|
|
- Róbert Balog
- 9 évvel ezelőtt
- Látták:
Átírás
1
2 , Teljes dokumentum Folyóiratcikk /Absztrakt /Tudományos [ ] 7. Kontár Orsolya, Erős Nóra, Désaknai Márton, Hársing Judit, Csomor Judit, Szepesi Ágota, Kárpáti Sarolta, Marschalkó Márta A felületi röntgen irradiáció hatékonyságának értékelése mycosis fungoideses, primer cutan CD8+ agresszív epidermotrop citotoxikus T-sejtes lymphomás, primer cutan anaplasiás nagy sejtes lymphomás és primer cutan marginális zóna B-sejtes lymphomás betegeken BŐRGYÓGYÁSZATI ÉS VENEROLÓGIAI SZEMLE 88:(2) pp (2012) Nyelv: Magyar Link(ek): MOB, Matarka Folyóiratcikk /Szakcikk /Tudományos [ ] 8. Szepesi Agota, Csomor Judit, Rajnai Hajnalka, Eros Nora, Wikonkal Norbert, Karpati Sarolta, Matolcsy Andras, Marschalko Marta Primary cutaneous aggressive epidermotropic CD8+T-cell lymphoma : report of two cases with no evidence of systemic disease EUROPEAN JOURNAL OF DERMATOLOGY 22:(5) pp (2012) Folyóiratcikk /Rövid közlemény /Tudományos [ ] [ Hitelesített ] 9. Toth B, Katona M, Harsing J, Szepesi A, Karpati S Indeterminate Cell Histiocytosis in a Pediatric Patient: Successful Treatment with Thalidomide PATHOLOGY AND ONCOLOGY RESEARCH 18:(2) pp (2012) Folyóiratcikk /Rövid közlemény /Tudományos [ ] [ Hitelesített ] Független idéző: 3 Összesen: 3 1 Logemann N, Thomas B, Yetto T Indeterminate cell histiocytosis successfully treated with narrowband UVB Dermatology Online Journal 19: (10) Paper PMID: (2013), Teljes dokumentum Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Ghanadan A, Kamyab K, Ramezani M, Goodarzi A, Daneshpazhooh M, Balighi K, Ansari M, Nassiri SFM, Daklan S Indeterminate cell histiocytosis: Report of a case Acta Med. Iran. (ISSN: ) 52: (10) pp (2014) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Halawi A, Abbas O, Mahalingam M S100 proteins and the skin: A review Journal of the European Academy of Dermatology and Venereology (ISSN: ) 28: (4) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 10. Balogh Z, Reiniger L, Rajnai H, Csomor J, Szepesi A, Balogh A, Deak L, Gagyi E, Bodor C, Matolcsy A High rate of neoplastic cells with genetic abnormalities in proliferation centers of chronic lymphocytic leukemia LEUKEMIA AND LYMPHOMA 52:(6) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 4 Összesen: Zent CS, Polliack A, Tadmor T FISHing for answers in proliferation centers of chronic lymphocytic leukemia lymph nodes LEUKEMIA & LYMPHOMA 52: (6) pp (2011) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 2 Gradowski JF, Sargent RL, Craig FE, Cieply K, Fuhrer K, Sherer C, Swerdlow SH Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma With Cyclin D1 Positive Proliferation Centers Do Not Have CCND1 Translocations or Gains and Lack SOX11 Expression AMERICAN JOURNAL OF CLINICAL PATHOLOGY 138: (1) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Herishanu Y, Katz B-Z, Lipsky A, Wiestner A Biology of Chronic Lymphocytic Leukemia in Different Microenvironments. Clinical and Therapeutic Implications. Hematology/Oncology Clinics of North America 27: (2) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 2 / :12
3 3 / :12 4 Cosimo E, McCaig AM, Carter-Brzezinski LJM, Wheadon H, Leach MT, Le Ster K, Berthou C, Durieu E, Oumata N, Galons H, Meijer L, Michie AM Inhibition of NF-κB-mediated signaling by the cyclin-dependent kinase inhibitor CR8 overcomes prosurvival stimuli to induce apoptosis in chronic lymphocytic leukemia cells Clinical Cancer Research 19: (9) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 11. Csomor J, Eros N, Szepesi A, Csernus B, Szakonyi J, Kontar O, Matolcsy A, Karpati S, Marschalko M Persistent agmination of lymphomatoid papulosis: a new case with immunohistopathologically confirmed mycosis fungoides component JOURNAL OF THE AMERICAN ACADEMY OF DERMATOLOGY 65:(3) pp. e98-e100. (2011) Link(ek): DOI, PubMed, Scopus Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] [ Hitelesített ] Független idéző: 2 Összesen: 2 1 Pileri A, Bacci F, Neri I, Ciabatti S, Stefoni V, Zinzani PL, Patrizi A Persistent Agmination of Lymphomatoid Papulosis: An Ongoing Debate DERMATOLOGY 225: (2) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 2 Buder K, Wendel AM, Cerroni L, Goebeler M, Kerstan A A Case of Lymphomatoid Papulosis Limited to Becker's Melanosis DERMATOLOGY 226: (2) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 12. Eros N, Kontar O, Marschalko M, Demeter J, Fodor A, Harsing J, Csomor J, Szepesi A, Matolcsy A, Karpati S Clinicopathological analysis of primary cutaneous CD4+small/medium-sized pleomorphic T-cell lymphoma JOURNAL OF INVESTIGATIVE DERMATOLOGY 131:(Suppl. 2) p. S44. (2011) Folyóiratcikk /Absztrakt /Tudományos [ ] 13. Györke T, Kollár A, Bottlik Gy, Szepesi Á, Bodó I, Masszi T, Bérczi V, Garai I Radioguided lymph node biopsy of a chemoresistant lymph node detected on interim FDG PET-CT in Hodgkin lymphoma INTERNATIONAL JOURNAL OF HEMATOLOGY 93:(4) pp (2011) Folyóiratcikk /Rövid közlemény /Tudományos [ ] [ Hitelesített ] Eros N, Marschalko M, Harsing J, Nagy Z, Demeter J, Csomor J, Szepesi A, Matolcsy A, Karpati S Primary cutaneous marginal zone lymphoma: Studies on Borrelia infection JOURNAL OF INVESTIGATIVE DERMATOLOGY 130:(Suppl. 2) p. S65. (2010) Folyóiratcikk /Absztrakt /Tudományos [ ] 15. Eros N, Marschalko M, Balassa K, Hidvegi B, Szakonyi J, Ilniczky S, Borka K, Kovacs A, Bottlik G, Harsing J, Csomor J, Szepesi A, Matolcsy A, Karpati S, Demeter J Central nervous system involvement in CD4+/CD56+ hematodermic neoplasm: a report of two cases. JOURNAL OF NEURO-ONCOLOGY 97:(2) pp (2010) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 3 Összesen: 3 1 Campbell Shannon M, Moad John C, Sammons Dawn L, Zirwas Matthew CD4(+)CD56(+) Hematodermic Neoplasm and Plasmacytoid Dendritic Cell Tumor: Case Report and Review of the Literature CUTIS 89: (6) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Saeed H, Awasthi M, Al-Qaisi A, Massarweh S Blastic plasmacytoid dendritic cell neoplasm with extensive cutaneous and central nervous system involvement Rare Tumors (ISSN: ) 6: (4) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ]
4 3 Gera S, Dekmezian MS, Duvic M, Tschen JA, Vega F, Cho-Vega JH Blastic plasmacytoid dendritic cell neoplasm: Evolving insights in an aggressive hematopoietic malignancy with a predilection of skin involvement AMERICAN JOURNAL OF DERMATOPATHOLOGY (ISSN: ) 36: (3) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 16. Erős Nóra, Marschalkó Márta, Hársing Judit, Nagy Zsolt, Demeter Judit, Csomor Judit, Szepesi Ágota, Matolcsy András, Kárpáti Sarolta Primer kután marginális zóna lymphoma kezelési eredményeiről 11 eset kapcsán HEMATOLÓGIA-TRANSZFUZIOLÓGIA 43:(Klnsz) p. 17. (2010) Link(ek): Matarka Folyóiratcikk /Absztrakt /Tudományos [ ] 17. Erős Nóra, Marschalkó Márta, Holló Péter, Harmos Ferenc, Hársing Judit, Désaknai Márton, Csomor Judit, Szepesi Ágota, Kárpáti Sarolta Kiterjedt bőrérintettséggel járó primer cutan anaplasiás nagy sejtes lymphoma sikeres kezelése röntgen irradiációval BŐRGYÓGYÁSZATI ÉS VENEROLÓGIAI SZEMLE 86:(4) pp (2010) Nyelv: Magyar Link(ek): MOB, Egyéb URL, Teljes dokumentum, Matarka Folyóiratcikk /Szakcikk /Tudományos [ ] [ Hitelesített ] 18. Szepesi A, Eros N, Timar B, Horvath B, Matolcsy A, Csomor J Intravascular large B-cell lymphoma: clinicopathological study of seven cases EJC SUPPLEMENTS 8:(4) p. 32. (2010) Folyóiratcikk /Absztrakt /Tudományos [ ] Balogh Z, Reiniger L, Rajnai H, Csomor J, Szepesi A, Balogh A, Deak L, Gagyi E, Bodor C, Matolcsy A High rate of genetic abnormalities of neoplastic cells in pseudofollicles of CLL CHROMOSOME RESEARCH 17:(Suppl 1) p (2009) 7th European Cytogenetics Conference. Stockholm, Svédország: Folyóiratcikk /Absztrakt /Tudományos [ ] 20. Erõs N, Marschalkó M, Lõrincz A, Hársing J, Csomor J, Szepesi A, Matolcsy A, Kárpáti S CD30-positive anaplastic large T-cell lymphoma of the tongue JOURNAL OF THE EUROPEAN ACADEMY OF DERMATOLOGY AND VENEREOLOGY 23:(2) pp (2009) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] [ Hitelesített ] Független idéző: 1 Összesen: 1 1 Wang WeiGe, Cai Ying, Sheng WeiQi, Lu HongFen, Li XiaoQiu The spectrum of primary mucosal CD30-positive T-cell lymphoproliferative disorders of the head and neck ORAL SURGERY ORAL MEDICINE ORAL PATHOLOGY ORAL RADIOLOGY (ISSN: ) 117: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 21. Fazakas A, Csire M, Berencsi G, Szepesi A, Matolcsy A, Jakab L, Karadi I, Varkony J Multicentric plasmocytic Castleman's disease with polyneuropathy, organomegaly, endocrinopathy, M protein, skin changes syndrome and coexistent human herpes virus-6 infection - a possible relationship (vol 50, pg 1661, 2009) LEUKEMIA AND LYMPHOMA 50:(12) p (2009) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 22. Fazakas A, Csire M, Berencsi G, Szepesi A, Matolcsy A, Jakab L, Karádi I, Várkonyi J Multicentric plasmocytic Castleman's disease with polyneuropathy, organomegaly, endocrinopathy, M protein, skin changes syndrome and coexistent human herpesvirus-6 infection - a possible relationship. LEUKEMIA AND LYMPHOMA 50:(10) pp (2009) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 / :12
5 [ Admin láttamozott ] Független idéző: 8 Függő idéző: 1 Összesen: 9 1 * Fazakas A, Csire M, Berencsi G, Szepesi A, Matolcsy A, Jakab L, Karadi I, Varkony J Multicentric plasmocytic Castleman's disease with polyneuropathy, organomegaly, endocrinopathy, M protein, skin changes syndrome and coexistent human herpes virus-6 infection - a possible relationship (vol 50, pg 1661, 2009) LEUKEMIA & LYMPHOMA 50: (12) pp (2009) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 2 Forghieri F, Potenza L, Barozzi P, Vallerini D, Riva G, Zanetti E, Quadrelli C, Torelli G, Luppi M HHV-6 and atypical lymphoproliferative disorders: are only qualitative molecular examinations sufficient to support a pathogenetic role? LEUKEMIA & LYMPHOMA 51: (3) pp (2010) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 3 Bonekamp D, Horton KM, Hruban RH, Fishman EK Castleman Disease: The Great Mimic RADIOGRAPHICS 31: (6) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 Ma Shihong, Liu Qinjiang, Yang Rong, Zhang Youcheng Diagnosis and surgical treatment of Castleman's disease National Medical Journal of China 91: (16) pp (2011) Link(ek): DOI, Wos-CSCD (Chinese), WoS, Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Wang X, Ye SH, Xiong CP, Gao JQ, Xiao CY, Xing XB Successful Treatment with Bortezomib and Thalidomide for POEMS Syndrome Associated with Multicentric Mixed-type Castleman's Disease JAPANESE JOURNAL OF CLINICAL ONCOLOGY (ISSN: ) 41: (10) pp (2011) Folyóiratcikk [ ] 6 Dickinson SI, Mo J, Cualing HD Lymphadenopathy with Predominant Follicular Patterns In: Non-Neoplastic Hematopathology and Infections. John Wiley and Sons, (ISBN ) pp Könyvrészlet /Könyvfejezet /Tudományos [ ] 7 Tian XL, Yi ES, Ryu JH Lymphocytic Interstitial Pneumonia and Other Benign Lymphoid Disorders SEMINARS IN RESPIRATORY AND CRITICAL CARE MEDICINE 33: (5) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 8 Aguilar-Rodriguez R, Milea S-L, Demirci I, Herold S, Flasshove M, Klosterhalfen B, Kinkel H, Janßen H Localized retroperitoneal Castleman's disease: A case report and review of the literature J. Med. Case Rep. (ISSN: ) 8: (1) Paper 93. (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Bonekamp David, Hruban Ralph H, Fishman Elliot K The Great Mimickers: Castleman Disease SEMINARS IN ULTRASOUND CT AND MRI (ISSN: ) 35: (3) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 23. Szepesi Á, Csomor J, Erős N, Kárpáti S, Matolcsy A, Marschalkó M Clinical characteristics of and course of epidermotropic primary cutaneous T-cell lymphomas: a case series of twelve patients In: EORTC CLTF Cutaneous Lymphoma Clinical Meeting,: Abstract Book. Konferencia helye, ideje: Athen, Görögország, Paper p. 95. Egyéb konferenciaközlemény /Absztrakt /Tudományos [ ] [ Admin láttamozott ] 24. Szepesi Á, Csomor J, Demeter J, Balassa K, Schneider T, Barna G, Matolcsy A Krónikus lymphocytás leukaemia (CLL) és akut myeloid leukaemia (AML) együttes előfordulása, két eset ismertetése és az irodalom áttekintése HEMATOLÓGIA-TRANSZFUZIOLÓGIA 42:(Suppl. 1) p. 90. (2009) Nyelv: Magyar Folyóiratcikk /Absztrakt /Tudományos [ ] [ Admin láttamozott ] 25. Varkonyi J, Farkas P, Kollai G, Szombath G, Tordai A, Andrikovics H, Sipos A, Szepesi A P100 Indications for iron chelation therapy - the Budapest Study Group protocol proposal LEUKEMIA RESEARCH 33:(SUPPL. 1) pp. S117-S118. (2009) Folyóiratcikk /Absztrakt /Tudományos [ ] Balogh Z, Reiniger L, Deak L, Bodor C, Csomor J, Szepesi A, Gagyi E, Kopper L, Matolcsy A IgV(H) gene mutation status and genomic imbalances in chronic lymphocytic leukaemia with increased prolymphocytes 5 / :12
6 6 / :12 (CLL/PL) ANNALS OF ONCOLOGY 19:(Suppl. 4) p (2008) 10th International Conference on Malignant Lymphoma. Lugano, Svájc: Folyóiratcikk /Absztrakt /Tudományos [ ] 27. Erős N, Csomor J, Demeter J, Désaknai M, Hársing J, Szepesi Á, Matolcsy A, Kárpáti S, Marschalkó M Cinicopathological features and outcome analysis of 6 patients with primary cutaneous CD4+ small/medium-sized pleomorphic Tcell lymphoma EORTC Cutaneous Lymphoma Task Force Clinical Meeting, Koppenhága, 2008 Sept (2008) Egyéb /Nem besorolt /Tudományos [ ] [ Admin láttamozott ] 28. Gagyi E, Balogh Z, Bödör C, Timár B, Reiniger L, Deák L, Csomor J, Csernus B, Szepesi A, Matolcsy A Somatic hypermutation of IGVH genes and aberrant somatic hypermutation in follicular lymphoma without BCL-2 gene rearrangement and expression HAEMATOLOGICA : THE HEMATOLOGY JOURNAL 93:(12) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 10 Függő idéző: 1 Összesen: 11 1 Ott G, Rosenwald A Molecular pathogenesis of follicular lymphoma HAEMATOL : HEMATOL J 93: (12) pp (2008) Folyóiratcikk /Ismertetés /Tudományos [ ] 2 Mottok A, Renne C, Seifert M, Oppermann E, Bechstein W, Hansmann ML, Kuppers R, Brauninger A Inactivating SOCS1 mutations are caused by aberrant somatic hypermutation and restricted to a subset of B-cell lymphoma entities BLOOD 114: (20) pp (2009) Folyóiratcikk /Rövid közlemény /Tudományos [ ] 3 van Krieken JH New developments in the pathology of malignant lymphoma: A review of the literature published from August to December 2008 Journal of Hematopathology 2: (1) pp (2009) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 4 Leich E, Zamo A, Horn H, Haralambieva E, Puppe B, Gascoyne RD, Chan WC, Braziel RM, Rimsza LM, Weisenburger DD, Delabie J, Jaffe ES, Fitzgibbon J, Staudt LM, Mueller-Hermelink HK, Calaminici M, Campo E, Ott G, Hernandez L, Rosenwald A MicroRNA profiles of t(14;18)-negative follicular lymphoma support a late germinal center B-cell phenotype BLOOD 118: (20) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Pan Y, Sun B Molecular genetic pathogenesis and research advances in follicular lymphoma without t(14;18) translocation Chinese Journal of Clinical Oncology 38: (21) pp (2011) Link(ek): Wos-CSCD (Chinese), WoS, Scopus Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 6 Leich E, Ott G, Rosenwald A Pathology, pathogenesis and molecular genetics of follicular NHL BEST PRACTICE & RESEARCH CLINICAL HAEMATOLOGY 24: (2) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 7 * Barna G, Mihalik R, Timar B, Tombol J, Csende Z, Sebestyen A, Bodor C, Csernus B, Reiniger L, Petak I, Matolcsy A ROR1 expression is not a unique marker of CLL HEMATOLOGICAL ONCOLOGY 29: (1) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Baseggio L, Geay MO, Gazzo S, Berger F, Traverse-Glehen A, Ffrench M, Hayette S, Callet-Bauchu E, Verney A, Morel D, Jallades L, Magaud JP, Salles G, Felman P In non-follicular lymphoproliferative disorders, IGH/BCL2-fusion is not restricted to chronic lymphocytic leukaemia BRITISH JOURNAL OF HAEMATOLOGY 158: (4) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Grigore R, Ene P, Popescu CR, Şaguna C, Popescu B, Briceag I, Berteşteanu SVG The expression of BCL 2 and KI 67 in patients with non Hodgkin's malignant lymphoma of the head and neck Archives of the Balkan Medical Union 47: (1) pp (2012) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 10 Gu XW, Shivarov V, Strout MP The role of activation-induced cytidine deaminase in lymphomagenesis CURRENT OPINION IN HEMATOLOGY 19: (4) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ]
7 11 Chang ST, Lu YH, Lu CL, Kuo SY, Liu HX, Lin SH, Win KT, Hsieh YC, Chuang SS Follicular lymphoma in Taiwan: a low frequency of t(14;18), with grade 3A tumours more closely related to grade 3B than to low-grade tumours HISTOPATHOLOGY 63: (1) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 29. Gagyi E, Balogh Z, Bodor C, Timar B, Reiniger L, Deak L, Csomor J, Csernus B, Szepesi A, Matolcsy A BCL-2 negative follicular lymphoma is associated with somatic hypermutation of the IGV(H) genes and aberrant somatic hypermutation ANNALS OF ONCOLOGY 19:(Suppl. 4) p (2008) 10th International Conference on Malignant Lymphoma. Lugano, Svájc: Folyóiratcikk /Absztrakt /Tudományos [ ] Balogh Z, Reiniger L, Deák L, Bödör C, Csomor J, Szepesi A, Gagyi E, Kopper L, Matolcsy A IgVH gene mutation status and genomic imbalances in chronic lymphocytic leukaemia with increased prolymphocytes (CLL/PL) HEMATOLOGICAL ONCOLOGY 25:(2) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 1 Függő idéző: 1 Összesen: 2 1 * Sipeky C, Keri G, Kiss A, Kopper L, Matolcsy A, Timar J, Molnar M J, Nagy L, Nemeth G, Petak I, Rasko I, Falus A, Melegh B Population pharmacogenomics and personalized medicine research in hungary: Achievements and lessons learned Current Pharmacogenomics and Personalized Medicine 8: (3) pp (2010) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Rouhigharabaei L, Ferreiro JF, Put N, Michaux L, Tousseyn T, Lefebvre C, Gardiner A, De Kelver W, Demuynck H, Verschuere J, Théate I, Vicente C, Vandenberghe P, Cools J, Wlodarska I BMI1, The polycomb-group gene, is recurrently targeted by genomic rearrangements in progressive B-cell leukemia/lymphoma Genes Chromosomes and Cancer 52: (10) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] Rajnai H, Bödör C, Reiniger L, Tímár B, Csernus B, Szepesi Á, Csomor J, Matolcsy A Új lehetőség a krónikus myeloproliferativ betegségek diagnosztikájában: a JAK2 mutáció kimutatása ORVOSI HETILAP 147:(45) pp (2006) Nyelv: Magyar Link(ek): MOB, PubMed, Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 2 Összesen: 2 1 Iványi J L, Marton É, Plander M A JAK2V617F-mutáció jelentosége krónikus myeloproliferativ neoplasiás betegeinkben [Significance of the JAK2V617F mutation in patients with chronic myeloproliferative neoplasia] Orvosi Hetilap 152: (45) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Karakulska-Prystupiuk E, Gierej B, Paszkowska-Kowalewska M, Wilkowojska U, Jȩdrzejczak WW Zakrzepica ukiadu wrotnego jako główny objaw niesklasyfikowanego JAK2-dodatnlego nowotworu mieloproliferacyjnego - Opis przypadku [Portal vein thrombosis as the main symptom of unclassified JAK2-posltlve myeloproliferative neoplasm - Case report]. Polski Merkuriusz Lekarski 33: (193) pp (2012) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 32. Reiniger L, Bodor C, Bognar A, Balogh Z, Csomor J, Szepesi A, Kopper L, Matolcsy A Richter's and prolymphocytic transformation of chronic lymphocytic leukemia are associated with high mrna expression of activation-induced cytidine deaminase and aberrant somatic hypermutation LEUKEMIA 20:(6) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 25 Függő idéző: 1 Összesen: 26 1 * Rossi D, Berra E, Cerri M, Deambrogi C, Barbieri C, Franceschetti S, Lunghi M, Conconi A, Paulli M, Matolcsy A, Pasqualucci L, Capello D, Gaidano G Aberrant somatic hypermutation in transformation of follicular lymphoma and chronic lymphocytic leukemia to diffuse large B-cell lymphoma HAEMATOLOGICA-THE HEMATOLOGY JOURNAL 91: (10) pp (2006) 7 / :12
8 8 / :12 Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Deutsch A J A, Aigelsreiter A, Staber P B, Beham A, Linkesch W, Guelly C, Brezinschek R I, Fruhwirth M, Emberger W, Buettner M, Beham-Schmid C, Neumeister P MALT lymphoma and extranodal diffuse large B-cell lymphoma are targeted by aberrant somatic hypermutation Blood 109: (8) pp (2007) Link(ek): DOI, PubMed, Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Okazaki I, Kotani A, Honjo T Role of AID in Tumorigenesis ADV IMMUNOL 94: pp (2007) Link(ek): DOI, PubMed, Scopus Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 4 Rossi D, Cerri M, Capello D, Deambrogi C, Rossi FM, Zucchetto A, De Paoli L, Cresta S, Rasi S, Spina V, Franceschetti S, Lunghi M, Vendramin C, Bomben R, Ramponi A, Monga G, Conconi A, Magnani C, Gattei V, Gaidano G Biological and clinical risk factors of chronic lymphocytic leukaemia transformation to Richter syndrome BRITISH JOURNAL OF HAEMATOLOGY 142: (2) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Dighiero G, Hamblin TJ Chronic lymphocytic leukaemia LANCET 371: (9617) pp (2008) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 6 Hamblin TJ, Davis ZA, Oscier DG Determination of how many immunoglobulin variable region heavy chain mutations are allowable in unmutated chronic lymphocytic leukaemia - long-term follow up of patients with different percentages of mutations BRITISH JOURNAL OF HAEMATOLOGY 140: (3) pp (2008) Folyóiratcikk /Rövid közlemény /Tudományos [ ] 7 Halldorsdottir AM, Fruhwirth M, Deutsch A, Aigesreiter A, Beham-Schmid C, Agnarssonc BA, Neurneister P, Burack WR Quantifying the role of aberrant somatic hypermutation in transformation of follicular lymphoma LEUKEMIA RESEARCH 32: (7) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Fueller F, Kubatzky KF The small GTPase RhoH is an atypical regulator of haematopoietic cells Cell Communication and Signaling 6: Paper 6. (2008) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 9 Stano-Kozubik K, Malcikova J, Tichy B, Kotaskova J, Borsky M, Hrabcakova V, Francova H, Valaskova I, Bourkova L, Smardova J, Doubek M, Brychtova Y, Pospisilova S, Mayer J, Trbusek M Inactivation of p53 and amplification of MYCN gene in a terminal lymphoblastic relapse in a chronic lymphocytic leukemia patient CANCER GENETICS AND CYTOGENETICS 189: (1) pp (2009) Folyóiratcikk /Szakcikk /Tudományos [ ] 10 Dal-Bo M, Bertoni F, Forconi F, Zucchetto A, Bomben R, Marasca R, Deaglio S, Laurenti L, Efremov DG, Gaidano G, Del Poeta G, Gattei V Intrinsic and extrinsic factors influencing the clinical course of B-cell chronic lymphocytic leukemia: prognostic markers with pathogenetic relevance JOURNAL OF TRANSLATIONAL MEDICINE 7: Paper 76. (2009) Link(ek): DOI, PubMed, WoS Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 11 Ross D, Gaidano G Richter syndrome: molecular insights and clinical perspectives HEMATOLOGICAL ONCOLOGY 27: (1) pp (2009) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 12 Rossi D, Spina V, Cerri M, Rasi S, Deambrogi C, De Paoli L, Laurenti L, Maffei R, Forconi F, Bertoni F, Zucca E, Agostinelli C, Cabras A, Lucioni M, Martini M, Magni M, Deaglio S, Ladetto M, Nomdedeu JF, Besson C, Ramponi A, Canzonieri V, Paulli M, Marasca R, Larocca LM, Carbone A, Pileri SA, Gattei V, Gaidano G Stereotyped B-Cell Receptor Is an Independent Risk Factor of Chronic Lymphocytic Leukemia Transformation to Richter Syndrome CLINICAL CANCER RESEARCH 15: (13) pp (2009) Folyóiratcikk /Szakcikk /Tudományos [ ] 13 Leuenberger M, Frigerio S, Wild PJ, Noetzli F, Korol D, Zimmermann DR, Gengler C, Probst-Hensch NM, Moch H, Tinguely M AID protein expression in chronic lymphocytic leukemia/small lymphocytic lymphoma is associated with poor prognosis and complex genetic alterations MODERN PATHOLOGY 23: (2) pp (2010) Folyóiratcikk /Szakcikk /Tudományos [ ] 14 Duong T, Grange F, Auffret N, Aractingi S, Bodemer C, Brousse N, Hermine O, Fraitag S Cutaneous Richter's Syndrome, Prognosis, and Clinical, Histological and Immunohistological Patterns: Report of Four Cases and Review of the Literature DERMATOLOGY 220: (3) pp (2010) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 15 Scandurra M, Rossi D, Deambrogi C, Rancoita PMV, Chigrinova E, Mian M, Cerri M, Rasi S, Sozzi E, Forconi F, Ponzoni M, Moreno SM, Piris MA, Inghirami G, Zucca E, Gattei V, Rinaldi A, Kwee I, Gaidano G, Bertoni F Genomic profiling of Richter's syndrome: recurrent lesions and differences with de novo diffuse large B-cell lymphomas HEMATOLOGICAL ONCOLOGY 28: (2) pp (2010) Folyóiratcikk /Szakcikk /Tudományos [ ]
9 9 / :12 16 Hoehn D, Medeiros LJ, Konoplev S Molecular Pathology of Chronic Lymphocytic Leukemia In: Crisan D (szerk.) : Hematopathology: Genomic Mechanisms of Neoplastic Diseases. HUMANA PRESS INC., (ISBN ) pp (Molecular and Translational Medicine) Link(ek): DOI Könyvrészlet /Könyvfejezet /Tudományos [ ] 17 Roullet M, Bagg A The Basis and Rational Use of Molecular Genetic Testing in Mature B-cell Lymphomas ADVANCES IN ANATOMIC PATHOLOGY 17: (5) pp (2010) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 18 Fangazio M, De Paoli L, Rossi D, Gaidano G Predictive markers and driving factors behind Richter syndrome development EXPERT REVIEW OF ANTICANCER THERAPY 11: (3) pp (2011) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 19 Patten PEM, Chu CC, Albesiano E, Damle RN, Yan X-J, Kim D, Zhang L, Magli AR, Barrientos J, Kolitz JE, Allen SL, Rai KR, Roa S, Mongini PK, MacCarthy T, Scharff MD, Chiorazzi N IGHV-unmutated and IGHV-mutated chronic lymphocytic leukemia cells produce activation-induced deaminase protein with a full range of biologic functions Blood 120: (24) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 20 Honjo T, Kobayashi M, Begum N, Kotani A, Sabouri S, Nagaoka H The AID Dilemma: Infection, or Cancer? In: Tew KD, Fisher PB (szerk.) : Advances in Cancer Research. (113) San Diego: Elsevier Academic Press, (ISBN ) pp (Advances in Cancer Research) Könyvrészlet /Könyvfejezet /Tudományos [ ] 21 Gu XW, Shivarov V, Strout MP The role of activation-induced cytidine deaminase in lymphomagenesis CURRENT OPINION IN HEMATOLOGY 19: (4) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 22 Dege C, Hagman J Activation of Aicda gene transcription by Pax5 in plasmacytoma cells IMMUNOLOGIC RESEARCH 55: (1-3) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 23 Montamat-Sicotte D, Palacios F, Di Noia JM, Oppezzo P Origins and consequences of AID expression in lymphoid neoplasms Current Immunology Reviews 9: (2) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 24 Rebhandl S, Huemer M, Gassner F J, Zaborsky N, Hebenstreit D, Catakovic K, Groessinger E M, Greil R, Geisberger R APOBEC3 signature mutations in chronic lymphocytic leukemia LEUKEMIA (ISSN: ) 28: (9) pp (2014) Link(ek): DOI, PubMed, WoS Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 25 Jain P, Keating M, O'brien S Richter's syndrome-update on biology and management Expert Opinion on Orphan Drugs (ISSN: ) 2: (5) pp (2014) Folyóiratcikk /Tudományos [ ] 26 Rasul Eahsan, Salamon Daniel, Nagy Noemi, Leveau Benjamin, Banati Ferenc, Szenthe Kalman, Koroknai Anita, Minarovits Janos, Klein George, Klein Eva The MEC1 and MEC2 Lines Represent Two CLL Subclones in Different Stages of Progression towards Prolymphocytic Leukemia PLOS ONE (ISSN: ) 9: (8) Paper e (2014) Link(ek): DOI, PubMed, WoS Folyóiratcikk /Szakcikk /Tudományos [ ] 33. Szepesi Á, Matolcsy A Onkohematológiai diagnosztika ORVOSKÉPZÉS 81:(3) pp (2006) Nyelv: Magyar Link(ek): MOB Folyóiratcikk /Szakcikk /Tudományos [ ] Bodor C, Bognar A, Reiniger L, Szepesi A, Toth E, Kopper L, Matolcsy A Aberrant somatic hypermutation and expression of activation-induced cytidine deaminase mrna in mediastinal large B-cell lymphoma ANNALS OF ONCOLOGY 16:(Suppl. 5) p (2005) Folyóiratcikk /Absztrakt /Tudományos [ ]
10 35. Bodor C, Bognar A, Reiniger L, Szepesi A, Toth E, Kopper L, Matolcsy A Aberrant somatic hypermutation and expression of activation-induced cytidine deaminase mrna in mediastinal large B-cell lymphoma BRITISH JOURNAL OF HAEMATOLOGY 129:(3) pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 11 Függő idéző: 1 Összesen: 12 1 Rossi D, Cerri M, Capello D, Deambrogi C, Berra E, Franceschetti S, Alabiso O, Gloghini A, Paulli M, Carbone A, Pileri S A, Pasqualucci L, Gaidano G Aberrant somatic hypermutation in primary mediastinal large B-cell lymphoma LEUKEMIA 19: (12) pp (2005) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 2 Liso A, Capello D, Marafioti T, Tiacci E, Cerri M, Distler V, Paulli M, Carbone A, Delsol G, Campo E, Pileri S, Pasqualucci L, Gaidano G, Falini B Aberrant somatic hypermutation in tumor cells of nodular-lymphocyte-predominant and classic Hodgkin lymphoma BLOOD 108: (3) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Mason D Y Clues to lymphoma's cellular origin BLOOD 107: (6) pp (2006) Folyóiratcikk /Rövid közlemény /Tudományos [ ] 4 * Reiniger L, Bödör C, Bognár A, Balogh Z, Csomor J, Szepesi A, Kopper L, Matolcsy Richter's and prolymphocytic transformation of chronic lymphocytic leukemia are associated with high mrna expression of activationinduced cytidine deaminase and aberrant somatic hypermutation Leukemia 20: (6) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Popov SW, Moldenhauer G, Wotschke B, Bruderlein S, Barth TF, Dorsch K, Ritz O, Moller P, Leithauser F Target sequence accessibility limits activation-induced cytidine deaminase activity in primary mediastinal B-cell lymphoma CANCER RESEARCH 67: (14) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Engels K, Jungnickel B, Tobollik S, Hansmann ML, Kriener S, Willenbrock K Expression of Activation-induced Cytidine Deaminase in Malignant Lymphomas Infiltrating the Bone Marrow APPLIED IMMUNOHISTOCHEMISTRY & MOLECULAR MORPHOLOGY 16: (6) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] 7 Halldorsdottir AM, Fruhwirth M, Deutsch A, Aigesreiter A, Beham-Schmid C, Agnarssonc BA, Neurneister P, Burack WR Quantifying the role of aberrant somatic hypermutation in transformation of follicular lymphoma LEUKEMIA RESEARCH 32: (7) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Fueller F, Kubatzky KF The small GTPase RhoH is an atypical regulator of haematopoietic cells Cell Communication and Signaling 6: Paper 6. (2008) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 9 Takakuwa T, Miyauchi A, Aozasa K Aberrant somatic hypermutations in thyroid lymphomas LEUKEMIA RESEARCH 33: (5) pp (2009) Folyóiratcikk /Szakcikk /Tudományos [ ] 10 Deutsch AJA, Fruhwirth M, Aigelsreiter A, Cerroni L, Neumeister P Primary Cutaneous Marginal Zone B-Cell Lymphomas Are Targeted by Aberrant Somatic Hypermutation JOURNAL OF INVESTIGATIVE DERMATOLOGY 129: (2) pp (2009) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 Dalle S, Thomas L, Balme B, Dumontet C, Thieblemont C Primary cutaneous marginal zone lymphoma CRITICAL REVIEWS IN ONCOLOGY HEMATOLOGY 74: (3) pp (2010) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 12 Orthwein A, Di Noia JM Activation induced deaminase: How much and where? SEMINARS IN IMMUNOLOGY 24: (4) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 36. Bognar A, Csernus B, Bodor C, Szepesi A, Toth E, Kopper L, Matolcsy A Clonal selection in the bone marrow involvement of follicular lymphoma ANNALS OF ONCOLOGY 16:(5) p (2005) Folyóiratcikk /Absztrakt /Tudományos [ ] 10 / :12
11 37. Bognar A, Csernus B, Bodor C, Reiniger L, Szepesi A, Toth E, Kopper L, Matolcsy A Clonal selection in the bone marrow involvement of follicular lymphoma LEUKEMIA 19:(9) pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 19 Függő idéző: 1 Összesen: 20 1 Ladetto M, Mantoan B, De Marco F, Drandi D, Aguzzi C, Astolfi M, Vallet S, Ricca I, Dell'Aquila M, Pagliano G, Monitllo L, Pollio B, Santo L, Cristiano C, Rocci A, Francese R, Bodoni CL, Borchiellini A, Schinco P, Boccadoro M, Tarella C Cells carrying nonlymphoma-associated bcl-2/igh rearrangements (NLABR) are phenotypically related to follicular lymphoma and can establish as long-term persisting clonal populations EXPERIMENTAL HEMATOLOGY 34: (12) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Roulland S, Navarro JM, Grenot P, Milili M, Agopian J, Montpellier B, Gauduchon P, Lebailly P, Schiff C, Nadel B Follicular lymphoma-like B cells in healthy individuals: a novel intermediate step in early lymphomagenesis JOURNAL OF EXPERIMENTAL MEDICINE 203: (11) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Seitz V, Stiege A, Mundlos S, Lenze D, Lammert H, Clermont A, Hirsch B, Von der Wall E, Muller H, Kirsch A, Diaz-Espada F, Uharek L, Anagnostopoulos I, Stein H, Hummel M Immunoglobulin receptor evolution in follicular lymphoma and a review of literature LEUKEMIA & LYMPHOMA 48: (10) pp (2007) Folyóiratcikk /Rövid közlemény /Tudományos [ ] 4 Roulland S, SuareZ F, Hermine O, Nadel B Pathophysiological aspects of memory B-cell development TRENDS IN IMMUNOLOGY 29: (1) pp (2008) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 5 Ruminy P, Jardin F, Picquenot JM, Parmentier F, Contentin N, Buchonnet G, Tison S, Rainville V, Tilly H, Bastard C S mu mutation patterns suggest different progression pathways in follicular lymphoma: early direct or late from FL progenitor cells BLOOD 112: (5) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Nakamura Y, Sato Y, Yoshida K, Kakegawa E, Ito Y, Seyama A, Kayano H, Bessho M A molecular analysis of biclonal follicular lymphoma: further evidence for bone marrow origin and clonal selection EUROPEAN JOURNAL OF HAEMATOLOGY 82: (5) pp (2009) Folyóiratcikk /Szakcikk /Tudományos [ ] 7 Eide MB, Liestol K, Lingjaerde OC, Hystad ME, Kresse SH, Meza-Zepeda L, Myklebost O, Troen G, Aamot HV, Holte H, Smeland EB, Delabie J Genomic alterations reveal potential for higher grade transformation in follicular lymphoma and confirm parallel evolution of tumor cell clones BLOOD 116: (9) pp (2010) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Zuckerman NS, McCann KJ, Ottensmeier CH, Barak M, Shahaf G, Edelman H, Dunn-Walters D, Abraham RS, Stevenson FK, Mehr R Ig gene diversification and selection in follicular lymphoma, diffuse large B cell lymphoma and primary central nervous system lymphoma revealed by lineage tree and mutation analyses INTERNATIONAL IMMUNOLOGY 22: (11) pp (2010) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Roulland S, Faroudi M, Mamessier E, Sungalee S, Salles G, Nadel B Early Steps of Follicular Lymphoma Pathogenesis In: Alt FW, Austen KF, Honjo T, Melchers F, Uhr JW, Unanue ER (szerk.) : Advances in Immunology. (111) San Diego: Elsevier Academic Press, (ISBN ) pp (Advances in Immunology) Könyvrészlet /Könyvfejezet /Tudományos [ ] 10 Jegalian AG, Eberle FC, Pack SD, Mirvis M, Raffeld M, Pittaluga S, Jaffe ES Follicular lymphoma in situ: clinical implications and comparisons with partial involvement by follicular lymphoma BLOOD 118: (11) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 Wahlin BE, Sander B, Christensson B, Ostenstad B, Holte H, Brown PD, Sundstrom C, Kimby E Entourage: the immune microenvironment following follicular lymphoma BLOOD CANCER JOURNAL 2: Paper e52. (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 12 * Rajnai H, Bodor C, Balogh Z, Gagyi E, Csomor J, Krenacs T, Toth E, Matolcsy A Impact of the reactive microenvironment on the bone marrow involvement of follicular lymphoma HISTOPATHOLOGY 60: (6B) pp. E66-E75. (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 13 Guilloton F, Caron G, Menard C, Pangault C, Ame-Thomas P, Dulong J, De Vos J, Rossille D, Henry C, Lamy T, Fouquet O, Fest T, Tarte K Mesenchymal stromal cells orchestrate follicular lymphoma cell niche through the CCL2-dependent recruitment and polarization of monocytes BLOOD 119: (11) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 / :12
12 14 Sachen KL, Strohman MJ, Singletary J, Alizadeh AA, Kattah NH, Lossos C, Mellins ED, Levy S, Levy R Self-antigen recognition by follicular lymphoma B-cell receptors BLOOD 120: (20) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 15 Mourcin F, Pangault C, Amin-Ali R, Amé-Thomas P, Tarte K Stromal cell contribution to human follicular lymphoma pathogenesis Frontiers in Immunology 3: (SEP) Paper 280. (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 16 Paulsson K, Forestier E, Andersen MK, Autio K, Barbany G, Borgström G, Cavelier L, Golovleva I, Heim S, Heinonen K, Hovland R, Johannsson JH, Kjeldsen E, Nordgren A, Palmqvist L, Johansson B High modal number and triple trisomies are highly correlated favorable factors in childhood B-cell precursor high hyperdiploid acute lymphoblastic leukemia treated according to the NOPHO ALL 1992/2000 protocols Haematologica (ISSN: ) 98: (9) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 17 Kluin PM Origin and migration of follicular lymphoma cells Haematologica 98: (9) pp (2013) Folyóiratcikk /Ismertetés /Tudományos [ ] 18 Tabibian-Keissar H, Schibby G, Michaeli M, Rakovsky-Shapira A, Azogui-Rosenthal N, Dunn-Walters DK, Rosenblatt K, Mehr R, Barshack I PCR amplification and high throughput sequencing of immunoglobulin heavy chain genes from formalin-fixed paraffin-embedded human biopsies Experimental and Molecular Pathology 94: (1) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 19 Wartenberg M, Vasil P, zum Bueschenfelde CM, Ott G, Rosenwald A, Fend F, Kremer M Somatic hypermutation analysis in follicular lymphoma provides evidence suggesting bidirectional cell migration between lymph node and bone marrow during disease progression and relapse HAEMATOLOGICA 98: (9) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 20 Ame-Thomas P, Tarte K The yin and the yang of follicular lymphoma cell niches: Role of microenvironment heterogeneity and plasticity SEMINARS IN CANCER BIOLOGY (ISSN: X) 24: pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 38. Szepesi A Molecular biology of CLL MAGYAR ONKOLÓGIA 49:(4) pp (2005) Nyelv: Magyar Link(ek): PubMed, Scopus Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] Független idéző: 2 Függő idéző: 1 Összesen: 3 1 * Szepesi Á, Matolcsy A Diagnostics in oncohaematology Orvoskepzes 81: (3) pp (2006) Link(ek): Scopus Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 2 Pajor L Chronic lymphocytic leukaemia: An autoimmune disorder? Prognostic factors and the current view of pathogenesis Orvosi Hetilap 148: (19) pp (2007) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 3 Kajtár B, Jáksó P, Kereskai L, Lacza Á, Méhes G, Bodnár MA, Dombi JP, Gasztonyi Z, Egyed M, Iványi JL, Kovács G, Marton É, Palaczki A, Petz S, Tóth P, Sziládi E, Losonczy H, Pajor L Complex analysis of prognostic factors in chronic lymphocytic leukemia Orvosi Hetilap 148: (16) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] Bodor C, Bognar A, Szepesi A, Matolcsy A Genetic instability caused by somatic hypermutation in primer mediastinal B-cell lymphoma TISSUE ANTIGENS 64:(4) p (2004) Folyóiratcikk /Absztrakt /Tudományos [ ] 40. Bognar A, Csernus B, Bodor C, Szepesi A, Matolcsy A Clonal selection in the bone marrow involvement of follicular lymphoma TISSUE ANTIGENS 64:(4) p (2004) 12 / :12
13 Folyóiratcikk /Absztrakt /Tudományos [ ] 41. Csernus B, Timar B, Fulop Z, Bognar A, Szepesi A, Laszlo T, Jakso P, Warnke R, Kopper L, Matolcsy A Mutational analysis of IgV(H) and BCL-6 genes suggests thymic B-cells origin of mediastinal (thymic) B-cell lymphoma LEUKEMIA AND LYMPHOMA 45:(10) pp (2004) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 7 Függő idéző: 1 Összesen: 8 1 Zamo A, Malpeli G, Scarpa A, Doglioni C, Chilosi M, Menestrina F Expression of TP73L is a helpful diagnostic marker of primary mediastinal large B-cell lymphomas MODERN PATHOL 18: pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Staudt LM, Dave S The biology of human lymphoid malignancies revealed by gene expression profiling ADV IMMUNOL 87: pp (2005) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 3 Savage KJ Primary mediastinal large b-cell lymphoma ONCOLOGIST 11: pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 * Reiniger L, Bodor C, Bognar A, Balogh Z, Csomor J, Szepesi A, Kopper L, Matolcsy A Richter's and prolymphocytic transformation of chronic lymphocytic leukemia are associated with high mrna expression of activationinduced cytidine deaminase and aberrant somatic hypermutation LEUKEMIA 20: pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Savage Kerry J Rare B-cell lymphomas - Primary mediastinal, intravascular, and primary effusion lymphoma In: Cancer Treatment and Research. Springer, pp (CANCER TREATMENT AND RESEARCH) Könyvrészlet /Könyvfejezet /Tudományos [ ] 6 Steidl C, Gascoyne RD The molecular pathogenesis of primary mediastinal large B-cell lymphoma BLOOD (ISSN: ) 118: (10) pp (2011) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 7 Pero R, Palmieri D, Angrisano T, Valentino T, Federico A, Franco R, Lembo F, Klein-Szanto AJ, Del Vecchio L, Montanaro D, Keller S, Arra C, Papadopoulou V, Wagner SD, Croce CM, Fusco A, Chiariotti L, Fedele M POZ-, AT-hook-, and Zinc Finger-containing Protein (PATZ) Interacts with Human Oncogene B Cell Lymphoma 6 (BCL6) and Is Required for Its Negative Autoregulation JOURNAL OF BIOLOGICAL CHEMISTRY (ISSN: ) 287: (22) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Dong F, Ke X-Y Recent advances in primary mediastinal large B-cell lymphoma Journal of Leukemia and Lymphoma 21: (4) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 42. Schnur J, Olah J, Szepesi A, Nagy P, Thorgeirsson SS Thioacetamide-induced hepatic fibrosis in transforming growth factor beta-1 transgenic mice EUROPEAN JOURNAL OF GASTROENTEROLOGY AND HEPATOLOGY 16:(2) pp (2004) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 39 Függő idéző: 1 Összesen: 40 1 Shek FW, Benyon RC How can transforming growth factor beta be targeted usefully to combat liver fibrosis? EUROPEAN JOURNAL OF GASTROENTEROLOGY AND HEPATOLOGY (ISSN: X) 16: (2) pp (2004) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Unknown Chinese Journal of Infections Diseases (ISSN: ) 23: (5) pp (2005) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Chang M -L, Yeh C -T, Chang P -Y, Chen J -C Comparison of murine cirrhosis models induced by hepatotoxin administration and common bile duct ligation World Journal of Gastroenterology 11: (27) pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 13 / :12
14 14 / :12 4 Hung KS, Lee TH, Chou WY, Wu CL, Cho CL, Lu CN, Jawan B, Wang CH Interleukin-10 gene therapy reverses thioacetamide-induced liver fibrosis in mice BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS (ISSN: X) 336: (1) pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Ding XK, Saxena NK, Lin SB, Xu A, Srinivasan S, Anania FA The roles of leptin and adiponectin: A novel paradigm in adipocytokine regulation of liver fibrosis and stellate cell biology AMERICAN JOURNAL OF PATHOLOGY (ISSN: ) 166: (6) pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Wang CH, Lee TH, Lu CN, Chou WY, Hung KS, Concejero AM, Jawan B Electroporative alpha-msh gene transfer attenuates thioacetamide-induced murine hepatic fibrosis by MMP and TIMP modulation GENE THERAPY (ISSN: ) 13: (13) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 7 Avraham Y, Israeli E, Gabbay E, Okun A, Zolotarev O, Silberman I, Ganzburg V, Dagon Y, Magen I, Vorobia L, Pappo O, Mechoulam R, Ilan Y, Berry EM Endocannabinoids affect neurological and cognitive function in thioacetamide-induced hepatic encephalopathy in mice NEUROBIOLOGY OF DISEASE (ISSN: ) 21: (1) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 de Gouville AC, Huet S Inhibition of ALK5 as a new approach to treat liver fibrotic diseases DRUG NEWS & PERSPECTIVES (ISSN: ) 19: (2) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Prosser CC, Yen RD, Wu J Molecular therapy for hepatic injury and fibrosis: Where are we? WORLD JOURNAL OF GASTROENTEROLOGY (ISSN: ) 12: (4) pp (2006) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 10 Yu Yihan, Yang Daofeng, Xie Linka Construction and Expression of the Eukaryotic Expression Vector Containing Truncated Type Ⅱ Human Transforming Growth Factor-beta Receptor Journal of Huazhong University of Science and Technology. Health Science (ISSN: ) 36: (1) pp (2007) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 SHU Jianchang, WU Haien, PI Xinjun, HE Yajun, LU Xia, FANG Li Curcumin inhibits lipid peroxidation and the expression of TGF - beta1 and PDGF in the liver of rats with hepatic fibrosis Chinese Journal of Pathophysiology (ISSN: ) 23: (12) pp (2007) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 12 Yang Y -J, Huang F Role of hepatic stellate cells and correlated cytokines in the formation of hepatic fibrosis World Chinese Journal of Digestology 15: (27) pp (2007) Link(ek): Scopus Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 13 Palacios RS, Roderfeld M, Hemmann S, Rath T, Atanasova S, Tschuschner A, Gressner OA, Weiskirchen R, Graf J, Roeb E Activation of hepatic stellate cells is associated with cytokine expression in thioacetamide-induced hepatic fibrosis in mice LABORATORY INVESTIGATION (ISSN: ) 88: (11) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] 14 Yang Y -J, Huang F, Hu J, Ma L, Li Z -W Effect of interleukin-10 on TGF-β1-induced CTGF expression in hepatic stellate cells World Chinese Journal of Digestology 16: (19) pp (2008) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 15 Newell P, Villanueva A, Friedman SL, Koike K, Llovet JM Experimental models of hepatocellular carcinoma JOURNAL OF HEPATOLOGY (ISSN: ) 48: (5) pp (2008) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 16 GUO Jianchun, BAO Jianfeng, CHEN Qunwei, LI Xiaoou, Shi Junping, LOU Guoqiang, SHI Weizhen, Xun Yungao Level of serum and liver tissue TGF-beta1 in patients with liver fibrosis due to chronic hepatitis B Chinese Journal of Experimental and Clinical Virology (ISSN: ) 22: (5) pp (2008) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 17 Shi HY, Dong L, Bai YH, Zhao JH, Zhang Y, Zhang L Chlorogenic acid against carbon tetrachloride-induced liver fibrosis in rats EUROPEAN JOURNAL OF PHARMACOLOGY (ISSN: ) 623: (1-3) pp (2009) Folyóiratcikk /Szakcikk /Tudományos [ ] 18 LIU Jin-Xia, SUN Dian-Xing, CAO Zhi-Chen Effects and possible mechanism of HGF/c-Met system on the convalescence stage in hepatic fibrosis rats Chinese Journal of Gerontology (ISSN: ) 29: (6) pp (2009) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 19 Heindryckx F, Colle I, Van Vlierberghe H Experimental mouse models for hepatocellular carcinoma research INTERNATIONAL JOURNAL OF EXPERIMENTAL PATHOLOGY (ISSN: ) 90: (4) pp (2009) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ]
15 15 / :12 20 Huo Lijuan, Zhang Suojuan, Liu Ying Clinical evaluation of valsartan on portal hypertension in patients with hepatic cirrhosis Chinese Journal of Hepatology (ISSN: ) 18: (8) pp (2010) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 21 Liao M, Lin X, Chen Z -N, Li Y, Zhuo L Effects of cocktail therapy on TGF-β1, COL I and COL III expression in liver fibrosis in rats World Chinese Journal of Digestology 18: (18) pp (2010) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 22 Liao M, Li Y, Shu W Effects of genistein on cell proliferation and TGF-β1, MMP-2 and TIMP-2 expression in rat hepatic stellate cells World Chinese Journal of Digestology 18: (3) pp (2010) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 23 Xu Ming, Sun Shen, Feng Panpan, Liu Jing Effects of Simvastatin on Hepatic Fibrosis in Rats and Its Mechanism Science & Technology Review (ISSN: ) 28: (24) pp (2010) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 24 Cui W, Jin HB, Li ZW Mechanism of the transforming growth factor-beta induction of fibronectin expression in hepatic stem-like cells BRAZILIAN JOURNAL OF MEDICAL AND BIOLOGICAL RESEARCH (ISSN: X) 43: (1) pp (2010) Folyóiratcikk /Szakcikk /Tudományos [ ] 25 Pan Chenwei, Pan Zhenzhen, Chen Yongping The Study of the Specific Antibody of Rat Induced by Recombinant TGF-beta1 Vaccine and Its Preventing Hepatic Fibrosis Chinese General Practice (ISSN: ) 13: (10C) pp (2010) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 26 Gu K, Zhao J -D, Ren Z -G, Ma N -Y, Lai S -T, Wang J, Liu J, Jiang G -L A natural process of cirrhosis resolution and deceleration of liver regeneration after thioacetamide withdrawal in a rat model Molecular Biology Reports 38: (3) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 27 Liao M, Mo C -F, Zhou Y, He M, Zhuo L Alterations in fibrosis-related gene expression and proteomic expression profile in rat hepatic stellate cells exposed to the cocktail World Chinese Journal of Digestology 19: (17) pp (2011) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 28 Avraham Y, Grigoriadis N C, Poutahidis T, Vorobiev L, Magen I, Ilan Y, Mechoulam R, Berry E M Cannabidiol improves brain and liver function in a fulminant hepatic failure-induced model of hepatic encephalopathy in mice British Journal of Pharmacology 162: (7) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 29 Wang LQ, Zhou HJ, Pan CF, Zhu SM, Xu LM Expression of IL-1 beta, IL-6 and TNF-alpha in rats with thioacetamide-induced acute liver failure and encephalopathy: correlation with brain edema ASIAN BIOMEDICINE (ISSN: ) 5: (2) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 30 Kono T, Kashiwade Y, Asama T, Chisato N, Ebisawa Y, Yoneda M, Kasai S Preventive effect of urinary trypsin inhibitor on the development of liver fibrosis in mice Experimental Biology and Medicine 236: (11) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 31 Kim HY, Kim SJ, Kim KN, Lee SG, Lee SM Protective effect of HV-P411, an herbal mixture, on carbon tetrachloride-induced liver fibrosis FOOD CHEMISTRY (ISSN: ) 124: (1) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 32 * Bugyik E, Dezso K, Turányi E, Szurián K, Paku S, Nagy P 1,4-Bis[2-(3,5-dichloropyridyloxy)]benzene induces substantial hyperplasia in fibrotic mouse liver International Journal of Experimental Pathology 93: (2) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 33 Duan Wei, Li Li, Liu Xinbin, Zhang Hongchao Protective effect of hepatocyte growth factor in model mice of acute decompensated heart failure Chinese Journal of Tissue Engineering Research (ISSN: ) 16: (2) pp (2012) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 34 Zhuang Rangxiao, Wang Fugen, Zhou Hongping, Shi Tingting, Liu Shourong The protective effect of N-acetylcysteine magnesium against liver cirrhosis with portal hypertension in rat Chinese Journal of Experimental and Clinical Virology (ISSN: ) 26: (5) pp (2012) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 35 Aldaba-Muruato Liseth R, Moreno Mario G, Shibayama Mineko, Tsutsumi Victor, Muriel Pablo Allopurinol Reverses Liver Damage Induced by Chronic Carbon Tetrachloride Treatment by Decreasing Oxidative Stress, TGF-beta Production and NF-kappa B Nuclear Translocation PHARMACOLOGY (ISSN: ) 92: (3-4) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ]
16 36 Hu Rentong, Zhang Xuerong, Xu Jin, Luo Xiaoling, Lin Xing, Liao Ming Effects of cobra venom NGF on cell proliferation,apoptosis and liver fibrosis protein expression in rat hepatic stellate cells Chinese Pharmacological Bulletin (ISSN: ) 29: (4) pp (2013) Link(ek): DOI, Wos-CSCD (Chinese), Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 37 Liu K, Pan L-L, Li T, Liu S-F Notoginseng glycosides effects on hyperplastic scar Chin. J. Tissue Eng. Res. (ISSN: ) 17: (24) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 38 Lee Jung Min, Yang Jing, Newell Pippa, Singh Sucha, Parwani Anil, Friedman Scott L, Nejak-Bowen Kari Nichole, Monga Satdarshan P beta-catenin signaling in hepatocellular cancer: Implications in inflammation, fibrosis, and proliferation CANCER LETTERS (ISSN: ) 343: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 39 Sheen-Chen Shyr-Ming, Lin Chung-Ren, Chen Kuan-Hung, Yang Chien-Hui, Lee Chien-Te, Huang Hui-Wen, Huang Chun-Ying Epigenetic histone methylation regulates transforming growth factor beta-1 expression following bile duct ligation in rats JOURNAL OF GASTROENTEROLOGY (ISSN: ) 49: (8) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 40 Lee Sang Hwa, Do Sung-Im, Kim Hyun-Soo Hyperoxia accelerates progression of hepatic fibrosis by up-regulation of transforming growth factor-beta expression WORLD JOURNAL OF GASTROENTEROLOGY (ISSN: ) 20: (11) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 43. Timar B, Fulop Z, Csernus B, Angster C, Bognar A, Szepesi A, Kopper L, Matolcsy A Relationship between the mutational status of V-H genes and pathogenesis of diffuse large B-cell lymphoma in Richter's syndrome LEUKEMIA 18:(2) pp (2004) Folyóiratcikk /Szakcikk /Tudományos [ ] Független idéző: 35 Függő idéző: 2 Összesen: 37 1 Robak T Second malignancies and richter's syndrome in patients with chronic lymphocytic leukemia Hematology 9: (5-6) pp (2004) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 2 Mehes G Chromosome abnormalities with prognostic impact in B-cell chronic lymphocytic leukemia PATHOL ONCOL RES 11: pp (2005) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 3 Hamblin TJ Richter's syndrome - the downside of fludarabine? Leukemia Research 29: (10) pp (2005) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 4 Yee K W, O Brien S M, Giles F J Richter's syndrome: Biology and therapy CANCER J 11: pp (2005) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 5 Thornton P D, Bellas C, Santon A, Shah G, Pocock C, Wotherspoon A C, Matutes E, Catovsky D Richter's transformation of chronic lymphocytic leukemia - The possible role of fludarabine and the Epstein-Barr virus in its pathogenesis LEUK RES 29: pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Molica S Second neoplasms in chronic lymphocytic leukemia: incidence and pathogenesis with emphasis on the role of different therapies LEUK LYMPHOMA 46: pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 7 Michaux L, Wlodarska I, Rack K, Stul M, Criel A, Maerevoet M, Marichal S, Demuynck H, Mineur P, Samani K K, van Hoof A, Ferrant A, Marynen P, Hagemeijer A Translocation t(1;6)(p35.3;p25.2): a new recurrent aberration in 'unmutated' B-CLL LEUKEMIA 19: pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Smit L A, van Maldegem F, Langerak A W, van Der Schoot C E, de Wit M J, Bea S, Campo E, Bende R J, van Noesel C J M Antigen receptors and somatic hypermutation in B-cell chronic lymphocytic leukemia with Richter's transformation HAEMATOL-HEMATOL J 91: pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Lazarevic V, Wahlin A, Hultdin M, Zhan FG, Shaughnessy J Chronic lymphocytic leukemia with osteolytic Richter's syndrome mimicking myeloma bone disease shows no over-expression of DKK1 LEUKEMIA & LYMPHOMA 47: pp (2006) 16 / :12
17 17 / :12 Folyóiratcikk /Szakcikk /Tudományos [ ] 10 * Reiniger L, Bodor C, Bognar A, Balogh Z, Csomor J, Szepesi A, Kopper L, Matolcsy A Richter's and prolymphocytic transformation of chronic lymphocytic leukemia are associated with high mrna expression of activationinduced cytidine deaminase and aberrant somatic hypermutation LEUKEMIA 20: pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 Prochorec-Sobieszek M, Majewski M, Sikorska A, Centkowski P, Tajer J, Lampka-Wojciechowska E, Rymkiewicz G, Konopka L, Meder J, Warzocha K, Maryniak RK Transformation in lymphomas - morphological, immunophenotypic and molecular features Polish Journal of Pathology 57: (2) pp (2006) Link(ek): Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 12 Andreas Rosenwald, H K Mueller-Hermelink, MAO Zhengrong, Andreas Rosenwald, ZHANG Shuojiang Analysis of clonal relationship in Richter's syndrome Journal of Practical oncology (ISSN: ) 22: (2) pp (2007) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 13 Sekikawa T, Takahara S, Suzuki H, Takeda N, Yamada H, Horiguchi-Yamada J Diffuse large B-cell lymphoma arising independently to lymphoplasmacytic lymphoma: a case of two lymphomas EUROPEAN JOURNAL OF HAEMATOLOGY 78: (3) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 14 Venkatraman L, Catherwood M, Benson G, Drake M Hodgkin transformation of small lymphocytic lymphoma: gene usage, mutational status and clonal relationship HISTOPATHOLOGY (ISSN: ) 51: (6) pp (2007) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 15 * Balogh Z, Reiniger L, Deak L, Bodor C, Csomor J, Szepesi A, Gagyi E, Kopper L, Matolcsy A IgV(H) gene mutation status and genomic imbalances in chronic lymphocytic leukaemia with increased prolymphocytes (CLL/PL) HEMATOLOGICAL ONCOLOGY (ISSN: ) 25: (2) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 16 Mao ZR, Quintanilla-Martinez L, Raffeld M, Richter M, Krugmann J, Burek C, Hartmann E, Rudiger T, Jaffe ES, Muller-Hermelink HK, Ott G, Fend F, Rosenwald A IgVH mutational status and clonality analysis of Richter's transformation - Diffuse large B-cell lymphoma and Hodgkin lymphoma in association with B-cell chronic lymphocytic leukemia (B-CLL) represent 2 different pathways of disease evolution AMERICAN JOURNAL OF SURGICAL PATHOLOGY (ISSN: ) 31: (10) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 17 Maddocks-Christianson K, Slager SL, Zent CS, Reinalda M, Call TG, Habermann TM, Bowen DA, Hoyer JD, Schwager S, Jelinek DF, Kay NE, Shanafelt TD Risk factors for development of a second lymphoid malignancy in patients with chronic lymphocytic leukaemia BRITISH JOURNAL OF HAEMATOLOGY (ISSN: ) 139: (3) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 18 Rossi D, Cerri M, Capello D, Deambrogi C, Rossi FM, Zucchetto A, De Paoli L, Cresta S, Rasi S, Spina V, Franceschetti S, Lunghi M, Vendramin C, Bomben R, Ramponi A, Monga G, Conconi A, Magnani C, Gattei V, Gaidano G Biological and clinical risk factors of chronic lymphocytic leukaemia transformation to Richter syndrome BRITISH JOURNAL OF HAEMATOLOGY (ISSN: ) 142: (2) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] 19 Mao ZR, Rosenwald A, Zhang SJ, Zhou R, Mueller-Hermelink HK Clonality analysis and mutation status of IgVH genes in classic Richter' s syndrome ZHONGHUA BINGLIXUE ZAZHI / CHINESE J PATHOL 37: (6) pp (2008) Link(ek): Wos-CSCD (Chinese), Scopus Folyóiratcikk /Szakcikk /Tudományos [ ] 20 Mao ZR, Rosenwald A, Zhang SJ, Zhou R, Mueller-Hermelink HK Clonality analysis and mutational status of IgVH gene in Hodgkin variant of Richter syndrome ZHONGHUA BINGLIXUE ZAZHI / CHINESE J PATHOL 37: (8) pp (2008) Link(ek): Wos-CSCD (Chinese) Folyóiratcikk /Szakcikk /Tudományos [ ] 21 Ramalingam P, Nayak-Kapoor A, Reid-Nicholson M, Jones-Crawford J, Ustun C Plasmablastic lymphoma with small lymphocytic lymphoma: Clinico-pathologic features, and review of the literature LEUKEMIA AND LYMPHOMA (ISSN: ) 49: (10) pp (2008) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 22 Omoti CE, Omoti AE Richter syndrome: a review of clinical, ocular, neurological and other manifestations BRITISH JOURNAL OF HAEMATOLOGY (ISSN: ) 142: (5) pp (2008) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 23 Ross D, Gaidano G Richter syndrome: molecular insights and clinical perspectives HEMATOLOGICAL ONCOLOGY (ISSN: ) 27: (1) pp (2009) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 24 Rossi D, Spina V, Cerri M, Rasi S, Deambrogi C, De Paoli L, Laurenti L, Maffei R, Forconi F, Bertoni F, Zucca E, Agostinelli C, Cabras A, Lucioni M, Martini M, Magni M, Deaglio S, Ladetto M, Nomdedeu JF, Besson C, Ramponi A, Canzonieri V, Paulli M, Marasca R, Larocca LM, Carbone A, Pileri SA, Gattei V, Gaidano G Stereotyped B-Cell Receptor Is an Independent Risk Factor of Chronic Lymphocytic Leukemia Transformation to Richter Syndrome CLINICAL CANCER RESEARCH (ISSN: ) 15: (13) pp (2009)
18 18 / :12 Folyóiratcikk /Szakcikk /Tudományos [ ] 25 Dolcetti R, Carbone A Epstein-Barr virus infection and chronic lymphocytic leukemia: A possible progression factor? Infectious Agents and Cancer 5: (1) Paper 22. (2010) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 26 Yamamoto Tomoko, Morita Kazuo, Iriyama Noriyoshi, Wakui Kiyotaka, Hiroi Atsuko, Sawada Tatsuo, Masuda Akihiro, Kobayashi Makio Intravascular Large B-Cell Lymphoma of the Uterus: A Case with Favorable Clinical Outcome INTERNATIONAL JOURNAL OF SURGICAL PATHOLOGY (ISSN: ) 19: (5) pp (2011) Link(ek): DOI, PubMed, WoS Folyóiratcikk /Szakcikk /Tudományos [ ] 27 Fangazio M, De Paoli L, Rossi D, Gaidano G Predictive markers and driving factors behind Richter syndrome development EXPERT REVIEW OF ANTICANCER THERAPY (ISSN: ) 11: (3) pp (2011) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 28 Fernandez-Flores Angel, Smucler-Simonovich Alicia, Escalante Fernando, Manjon Jose A The Differential Diagnosis Between Primary Cutaneous Large B-cell Lymphoma and Cutaneous Follicular Lymphoma: Prognostic and Therapeutic Implications AMERICAN JOURNAL OF DERMATOPATHOLOGY (ISSN: ) 33: (8) pp (2011) Link(ek): DOI, PubMed, WoS Folyóiratcikk [ ] 29 Rossi D, Spina V, Deambrogi C, Rasi S, Laurenti L, Stamatopoulos K, Arcaini L, Lucioni M, Rocque GB, Xu-Monette ZY, Visco C, Chang J, Chigrinova E, Forconi F, Marasca R, Besson C, Papadaki T, Paulli M, Larocca LM, Pileri SA, Gattei V, Bertoni F, Foa R, Young KH, Gaidano G The genetics of Richter syndrome reveals disease heterogeneity and predicts survival after transformation BLOOD (ISSN: ) 117: (12) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 30 Kryachok I, Abramenko I, Bilous N, Chumak A, Martina Z, Filonenko I IGHV gene rearrangements as outcome predictors for CLL patients: experience of Ukrainian group MEDICAL ONCOLOGY (ISSN: ) 29: (2) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 31 Liu HX, Yan QG, Nuako-Bandoh B, Grigoropoulos N, Huang YX, Follows G, Grant J, Lawton H, Wright P, Du MQ Richter transformation: clonal identity does not indicate a linear disease progression BRITISH JOURNAL OF HAEMATOLOGY (ISSN: ) 157: (1) pp (2012) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 32 Jain P, O'Brien S Richter's Transformation in Chronic Lymphocytic Leukemia ONCOLOGY-NEW YORK (ISSN: ) 26: (12) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 33 Martinez D, Valera A, Perez NS, Villegas LFS, Gonzalez-Farre B, Sole C, Gine E, Lopez-Guillermo A, Roue G, Martinez S, Sant F, Warzocha K, Robak T, Czader M, Villamor N, Colomo L, Campo E, Martinez A Plasmablastic Transformation of Low-grade B-cell Lymphomas Report on 6 Cases AMERICAN JOURNAL OF SURGICAL PATHOLOGY (ISSN: ) 37: (2) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 34 Rossi D, Gaidano G Richter syndrome Adv. Exp. Med. Biol. (ISSN: ) 792: pp (2013) Folyóiratcikk /Tudományos [ ] 35 Hong Jung Yong, Kim Hee Jin, Ko Young Hyeh, Choi Joon Young, Jung Chul Won, Kim Seok Jin, Kim Won Seog Clinical Features and Treatment Outcomes of Intravascular Large B-Cell Lymphoma: A Single-Center Experience in Korea ACTA HAEMATOLOGICA (ISSN: ) 131: (1) pp (2014) Link(ek): DOI, PubMed, WoS Folyóiratcikk [ ] 36 Wei Q, Sebastian S, Papavassiliou P, Rehder C, Wang E Metachronous/concomitant B-cell neoplasms with discordant light-chain or heavy-chain isotype restrictions: Evidence of distinct B-cell neoplasms rather than clonal evolutions Hum. Pathol. (ISSN: ) 45: (10) pp (2014) Folyóiratcikk /Tudományos [ ] 37 Jain P, Keating M, O'brien S Richter's syndrome-update on biology and management Expert Opin. Orphan Drugs (ISSN: ) 2: (5) pp (2014) Folyóiratcikk /Tudományos [ ] 44. Fulop Z, Csernus B, Timar B, Szepesi A, Matolcsy A Microsatellite instability and hmlh1 promoter hypermethyl ation in Richter's transformation of chronic lymphocytic leukemia LEUKEMIA 17:(2) pp (2003) Folyóiratcikk /Szakcikk /Tudományos [ ] 2003
19 Független idéző: 35 Függő idéző: 2 Összesen: 37 1 Cerny J, Slavickova C, Krepelova A, Trneny M, Karban J, Kiener P Familial chronic lymphocytic leukemia HAEMATOLOGICA 88: pp (2003) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Leone G, Vosoa MT, Teofili L, Lubbert M Inhibitors of DNA methylation in the treatment of hematological malignancies and MDS CLINICAL IMMUNOLOGY (ISSN: ) 109: (1) pp (2003) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 3 Novak U, Tobler A, Fey MF Allelotyping in B-cell chronic lymphocytic leukemia (B-CLL) LEUKEMIA AND LYMPHOMA (ISSN: ) 45: (5) pp (2004) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 Kinoshita T Epigenetic inactivation of tumor suppressor genes in hematologic malignancies INTERNATIONAL JOURNAL OF HEMATOLOGY (ISSN: ) 80: (2) pp (2004) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 5 Niv E, Bomstein Y, Bernheim J, Lishner M Microsatellite instability in gastric MALT lymphoma MODERN PATHOLOGY (ISSN: ) 17: (11) pp (2004) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Tucker JD Radiation cytogenetics: From chromosomes to single nucleotides and from metaphase cells to tissues CANCER AND METASTASIS REVIEWS (ISSN: ) 23: (3-4) pp (2004) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 7 * Timar B, Fulop Z, Csernus B, Angster C, Bognar A, Szepesi A, Kopper L, Matolcsy A Relationship between the mutational status of V-H genes and pathogenesis of diffuse large B-cell lymphoma in Richter's syndrome LEUKEMIA 18: pp (2004) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Robak T Second malignancies and richter's syndrome in patients with chronic lymphocytic leukemia Hematology 9: (5-6) pp (2004) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 9 Byrd J C, Marcucci G, Parthun M R, Xiao J J, Klisovic R B, Moran M, Lin T S, Liu S J, Sklenar A R, Davis M E, Lucas D M, Fischer B, Shank R, Tejaswi S L, Binkley P, Wright J, Chan K K, Grever M R A phase 1 and pharmacodynamic study of depsipeptide (FK228) in chronic lymphocytic leukemia and acute myeloid leukemia BLOOD 105: pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 10 Pittner B T, Shanafelt T D, Kay N E, Jelinek D F CD38 expression levels in chronic lymphocytic leukemia B cells are associated with activation marker expression and differential responses to interferon stimulation LEUKEMIA 19: pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 Niv E, Bomstein Y, Yuklea M, Lishner M Microsatellite instability in patients with chronic B-cell lymphocytic leukaemia BRITISH JOURNAL OF CANCER (ISSN: ) 92: (8) pp (2005) Folyóiratcikk /Szakcikk /Tudományos [ ] 12 Tsimberidou A M, Keating M J Richter syndrome CANCER 103: pp (2005) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 13 Yee KW, O Brien SM, Giles FJ Richter's syndrome: Biology and therapy CANCER JOURNAL (ISSN: ) 11: (3) pp (2005) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 14 Dobrovic A DNA repair gene inactivation in non-hodgkin's lymphoma Leukemia and Lymphoma 47: (9) pp (2006) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 15 Raval A, Byrd JC, Plass C Epigenetics in chronic lymphocytic leukemia SEMINARS IN ONCOLOGY (ISSN: ) 33: (2) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 19 / :12
20 20 / :12 16 Nandi S, Yu J, Burger A M, Reinert L S, Gartenhaus R B Expression of DNA mismatch repair proteins in transformed non-hodgkin's lymphoma: Relationship to smoking Leukemia and Lymphoma 47: (9) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 17 Niv E, Bomstein Y, Bernheim J, Lishner M Microsatellite instability in multiple nonfamilial malignancies MOLECULAR CARCINOGENESIS (ISSN: ) 45: (3) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 18 Tsimberidou AM, Keating MJ Richter's transformation in chronic lymphocytic leukemia SEMINARS IN ONCOLOGY (ISSN: ) 33: (2) pp (2006) Folyóiratcikk /Szakcikk /Tudományos [ ] 19 Assaf C, Sanchez JAA, Lukowsky A, Kolble K, Fischer T, Amerio P, Sterry W, Walden P Absence of microsatellite instability and lack of evidence for subclone diversification in the pathogenesis and progression of mycosis fungoides JOURNAL OF INVESTIGATIVE DERMATOLOGY (ISSN: X) 127: (7) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 20 Sekikawa T, Takahara S, Suzuki H, Takeda N, Yamada H, Horiguchi-Yamada J Diffuse large B-cell lymphoma arising independently to lymphoplasmacytic lymphoma: a case of two lymphomas EUROPEAN JOURNAL OF HAEMATOLOGY 78: (3) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 21 Sellick GS, Lubbe SJ, Matutes E, Catovsky D, Houlston RS Microsatellite instability indicative of defects in the major mismatch repair genes is rare in patients with B-cell chronic lymphocytic leukemia: Evaluation with disease stage and family history LEUKEMIA AND LYMPHOMA (ISSN: ) 48: (7) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 22 Plass C, Byrd JC, Raval A, Tanner SM, de la Chapelle A Molecular profiling of chronic lymphocytic leukaemia: genetics meets epigenetics to identify predisposing genes BRITISH JOURNAL OF HAEMATOLOGY (ISSN: ) 139: (5) pp (2007) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 23 * Inamdar KV, Bueso-Ramos CE Pathology of chronic lymphocytic leukemia: an update ANNALS OF DIAGNOSTIC PATHOLOGY (ISSN: ) 11: (5) pp (2007) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 24 Gorman EB, Chen L, Albanese J, Ratech H Patterns of spectrin expression in B-cell lymphomas: loss of spectrin isoforms is associated with nodule-forming and germinal centerrelated lymphomas MODERN PATHOLOGY (ISSN: ) 20: (12) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 25 Yu MK, Bergonia H, Szabo A, Phillips JD Progressive disease in chronic lymphocytic leukemia is correlated with the DNA methylation index LEUKEMIA RESEARCH (ISSN: ) 31: (6) pp (2007) Folyóiratcikk /Szakcikk /Tudományos [ ] 26 Swords R, Bruzzi J, Giles F Recent advances in the diagnosis and therapy of Richter's syndrome MEDICAL ONCOLOGY (ISSN: ) 24: (1) pp (2007) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 27 Tsimberidou A -M, Keating M J, Wierda W G Richter's transformation in chronic lymphocytic leukemia Current Hematologic Malignancy Reports 2: (4) pp (2007) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 28 Miyashita K, Fujii K, Yamada Y, Hattori H, Taguchi K, Yamanaka T, Yoshida MA, Okamura J, Oda S, Muta K, Nawata H, Takayanagi R, Uike N Frequent microsatellite instability in non-hodgkin lymphomas irresponsive to chemotherapy LEUKEMIA RESEARCH (ISSN: ) 32: (8) pp (2008) Folyóiratcikk /Szakcikk /Tudományos [ ] 29 Omoti CE, Omoti AE Richter syndrome: a review of clinical, ocular, neurological and other manifestations BRITISH JOURNAL OF HAEMATOLOGY (ISSN: ) 142: (5) pp (2008) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 30 Seeliger B, Wilop S, Osieka R, Galm O, Jost E CpG island methylation patterns in chronic lymphocytic leukemia LEUKEMIA AND LYMPHOMA (ISSN: ) 50: (3) pp (2009) Folyóiratcikk /Szakcikk /Tudományos [ ]
AZ ABERRÁNS HIPERMUTÁCIÓ OKOZTA GENETIKAI INSTABILITÁS SZEREPE A B-SEJTES NON-HODGKIN LYMPHOMÁK KIALAKULÁSÁBAN ÉS TRANSZFORMÁCIÓJÁBAN
(OTKA T049306 ) AZ ABERRÁNS HIPERMUTÁCIÓ OKOZTA GENETIKAI INSTABILITÁS SZEREPE A B-SEJTES NON-HODGKIN LYMPHOMÁK KIALAKULÁSÁBAN ÉS TRANSZFORMÁCIÓJÁBAN TEMATIKUS OTKA PÁLYÁZAT ÉLETTUDOMÁNYOK Matolcsy András
Az aberráns szomatikus hipermutáció és az aktiváció-indukált citidin deamináz szerepe a mediastinális nagy B-sejtes lymphoma patogenezisében
Az aberráns szomatikus hipermutáció és az aktiváció-indukált citidin deamináz szerepe a mediastinális nagy B-sejtes lymphoma patogenezisében Doktori tézisek Bödör Csaba Semmelweis Egyetem Patológiai Tudományok
Egészséges élet, aktív öregedés
Tudományos Trilaterális Szimpózium a 32 éves együttműködés alkalmából Egészséges élet, aktív öregedés 2015. június 12. -13. Semmelweis Szalon 2015. június 12. péntek 10.30 Prof. Dr. Molnár Mária Judit,
E4 A Gyermekkori szervezett lakossági emlőszűrések hatása az emlőműtétek
08.30-09.30 09.00-10.30 Pátria terem 2005. november 10. csütörtök E1 MEGNYITÓ E2 1.Nemzeti Üléselnökök: Rákkontroll Kovács Attila, Program Csonka I. Csaba, Ottó Szabolcs E3 Kásler Ottó jellegzetességei,
2014. május 23-án (PÉNTEK) 8:30-18:15-ig.
2014. május 23-án (PÉNTEK) 8:30-18:15-ig. 8:30 10:10 Follicularis lymphomák Üléselnökök: Borbényi Zita, Schneider Tamás SZÜNET A FOLLICULARIS LYMPHOMA KIALAKULÁSÁBAN ÉS PROGRESSZIÓJÁBAN SZEREPET JÁTSZÓ
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon
A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,
KLINIKAI ÉS EGÉSZSÉG- GAZDASÁGTANI EVIDENCIÁK A VASTAGBÉLSZŰRÉSBEN
Vastagbélszűrési disszeminációs workshop Szeged, 2015. május 12. KLINIKAI ÉS EGÉSZSÉG- GAZDASÁGTANI EVIDENCIÁK A VASTAGBÉLSZŰRÉSBEN Prof. Dr. Boncz Imre PTE ETK Egészségbiztosítási Intézet AZ ELŐADÁS TÉMÁJA
Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May
Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
"A genius is one per cent inspiration and ninety nine per cent perspiration." Thomas A. Edison
"A genius is one per cent inspiration and ninety nine per cent perspiration." Thomas A. Edison Zorn-Keszthelyi Rita laborvezető Hisztopatológia Kft, Pécs www.histopat.hu Pécs, 2013. június 7. Alapítás
(AD) β (A ) (2) ACDP ACDP ACDP APP. APP-C99 γ (3) A 40 A 42 A A A A 42/A 40. in vivo A A A A
(AD) β (A) A AAPP APP-C99 γ A A40 A42 A AA42/A40 γ A A γ AD A A A A APP APP APP A A A A A A (1)AD A42 A AD AD (2) ACDP AACDP ACDP A A ACDP (3) (1)A in vivo A APP Gray and Whittaker 1962; Perez-Otano et
COURSE DIRECTOR. Department of Behavioural Sciences Department of Biophysics Department of Medical Biology
aokgen06 2006/2007 f 1 OAA-ANT Medical Anthropology Dr. Csathó Árpád aokgen06 2006/2007 f 1 OAA-BF1 Biophysics 1 aokgen06 2006/2007 f 1 OAA-MB1 Molecular Cell Biology 1 ifj. Dr. Kellermayer Miklós Dr.
STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:
STUDENT LOGBOOK 1 week general practice course for the 6 th year medical students Name of the student: Dates of the practice course: Name of the tutor: Address of the family practice: Tel: Please read
Ultrasound biomicroscopy as a diagnostic method of corneal degeneration and inflammation
Ultrasound biomicroscopy as a diagnostic method of corneal degeneration and inflammation Ph.D. Thesis Ákos Skribek M.D. Department of Ophthalmology Faculty of Medicine University of Szeged Szeged, Hungary
INVITATION. The cost of adherence: quality of life and health economic impacts. Corvinus Health Policy and Health Economics Conference Series 2014/3
Corvinus Health Policy and Health Economics Conference Series 2014/3 Health Economics Study Circle, Health and Health Care Economics Section of the Hungarian Economic Association in cooperation with: Semmelweis
Oroszlán u. 4. Szeged H6720. mandi.yvette@med.u-szeged.hu. Szegedi Tudományegyetem Általános Orvostudományi Kar
Europass Önéletrajz Személyi adatok Vezetéknév / Utónév(ek) Dr Mándi Yvette Cím(ek) Oroszlán u. 4. Szeged H6720 Telefonszám(ok) +36 62 545 115 Mobil: +36 20 326 5569 Fax(ok) +36 62 545 113 E-mail(ek) mandi.yvette@med.u-szeged.hu
DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA
DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA TÓTH ADÉL TÉMAVEZETŐ: DR. GÁCSER ATTILA TUDOMÁNYOS FŐMUNKATÁRS
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.
Correlation & Linear Regression in SPSS Petra Petrovics PhD Student Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and
1 2 3 4 5 Journal name: Applied Microbiology and Biotechnology Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and evaluation of its effect on lignocellulosic
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
Tóth István Balázs személyi adatai és szakmai önéletrajza
Személyi adatok Tóth István Balázs személyi adatai és szakmai önéletrajza Név: Tóth István Balázs Születési hely, idő: Debrecen, 1978. december 30. Családi állapot: nős, két gyermek édesapja Szakmai önéletrajz
There are no translations available. CURRENT APPOINTMENT(S):
There are no translations available. CURRENT APPOINTMENT(S): Research fellow of Biochemistry and Molecular Biology, Department of Biochemistry and Molecular Biology, Medical and Health Science Center (MHSC),
Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI
Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance
PUBLIKÁCIÓS ÉS ALKOTÁSI TEVÉKENYSÉG ÉRTÉKELÉSE, IDÉZETTSÉG Oktatói, kutatói munkakörök betöltéséhez, magasabb fokozatba történı kinevezéshez.
FARKAS GABRIELLA PUBLIKÁCIÓS ÉS ALKOTÁSI TEVÉKENYSÉG ÉRTÉKELÉSE, IDÉZETTSÉG Oktatói, kutatói munkakörök betöltéséhez, magasabb fokozatba történı kinevezéshez. könyv, könyvrészlet oktatási anyag folyóiratcikkek
CD8 pozitív primér bőr T-sejtes limfómák 14 eset kapcsán
CD8 pozitív primér bőr T-sejtes limfómák 14 eset kapcsán Szepesi Ágota 1, Csomor Judit 1, Marschalkó Márta 2 Erős Nóra 2, Kárpáti Sarolta 2, Matolcsy András 1 Semmelweis Egyetem I. Patológiai és Kísérlet
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
1. Kiraly I, Pataricza J, Bajory Z, Simonsen U, Varro A, Papp JG, Pajor L, Kun A
2013 1. Kiraly I, Pataricza J, Bajory Z, Simonsen U, Varro A, Papp JG, Pajor L, Kun A Involvement Of Large-Conductance Ca(2+) -Activated K(+) Channels In Both Nitric Oxide And Endothelium-Derived Hyperpolarization-Type
Oszvald Mária. A búza tartalékfehérjék tulajdonságainak in vitro és in vivo vizsgálata rizs modell rendszerben
Budapesti Műszaki és Gazdaságtudományi Egyetem Alkalmazott Biotechnológia és Élelmiszertudományi Tanszék PHD ÉRTEKEZÉS TÉZISEI Készítette: Oszvald Mária A búza tartalékfehérjék tulajdonságainak in vitro
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán
Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán 1.Számú Patológiai és Kísérleti Rákkutató Intézet Diagnózis (definitív): benignus, malignus, intermedier malignitás, borderline
Expansion of Red Deer and afforestation in Hungary
Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi www.vmi.szie.hu Background and importance large herbivores are overpopulated
Induló egyetemi spin-off vállalkozások mozgástere. Ferdinandy Péter. www.cardiovasc.com www.pharmahungary.com
Induló egyetemi spin-off vállalkozások mozgástere Ferdinandy Péter kari innovációs igazgató, Orvostudományi Kar, Szegedi Tudományegyetem, alapító, ügyvezet igazgató, PharmaHungary 2000 Kft e-mail: peter.ferdinandy@pharmahungary.com
AZ INFEKTOLÓGIA AKTUÁLIS PROBLÉMÁI. SZOLNOK, 2013.szeptember 4. Prinz Gyula
AZ INFEKTOLÓGIA AKTUÁLIS PROBLÉMÁI SZOLNOK, 2013.szeptember 4. Prinz Gyula WEST NILE VÍRUS FERTŐZÉSEK A fertőzöttek 20-40%-ban jelentkezik enyhe influenza szerű megbetegedés A fertőzöttek kevesebb mint
Szakmai önéletrajz febr.16.
Szakmai önéletrajz Név: Dr. Milley György Máté Foglalkozás: általános orvos (79874) Beosztás: Ph.D. hallgató Jelenlegi munkahely: Semmelweis Egyetem (SE) Genomikai Medicina és Ritka Betegségek Intézete,
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
Correlation & Linear Regression in SPSS
Correlation & Linear Regression in SPSS Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise 1 - Correlation File / Open
Nemzeti Neurofibromatózis Regiszter létrehozása és felhasználási területei. Ideggyógyászati Szemle. Horváth András SE Neurológiai Klinika 2014.01.28.
Nemzeti Neurofibromatózis Regiszter létrehozása és felhasználási területei Ideggyógyászati Szemle Horváth András SE Neurológiai Klinika 2014.01.28. Miért éppen a neurofibromatózis (NF)? Betegregiszterekhelyzetkép
Géneltérések biológiai szerepe és prognosztikai jelentősége humán malignus melanomákban
268 Doktori tézisek Géneltérések biológiai szerepe és prognosztikai jelentősége humán malignus melanomákban Vízkeleti Laura Debreceni Egyetem, Egészségtudományok Doktori Iskola, Debrecen Témavezető: Prof.
Procalcitonin a kritikus állapot prediktora. Fazakas János, PhD, egyetemi docens Semmelweis Egyetem, Transzplantációs és Sebészeti Klinika
Procalcitonin a kritikus állapot prediktora Fazakas János, PhD, egyetemi docens Semmelweis Egyetem, Transzplantációs és Sebészeti Klinika Procalcitonin a kritikus állapot prediktora PCT abszolút érték
A kommunikáció és az információmegosztás mennyiségi vizsgálata a rehabilitációs teamben a kommunikáció mennyiségi vizsgálóeljárásnak bemutatása
Orvosi Rehabilitáció és Fizikális Medicina Magyarországi Társasága XXIX. Vándorgyűlése Szeged, 2010. szeptember 2-4. A kommunikáció és az információmegosztás mennyiségi vizsgálata a rehabilitációs teamben
Epithelialis-mesenchymalis átmenet vastagbél daganatokban
Epithelialis-mesenchymalis átmenet vastagbél daganatokban Éles Klára Országos Onkológiai Intézet Sebészi és Molekuláris Daganatpatológiai Centrum Budapest, 2010. 12. 03. Epithelialis-mesenchymalis átmenet
Report on esi Scientific plans 7 th EU Framework Program. José Castell Vice-President ecopa, ES
Report on esi Scientific plans 7 th EU Framework Program José Castell Vice-President ecopa, ES the Seventh Framework Programme (2007-2013) Ecopa scientific plans for 2007-2008?
OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA ÁGH TAMÁS DR., MÉSZÁROS ÁGNES DR.
ALL RIGHTS RESERVED SOKSZOROSÍTÁSI CSAK A MTT ÉS A KIADÓ ENGEDÉLYÉVEL Az asthmás és COPD-s betegek életminõségét befolyásoló tényezõk OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA Semmelweis Egyetem
Udvardyné Tóth Lilla intézeti biológus
Udvardyné Tóth Lilla intézeti biológus Tudományos közlemények Közlemények idegen nyelven TÓTH, L. GÁCSI, M. TOPÁL, J. MIKLÓSI, Á.: Playing styles and possible causative factors in dogs behaviour when playing
Az ellenanyagok által közvetített patológiás válasz (I., II., III. típusú hiperszenzitivitási reakció, receptor blokkolás/stimuláció)
Az ellenanyagok által közvetített patológiás válasz (I., II., III. típusú hiperszenzitivitási reakció, receptor blokkolás/stimuláció) Füst György Semmelweis Egyetem, III. Belklinika I. típusú, IgE-mediált
Három anthelminthieum hatásosságának összehasonlító vizsgálata humán ancylostomiasisban
Három anthelminthieum hatásosságának összehasonlító vizsgálata humán ancylostomiasisban Dr. LENGYEL Anna Dr. LÉVAI János Dr. VIDOR Éva Országos Közegészségügyi Intézet Parazitológiai Osztálya, Budapest
2014. május 22-én (CSÜTÖRTÖK) 11:00-18:00-ig.
2014. május 22-én (CSÜTÖRTÖK) 11:00-18:00-ig. 11:00 13:00 Hodgkin lymphoma EBÉD ÚJDONSÁGOK A HODGKIN LYMPHOMA ELSŐDLEGES KEZEL ÉSÉBEN Molnár Zsuzsa Országos Onkológiai Intézet, Kemoterápia A Belosztály,
SZAKMAI ÖNÉLETRAJZ, PUBLIKÁCIÓK
SZAKMAI ÖNÉLETRAJZ, PUBLIKÁCIÓK Név: Dr. SIMON ÁGNES Születési hely, idő: Nyíregyháza,1969. november 20. Állampolgárság: magyar Telefon, e-mail: +36-70/369-7408, simonagi70@hotmail.com Iskolák: Középiskola:
Immunológia alapjai T sejt fejlődés a tímuszban Differenciálódási stádiumok, környezeti faktorok szerepe
Immunológia alapjai T sejt fejlődés a tímuszban Differenciálódási stádiumok, környezeti faktorok szerepe Berki Timea A tímusz szerkezet A tímusz lebenyke szerkezet The thymic stoma creates the microenvironment
A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere
Nagy Szabolcs 1 Benedek Zsuzsanna 2 Polgár J. Péter 3 Magnus Andersson 4 A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere Genetic background of scrotal and inguinal hernia in swine nagy.szabolcs@georgikon.hu
Follicularis lymphomák komplex diagnosztikája
Follicularis lymphomák komplex diagnosztikája Eredeti közlemény Tóth Erika, 1 Schneider Tamás, 2 Melegh Zsombor, 1 Csernák Erzsébet, 1 Udvarhelyi Nóra, 3 Rosta András, 2 Szentirmay Zoltán 1 Országos Onkológiai
A felnôttkori combfejnecrosis korai kimutatása
MOZGÁSSZERVI DIAGNOSZTIKA Összefoglaló közlemény A felnôttkori combfejnecrosis korai kimutatása Gion Katalin, Palkó András Early detection of adult femoral head necrosis A felnôttkori combfejnecrosis a
SEBÉSZETI ELŐADÁSOK Magyar nyelvű képzés, III. évfolyam 2015/2016. tanév / 2. félév (6. szemeszter) (SZERDA: 10.15-12.
SEBÉSZETI ELŐADÁSOK Magyar nyelvű képzés, III. évfolyam 2015/2016. tanév / 2. félév (6. szemeszter) (SZERDA: 10.15-12.00, 2x45 perc) II. 10. Általános radiológia. Dr. Arany-Tóth II.17. A csontok és ízületek
FOLYÓIRATOK, ADATBÁZISOK
Szakkönyvtár FOLYÓIRATOK, ADATBÁZISOK 2013. szeptember Acta Oeconomica Állam- és Jogtudomány Élet és Irodalom Figyelő Gazdaság és Jog Határozatok Tára HVG Közgazdasági Szemle Külgazdaság Magyar Hírlap
Dr. Fittler András, Ph.D. 2014. március 03. Publikációk Összesített impakt faktor: 14,624 Összes független idézés: 17 Önidézés: 1
Dr. Fittler András, Ph.D. 2014. március 03. Publikációk Összesített impakt faktor: 14,624 Összes független idézés: 17 Önidézés: 1 1. Fittler A.: Amfotericin B tartalmú orrspray orrpolyp kezelésére. Gyógyszerészet
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, TILLING
Hagyomány és haladás a növénynemesítésben AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, BÁLINT ANDRÁS FERENC 1, SZIRA FRUZSINA 1, ANDREAS BÖRNER 2, KERSTIN
NINJA KARATE CENTRUM BUDO AKADÉMIA TAIJI QUAN VIZSGAANYAG JITAKYOEI BUDO & WUSHU HUNGARY. Mor. Stabilini-Ha SZABÓ PÁL
NINJA KARATE CENTRUM BUDO AKADÉMIA TAIJI QUAN VIZSGAANYAG JITAKYOEI BUDO & WUSHU HUNGARY Mor. Stabilini-Ha SZABÓ PÁL 5.kyu Kivárási idő: 6 hónap 2.WU KUNG/QI GONG/HU KUNG: (YANG TSE) 1. WU-JI ZHUANG 2.
Összegyűjtöttük, a magyar radiológus és radiográfus közösség hogyan vesz részt aktívan az idei európai radiológiai kongresszuson.
Összegyűjtöttük, a magyar radiológus és radiográfus közösség hogyan vesz részt aktívan az idei európai radiológiai kongresszuson. A módszertan egyszerű: a végleges programot itt letölteni, a keresőbe beírni
Doktori tézisek. Dr. Reiniger Lilla. Semmelweis Egyetem Patológia Tudományok Doktori Iskolája. Témavezető: Dr. Szepesi Ágota egyetemi adjunktus, PhD
Az aktiváció-indukált citidin deamináz és az aberráns szomatikus hipermutáció szerepe a krónikus lymphocytás leukaemia Richter és prolymphocytás transzformációjában Doktori tézisek Dr. Reiniger Lilla Semmelweis
Fügedi Balázs PhD. Szerz, cím, megjelenés helye, 2008. Szerz, cím, megjelenés. Szerz, cím, megjelenés helye, helye, PUBLIKÁCIÓ. Könyv, idegen nyelv
Fügedi Balázs PhD PUBLIKÁCIÓ Könyv, idegen nyelv Szerz, cím, megjelenés helye, 2006 Szerz, cím, megjelenés helye, 2007 Szerz, cím, megjelenés helye, 2008 Szerz, cím, megjelenés helye, 2009 Könyv, magyar
2013. szeptember 28 29. PROGRAM. Dr. Hegyi Gabriella, elnök, Magyar Akupunktúrás Orvosok Társasága
PROGRAM 2013. szeptember 28., szombat 09.00 09.10 elnöki köszöntő Dr. Hegyi Gabriella, elnök, Magyar Akupunktúrás Orvosok Társasága 09.10 10.30 szekcióülés 1 Üléselnökök: Dr. Pesztenlehrer István, Dr.
Mit tud a tüdő-citológia nyújtani a klinikus igényeinek?
Mit tud a tüdő-citológia nyújtani a klinikus igényeinek? XVI. Citológus Kongresszus és akkreditált tanfolyam Siófok, 2017. március 30-április 1. Pápay Judit SE, I.sz.Patológiai és Kísérleti Rákkutató intézet
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit.
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit. MYB Primer pairs TC AtMYB Forward Reverse TC199266 MYB12 AGGCTCTTGGAGGTCGTTACC CAACTCTTTCCGCATCTCAATAATC
RAYMOND RIFE gyógyító frekvenciái
RAYMOND RIFE gyógyító frekvenciái Sárgabarackmag és a B17 vitamin Szerencsére egyre többen hallottak már a regeneráló, gyógyulást segítõ frekvenciákról. Ezeket a készülékeket R. Raymond Rife munkáinak
Laboratóriumi diagnosztika helyzete: szakmai aranybánya, vagy gazdasági csőd?
Laboratóriumi diagnosztika helyzete: szakmai aranybánya, vagy gazdasági csőd? XXII. Magyarországi Egészségügyi Napok Debrecen, 2015. október 7 9. Dr. Hetyésy Katalin c. egyetemi docens, osztályvezető főorvos,
A myeloma multiplex és diffúz nagy B-sejtes
Myeloma multiplex és diffúz nagy B-sejtes lymphoma ritka társulása RADVÁNYI Mónika, ILLÉS Árpád, MÉHES Gábor, KAJTÁR Béla, FAZAKAS Ferenc, GARAI Ildikó, GERGELY Lajos CONCOMITANT OCCURRENCE OF MULTIPLE
HELYSZÍNEK PROGRAM ÁPRILIS 20. csütörtök SZÁLLÁS
HELYSZÍNEK PROGRAM SZÁLLÁS 1 (6721 Szeged, Maros u. 1.) 2 Matrix Hotel (6721 Szeged, Zárda u. 8.) 3 Partium Hotel (6722 Szeged, Honvéd tér 3.) 4 Tisza Hotel (6720 Szeged, Széchenyi tér 3.) 5 Oázis Apartmanház
A vastagbélhám sejtkinetikai változásainak vizsgálata gyulladásos vastagbélbetegségekben a gyulladás szövettani aktivitásának függvényében
A vastagbélhám sejtkinetikai változásainak vizsgálata gyulladásos vastagbélbetegségekben a gyulladás szövettani aktivitásának függvényében Doktori (PhD) dolgozat Gastroenterológia c. PhD program keretében
Analysis of prognostic factors in chronic lymphocytic leukemia
Analysis of prognostic factors in chronic lymphocytic leukemia Doctoral (Ph.D.) theses summary Gábor Kovács MD University of Pécs, Clinical Center, 1 st Department of Internal Medicine Interdisciplinary
Grádus rendszerek vizsgálata IAés IB stádiumú adenocarcinomákban
Grádus rendszerek vizsgálata IAés IB stádiumú adenocarcinomákban Zombori Tamás, Furák József, Urbán Dániel, Némedi Réka, Nyári Tibor, Cserni Gábor, TiszlaviczLászló Pathologiai Intézet, ÁOK Szegedi Tudományegyetem
A Magyar Nemzeti Bank H-EN-III-275/2019. számú határozata tőkepiaci közvetítők Bszt. szerinti hatósági nyilvántartásba vétele tárgyában
A Magyar Nemzeti Bank H-EN-III-275/2019. számú határozata tőkepiaci közvetítők Bszt. szerinti hatósági nyilvántartásba vétele tárgyában A Magyar Posta Befektetési Szolgáltató Zártkörűen Működő Részvénytársaság
Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához?
Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Falus András Genetikai, Sejt- és Immunbiológiai Intézet Semmelweis Egyetem Antal Péter Hadadi Éva
PUBLIKÁCIÓK JEGYZÉKE FOLYÓIRATBAN MEGJELENT IN EXTENSO KÖZLEMÉNY
PUBLIKÁCIÓK JEGYZÉKE FOLYÓIRATBAN MEGJELENT IN EXTENSO KÖZLEMÉNY 1. Maráz K., Gorzó I., Olasz T., Kapros P.: Szövődményes periapicalis elváltozás konzervatív kezelése. Egy eset kapcsán a kalcium-hidroxidról.
SZTE ETSZK Publikációs lista 2010
SZTE ETSZK Publikációs lista 2010 Doktori értekezés: Erdősi Erika: Az asszertivitás személyiségi hátterének vizsgálata ápolóhallgatók körében. Doktori értekezés. Kézirat. Semmelweis Egyetem, Budapest,
Prof. Enikő Csilla Kiss
Professor of Personality Psychology Head of the Personality and Health Psychology Department. CONTACT Institute of Psychology, H7624 Pécs Ifjúság u. 6. Room: B 307 Tel: +36 72 501516 / E-mail: kiss.eniko
Tűzoltók angol nyelvi képzésének tapasztalatai a Nemzeti Közszolgálati Egyetem Katasztrófavédelmi Intézetében
Tűzvédelmi Szakmai Nap 2016 Tudományos Konferencia Szentendre, 2016. március 2. Tűzoltók angol nyelvi képzésének tapasztalatai a Nemzeti Közszolgálati Egyetem Katasztrófavédelmi Intézetében Kuk Enikő Doktorandusz
SURGICAL MANAGEMENT OF ODONTOGENIC CYSTS. SE Arc-Állcsont-Szájsebészeti és Fogászati Klinika BUDAPEST
SURGICAL MANAGEMENT OF ODONTOGENIC CYSTS SE Arc-Állcsont-Szájsebészeti és Fogászati Klinika BUDAPEST DEFINITION A cyst is a sac with walls of connective tissue, lined by epithelium, containing fluid or
SZAKMAI ÖNÉLETRAJZ. Hematológia,jeles
SZAKMAI ÖNÉLETRAJZ SEZEMÉLYES ADATOK Név Dr. Masszi Tamás Születési hely, idı: Budapest, 1958. december 15. Lakcím: 1213 Budapest, Mókus út 38. Család: Nıs, öt gyermeke van: Eszter, Csilla, Domonkos, Katalin,
Fiatal férfi beteg sikeres kombinált neurointervenciós idegsebészeti-sugársebészet
A carotisarteria szűkületének javasolt ellátási módját alapvetően befolyásolja, ha a szűkület mindkét oldalon szignifikáns mértékű, ha a szűkület oka előzetes nyaki besugárzás, illetve ha a betegnek intracranialis
6th Conference of the Hungarian & 4th Conference of the Eastern and Central European Pancreatic Study Groups
6th Conference of the Hungarian & 4th Conference of the Eastern and Central European Pancreatic Study Groups FOCUS ON Importance of the International Pancreatic Registries and Biobanks Results from the
Az Akadémiai Kiadó folyóirat-kiadási tapasztalatai
Az Akadémiai Kiadó folyóirat-kiadási tapasztalatai Dr. Bencsik Péter Természettudományi szerkesztőség vezetője 2015. október 7. Bölcsességfog mit tud erről a Scopus? Idősebb férfiak sokat nyafognak Mivel
A CMDh megvizsgálta a PRAC alábbi, a tesztoszteron tartalmú készítményekre vonatkozó ajánlását:
II. melléklet Tudományos következtetések és a forgalomba hozatali engedélyek feltételeinek feltételekhez kötésben álló módosításának indoklása, valamint a PRAC ajánlástól való eltérések tudományos indoklásának
Élő szervezetek külső sztatikus mágneses tér expozícióra adott biológiai válaszai
Élő szervezetek külső sztatikus mágneses tér expozícióra adott biológiai válaszai készült az ELTE Alkalmazott Matematikus M. Sc. Önálló Projekt című tárgy témakiírására Dr. László János, Debreceni Egyetem
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK Despite enormous challenges many developing countries are service exporters Besides traditional activities such as tourism;
DIGITÁLIS MIKROSZKÓPIA AZ EMÉSZTŐRENDSZERI SZÖVETI
DIGITÁLIS MIKROSZKÓPIA AZ EMÉSZTŐRENDSZERI SZÖVETI MINTÁK DIAGNOSZTIKÁJÁBAN Doktori tézisek Ficsór Levente Semmelweis Egyetem, 2. sz. Belgyógyászati Klinika Klinikai Orvostudományok Doktori Iskola Programvezető:
A háti szakasz scoliosisának módosított instrumentálása Elsô klinikai tapasztalatok a CAB horgok alkalmazásával
A Debreceni Orvostudományi Egyetem, Ortopédiai Klinika és a **Szent János Kórház, Ortopéd-Traumatológiai Osztály közleménye A háti szakasz scoliosisának módosított instrumentálása Elsô klinikai tapasztalatok
Kiterjedt bôrérintettséggel járó primer cutan anaplasiás nagy sejtes lymphoma sikeres kezelése röntgen irradiációval
BÔRGYÓGYÁSZATI ÉS VENEROLÓGIAI SZEMLE 86. ÉVF. 4. 116 119. Semmelweis Egyetem Általános Orvostudományi Kar, Bôr-, Nemikórtani és Bôronkológiai Klinika (igazgató: Kárpáti Sarolta dr., egyetemi tanár) 1,
Statistical Dependence
Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent
SEBÉSZETI ELŐADÁSOK Magyar nyelvű képzés, IV.évfolyam 2012/2013. 1. félév, 7. szemeszter (Kedd: 8.15-11.00)
SEBÉSZETI ELŐADÁSOK Magyar nyelvű képzés, IV.évfolyam 2012/2013. 1. félév, 7. szemeszter (Kedd: 8.15-11.00) IX. 4. A nyílt sérülések és azok osztályozása Dr. Tóth 3 óra A nyílt sérülések megjelenési formái
Néhány folyóiratkereső rendszer felsorolása és példa segítségével vázlatos bemutatása Sasvári Péter
Néhány folyóiratkereső rendszer felsorolása és példa segítségével vázlatos bemutatása Sasvári Péter DOI: http://doi.org/10.13140/rg.2.2.28994.22721 A tudományos közlemények írása minden szakma művelésének
OncotypeDX az emlőrák kezelésében
OncotypeDX az emlőrák kezelésében Dr. Nagy Zoltán Med Gen-Sol Kft. Szenológiai Kongresszus Kecskemét 2018. 04. 13-14. Slide 1 Az Oncotype DX korai emlőrák teszt 16 tumorral kapcsolatos gén Ösztrogén csoprt
Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1.
Biobankok a Semmelweis Egyetemen Szalai Csaba 2009. július 1. Molnár Mária Judit MD, PhD A Semmelweis Egyetem Molekuláris Neurológiai Klinikai és Kutatási Központ igazgatója SE Molekuláris Neurológiai
A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban
BEVEZETÉS ÉS A KUTATÁS CÉLJA A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban (LCPUFA), mint az arachidonsav
Heveny myeloid leukaemiás betegeink kezelésével szerzett tapasztalataink (2007 2013)
EREDETI KÖZLEMÉNY Heveny myeloid leukaemiás betegeink kezelésével szerzett tapasztalataink (2007 2013) Selmeczi Anna dr. 1 Udvardy Miklós dr. 1 Illés Árpád dr. 1 Telek Béla dr. 1 Kiss Attila dr. 1 Batár
BÔRGYÓGYÁSZATI ÉS VENEROLÓGIAI SZEMLE ÉVF DOI /bvsz
BÔRGYÓGYÁSZATI ÉS VENEROLÓGIAI SZEMLE 2012 88. ÉVF. 1. 39 45. DOI 10.7188/bvsz.2012.88.2.1 A felületi röntgen irradiáció hatékonyságának értékelése mycosis fungoideses, primer cutan CD8+ agresszív epidermotrop
KÖVETELMÉNYRENDSZER ANGOL KÖZÉP-, FELSŐFOKÚ PROFEX II. KURZUS
KÖVETELMÉNYRENDSZER ANGOL KÖZÉP-, FELSŐFOKÚ PROFEX II. KURZUS Semmelweis Egyetem Gyógyszerésztudományi Kar, Nyelvi Kommunikációs Központ Tantárgy neve: Angol PROFEX II nyelvizsga-előkészítő kódja: kreditértéke:
HUMAN IMMUNODEFICIENCY VIRUS (HIV) ÉS AIDS
HUMAN IMMUNODEFICIENCY VIRUS (HIV) ÉS AIDS Dr. Mohamed Mahdi MD. MPH. Department of Infectology and Pediatric Immunology University of Debrecen 2010 Történelmi tények a HIV-ről 1981: Első megjelenés San