Limitations and challenges of genetic barcode quantification

Hasonló dokumentumok
SOLiD Technology. library preparation & Sequencing Chemistry (sequencing by ligation!) Imaging and analysis. Application specific sample preparation

Supporting Information

Supplementary Figure 1

Modular Optimization of Hemicellulose-utilizing Pathway in. Corynebacterium glutamicum for Consolidated Bioprocessing of

Forensic SNP Genotyping using Nanopore MinION Sequencing

Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo

University of Bristol - Explore Bristol Research

Mapping Sequencing Reads to a Reference Genome

Expression analysis of PIN genes in root tips and nodules of Lotus japonicus

Cluster Analysis. Potyó László

Flowering time. Col C24 Cvi C24xCol C24xCvi ColxCvi

Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and

discosnp demo - Peterlongo Pierre 1 DISCOSNP++: Live demo

Construction of a cube given with its centre and a sideline

Supporting Information

Correlation & Linear Regression in SPSS

Klaszterezés, 2. rész

Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes

A cell-based screening system for RNA Polymerase I inhibitors

Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li

A KELET-BORSODI HELVÉTI BARNAKŐSZÉNTELEPEK TANI VIZSGÁLATA

Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and

Bioinformatics: Blending. Biology and Computer Science

Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit.

Performance Modeling of Intelligent Car Parking Systems

Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Supplementary Figure S1.

Correlation & Linear Regression in SPSS

Statistical Inference

Lecture 11: Genetic Algorithms

T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma

Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1

The role of aristolochene synthase in diphosphate activation

University of Bristol - Explore Bristol Research

A magyar racka juh tejének beltartalmi változása a laktáció alatt

tccattaattcgacagaccagagttaaataatccttgtatgccattgtgatcacatctacagttcagattttgtatttca

Supporting Information

Supplemental Information. RNase H1-Dependent Antisense Oligonucleotides. Are Robustly Active in Directing RNA Cleavage

Decision where Process Based OpRisk Management. made the difference. Norbert Kozma Head of Operational Risk Control. Erste Bank Hungary

Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Hypothesis Testing. Petra Petrovics.

Anyagmérnöki Tudományok, 37. kötet, 1. szám (2012), pp

Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.

vancomycin CFSL cefepime CFPM cefozopran CZOP 4 cephem cefpirome CPR cefoselis Inhibitory Concentration FIC index

Suppl. Materials. Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids. Germany

Statistical Dependence

4 vana, vanb, vanc1, vanc2

Választási modellek 3

Bird species status and trends reporting format for the period (Annex 2)

Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Nonparametric Tests

IES TM Evaluating Light Source Color Rendition

Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

- Supplementary Data

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis

Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm

MAX. CAR SPACE CAPACITY 2000 Kg. MAX. 500 Kg. ON EACH WHEEL. Vízelvezető Water Drainage 10 x 10

A évi fizikai Nobel-díj

Heterogén hegesztett kötés integritásának értékelése

Effect of sowing technology on the yield and harvest grain moisture content of maize (Zea mays L.) hybrids with different genotypes

Ensemble Kalman Filters Part 1: The basics

HAL SST CL P 30 W 230 V E14

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

MATEMATIKA ANGOL NYELVEN

Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon

Földtani térképek kartografálásának segítése térinformatikai módszerekkel

PLATTÍROZOTT ALUMÍNIUM LEMEZEK KÖTÉSI VISZONYAINAK TECHNOLÓGIAI VIZSGÁLATA TECHNOLOGICAL INVESTIGATION OF PLATED ALUMINIUM SHEETS BONDING PROPERTIES

Depending on the load class and nominal size, the inlet invert between mm.

A TAKARMÁNYOK FEHÉRJE TARTALMÁNAK ÉS AMINOSAV ÖSSZETÉTELÉNEK HATÁSA A TOJÓHIBRIDEK TELJESÍTMÉNYÉRE

DOAS változások, összefoglaló

Számlakezelés az ELO DocXtraktor modullal

TANULÁSI GÖRBÉK AZ ÉPÍTŐIPARBAN

GEOGRAPHICAL ECONOMICS B

Hogyan használja az OROS online pótalkatrész jegyzéket?

Széchenyi István Egyetem

A magyarországi Gauss-Krüger-vetületû katonai topográfiai térképek dátumparaméterei

NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING

On The Number Of Slim Semimodular Lattices

TANULÁSI GÖRBÉK AZ ÉPÍTŐIPARBAN

Összefoglalás. Summary. Bevezetés

practices Mosaic and timed mowing Mosaic and timed mowing Mosaic and timed mowing 10 m wide fallow strips (4 parcels)

építészet & design ipari alkalmazás teherautó felépítmény

Out-Look. Display. Analog Bar. Testing Mode. Main Parameter. Battery Indicator. Second Parameter. Testing Frequency

FOSS4G-CEE Prágra, 2012 május. Márta Gergely Sándor Csaba

Ültetési és öntözési javaslatok. Planting and watering instructions

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Animal welfare, etológia és tartástechnológia

KIEGÉSZÍTŽ FELADATOK. Készlet Bud. Kap. Pápa Sopr. Veszp. Kecsk Pécs Szomb Igény

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

FÖLDRAJZ ANGOL NYELVEN

A katalógusban szereplő adatok változásának jogát fenntartjuk es kiadás

2. Local communities involved in landscape architecture in Óbuda

István Micsinai Csaba Molnár: Analysing Parliamentary Data in Hungarian

(A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5

A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE

First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium

Descriptive Statistics

Genome 373: Hidden Markov Models I. Doug Fowler

Ignácz Ferenc*. Bell Márton** **IbB Hungary Mérnöki Szakértıi Iroda, Budapest, H Hungary (Tel: +36(1) ;

Analitikai megoldások IBM Power és FlashSystem alapokon. Mosolygó Ferenc - Avnet

Átírás:

Limitations and challenges of genetic barcode quantification Lars hielecke, im ranyossy, ndreas Dahl, Rajiv iwari, Ingo Roeder, Hartmut eiger, Boris Fehse, Ingmar lauche and Kerstin ornils SUPPLEMENRY D Figure S a 0.6 density 0.4 0.2 0 2 B6 0 3 B6 0 4 B6 0 2 B32 0 3 B32 0 4 B32 0.0 2 3 4 5 6 7 8 9 0 2 3 4 5 6 7 8 9 2 22 23 b minimal HD 5 LR 3 LR Δ R U5 SFFV Fluorescence Marker wpre Δ R U5 B6 Illu - B32 - Illu st PR 2 nd PR mplification from gdn Library preparation PR mplification from gdn + Library preparation Illumina-Sequencing Fig. S: (a) Simulated average Hamming distance distributions for a randomly picked sample of a 6 and 32 nucleotides long barcode and for three different initial cell numbers (averaged over 00 simulations). (b) Optimization strategy for the B32 construct: additionally to the extension from 6 to 32 wobble bases, the construct was equipped with adaptors for Illumina-sequencing. hese modules allow the amplification and NS-library preparation in one PR step and with less cycles.

Figure S2 a read counts 0 6 0 5 0 4 0 3 0 2 0 HDs 0 2 3 4 5 6 7 read counts 0 6 0 5 0 4 0 3 0 2 0 barcodes barcodes b read counts 0 6 0 5 0 4 0 3 0 2 0 HDs 0 2 3 4 5 6 7 read counts 0 6 0 5 0 4 0 3 0 2 0 barcodes barcodes Fig. S2: Results of the error-correction method for one exemplary (a) B6 and (b) B32 minibulk. he remaining barcodes (shaded in grey) can not be reliably assigned to any of the original barcodes and are most likely contaminations (HD > 6). 2

Figure S3 a fraction of error corrected barcodes.0 0.9 0.8 0.7 2 4 6 8 0 2 4 6 HD threshold b fraction of error corrected barcodes.0 0.9 0.8 0.7 2 4 6 8 0 2 4 6 8 22 24 26 28 30 32 HD threshold Fig. S3: Sensitivity analysis of the effect of the chosen Hamming distance (HD) threshold for the error correction model. he dashed line indicates the chosen upper Hamming distance threshold for the definition of similarity during error correction for both barcode constructs. 3

Figure S4 5 LR 3 LR Δ R U5 SFFV Fluorescence Marker wpre B Δ R U5 ~kb p90 VIS-specific reverse primer lone enomic location Reverse primer Length of obtained fragment (bp) B6-B hr. q3.2 7 6Bw-µL Kl.7 979 B6- hr. 9q32 8 6Bw-µL Kl.8 973 B6-2 hr. 5q35.3 6B-Klon2-hr 948 B6-D hr. 2q22.3 9a 6Bw-µL Kl.4 93 B6-E hr. 9q34.3 0 6Bw-µL Kl.0 930 B32- hr. 8q22. 7 32Bw-5µL Kl.3 088 B32- hr. 0q24.4 a 32Bw-5µL Kl.9 082 B32- hr. 7q25.3 9 32Bw-5µL Kl.5 056 B32-E hr. 9q3.42 0 32Bw-5µL Kl.7 079 Fig. S4 Viral integration site analysis and generation of kb fragments. he viral integration site (IS) was identified via LM-PR (26). o generate PR fragments with approximately kb in length, we used a forward-primer located on the provirus (p90) and a IS-specific reverse primer. he obtained PR-product contained the respective barcodesequence of each clone 4

Figure S5 a 00 00 00 00 00 00 00 00 00 00 00 00 b 00 00 00 00 00 00 00 00 00 00 00 00 5

c 00 00 00 00 00 00 00 00 00 00 00 00 Fig. S5: Detailed inspection of mutation patterns on the level of single nucleotide substitutions for only the most similar descendent barcodes (with a HD = and HD = 2 to the original barcodes) are displayed as ternary plots. Shown are the results for the B6 construct (a), for the B6 Q5 polymerase approach (b), and for the B32 construct (c). 6

Figure S6 a b 0 6 0 6 0 5 0 5 read counts 0 4 0 3 0 2 read counts 0 4 0 3 0 2 0 0 B6 B B6 B6 2 B6 D B6 E B32 B32 B32 B32 E c 0.75.00.25.50 B6 / B6 2 Fig. S6: Read count distribution of all identified descendent Bs for the (a) B6 and (b) B32 construct. (c) Read count ratio of the double integrated B6- and B6-2 Bs for all available minibulks is depicted as boxplot. 7

Figure S7 a b cumulative reads of descendents 3*0 4 2*0 4 *0 4 B6 B B6 B6 2 B6 D B6 E unknown cumulative reads of descendents 5*0 4 4*0 4 3*0 4 2*0 4 *0 4 B32 B32 B32 B32 E unknown 0*0 5 2*0 5 4*0 5 6+0 5 barcode reads 0*0 5 2*0 5 4*0 5 6*0 5 8*0 5 barcode reads Fig. S7: he ratio of read counts obtained from the original barcodes vs their related descendent barcodes, according to the chosen thresholds of (a) HD = 4 for the B6 and (b) HD = 8 for the B32 construct. Figure S8 ratio 0.25 0. 0.5 0.0 barcode reads 0 6 0 5 0 4 0 3 0 2 0 barcodes original Bs descendent Bs 0.05 0.00 B6 B32 Fig. S8: he distribution of the relative read count ratio between the smallest original barcode and the biggest descendent barcode (B descendent /B original ) for both of the studied barcode constructs is visualized as boxplots. 8

Figure S9 a b 00% 00% % % content % % content % % % % 0% B6 B B6 B6 2 B6 D B6 E 0% B32 B32 B32 E B32 Fig. S9: content within the barcode sequences of the chosen (a) B6 and (b) B32 barcodes. 9

Figure S0 343 plasmids (LeO-EFS-eFP-B) 69 Bs 69 Bs 69 Bs 68 Bs 68 Bs Stock Stock 2 Stock 3 Stock 4 Stock 5 Maxi Maxi 2 Maxi 3 Maxi 4 Maxi 5 B Library Virusproduction Fig. S0: 343 barcode equipped plasmids were selected and combined into five stocks, containing 68 or 69 different barcodes. fter transformation and plasmid preparation, the five maxi-preparations were merged to generate the final annotated barcode library. s a quality control of the different steps, NS of the selected plasmids for all stocks and the subsequently generated maxi preparations was performed. 0

able S Function Name Sequence (5'->3') Barcode Oligos eneration of B6 Barcode-FP-FW Barcode-FP-RV NNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNN eneration of B32 Poly-FP-barcode ggtgannn NNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNN 32B-Poly-rev PR and Sequencing primers Barcode identification B-PR-FW B-PR-RV_neu B-PR-Seq B6 barcode retrieval B-PR-FW B-PR-RV_neu Ill2_ail-complete Ill-ail2 B32 barcode retrieval MPLX-primer xxxxxx p43 DUL-Index-primer xxxxxxxx x LM-PR (5'LR) Identification of LV-5-LR- [biotin]- second Integration LV-5-LR-2 in clone B6- LV-5-LR-3 LV-5-LR-Seq O O2 digital droplet PR IS-specific ddpr LV-Seq Lenti-LR-BHQ FM--BHQ 7 6Bw-µL Kl.7 8 6Bw-µL Kl.8 6B-Klon2-hr 9a 6Bw-µL Kl.4 0 6Bw-µL Kl.0 7 32Bw-5µL Kl.3 a 32Bw-5µL Kl.9 9 32Bw-5µL Kl.5 0 32Bw-5µL Kl.7 B-specific ddpr 6B-dPR-FW 6B-dPR-P FM--BHQ 6B-KlonB 6B-Klon 6B-Klon2 6B-KlonD 6B-KlonE 32-dPR-FW 32-dPR-P FM--BHQ 32B-Klon-RV 32B-Klon-RV 32B-Klon-RV 32B-KlonE-RV VN ddpr FP-dPR-FW FP-dPR-BHQ FM--BHQ FP-dPR-RV Housekeeping mepo-fw mepo-probe HEX--BHQ mepo-rv kb fragments p90 7 6Bw-µL Kl.7 8 6Bw-µL Kl.8 6B-Klon2-hr 9a 6Bw-µL Kl.4 0 6Bw-µL Kl.0 7 32Bw-5µL Kl.3 a 32Bw-5µL Kl.9 9 32Bw-5µL Kl.5 0 32Bw-5µL Kl.7

able S2 2

3

4

5

6

7