH kezelésében- Interdiszcinplináris fórum, Pécs, SzántóÁ.: A prosztatarák endokrin therápiájának kórélettana Urológus Szakorvosjelöltek Továbbképzı Programja, Pécs, 2003 Szántó Á.: A radikális retropubicus nerve sparing prostatectomia technikája és alkalmazásának elınyei Urológus Szakorovosjelöltek Továbbképzı Programja, Pécs Szántó Á.: Urológiai Infekciók a klinikákon, kórházakban, szociális intézményekben Szakdolgozói Továbbképzı Program- Pécs,
18 Szántó Á.,Fábos Z.: Cardiovascularis betegségek és az erectilis dysfunctio kapcsolata Cardiovascularis betegségek kezelésésnek komplex szemlélete- Interdiszciplináris Fórum Pécs Szántó Á.: Az apoptózis, a programozott sejthalál urológiai jelentısége- Urológus Szakorvosok Továbbképzı Programja- Pécs, Szántó Á.: A heretumoros betegek fertilitásábnak kérdései Urológus Szakorvosjelöltek Továbbképzı Programja-Pécs Szántó Á.: Az erectilis dysfunctio elıfordulási gyakorisága, patofiziológiája Az erectilis dysfunctio ( ED)-Multidiszciplináris Továbbképzı Konferencia, Pécs, 2004 Szántó Á., Jávorházy A, Farkas L.: Szempontok a BPH konzervatív kezeléséhez, V. Huth Tivadar Urológus Napok Pécs, Szántó Á.: Az erektilis diszfunkció kardiológiai és urológiai vonatkozásai. ANTSZ Továbbképzı Konferencia, Pécs,
PARP-1 indukált AKT aktiváció szerepe a citosztatikum rezisztenciában
Ph.D. értekezés tézisei PARP-1 indukált AKT aktiváció szerepe a citosztatikum rezisztenciában Dr. Szántó Árpád Urológiai Klinika Orvostudományi Kar Pécsi Tudományegyetem Ph.D. Programvezetı: Prof. Sümegi
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
The role of the endogenous antioxidant enzyme, glutathione S-transferase /GST/ on cultured cardiomyocytes under oxidative stress conditions
The role of the endogenous antioxidant enzyme, glutathione S-transferase /GST/ on cultured cardiomyocytes under oxidative stress conditions Summary of Ph.D. Thesis Borbála Balatonyi, M.D. University of
Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and
WT sham Trpv4 -/- sham Saline 10µM GSK1016709A P value Saline 10µM GSK1016709A P value Number 10 10 8 8 Intercontractile interval (sec) 143 (102 155) 98.4 (71.4 148) 0.01 96 (92 121) 109 (95 123) 0.3 Voided
A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon
A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo Yuma Oka and Thomas N. Sato Supplementary Figure S1. Whole-mount smfish with and without the methanol pretreatment.
Különböző mechanizmusok az NF- B és kináz kaszkád rendszerek szabályozásában a gyulladásban
Különböző mechanizmusok az NF- B és kináz kaszkád rendszerek szabályozásában a gyulladásban PhD tézis Radnai Balázs PhD programvezető: Prof. Sümegi Balázs DSc Pécsi Tudományegyetem, Általános Orvostudományi
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:
STUDENT LOGBOOK 1 week general practice course for the 6 th year medical students Name of the student: Dates of the practice course: Name of the tutor: Address of the family practice: Tel: Please read
Significance of the mitochondrial permeability transition in the regulation of cell death
Significance of the mitochondrial permeability transition in the regulation of cell death Ph.D. Thesis Alíz Szabó Program leader: Professor Balázs Sümegi, D.Sc. University of Pécs, Medical School Department
sikeresnek bizonyult, és ami a legfontosabb az onkoterápiában, hogy a vegyület nem toxikus, ezért igen magas dózissal is eredményesn alkalmazható.
Turmeric Live Extract 30db A teljes kurkuma kivonat hatásának rövid jellemzése A Turmeric Live Extract bonyolult, számos eltérő molekulát tartalmazó összetett hatóanyag. A turmeron/ol különböző formáit,
sz. OTKA pályázat
Dr. Bellyei Szabolcs 68469. sz. OTKA pályázat 1. Magyar összefoglaló Munkacsoportunk folyamatosan végzi a szövet-, vizelet- és szérumminták szisztémás gyűjtését különféle daganatokban, ahogy azt a pályázat
Új diagnosztikus és terápiás lehetőségek a glioblastoma multiforme kezelésében
New diagnostic and therapeutical possibilities in the treatment of glioblastoma multiforme Új diagnosztikus és terápiás lehetőségek a glioblastoma multiforme kezelésében Ph.D. Thesis Ph.D Tézisek Dr. Bellyeiné
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.
Correlation & Linear Regression in SPSS Petra Petrovics PhD Student Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Nonparametric Tests
Nonparametric Tests Petra Petrovics Hypothesis Testing Parametric Tests Mean of a population Population proportion Population Standard Deviation Nonparametric Tests Test for Independence Analysis of Variance
Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ
Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ Azért, mert a kemoterápia bizonyított módon fokozza a gyógyulás esélyét! A kemoterápiának az a célja, hogy az esetleg, vagy biztosan visszamaradt daganatsejtek
A sejtfelszíni FasL és szolubilis vezikulakötött FasL által indukált sejthalál gátlása és jellemzése
A sejtfelszíni FasL és szolubilis vezikulakötött FasL által indukált sejthalál gátlása és jellemzése Doktori értekezés tézisei Hancz Anikó Témavezetők: Prof. Dr. Sármay Gabriella Dr. Koncz Gábor Biológia
Correlation & Linear Regression in SPSS
Correlation & Linear Regression in SPSS Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise 1 - Correlation File / Open
Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI
Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance
EN United in diversity EN A8-0206/419. Amendment
22.3.2019 A8-0206/419 419 Article 2 paragraph 4 point a point i (i) the identity of the road transport operator; (i) the identity of the road transport operator by means of its intra-community tax identification
Receptor Tyrosine-Kinases
Receptor Tyrosine-Kinases MAPkinase pathway PI3Kinase Protein Kinase B pathway PI3K/PK-B pathway Phosphatidyl-inositol-bisphosphate...(PI(4,5)P 2...) Phosphatidyl-inositol-3-kinase (PI3K) Protein kinase
FAMILY STRUCTURES THROUGH THE LIFE CYCLE
FAMILY STRUCTURES THROUGH THE LIFE CYCLE István Harcsa Judit Monostori A magyar társadalom 2012-ben: trendek és perspektívák EU összehasonlításban Budapest, 2012 november 22-23 Introduction Factors which
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
Ultrasound biomicroscopy as a diagnostic method of corneal degeneration and inflammation
Ultrasound biomicroscopy as a diagnostic method of corneal degeneration and inflammation Ph.D. Thesis Ákos Skribek M.D. Department of Ophthalmology Faculty of Medicine University of Szeged Szeged, Hungary
4 vana, vanb, vanc1, vanc2
77 1) 2) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 12 7 17 4 8 2003 1 2004 7 3 Enterococcus 5 Enterococcus faecalis 1 Enterococcus avium 1 Enterococcus faecium 2 5 PCR E. faecium 1 E-test MIC 256 mg/ml vana MRSA MRSA
A PARP gátlás sejtvédő hatásának szerepe, Akt aktiváció és a mitokondriális védelem oxidatív stresszben Ph.D. értekezés tézisei
A PARP gátlás sejtvédő hatásának szerepe, Akt aktiváció és a mitokondriális védelem oxidatív stresszben Ph.D. értekezés tézisei Tapodi Antal Pécsi Tudományegyetem Általános Orvostudományi Kar Biokémiai
Influence of geogas seepage on indoor radon. István Csige Sándor Csegzi Sándor Gyila
VII. Magyar Radon Fórum és Radon a környezetben Nemzetközi workshop Veszprém, 2013. május 16-17. Influence of geogas seepage on indoor radon István Csige Sándor Csegzi Sándor Gyila Debrecen Marosvásárhely
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Karancsi Lajos Gábor Debreceni Egyetem Agrár és Gazdálkodástudományok Centruma Mezőgazdaság-, Élelmiszertudományi és Környezetgazdálkodási
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK Despite enormous challenges many developing countries are service exporters Besides traditional activities such as tourism;
A cell-based screening system for RNA Polymerase I inhibitors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information A cell-based screening system for RNA Polymerase I inhibitors Xiao Tan,
Budapesti Műszaki és Gazdaságtudományi Egyetem Építőmérnöki Kar
M Ű E G Y E T E M 1 7 8 2 Budapesti Műszaki és Gazdaságtudományi Egyetem Építőmérnöki Kar AZ ÁGYAZATRAGASZTÁSI TECHNOLÓGIÁVAL STABILIZÁLT ZÚZOTTKŐ ÁGYAZATÚ VASÚTI FELÉPÍTMÉNY STATIKUS ÉS DINAMIKUS TERHEKRE
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
SOLiD Technology. library preparation & Sequencing Chemistry (sequencing by ligation!) Imaging and analysis. Application specific sample preparation
SOLiD Technology Application specific sample preparation Application specific data analysis library preparation & emulsion PCR Sequencing Chemistry (sequencing by ligation!) Imaging and analysis SOLiD
Mapping Sequencing Reads to a Reference Genome
Mapping Sequencing Reads to a Reference Genome High Throughput Sequencing RN Example applications: Sequencing a genome (DN) Sequencing a transcriptome and gene expression studies (RN) ChIP (chromatin immunoprecipitation)
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
ANNEX V / V, MELLÉKLET
ANNEX V / V, MELLÉKLET VETERINARY CERTIFICATE EMBRYOS OF DOMESTIC ANIMALS OF THE BOVINE SPECIES FOR IMPORTS COLLECTED OR PRODUCED BEFORE 1 st JANUARY 2006 ÁLLAT-EGÉSZSÉGÜGYI BIZONYÍTVÁNY 2006. JANUÁR 1-JE
Construction of a cube given with its centre and a sideline
Transformation of a plane of projection Construction of a cube given with its centre and a sideline Exercise. Given the center O and a sideline e of a cube, where e is a vertical line. Construct the projections
The critical role of MAP-kinases and PI3K-Akt signaling pathways in inflammation and oxidative stress
The critical role of MAP-kinases and PI3K-Akt signaling pathways in inflammation and oxidative stress PhD Thesis Eszter Bognár Doctoral School leader: Balázs Sümegi Ph.D., DSci Supervisor: Ferenc Gallyas
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Nonparametric Tests. Petra Petrovics.
Nonparametric Tests Petra Petrovics PhD Student Hypothesis Testing Parametric Tests Mean o a population Population proportion Population Standard Deviation Nonparametric Tests Test or Independence Analysis
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
KN-CP50. MANUAL (p. 2) Digital compass. ANLEITUNG (s. 4) Digitaler Kompass. GEBRUIKSAANWIJZING (p. 10) Digitaal kompas
KN-CP50 MANUAL (p. ) Digital compass ANLEITUNG (s. 4) Digitaler Kompass MODE D EMPLOI (p. 7) Boussole numérique GEBRUIKSAANWIJZING (p. 0) Digitaal kompas MANUALE (p. ) Bussola digitale MANUAL DE USO (p.
Modular Optimization of Hemicellulose-utilizing Pathway in. Corynebacterium glutamicum for Consolidated Bioprocessing of
[Supplementary materials] Modular Optimization of Hemicellulose-utilizing Pathway in Corynebacterium glutamicum for Consolidated Bioprocessing of Hemicellulosic Biomass Sung Sun Yim 1, Jae Woong Choi 1,
(A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5
Fig. S1. Brg1 ablation leads to abnormal villous structure in the duodenum in the perinatal period (A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5 (B, E), and P0.5
7 th Iron Smelting Symposium 2010, Holland
7 th Iron Smelting Symposium 2010, Holland Október 13-17 között került megrendezésre a Hollandiai Alphen aan den Rijn városában található Archeon Skanzenben a 7. Vasolvasztó Szimpózium. Az öt napos rendezvényen
Skills Development at the National University of Public Service
Skills Development at the National University of Public Service Presented by Ágnes Jenei National University of Public Service Faculty of Public Administration Public Ethics and Communication 13. 12. 2013
Computer Architecture
Computer Architecture Locality-aware programming 2016. április 27. Budapest Gábor Horváth associate professor BUTE Department of Telecommunications ghorvath@hit.bme.hu Számítógép Architektúrák Horváth
Animal welfare, etológia és tartástechnológia
Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 9 Issue 3 Különszám/Special Issue Gödöllő 2013 69 TEJ ALAPÚ HIGÍTÓK ALKALMAZÁSÁNAK LEHETŐSÉGE NYÚL SPERMA
UNIVERSITY OF PUBLIC SERVICE Doctoral School of Military Sciences. AUTHOR S SUMMARY (Thesis) Balázs Laufer
DOI azonosító: 10.17625/NKE.2013.021 UNIVERSITY OF PUBLIC SERVICE Doctoral School of Military Sciences AUTHOR S SUMMARY (Thesis) Balázs Laufer LAW ENFORCEMENT AND NATIONAL SECURITY CHALLENGES POSED BY
Étkezési búzák mikotoxin tartalmának meghatározása prevenciós lehetıségek
Étkezési búzák mikotoxin tartalmának meghatározása prevenciós lehetıségek Téren, J., Gyimes, E., Véha, A. 2009. április 15. PICK KLUB Szeged 1 A magyarországi búzát károsító Fusarium fajok 2 A betakarítás
History. Barcelona 11 June 2013 HLASA 1
History 1893 National Ornithological Centre (Ottó Herman) New ways of breeding and use of laboratory animals (Dr.Kállai László A laboratoriumiállat-tenyésztés és felhasználás új útjai. In: A biológia aktuális
EPILEPSY TREATMENT: VAGUS NERVE STIMULATION. Sakoun Phommavongsa November 12, 2013
EPILEPSY TREATMENT: VAGUS NERVE STIMULATION Sakoun Phommavongsa November 12, 2013 WHAT IS EPILEPSY? A chronic neurological disorder characterized by having two or more unprovoked seizures Affects nearly
FÖLDRAJZ ANGOL NYELVEN
Földrajz angol nyelven középszint 0821 ÉRETTSÉGI VIZSGA 2009. május 14. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ OKTATÁSI ÉS KULTURÁLIS MINISZTÉRIUM Paper
SAJTÓKÖZLEMÉNY Budapest 2011. július 13.
SAJTÓKÖZLEMÉNY Budapest 2011. július 13. A MinDig TV a legdinamikusabban bıvülı televíziós szolgáltatás Magyarországon 2011 elsı öt hónapjában - A MinDig TV Extra a vezeték nélküli digitális televíziós
A "Risk-based" monitoring háttere és elméleti alapja
MAGYAR KLINIKAI FARMAKOLOGUSOK, XV. TOVABBKÉPZŐ NAPOK Debrecen, 2013. december 12 14.. Dr. Szakolczai-Sándor Norbert A "Risk-based" monitoring háttere és elméleti alapja 2011 INC Research, LLC 1 Agenda
Lexington Public Schools 146 Maple Street Lexington, Massachusetts 02420
146 Maple Street Lexington, Massachusetts 02420 Surplus Printing Equipment For Sale Key Dates/Times: Item Date Time Location Release of Bid 10/23/2014 11:00 a.m. http://lps.lexingtonma.org (under Quick
Statistical Dependence
Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent
DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA
DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA TÓTH ADÉL TÉMAVEZETŐ: DR. GÁCSER ATTILA TUDOMÁNYOS FŐMUNKATÁRS
Fehérjeglikoziláció az endoplazmás retikulumban mint lehetséges daganatellenes támadáspont
Fehérjeglikoziláció az endoplazmás retikulumban mint lehetséges daganatellenes támadáspont Doktori tézisek Dr. Konta Laura Éva Semmelweis Egyetem Molekuláris Orvostudományok Tudományági Doktori Iskola
Összefoglalás. Summary
Parlagoltatásos, zöld- és istállótrágyázásos vetésforgók összehasonlítása a talajtömörödöttség tükrében Szőllősi István Antal Tamás Nyíregyházi Főiskola, Műszaki és Mezőgazdasági Főiskolai Kar Jármű és
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING
Anyagmérnöki Tudományok, 39/1 (2016) pp. 82 86. NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING LEDNICZKY
KÉPI INFORMÁCIÓK KEZELHETŐSÉGE. Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet. Összefoglaló
KÉPI INFORMÁCIÓK KEZELHETŐSÉGE Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet Összefoglaló Tanórákon és az önálló tanulás részeként is, az informatika világában a rendelkezésünkre álló óriási mennyiségű
Nevezze meg a jelölt csontot latinul! Name the bone marked! Nevezze meg a jelölt csont típusát! What is the type of the bone marked?
1 Nevezze meg a jelölt csontot latinul! Name the bone marked! 2 Nevezze meg a jelölt csont típusát! What is the type of the bone marked? 3 Milyen csontállomány található a jelölt csont belsejében? What
4-42 ELECTRONICS WX210 - WX240
4-42 ELECTRONICS WX210 - WX240 PCS 40000499-en Fig. 8 WX210 - WX240 ELECTRONICS 4-43 PCS COMPONENTS 40000471-en Load-limit regulator Legend Fig. 1 Fig. 2 1 Power supply 2 PWM1 output, proportional valve
Mangalica: The VM-MOE Treaty. Olmos és Tóth Kft. Monte Nevado
Mangalica: The VM-MOE Treaty The agreement 2013 the Goverment of Hungary decided to launch a strategic cooperation with the MOE. The deal is based in the Hungarian Pig Development Strategy (3 to 6 millon
Szívkatéterek hajlékonysága, meghajlítása
Szívkatéterek hajlékonysága, meghajlítása Összefoglalás A szívkatéter egy olyan intravaszkuláris katéter, amelyet a szívbe vezetnek, ültetnek be diagnosztikus vagy terápiás célból. A katéterek felvezetés/eltávolítás
Expansion of Red Deer and afforestation in Hungary
Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi www.vmi.szie.hu Background and importance large herbivores are overpopulated
Induló egyetemi spin-off vállalkozások mozgástere. Ferdinandy Péter. www.cardiovasc.com www.pharmahungary.com
Induló egyetemi spin-off vállalkozások mozgástere Ferdinandy Péter kari innovációs igazgató, Orvostudományi Kar, Szegedi Tudományegyetem, alapító, ügyvezet igazgató, PharmaHungary 2000 Kft e-mail: peter.ferdinandy@pharmahungary.com
A nemi különbségek vizsgálatáról lévén szó, elsődleges volt a nemi hormonok, mint belső környezetbeli különbségeket létrehozó tényezők szerepének
Kutatási beszámoló Pályázatunk célja annak kiderítése volt, hogy az agyi asztrociták mutatnak-e nemi különbségeket, akár struktura, akár területi megoszlás, akár reaktivitás tekintetében. Alkalmazott megközelítésünk
Összefoglalás. Summary. Bevezetés
A talaj kálium ellátottságának vizsgálata módosított Baker-Amacher és,1 M CaCl egyensúlyi kivonószerek alkalmazásával Berényi Sándor Szabó Emese Kremper Rita Loch Jakab Debreceni Egyetem Agrár és Műszaki
Effect of the different parameters to the surface roughness in freeform surface milling
19 November 0, Budapest Effect of the different parameters to the surface roughness in freeform surface milling Balázs MIKÓ Óbuda University 1 Abstract Effect of the different parameters to the surface
Decision where Process Based OpRisk Management. made the difference. Norbert Kozma Head of Operational Risk Control. Erste Bank Hungary
Decision where Process Based OpRisk Management made the difference Norbert Kozma Head of Operational Risk Control Erste Bank Hungary About Erste Group 2010. 09. 30. 2 Erste Bank Hungary Erste Group entered
Procalcitonin a kritikus állapot prediktora. Fazakas János, PhD, egyetemi docens Semmelweis Egyetem, Transzplantációs és Sebészeti Klinika
Procalcitonin a kritikus állapot prediktora Fazakas János, PhD, egyetemi docens Semmelweis Egyetem, Transzplantációs és Sebészeti Klinika Procalcitonin a kritikus állapot prediktora PCT abszolút érték
A modern e-learning lehetőségei a tűzoltók oktatásának fejlesztésében. Dicse Jenő üzletfejlesztési igazgató
A modern e-learning lehetőségei a tűzoltók oktatásának fejlesztésében Dicse Jenő üzletfejlesztési igazgató How to apply modern e-learning to improve the training of firefighters Jenő Dicse Director of
ó Ú ő ó ó ó ö ó ó ő ö ó ö ö ő ö ó ö ö ö ö ó ó ó ó ó ö ó ó ó ó Ú ö ö ó ó Ú ú ó ó ö ó Ű ő ó ó ó ő ó ó ó ó ö ó ó ó ö ő ö ó ó ó Ú ó ó ö ó ö ó ö ő ó ó ó ó Ú ö ö ő ő ó ó ö ö ó ö ó ó ó ö ö ő ö Ú ó ó ó ü ú ú ű
Az fmri alapjai BOLD fiziológia. Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika
Az fmri alapjai BOLD fiziológia Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika T2* Az obszervált transzverzális relaxáció (T2*) több különböző komponens összege Many physical effects result
First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.
First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this
A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE
KARSZTFEJLŐDÉS XIX. Szombathely, 2014. pp. 137-146. A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE ANALYSIS OF HYDROMETEOROLIGYCAL DATA OF BÜKK WATER LEVEL
Using the CW-Net in a user defined IP network
Using the CW-Net in a user defined IP network Data transmission and device control through IP platform CW-Net Basically, CableWorld's CW-Net operates in the 10.123.13.xxx IP address range. User Defined
The mechanism of T cell apoptosis caused by soluble and cellderived Gal-1; a comparative study to determine the physiological effect of Gal-1
The mechanism of T cell apoptosis caused by soluble and cellderived Gal-1; a comparative study to determine the physiological effect of Gal-1 Andrea Blaskó Ph.D. thesis Supervisor: Éva Monostori Ph.D.,
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Hypothesis Testing. Petra Petrovics.
Hypothesis Testing Petra Petrovics PhD Student Inference from the Sample to the Population Estimation Hypothesis Testing Estimation: how can we determine the value of an unknown parameter of a population
OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA ÁGH TAMÁS DR., MÉSZÁROS ÁGNES DR.
ALL RIGHTS RESERVED SOKSZOROSÍTÁSI CSAK A MTT ÉS A KIADÓ ENGEDÉLYÉVEL Az asthmás és COPD-s betegek életminõségét befolyásoló tényezõk OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA Semmelweis Egyetem
2. Local communities involved in landscape architecture in Óbuda
Év Tájépítésze pályázat - Wallner Krisztina 2. Közösségi tervezés Óbudán Óbuda jelmondata: Közösséget építünk, ennek megfelelően a formálódó helyi közösségeket bevonva fejlesztik a közterületeket. Békásmegyer-Ófaluban
On The Number Of Slim Semimodular Lattices
On The Number Of Slim Semimodular Lattices Gábor Czédli, Tamás Dékány, László Ozsvárt, Nóra Szakács, Balázs Udvari Bolyai Institute, University of Szeged Conference on Universal Algebra and Lattice Theory
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis
Factor Analysis Factor analysis is a multiple statistical method, which analyzes the correlation relation between data, and it is for data reduction, dimension reduction and to explore the structure. Aim
Bérczi László tű. dandártábornok Országos Tűzoltósági Főfelügyelő
The role of volunteer firefighter organizations, municipality and facility firefighter departments in the unified disaster management system of Hungary Bérczi László tű. dandártábornok Országos Tűzoltósági
Apoptózis. 1. Bevezetés 2. Külső jelút 3. Belső jelút
Jelutak Apoptózis 1. Bevezetés 2. Külső jelút 3. Belső jelút Apoptózis Sejtmag 1. Kondenzálódó sejtmag apoptózis autofágia nekrózis Lefűződések Összezsugorodás Fragmentálódó sejtmag Apoptotikus test Fagocita
There are no translations available. CURRENT APPOINTMENT(S):
There are no translations available. CURRENT APPOINTMENT(S): Research fellow of Biochemistry and Molecular Biology, Department of Biochemistry and Molecular Biology, Medical and Health Science Center (MHSC),
Szakmai önéletrajz. Tanulmányok: Tudományos minısítés:
Dr. Benyó Zoltán, Egyetemi Tanári Pályázat 2009, Szakmai Önéletrajz, 1. oldal Szakmai önéletrajz Név: Dr. Benyó Zoltán Születési hely, idı: Budapest, 1967. június 15. Családi állapot: nıs, 2 gyermek (Barnabás,
Cluster Analysis. Potyó László
Cluster Analysis Potyó László What is Cluster Analysis? Cluster: a collection of data objects Similar to one another within the same cluster Dissimilar to the objects in other clusters Cluster analysis
Cashback 2015 Deposit Promotion teljes szabályzat
Cashback 2015 Deposit Promotion teljes szabályzat 1. Definitions 1. Definíciók: a) Account Client s trading account or any other accounts and/or registers maintained for Számla Az ügyfél kereskedési számlája
Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán
Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán 1.Számú Patológiai és Kísérleti Rákkutató Intézet Diagnózis (definitív): benignus, malignus, intermedier malignitás, borderline
Csípôízületi totál endoprotézis-beültetés lehetôségei csípôkörüli osteotomiát követôen
A Pécsi Orvostudományi Egyetem Ortopédiai Klinika közleménye Csípôízületi totál endoprotézis-beültetés lehetôségei csípôkörüli osteotomiát követôen DR. BELLYEI ÁRPÁD, DR. THAN PÉTER. DR. VERMES CSABA Érkezett:
Suppl. Materials. Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids. Germany
Suppl. Materials Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids Stephanie Bresan 1, Anna Sznajder 1, Waldemar Hauf 2, Karl Forchhammer 2, Daniel Pfeiffer 3 and Dieter Jendrossek 1 1 Institute
Jelutak. Apoptózis. Apoptózis Bevezetés 2. Külső jelút 3. Belső jelút. apoptózis autofágia nekrózis. Sejtmag. Kondenzálódó sejtmag
Jelutak Apoptózis 1. Bevezetés 2. Külső jelút 3. Belső jelút Apoptózis Sejtmag Kondenzálódó sejtmag 1. autofágia nekrózis Lefűződések Összezsugorodás Fragmentálódó sejtmag Apoptotikus test Fagocita bekebelezi
Glyma10g15850 aagggatccattctggaaccatatcttgctgtg ttgggtacccttggatgcaggatgacacg AtMKK6, AT5g56580
Supplemental table 1. Soybean MAPK, MAPKK, and MAPKKK genes and primers for VIGS cloning Gene_ID Forward Primer Reverse Primer Arabidopsis Ortholog Glyma04g03210 aagggatcctgcagcaagaaccagttcat ttgggtaccctaatggatgcgcattaggataaag
Bird species status and trends reporting format for the period (Annex 2)
1. Species Information 1.1 Member State Hungary 1.2.2 Natura 2000 code A634-B 1.3 Species name Ardea purpurea purpurea 1.3.1 Sub-specific population East Europe, Black Sea & Mediterranean/Sub-Saharan Africa
A prokalcitonin prognosztikai értéke
A prokalcitonin prognosztikai értéke az első 24 órában Dr. Tánczos Krisztián SZTE Aneszteziológiai és Intenzív Terápiás Intézet Carlet et al. Antimicrobial Resistance and Infection Control 2012, 1:11 Carlet
PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER
SEMMELWEIS UNIVERSITY PETER PAMANY CATLIC UNIVERSITY Development of Complex Curricula for Molecular Bionics and Infobionics Programs within a consortial* framework** Consortium leader PETER PAMANY CATLIC