Fabry Disease: Novel a-galactosidase A 3 -Terminal Mutations Result in Multiple Transcripts Due to Aberrant 3 -End Formation
|
|
- Egon Vörös
- 6 évvel ezelőtt
- Látták:
Átírás
1 Am. J. Hum. Genet. 73: , 2003 Fabry Disease: Novel a-galactosidase A 3 -Terminal Mutations Result in Multiple Transcripts Due to Aberrant 3 -End Formation Makiko Yasuda, 1,2 Junaid Shabbeer, 1 Makiko Osawa, 2 and Robert J. Desnick 1 1 Department of Human Genetics, Mount Sinai School of Medicine, New York; and 2 Department of Pediatrics, Tokyo Women s Medical University, Tokyo Mutations in the gene that encodes the lysosomal exoglycohydrolase, a-galactosidase A (a-gala), cause Fabry disease, an X-linked recessive inborn error of glycosphingolipid catabolism. Human a-gala is one of the rare mammalian genes that has its polyadenylation signal in the coding sequence and lacks a 3 untranslated region (UTR). We identified two novel frameshift mutations, 1277delAA (del2) and 1284delACTT (del4), in unrelated men with classical Fabry disease. Both mutations occurred in the 3 terminus of the coding region and obliterated the termination codon, and del2 also altered the polyadenylation signal. To characterize these mutations, 3 rapid amplification of cdna ends (RACE) and polymerase chain reactions (PCR) were performed, and the amplicons were subcloned and sequenced. Both mutations generated multiple transcripts with various lengths of 3 terminal sequences, some elongating 1 kb. Mutant transcripts were classified as follows: type I transcripts had terminal in-frame thymidines that created termination codons when polyadenylated, type II had downstream termination codons within the elongated a-gala sequence, and type III, the most abundant, lacked termination codons at their 3 ends. To determine if the type III transcripts were degraded by the recently described cytosolic messenger RNA degradation pathway for messages lacking termination codons, northern blot analysis was performed. However, the finding of similar levels of nuclear and cytoplasmic a-gala mrna in normal and patient lymphoblasts suggested that mrna degradation did not result from either mutation. Expression of representative transcript types revealed differences in intracellular localization and/or protein stability and catalytic activity, with most mutant proteins being nonfunctional. Characterization of these 3 mutations identified a novel molecular mechanism causing classical Fabry disease. Introduction Fabry disease (MIM ) is an X-linked recessive inborn error of glycosphingolipid catabolism resulting from the deficient activity of the lysosomal exoglycohydrolase, a-galactosidase A (a-gala) (EC ). The enzymatic defect results in the progressive accumulation of neutral glycosphingolipids with terminal a- linked galactosyl moieties (primarily globotriaosylceramide [GL-3]) in the plasma and in the lysosomes of cells throughout the body (Desnick et al. 2001). In classically affected males with little, if any, a-gala activity, the accumulation of GL-3, particularly in the vascular endothelium, leads to the major clinical manifestations, including acroparesthesias, angiokeratoma, hypohidrosis, and the characteristic corneal and lenticular opaci- Received March 5, 2003; accepted for publication April 29, 2003; electronically published June 6, Address for correspondence and reprints: Dr. Robert J. Desnick, Department of Human Genetics, Mount Sinai School of Medicine, 1425 Madison Avenue, Box 14-98, New York, NY rjdesnick@mssm.edu 2003 by The American Society of Human Genetics. All rights reserved /2003/ $15.00 ties. Onset usually occurs in childhood or adolescence, and, with advancing age, vascular complications of the heart, kidney, and brain lead to early demise. In contrast, atypical variants, who have low levels of residual a-gala activity, lack the typical manifestations and present later in life, with major symptoms limited to the heart (von Scheidt et al. 1991; Nakao et al. 1995; Desnick et al. 2001). The complete genomic and cdna sequences of the human a-gala gene have been determined (Bishop et al. 1986; Kornreich et al. 1989). This gene is unique among eukaryotic genes, because it lacks a 3 UTR, except for rare variant mrnas having short 3 UTRs of 6 or 7 nt (Bishop et al. 1988). The polyadenylation signal (pas) is in the coding sequence, and the termination signal is in the last codon. To date, 1300 disease-causing a-gala mutations have been identified, including missense mutations, small deletions/insertions, splice mutations, and large gene rearrangements (Desnick et al. 2001). Despite the marked molecular heterogeneity of this disease, mutations that affect 3 -end formation have not been described. In most eukaryotic mrnas, 3 -end formation is generated through endonucleolytic cleavage and addition 162
2 Yasuda et al.: Unique 3 -End Lesions Cause Fabry Disease 163 of the poly(a) tail. In mammalian cells, this reaction depends on three elements that define the core pas: the consensus AAUAAA hexonucleotide or some functional variant, a degenerate U-rich or GU-rich sequence nt downstream of the cleavage site (the downstream element [DSE]), and the cleavage site itself, which becomes the point of poly(a) addition, that is, the poly(a) site (Zhao et al. 1999). The poly(a) tail presumably enhances the translation and stability of mrnas (Sachs et al. 1997; Preiss and Hentze 1998), as well as contributing to their transport from the nucleus to the cytoplasm (Eckner et al. 1991; Huang and Carmichael 1996; Hilleren et al. 2001). Defects in 3 -end formation can therefore have profound effects on gene expression and may cause disease. Only a few human pas mutations have been reported elsewhere; they include mutations in the a- and b-globin (Orkin et al. 1985; Rund et al. 1992; Harteveld et al. 1994), the IL2RG (Hsu et al. 2000), and the FOXP3 genes (Bennett et al. 2001), all four of which have 3 UTRs. Most of these pas mutations caused disease by reducing the levels of their respective mature mrnas. Here, we describe two novel a-gala mutations that altered 3 -end formation in unrelated men with classical Fabry disease. Both lesions were small deletions that caused frameshift mutations at the 3 terminus of the gene, thereby obliterating the termination codon. Surprisingly, both mutations resulted in multiple transcripts with various 3 lengths. Of note, many of the mutant transcripts were cleaved at upstream and distant downstream sites, which had alternative pas motifs. To further characterize these disease-causing mutations, the stability of the mutant transcripts in each patient s cultured lymphoblasts was analyzed, and the expressed activity and subcellular localization of representative mutant proteins were determined in COS-7 cells. Subjects, Material, and Methods Probands Proband 1 was a 51-year-old Swedish man who had onset of acroparesthesias at 10 years of age and subsequently had gastrointestinal manifestations, including abdominal pain and chronic diarrhea. He developed hypertrophic cardiomyopathy and, because of an atrioventricular block II III, required a pacemaker. His renal function was normal, with only a trace of urinary protein. His a-gala activities in plasma and cultured lymphoblasts were 0.4 nmol/h/ml (normal mean SD nmol/h/ml) and 1.8 nmol/h/mg protein (normal mean SD nmol/h/mg protein), respectively. Proband 2 was a 51-year-old Brazilian man who had childhood onset of acroparesthesias, angiokeratoma, hypohidrosis, and corneal opacities. He had microalbuminuria, which may have been secondary to his diabetes mellitus, but retained normal renal function. He had no evidence of cardiac or cerebral involvement. His a-gala activities in plasma and cultured lymphoblasts were 0.4 nmol/h/ml and 1.7 nmol/h/mg, respectively. Mutation Analysis Peripheral blood was collected in EDTA from the probands after informed consent was obtained. Genomic DNA was isolated and amplified, and mutation analysis was performed as described elsewhere (Shabbeer et al. 2002). In brief, each of the a-gala exons and flanking intronic sequences was PCR amplified from genomic DNA. Each amplicon was then sequenced with an ABI Prism 3700 Capillary Array Sequencer, using the ABI Prism BigDye Terminator Ready Reaction Mix (Perkin- Elmer-Cetus). Each mutation was confirmed by repeat PCR amplification and sequencing of the opposite strand and by cosegregation of the lesion and disease in other family members. RNA Isolation and Characterization of Mutant Transcripts Total RNA was isolated from control and patient lymphoblast cell lines, using TRI reagent (Molecular Research Center). Polyadenylated RNA (poly[a] RNA) was isolated using the Oligotex mrna kit (Qiagen), and, for each sample, 1.0 mg of poly(a) RNA was used to perform 3 rapid amplification of cdna ends rapid amplification of cdna ends (RACE) with the SMART RACE cdna amplification kit (Clontech). A genespecific primer near the end of exon 6 (5 -GACGTAAT- TGCCATCAATCAGGACC-3 ) and a nested universal primer within the oligo(dt) anchor sequence (5 -CCTC- AAGCTATGGTATCAACGCAGAGT-3 ) were used to amplify a fragment of 380 bp for the normal a-gala cdna, with the precise length depending on the length of the poly(a) tail. The PCR products were cloned into PCRII-TOPO vectors, using the Topo TA cloning kit (Invitrogen), and 50 clones were randomly selected to be sequenced for each mutation. The different del2 and del4 subclones were designated transcripts A1 A20 and B1 B16, respectively. Subcellular Fractionation and Northern Analysis Cultured control and patient lymphoblasts were treated or untreated with 100mg/ml cycloheximide for 5 h, and subcellular fractionation of control and patient lymphoblasts was performed as described elsewhere (Frischmeyer et al. 2002), with the following modifications: cultured lymphoblasts were washed in cold PBS, pelleted by centrifugation at 200 g for 5 min at
3 164 Am. J. Hum. Genet. 73: , C, and resuspended in hypotonic lysis buffer (10 mmol/l NaCl, 3 mmol/l MgCl 2, 10 mmol/l Tris-HCl [ph 7.4], 0.5% NP-40, 1 mmol/l dithiothreitol, and 400 U/ml RNase inhibitor [Roche Molecular Biochemicals]). After vortexing and incubation on ice for 5 min, the nuclei were pelleted by centrifugation at 800 g for 5 min at 4 C. mrna was isolated immediately from the nuclear and cytoplasmic fractions, using TRI reagent (Molecular Research Center). For each cellular fraction, 5.0 mg of mrna was loaded onto a gel containing 1.0% agarose and 5.0% formaldehyde. After electrophoresis, RNA was transferred onto a Hybond XL membrane (Amersham Pharmacia Biotech) in 20# standard saline citrate buffer. The filter was incubated at 80 C for2h and was UV irradiated and hybridized with a randomly primed 32 [P]-labeled full-length a-gala cdna probe. To determine the integrity of the RNA, the membrane was rehybridized with a 32 [P]-labeled cdna for human b- actin. The intensity of each signal was estimated using the National Institutes of Health Image program. Generation of Mutant a-gala Constructs The full-length wild-type a-gala cdna was obtained from normal lymphoblasts by 3 RACE, using the sense primer 3 -AGGTTAATCTTAAAAGCCCAGGTTAC-5 and the nested universal primer (described above). After Topo TA cloning, the insert was subcloned into the pcdna 3.0 expression vector (Invitrogen), and this construct was designated pcwt. To generate the fulllength mutant a-gala constructs pca2, pca3, pca6, pca7, pca8, pca12, pca14, pca16, pca19 (del2), pcb1, pcb3, pcb4, pcb6, pcb7, pcb10, and pcb14 pcb16 (del4) a 1-kb fragment containing most of the wildtype a-gala gene from the 5 end was digested out of the pcwt and was spliced into the respective mutant pcr-ii TOPO plasmids, using KpnI restriction sites. The full-length mutant a-gala cdnas were then subcloned into the pcdna 3.0 expression vector. All constructs were confirmed by sequencing. Note that the reverse primer used for 3 RACE contained three termination codons, each in a different reading frame (fig. 1A). Thus, all cloned cdnas were designed to terminate within this primer sequence, regardless of their reading frame. Cell Culture and Transient Transfections Patient lymphoblasts were cultured as described elsewhere (Anderson and Gusella 1984). COS-7 cells from the American Type Culture Collection were maintained in Dulbecco s modified Eagle medium (Invitrogen) supplemented with 10% fetal bovine serum and antibiotics at 37 C with 5% CO 2. COS-7 cells were plated onto 35-mm six-well culture plates with or without coverslips for immunofluorescence microscopy and a-gala enzyme assays, respectively. Plasmid DNA (1.0 mg) was transfected into each well, using FuGene6 transfection reagent (Roche Molecular Biochemicals), and incubated at 37 C for 48 h. Protein Quantification and a-gala Enzyme Assays a-gala activity was determined using the fluorogenic substrate, 4-methylumbelliferyl-a-D-galactopyranoside (Diagnostic Chemicals), as described elsewhere (Desnick et al. 1973). N-acetylgalactosamine (0.1 mmol) (Amersham Pharmacia Biotech) was used as an inhibitor of a- galactosidase B activity. For enzyme assays in COS-7 cells, transient transfections were performed as described above, and cells were harvested, lysed, and assayed for a-gala activity. Protein concentrations of the samples were determined by use of the DC Protein Assay kit (Bio- Rad). Enzymatic activity was expressed as nanomoles of substrate protein hydrolyzed per hour per milligram. All assays were done in triplicate from three separate transfections, and, after subtraction of background, the mean values were used to calculate the percent of wild-type activity. Immunofluorescence Microscopy COS-7 cells were grown on coverslips and transfected as described above. After 48 h of incubation, cells were washed with PBS and fixed with 50% methanol/50% acetone (vol/vol). Then the cells were washed extensively in PBS, blocked in 3% BSA/0.2% Tween-20/PBS for 30 min, and incubated overnight at 4 C with rabbit anti human a-gala antibodies (Ioannou et al. 1998). The a- GalA antibody solution was removed, and cells were incubated with mouse anti human LAMP2 antibodies (Hybridoma Bank, University of Iowa) or mouse anti human BiP antibodies (BD Biosciences Pharingen) for 1 h at room temperature. After three washes in 1% Triton- X/0.2% Tween-20/PBS, the cells were incubated with donkey anti rabbit IgG-FITC (Jackson Immuno Research) and donkey anti mouse IgG Rhodamine Red (Jackson Immuno Research) for 30 min at room temperature. The coverslips were washed as described above and were mounted onto a microscope slide. The slides were observed under a Nikon Eclipse fluorescence microscope equipped with a charged coupling device camera. Results Identification and Characterization of the a-gala Mutations PCR amplification and direct sequencing of the a- GalA gene from genomic DNA isolated from probands 1 and 2 revealed a two-base deletion 1277delAA (designated del2 ), which altered the last nucleotide of the pas AUUAAA to AUUAAG and a four-base dele-
4 Yasuda et al.: Unique 3 -End Lesions Cause Fabry Disease 165 Figure 1 3 RACE PCR analysis, using normal and mutant lymphoblasts. A, Design of 3 RACE PCR. A gene-specific sense primer (P1) at the end of exon 6 and a nested primer within the oligo(dt) anchor sequence (P2) were used. The antisense primer contained three separate termination codons, all in different reading frames. B, 3 RACE PCR products analyzed on a 1.5% agarose gel. Lane 1, normal control; lane 2, 1277delAA; lane 3, 1284delACTT. tion 1284delACTT (designated del4 ), which eliminated the four bases before the termination codon. Sequencing of RT-PCR products confirmed their respective lesions and did not identify any other upstream alterations. To characterize the mutant transcripts, 3 RACE PCR was performed using mrna extracted from cultured lymphoblasts established from each proband. Electrophoresis showed that the del2 mutation had a major product that was slightly smaller than the wild-type cdna and had several minor larger cdnas, whereas the del4 product was similar in size to the wild-type cdna (fig. 1B). These cdnas were subcloned, and 50 randomly selected colonies were sequenced for each mutation. Surprisingly, both mutations had multiple cdnas with various 3 lengths, some being shorter than wild type and others being elongated (fig. 2). In contrast, sequencing of 10 colonies for the wild-type 3 RACE cdnas revealed seven subclones having no 3 UTR and only three subclones having six or seven additional nucleotides before the poly(a) tail, as described elsewhere (Bishop et al. 1988). The different del2 and del4 subclones were designated transcripts A1 A20 and B1 B16, respectively. The major del2 transcripts A3, A4, and A6 (fig. 2A) were 5 14 nt shorter than wild type and accounted for 40% of the transcripts. Only A8, which accounted for 8% of del2 transcripts, used the same cleavage/polyadenylation site as wild-type a-gala. Transcripts A1, A2, A5, and A7 were within the range of 17 to 1 nt of the wild type, whereas transcripts A9 A15 were elongated by 1 22 nt. Interestingly, 20% of the cloned transcripts (A16 A20), were elongated by 1180 nt, the
5 166 Am. J. Hum. Genet. 73: , 2003 Figure 2 Mutant transcripts detected in the 1277delAA (A) and 1284delACTT (B) mutations. The natural polyadenylation signal, AUUAAA, or mutated AUUAAG (del2) is indicated by an underline, and the alternative signal, AAUACA, is shown in italics. The original termination codon is shown in bold. Sequences upstream of the original termination site are capitalized, whereas nonconsensus and elongated sequences are in lowercase. The mutant transcripts were designated A1 A20 (1277delAA) and B1 B16 (1284delACTT), and their frequencies among the 50 colonies are indicated, as well as transcript type. A bullet ( ) indicates that the base was identical to the one above. longest (A20) by 1 kb. Among these, A16, A18, and A20 were followed by A-rich sequences and therefore may have been derived through false priming of the 3 RACE oligo(dt) primer (fig. 3). In contrast, transcripts A17 and A19 were not followed by A-rich motifs, suggesting that these cleavage sites must be used in vivo. Notably, transcripts A2 and A7 had terminal, in-frame thymidines, which, if followed by the poly(a) tail, would encode TAA, a de novo termination codon (designated type I transcripts). The longer transcripts, A16 A20, had termination codons that were 55 nt downstream of the obliterated, wild-type poly(a) site (designated
6 Yasuda et al.: Unique 3 -End Lesions Cause Fabry Disease 167 Figure 3 The elongated del2 mutant transcripts are cleaved at different downstream sites. Uppercase sequences are the coding region of the human a-gala gene, and the downward arrowhead ( ) indicates the natural poly(a) site. The poly(a) sites of the mutant transcripts are shown by insertion of the corresponding transcript numbers in parentheses. Consensus AAUAAA signals are shown in bold, and the DSEs are underlined. type II transcripts) (fig. 4). However, most ( 70%) of the del2 transcripts lacked termination codons at their 3 ends (designated type III or nonstop transcripts). In comparison with the variety of del2 transcripts, the del4 transcripts were less diverse (fig. 2B). The major del4 transcripts, B7 and B10, were 6 and 7 nt longer than the wild-type forms, respectively, and used the same cleavage sites as the wild-type variant forms (Bishop et al. 1988). Transcript B1, which was 36 nt shorter than wild-type transcripts, was the shortest among the del2 and del4 transcripts. B2 B4 were 5 14 nt shorter than wild type, whereas B5, B6, B8, B9, and B11 B15 were 4 23 nt longer. Transcript B1, as well as B16, which shared the same cleavage site as A18, may have been derived through false priming, since they were followed by A-rich sequences. Transcripts B6 and B15 both had a terminal, in-frame thymidine (type I), and B16 had a termination codon 70 nt downstream of the obliterated termination site (type II) (fig. 4). The majority ( 90%) of del4 transcripts lacked termination codons at their 3 ends (type III). Stability of the Mutant Transcripts To determine whether the del2 and del4 type III transcripts that lacked a termination codon were degraded by the recently proposed nonstop transcript decay pathway, the mrnas in the nuclear and cytoplasmic fractions of wild-type, del2, and del4 lymphoblasts were isolated and assessed by northern hybridization. The a- GalA mrna levels (normalized to b-actin mrna) in the nuclear and cytoplasmic fractions were comparable to or somewhat higher than those of the wild-type mrna (fig. 5), even when the cells were treated with the translational inhibitor, cycloheximide (data not shown) (Frischmeyer et al This indicated that the del2 and del4 mutant transcripts were stable and abundant. The sizes of the mutant a-gala mrnas were essentially the same as the normal transcript, and elongated transcripts were undetectable from either the del2 or del4 mrnas. Expression Analysis of Mutant Constructs The intracellular a-gala activity and subcellular localization of the mutant proteins encoded by representative del2 and del4 mutant cdnas were determined by transient transfection in COS-7 cells. The mutant constructs had five different protein expression profiles, depending upon whether or not their cdnas ended with a termination codon and the extent to which they were elongated (table 1). The mutant proteins that were encoded by transcripts with in-frame terminal thymidines (type I) and within the range of 15 to 5 ntofthe wild-type sequence were sorted to the lysosomes (fig. 6a) and had wild-type catalytic activity (designated type I- L ). These included the mutant proteins encoded by del2 transcripts A2 and A7 and del4 transcript B6 (table 1). In contrast, the mutant protein synthesized by transcript B15, which had an in-frame terminal thymidine but was elongated by 23 nt, had only partial activity and was retained in the endoplasmic reticulum (ER) (designated type I-ER ) (fig. 6b). Mutant proteins encoded by transcripts elongating 1180 nt, which had de novo termi-
7 168 Am. J. Hum. Genet. 73: , 2003 Figure 4 Elongation of the 1277delAA and 1284delACTT mutant proteins. Sequences are aligned by codons, and the corresponding amino acid is shown below each codon. Termination codons are indicated by asterisks (*). nation codons within their elongated a-gala sequences (type II), were retained in the ER, because of misfolding, and had no catalytic activity. These included del2 transcripts A16 A20 and del4 transcript B16. The mutant proteins synthesized by type III nonstop transcripts, whose lengths were between 36 nt shorter and 7 nt longer than those of the wild type, were transported to the lysosomes but retained only partial activity (designated type III-L ). These included del2 transcripts A3, A6, and A8 and del4 transcripts B1, B3, B4, B7, and B10. In contrast, the proteins produced by the longer nonstop transcripts (17 22 nt longer than wild type) had no catalytic activity and were undetectable by immunofluorescence staining. These proteins were designated type III-X (fig. 6c) and included the mutant forms expressed by del2 transcripts A12 and A14 and del4 transcript B14. Of note, the mutant constructs were designed to have a termination codon within the reverse primer sequence following their poly(a) tails (fig. 1A). Thus, nonstop transcripts were predicted to encode multiple lysines, because their poly(a) tails were translated, and to terminate within the next 22 nt. To determine whether poly(a) tract length affected protein expression, nonstop transcripts that were identical to A6 and B7, except for their poly(a) tail length, were selected and expressed. The A6 and B7 transcripts originally used in the expression studies had poly(a) tracts of 15 adenosines. Interestingly, when the poly(a) length was increased from 15 to 60 adenosines, the cataclytic activity was totally lost, and the A6- and B7-expressed proteins became undetectable by immunofluorescence (table 2). Discussion Among eukaryotic genes, the human a-gala gene is unique, in that it has no 3 UTR but retains the pas in the coding sequence and a termination signal in the last codon. Therefore, the discovery of two deletions, del2 and del4, that cause classical Fabry disease was of interest, and studies were conducted to characterize these lesions. Both frameshift mutations resulted in multiple mutant transcripts with different 3 lengths in cultured lymphoblasts. The del2 mutation, which occurred in the last nucleotide of the AUUAAA pas consensus sequence, resulted in a more diverse population of transcripts, in comparison with the del4 mutation, which did not directly modify the pas. To our knowledge, this is the first report of 3 mutations that display such a wide spectrum of mutant transcripts. This exceptional variety of mutant transcripts seems to result from at least two different mechanisms, alternative pas usage and aberrant cleavage-site selection. For example, some of the mutant transcripts were cleaved through activation of the alternative pas, AAU- ACA, which is located 28 nt upstream of the wild-type termination codon (fig. 2). Transcripts A1 A7 and B2 B4 presumably used this upstream signal, since their
8 Yasuda et al.: Unique 3 -End Lesions Cause Fabry Disease 169 Figure 5 Northern blot analysis of nuclear (Nuc) and cytoplasmic (Cyto) fractions in normal and patient lymphoblast lines (1277delAA and 1284delACTT). a-gala mrna levels were normalized against b-actin, and the ratio of normalized mutant a-gala to wild-type a-gala was calculated for each cellular compartment. cleavage sites were within reasonable distance (12 26 nt) from the AAUACA hexonucleotide but were too close (!10 nt) or were even further upstream of the mutated AUUAAG (del2) or wild-type AUUAAA sequence. Most of the remaining transcripts most likely used the mutated AUUAAG signal (in the case of A8 A15) or wild-type AUUAAA signal (in the case of B5 B15). However, since the two signals AAUACA and AUUAAA/AUUAAG (del2) were very close to one another, it was difficult, for some mutant transcripts, to pinpoint which of the two signals was actually used. Thus, the del2 mutation, whose major transcripts (A3, A4, and A6) used the upstream alternative AAUACA hexonucleotide, resulted in more diverse transcripts, compared with those resulting from the del4 mutation, whose major transcripts (B7 and B10) used the wildtype AUUAAA signal. In addition to the upstream alternative pas, the del2 mutation also seemed to have activated distant downstream pass. This presumption is based on the fact that both of the elongated del2 transcripts (A17 and A19) had alternative AAUAAA hexonucleotides within nt upstream of their cleavage sites, as well as GUrich DSEs!30 nt downstream (fig. 3). Two mutations in the pas of the human b-globin gene also have been shown to cause similar read-through transcripts in vivo, which elongated beyond the normal termination site and were presumably cleaved at downstream alternative poly(a) sites (Rund et al. 1992). Studies have demonstrated that the efficiency of a cleavage/polyadenylation site is defined by the stability of its interaction with the cleavage/polyadenylation complex, particularly the cleavage polyadenylation specifying factor, with the AAUAAA hexonucleotide, and the cleavage-stimulating factor, with the DSE (Wahle and Ruegsegger 1999). The AAUAAA pas is highly conserved among mammals, whereas AUUAAA is the most common variant signal (Wahle and Ruegsegger 1999). The upstream alternative pas, AAUACA, is rare but is used in several mammalian genes (Beaudoing et al. 2000), including the human genes spermidine synthase (Myöhänen et al. 1991) and type I keratin (Marchuk et al. 1985) and in the a-subunit of the photoreceptor cgmp phosphodiesterase (Pittler et al. 1990). In contrast, the mutated pas of del2, AUUAAG, was not identified in a pas motif analysis of 5,600 ESTs, and it was suggested that either its efficiency is low or it may even have a deleterious effect (Beaudoing et al. 2000). It is probable that the del2 mutation, by altering the last nucleotide of the AUUAAA sequence to AUUAAG, caused instability of the pre-mrna cleavage/polyadenylation complex and led to the relative strengthening of upstream and multiple downstream pass, thereby resulting in a wider variety of transcripts, compared with del4. Another mechanism involved in the generation of multiple mutant transcripts is aberrant cleavage-site selection. Interestingly, even the mutant transcripts that shared the same pas used multiple adjacent cleavage sites. For instance, transcripts A8 A15 and B5 B15 most
9 170 Am. J. Hum. Genet. 73: , 2003 Table 1 In vitro a-gala Activity and Subcellular Localization of Expressed Mutant Constructs in COS-7 Cells Mutant Construct Transcript Type Length (nt) In-Frame Thymidine Termination Codon a a-gala Activity (% WT) b Subcellular Localization 1277del2: A2 I Lysosome A7 I 1 91 Lysosome A16 II ER A19 II ER A3 III Lysosome A6 III 5 15 Lysosome A8 III 0 18 Lysosome A12 III 17 0 Undetectable A14 III 19 0 Undetectable 1284del4: B6 I Lysosome B15 I ER B16 II ER B1 III Lysosome B3 III 9 61 Lysosome B4 III 5 26 Lysosome B7 III 6 46 Lysosome B10 III 7 5 Lysosome B14 III 22 0 Undetectable a All type III transcripts have artificial termination codons (fig. 1A), which permit expression in vitro (see Discussion section for details). b WT p wild type. likely used the AUUAAG (del2) or wild-type AUUAAA signal. However, among these transcripts, only A8, which accounted for 8% of all del2 transcripts, was cleaved/ polyadenylated at the same site as the wild type (fig. 2A). Aberrant cleavage-site selection may have resulted from alteration of the relative positions of the AAUAAA motif and the DSE, since the distance between these two elements is believed to be an important cleavage site determinant (Chen et al. 1995). Of note, both the del2 and del4 mutations occur at STRs, presumably through backward slipped strand mispairing. The del2 mutation occurs in the last two of four consecutive adenosines, whereas the del4 occurs in the second set of the repeated nucleotides ACTT (fig. 2). Although the del2 mutation altered the pas, del4 altered neither the pas nor the sequence surrounding the termination codon, since it occurred within a repeated sequence. Thus, the del4 mutation provides further evidence that distance, more than sequence context, is a crucial determinant of cleavage-site selection. Although there is no strict requirement for the precise sequences at which cleavage occurs, previous studies have shown that there is a preference of A 1 U 1 C k G (Chen et al. 1995). Analysis of the mutant del2 and del4 transcripts, excluding those that may have emerged through false priming (i.e., del2 A16, A18, and A20 and del4 B1 and B16), shows that 70% of del2 transcripts (A1, A3, A4, A6, A8, A15, A17, and A19) were polyadenylated at sites adjacent to As, indicating that this nucleotide preference may have contributed to cleavage-site selection. In contrast, among the del4 transcripts, only 30% (B2, B3, B10, B13, and B14) were polyadenylated at sites adjacent to As. It should be noted that these transcripts were probably cleaved at the A nucleotide in vivo; thus, the first adenosine of their poly(a) tails was derived from their transcripts. Therefore, we propose that the del2 mutation caused activation of several alternative pass, as well as aberrant cleavage, whereas the del4 mutation mainly caused aberrant cleavage and resulted in multiple mutant transcripts. The fact that these mutant transcripts were stable was significant. Recently, a novel mrna degradation pathway in which transcripts lacking termination codons are degraded by the cytoplasmic exosome was demonstrated in yeast and mammalian cells (Frischmeyer et al. 2002; van Hoof et al. 2002). This pathway was referred to as nonstop transcript decay. The majority of del2 and del4 transcripts lacked termination codons at their 3 terminals and, hence, were candidate substrates for this degradation pathway. However, the results of the northern blot analysis suggested that nonstop decay did not occur in the del2 and del4 lymphoblasts. Alternatively, nonstop decay may not have occurred because of the unique 3 end structure of the human a-gala gene. In addition, nonstop decay, a translation-dependent pathway, would be impeded if
10 Yasuda et al.: Unique 3 -End Lesions Cause Fabry Disease 171 aberrant 3 -end formation of the mutant transcripts caused inefficient translation in vivo. To investigate whether the mutant cdnas were translatable and to determine their protein expression patterns, representative mutant constructs were transfected into COS-7 cells. These studies demonstrated that the mutant cdnas were translated, although the vast majority did not synthesize functional proteins (table 1). The elongated type II transcripts with downstream termination codons produced misfolded proteins that were retained in the ER. Although nonstop constructs with short ( 15 nt) poly(a) tracts made proteins with partial activity, the actual lengths of poly(a) tails of in vivo type III transcripts were assumed to be normal (generally 200 adenosines), because the mutant transcripts were transported to the cytoplasm (fig. 5) (Eckner et al. 1991; Huang and Carmichael 1996; Hilleren et al. 2001). Therefore, two sets of type III transcripts that use the same cleavage site but have longer ( 60 nt) poly(a) tracts were expressed. Although the poly(a) 60 transcripts were stable in COS-7 cells (data not shown), they did not result in immunologically detectable proteins. Presumably, the strong positive charge of multiple lysines encoded by the poly(a) tail has trapped the protein in the ER membrane, thereby preventing release of the nascent protein into the ER lumen and triggering rapid degradation. Another possibility is that the mutant protein with the longer poly(a) tract may have resulted in a misfolded, highly unstable undimerized polypeptide that was not recognized by the anti a-gala antibodies. Hence, it is likely that the mutant proteins Table 2 Effect of Poly(A) Tract Length on Protein Expression Pattern POLY(A) 15 POLY(A) 60 MUTANT CONSTRUCT Activity (% WT) a Localization Activity (% WT) a Localization A6 15 Lysosome 0 Undetectable B7 46 Lysosome 0 Undetectable a WT p wild type. encoded by the nonstop transcripts in vivo are highly unstable and rapidly degraded. Thus, only the type I-L transcripts, which had inframe terminal thymidines and were relatively short, synthesized functional proteins with enzymatic activity comparable to wild type. In the present studies, such transcripts accounted for only 6% of the cdnas in both patients. The actual a-gala activity in the lymphoblasts of the two patients was 2.0% of the normal mean, suggesting that these functional transcripts were even less abundant in vivo. In addition, since a-gala is a homodimeric protein, it is possible that the few functional transcripts may have encoded polypeptides that dimerized with nonfunctional enzyme subunits, rendering the heterodimer noncatalytic or unstable. In summary, we have identified two novel frameshift mutations at the 3 terminus of the a-gala gene in unrelated men with classical Fabry disease. Both mutations resulted in multiple, stable transcripts with various 3 lengths that were classified in three major types. Representative mutant constructs were expressed, demon- Figure 6 Subcellular localization of mutant proteins. Representative mutant constructs were double stained with rabbit anti human a- GalA antibodies and either rabbit anti human LAMP-2 (as the lysosome marker) antibodies (a) or rabbit anti human BiP (the ER marker) antibodies (b and c). Representative staining patterns of lysosomal (a), ER (b), and undetectable (c) proteins are shown.
11 172 Am. J. Hum. Genet. 73: , 2003 strating that the vast majority of mutant polypeptides were nonfunctional. These mutations reveal a novel molecular mechanism causing classical Fabry disease, and they emphasize the molecular genetic heterogeneity of this disorder. The present studies provide an increased understanding of 3 -end formation and nonstop transcript decay in higher eukaryotes. Acknowledgments We thank Drs. Harry Dietz (Johns Hopkins University) and David Bishop (Mount Sinai School of Medicine), for helpful discussions and comments on the manuscript, and Drs. E. Pettersson and M. Lipson, for referral of the patients. M.Y. is a recipient of the NORD/Roscoe Brady Lysosomal Storage Disease Fellowship from the National Organization of Rare Disorders. This work was supported in part by National Institutes of Health grants R37 DK34045 (Merit Award), 5 M01 RR00071 (for the Mount Sinai General Clinical Research Center Program), and 5 P30 HD28822 (for the Mount Sinai Child Health Research Center) and by a research grant from the Genzyme Corporation. Electronic-Database Information The URL for data presented herein is as follows: Online Mendelian Inheritance of Man (OMIM), (for Fabry disease) References Anderson MA, Gusella JF (1984) Use of cyclosporin A in establishing Epstein-Barr virus transformed human lymphoblastoid cell lines. In Vitro 20: Beaudoing E, Freier S, Wyatt JR, Claverie JM, Gautheret D (2000) Patterns of variant polyadenylation signal usage in human genes. Genome Res 10: Bennett CL, Brunkow ME, Ramsdell F, O Briant KC, Zhu Q, Fuleihan RL, Shigeoka AO, Ochs HD, Chance PF (2001) A rare polyadenylation signal mutation of the FOXP3 gene (AAUAAArAAUGAA) leads to the IPEX syndrome. Immunogenetics 53: Bishop DF, Calhoun DH, Bernstein HS, Hantzopoulos P, Quinn M, Desnick RJ (1986) Human a-galactosidase A: nucleotide sequence of a cdna clone encoding the mature enzyme. Proc Natl Acad Sci USA 83: Bishop DF, Kornreich R, Desnick RJ (1988) Structural organization of the human a-galactosidase A gene: further evidence for the absence of a 3 untranslated region. Proc Natl Acad Sci USA 85: Chen F, MacDonald CC, Wilusz J (1995) Cleavage site determinants in the mammalian polyadenylation signal. Nucleic Acids Res 23: Desnick RJ, Allen KY, Desnick SJ, Raman MK, Bernlohr RW, Krivit W (1973) Fabry s disease: enzymatic diagnosis of hemizygotes and heterozygotes a-galactosidase activities in plasma, serum, urine, and leukocytes. J Lab Clin Med 81: Desnick RJ, Ioannou YA, Eng CM (2001) a-galactosidase A deficiency: Fabry disease. In: Scriver CR, Beaudet AL, Sly WS, Valle D, Kinzler KE, Vogelstein B (eds) The metabolic and molecular basis of inherited disease. McGraw-Hill, New York, pp Eckner R, Ellmeier W, Birnstiel ML (1991) Mature mrna 3 end formation stimulates RNA export from the nucleus. EMBO J 10: Frischmeyer PA, van Hoof A, O Donnell K, Guerrerio AL, Parker R, Dietz HC (2002) An mrna surveillance mechanism that eliminates transcripts lacking termination codons. Science 295: Harteveld CL, Losekoot M, Haak H, Heister GA, Giordano PC, Bernini LF (1994) A novel polyadenylation signal mutation in the a-2-globin gene causing a-thalassaemia. Br J Haematol 87: Hilleren P, McCarthy T, Rosbash M, Parker R, Jensen TH (2001) Quality control of mrna 3 -end processing is linked to the nuclear exosome. Nature 413: Hsu AP, Tsai EJ, Anderson SM, Fischer RE, Malech H, Buckley RH, Puck JM (2000) Unusual X-linked SCID phenotype due to mutation of the poly-a addition signal of IL2RG. Am J Hum Genet 67:A206 Huang Y, Carmichael GC (1996) Role of polyadenylation in nucleocytoplasmic transport of mrna. Mol Cell Biol 16: Ioannou YA, Zeidner KM, Grace ME, Desnick RJ (1998) Human a-galactosidase A: glycosylation site 3 is essential for enzyme solubility. Biochem J 332: Kornreich R, Desnick RJ, Bishop DF (1989) Nucleotide sequence of the human a-galactosidase A gene. Nucleic Acids Res 17: Marchuk D, McCrohon S, Fuchs E (1985) Complete sequence of a gene encoding a human type I keratin: sequence homologous to enhancer elements in the regulatory region of the gene. Proc Natl Acad Sci USA 82: Myöhänen S, Kauppinen L, Wahlfors J, Alhonen L, Janne J (1991) Human spermadine synthase gene: structure and chromosomal localization. DNA Cell Biol 10: Nakao S, Takenaka T, Maeda M, Kodama C, Tanaka A, Tahara M, Yoshida A, Kuriyama M, Hayashibe H, Sakuraba H, Tanaka H (1995) An atypical variant of Fabry s disease in men with left ventricular hypertrophy. N Engl J Med 333: Orkin SH, Cheng TC, Antonarakis SE, Kazazian HH Jr (1985) Thalassemia due to a mutation in the cleavage-polyadenylation signal of the human b-globin gene. EMBO J 4: Pittler SJ, Baehr W, Wasmuth JJ, McConnel DG, Champagne MS, vantuinen P, Ledbetter D, Davis RL (1990) Molecular characterization of human and bovine rod photoreceptor cgmp phosphodiesterase a-subunit and chromosomal localization of the human gene. Genomics 6: Preiss T, Hentze MW (1998) Dual function of the messenger RNA cap structure in poly(a)-tail-promoted translation in yeast. Nature 392: Rund D, Dowling C, Najjar K, Rachmilewitz EA, Kazazian HH Jr, Oppenheim A (1992) Two mutations in the b-globin polyadenylylation signal reveal extended transcripts and new RNA polyadenylylation sites. Proc Natl Acad Sci USA 89:
12 Yasuda et al.: Unique 3 -End Lesions Cause Fabry Disease 173 Sachs AB, Sarnow P, Hentze MW (1997) Starting at the beginning, middle, and end: translation initiation in eukaryotes. Cell 89: Shabbeer J, Yasuda M, Luca E, Desnick RJ (2002) Fabry disease: 45 novel mutations in the a-galactosidase A gene causing the classical phenotype. Mol Genet Metab 76:23 30 van Hoof A, Frischmeyer PA, Dietz HC, Parker R (2002) Exosome-mediated recognition and degradation of mrnas lacking a termination codon. Science 295: von Scheidt W, Eng CM, Fitzmaurice TF, Erdmann E, Hubner G, Olsen EG, Christomanou H, Kandolf R, Bishop DF, Desnick RJ (1991) An atypical variant of Fabry s disease with manifestations confined to the myocardium. N Engl J Med 324: Wahle E, Ruegsegger U (1999) 3 -End processing of pre-mrna in eukaryotes. FEMS Microbiol Rev 23: Zhao J, Hyman L, Moore C (1999) Formation of mrna 3 ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mrna synthesis. Microbiol Mol Biol Rev 63:
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and
WT sham Trpv4 -/- sham Saline 10µM GSK1016709A P value Saline 10µM GSK1016709A P value Number 10 10 8 8 Intercontractile interval (sec) 143 (102 155) 98.4 (71.4 148) 0.01 96 (92 121) 109 (95 123) 0.3 Voided
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
University of Bristol - Explore Bristol Research
Al-Salihi, S. A. A., Scott, T. A., Bailey, A. M., & Foster, G. D. (2017). Improved vectors for Agrobacterium mediated genetic manipulation of Hypholoma spp. and other homobasidiomycetes. Journal of Microbiological
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
FAMILY STRUCTURES THROUGH THE LIFE CYCLE
FAMILY STRUCTURES THROUGH THE LIFE CYCLE István Harcsa Judit Monostori A magyar társadalom 2012-ben: trendek és perspektívák EU összehasonlításban Budapest, 2012 november 22-23 Introduction Factors which
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo Yuma Oka and Thomas N. Sato Supplementary Figure S1. Whole-mount smfish with and without the methanol pretreatment.
University of Bristol - Explore Bristol Research
Tan, B. G., Wellesley, F. C., Savery, N. J., & Szczelkun, M. D. (2016). Length heterogeneity at conserved sequence block 2 in human mitochondrial DNA acts as a rheostat for RNA polymerase POLRMT activity.
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
A cell-based screening system for RNA Polymerase I inhibitors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information A cell-based screening system for RNA Polymerase I inhibitors Xiao Tan,
Expression analysis of PIN genes in root tips and nodules of Lotus japonicus
Article Expression analysis of PIN genes in root tips and nodules of Lotus japonicus Izabela Sańko-Sawczenko 1, Dominika Dmitruk 1, Barbara Łotocka 1, Elżbieta Różańska 1 and Weronika Czarnocka 1, * 1
Construction of a cube given with its centre and a sideline
Transformation of a plane of projection Construction of a cube given with its centre and a sideline Exercise. Given the center O and a sideline e of a cube, where e is a vertical line. Construct the projections
Flowering time. Col C24 Cvi C24xCol C24xCvi ColxCvi
Flowering time Rosette leaf number 50 45 40 35 30 25 20 15 10 5 0 Col C24 Cvi C24xCol C24xCvi ColxCvi Figure S1. Flowering time in three F 1 hybrids and their parental lines as measured by leaf number
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
kpis(ppk20) kpis(ppk46)
Table S1. C. elegans strains used in this study Strains carrying transgenes Strain Transgene Genotype Reference IT213 tcer-1 prom:tcer-1orf:gfp:tcer-1 3'utr unc-119(ed3) III; kpis(ppk6) This study IT283
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.
Correlation & Linear Regression in SPSS Petra Petrovics PhD Student Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise
Supplemental Information. RNase H1-Dependent Antisense Oligonucleotides. Are Robustly Active in Directing RNA Cleavage
YMTHE, Volume 25 Supplemental Information RNase H1-Dependent Antisense Oligonucleotides Are Robustly Active in Directing RNA Cleavage in Both the Cytoplasm and the Nucleus Xue-Hai Liang, Hong Sun, Joshua
STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:
STUDENT LOGBOOK 1 week general practice course for the 6 th year medical students Name of the student: Dates of the practice course: Name of the tutor: Address of the family practice: Tel: Please read
Supporting Information
Supporting Information Plasmid Construction DNA cloning was carried out according to standard protocols. The sequence of all plasmids was confirmed by DNA sequencing and amplified using the E. coli strain
Tutorial 1 The Central Dogma of molecular biology
oday DN RN rotein utorial 1 he entral Dogma of molecular biology Information flow in genetics:» ranscription» ranslation» Making sense of genomic information Information content in DN - Information content
Supplementary Figure 1
Supplementary Figure 1 Plot of delta-afe of sequence variants detected between resistant and susceptible pool over the genome sequence of the WB42 line of B. vulgaris ssp. maritima. The delta-afe values
Correlation & Linear Regression in SPSS
Correlation & Linear Regression in SPSS Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise 1 - Correlation File / Open
Modular Optimization of Hemicellulose-utilizing Pathway in. Corynebacterium glutamicum for Consolidated Bioprocessing of
[Supplementary materials] Modular Optimization of Hemicellulose-utilizing Pathway in Corynebacterium glutamicum for Consolidated Bioprocessing of Hemicellulosic Biomass Sung Sun Yim 1, Jae Woong Choi 1,
Whole mount in situ hybridization, sectioning, and immunostaining Ribonuclease protection assay (RPA) Collagen gel tube formation assay
Whole mount in situ hybridization, sectioning, and immunostaining In situ hybridization for tie-1 and lncrna tie-1as and sectioning of ISH stained embryos were performed according to previously published
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
4 vana, vanb, vanc1, vanc2
77 1) 2) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 12 7 17 4 8 2003 1 2004 7 3 Enterococcus 5 Enterococcus faecalis 1 Enterococcus avium 1 Enterococcus faecium 2 5 PCR E. faecium 1 E-test MIC 256 mg/ml vana MRSA MRSA
Using the CW-Net in a user defined IP network
Using the CW-Net in a user defined IP network Data transmission and device control through IP platform CW-Net Basically, CableWorld's CW-Net operates in the 10.123.13.xxx IP address range. User Defined
pjnc-pgluc Codon-optimized Gaussia luciferase (pgluc) Vector backbone: JM83 pjnc-pgluc is resistant to ampicillin and neomycin High or low copy:
pjnc-pgluc Gene/Insert name: Codon-optimized Gaussia luciferase (pgluc) Vector backbone: pcmv-jnc Vector type: Mammalian cells Backbone size w/o insert (bp): 5375 Bacterial resistance: Ampicillin and neomycin
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK Despite enormous challenges many developing countries are service exporters Besides traditional activities such as tourism;
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis
Factor Analysis Factor analysis is a multiple statistical method, which analyzes the correlation relation between data, and it is for data reduction, dimension reduction and to explore the structure. Aim
Mapping Sequencing Reads to a Reference Genome
Mapping Sequencing Reads to a Reference Genome High Throughput Sequencing RN Example applications: Sequencing a genome (DN) Sequencing a transcriptome and gene expression studies (RN) ChIP (chromatin immunoprecipitation)
Limitations and challenges of genetic barcode quantification
Limitations and challenges of genetic barcode quantification Lars hielecke, im ranyossy, ndreas Dahl, Rajiv iwari, Ingo Roeder, Hartmut eiger, Boris Fehse, Ingmar lauche and Kerstin ornils SUPPLEMENRY
Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites
Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites Selwyn Quan *, Ole Skovgaard, Robert E. McLaughlin, Ed T. Buurman,1, and Catherine L. Squires * Department
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Hypothesis Testing. Petra Petrovics.
Hypothesis Testing Petra Petrovics PhD Student Inference from the Sample to the Population Estimation Hypothesis Testing Estimation: how can we determine the value of an unknown parameter of a population
Genome 373: Hidden Markov Models I. Doug Fowler
Genome 373: Hidden Markov Models I Doug Fowler Review From Gene Prediction I transcriptional start site G open reading frame transcriptional termination site promoter 5 untranslated region 3 untranslated
Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and
1 2 3 4 5 Journal name: Applied Microbiology and Biotechnology Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and evaluation of its effect on lignocellulosic
Mark Auspitz, Fayez Quereshy, Allan Okrainec, Alvina Tse, Sanjeev Sockalingam, Michelle Cleghorn, Timothy Jackson
Mark Auspitz, Fayez Quereshy, Allan Okrainec, Alvina Tse, Sanjeev Sockalingam, Michelle Cleghorn, Timothy Jackson Division of General Surgery, University Health Network, University of Toronto, Toronto,
On The Number Of Slim Semimodular Lattices
On The Number Of Slim Semimodular Lattices Gábor Czédli, Tamás Dékány, László Ozsvárt, Nóra Szakács, Balázs Udvari Bolyai Institute, University of Szeged Conference on Universal Algebra and Lattice Theory
EN United in diversity EN A8-0206/419. Amendment
22.3.2019 A8-0206/419 419 Article 2 paragraph 4 point a point i (i) the identity of the road transport operator; (i) the identity of the road transport operator by means of its intra-community tax identification
A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon
A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,
EPILEPSY TREATMENT: VAGUS NERVE STIMULATION. Sakoun Phommavongsa November 12, 2013
EPILEPSY TREATMENT: VAGUS NERVE STIMULATION Sakoun Phommavongsa November 12, 2013 WHAT IS EPILEPSY? A chronic neurological disorder characterized by having two or more unprovoked seizures Affects nearly
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
Cluster Analysis. Potyó László
Cluster Analysis Potyó László What is Cluster Analysis? Cluster: a collection of data objects Similar to one another within the same cluster Dissimilar to the objects in other clusters Cluster analysis
Statistical Inference
Petra Petrovics Statistical Inference 1 st lecture Descriptive Statistics Inferential - it is concerned only with collecting and describing data Population - it is used when tentative conclusions about
Computer Architecture
Computer Architecture Locality-aware programming 2016. április 27. Budapest Gábor Horváth associate professor BUTE Department of Telecommunications ghorvath@hit.bme.hu Számítógép Architektúrák Horváth
SOLiD Technology. library preparation & Sequencing Chemistry (sequencing by ligation!) Imaging and analysis. Application specific sample preparation
SOLiD Technology Application specific sample preparation Application specific data analysis library preparation & emulsion PCR Sequencing Chemistry (sequencing by ligation!) Imaging and analysis SOLiD
Cashback 2015 Deposit Promotion teljes szabályzat
Cashback 2015 Deposit Promotion teljes szabályzat 1. Definitions 1. Definíciók: a) Account Client s trading account or any other accounts and/or registers maintained for Számla Az ügyfél kereskedési számlája
SAJTÓKÖZLEMÉNY Budapest 2011. július 13.
SAJTÓKÖZLEMÉNY Budapest 2011. július 13. A MinDig TV a legdinamikusabban bıvülı televíziós szolgáltatás Magyarországon 2011 elsı öt hónapjában - A MinDig TV Extra a vezeték nélküli digitális televíziós
First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.
First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this
Contact us Toll free (800) fax (800)
Table of Contents Thank you for purchasing our product, your business is greatly appreciated. If you have any questions, comments, or concerns with the product you received please contact the factory.
ANNEX V / V, MELLÉKLET
ANNEX V / V, MELLÉKLET VETERINARY CERTIFICATE EMBRYOS OF DOMESTIC ANIMALS OF THE BOVINE SPECIES FOR IMPORTS COLLECTED OR PRODUCED BEFORE 1 st JANUARY 2006 ÁLLAT-EGÉSZSÉGÜGYI BIZONYÍTVÁNY 2006. JANUÁR 1-JE
- Bevándoroltak részére kiadott személyazonosító igazolvány
HUNGARY - Bevándoroltak részére kiadott személyazonosító igazolvány (Blue booklet form or card format issued for permanent residents - from 1 January 2000 a new card format has been introduced and issued)
tccattaattcgacagaccagagttaaataatccttgtatgccattgtgatcacatctacagttcagattttgtatttca
Figure Legends for Supplementary Materials: Fig. 1. Nucleotide sequence of the zebrafish lumican (zlum) gene. Exons are indicated by uppercase letters, and introns are indicated by lowercase letters. The
Angol Középfokú Nyelvvizsgázók Bibliája: Nyelvtani összefoglalás, 30 kidolgozott szóbeli tétel, esszé és minta levelek + rendhagyó igék jelentéssel
Angol Középfokú Nyelvvizsgázók Bibliája: Nyelvtani összefoglalás, 30 kidolgozott szóbeli tétel, esszé és minta levelek + rendhagyó igék jelentéssel Timea Farkas Click here if your download doesn"t start
Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI
Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance
Supplemental Information. Investigation of Penicillin Binding Protein. (PBP)-like Peptide Cyclase and Hydrolase
Cell Chemical Biology, Volume upplemental Information Investigation of Penicillin Binding Protein (PBP)-like Peptide Cyclase and ydrolase in urugamide on-ribosomal Peptide Biosynthesis Yongjun Zhou, Xiao
ó Ú ő ó ó ó ö ó ó ő ö ó ö ö ő ö ó ö ö ö ö ó ó ó ó ó ö ó ó ó ó Ú ö ö ó ó Ú ú ó ó ö ó Ű ő ó ó ó ő ó ó ó ó ö ó ó ó ö ő ö ó ó ó Ú ó ó ö ó ö ó ö ő ó ó ó ó Ú ö ö ő ő ó ó ö ö ó ö ó ó ó ö ö ő ö Ú ó ó ó ü ú ú ű
Eredeti gyógyszerkutatás. ELTE TTK vegyészhallgatók számára Dr Arányi Péter 2009 március, 4.ea. Szerkezet optimalizálás (I.)
Eredeti gyógyszerkutatás ELTE TTK vegyészhallgatók számára Dr Arányi Péter 2009 március, 4.ea. Szerkezet optimalizálás (I.) 1 How do we proceed? New target Internal Literature Validation Selected Target
Suppl. Materials. Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids. Germany
Suppl. Materials Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids Stephanie Bresan 1, Anna Sznajder 1, Waldemar Hauf 2, Karl Forchhammer 2, Daniel Pfeiffer 3 and Dieter Jendrossek 1 1 Institute
General information for the participants of the GTG Budapest, 2017 meeting
General information for the participants of the GTG Budapest, 2017 meeting Currency is Hungarian Forint (HUF). 1 EUR 310 HUF, 1000 HUF 3.20 EUR. Climate is continental, which means cold and dry in February
Statistical Dependence
Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent
discosnp demo - Peterlongo Pierre 1 DISCOSNP++: Live demo
discosnp demo - Peterlongo Pierre 1 DISCOSNP++: Live demo Download and install discosnp demo - Peterlongo Pierre 3 Download web page: github.com/gatb/discosnp Chose latest release (2.2.10 today) discosnp
Rezgésdiagnosztika. Diagnosztika 02 --- 1
Rezgésdiagnosztika Diagnosztika 02 --- 1 Diagnosztika 02 --- 2 A rezgéskép elemzésével kimutatható gépészeti problémák Minden gép, mely tartalmaz forgó részt (pl. motor, generátor, szivattyú, ventilátor,
Expansion of Red Deer and afforestation in Hungary
Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi www.vmi.szie.hu Background and importance large herbivores are overpopulated
FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY
Földrajz angol nyelven középszint 0623 ÉRETTSÉGI VIZSGA 2007. május 15. FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA INTERMEDIATE LEVEL WRITTEN EXAM JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ
Forensic SNP Genotyping using Nanopore MinION Sequencing
Forensic SNP Genotyping using Nanopore MinION Sequencing AUTHORS Senne Cornelis 1, Yannick Gansemans 1, Lieselot Deleye 1, Dieter Deforce 1,#,Filip Van Nieuwerburgh 1,#,* 1 Laboratory of Pharmaceutical
PROSPECTIVE ASSESSMENT OF THE RISK OF BACTEREMIA IN CIRRHOTIC PATIENTS AFTER EUS WITH AND WITHOUT FNA
PROSPECTIVE ASSESSMENT OF THE RISK OF BACTEREMIA IN CIRRHOTIC PATIENTS AFTER EUS WITH AND WITHOUT FNA Fernández ndez-esparrach G, Gimeno-Garc García a AZ, Pellisé M, Almela M*, Sendino O, Zabalza M, Llach
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit.
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit. MYB Primer pairs TC AtMYB Forward Reverse TC199266 MYB12 AGGCTCTTGGAGGTCGTTACC CAACTCTTTCCGCATCTCAATAATC
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Nonparametric Tests
Nonparametric Tests Petra Petrovics Hypothesis Testing Parametric Tests Mean of a population Population proportion Population Standard Deviation Nonparametric Tests Test for Independence Analysis of Variance
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Supplementary Figure S1.
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Sheila I. Jensen 1*, Rebecca M. Lennen 1, Markus J. Herrgård 1, Alex T. Nielsen 1*
FÖLDRAJZ ANGOL NYELVEN
Földrajz angol nyelven középszint 1112 ÉRETTSÉGI VIZSGA 2014. május 15. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ EMBERI ERŐFORRÁSOK MINISZTÉRIUMA Paper
Az fmri alapjai BOLD fiziológia. Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika
Az fmri alapjai BOLD fiziológia Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika T2* Az obszervált transzverzális relaxáció (T2*) több különböző komponens összege Many physical effects result
Proxer 7 Manager szoftver felhasználói leírás
Proxer 7 Manager szoftver felhasználói leírás A program az induláskor elkezdi keresni az eszközöket. Ha van olyan eszköz, amely virtuális billentyűzetként van beállítva, akkor azokat is kijelzi. Azokkal
Dynamic freefly DIVE POOL LINES
Dynamic freefly 3.rész Part 3 DIVE POOL LINES A dynamic repülés három fajta mozgásból áll: Dynamic freeflying is composed of three types of movements: -Lines (vízszintes "szlalom") (horizontal "slalom")
CLUSTALW Multiple Sequence Alignment
Version 3.2 CLUSTALW Multiple Sequence Alignment Selected Sequences) FETA_GORGO FETA_HORSE FETA_HUMAN FETA_MOUSE FETA_PANTR FETA_RAT Import Alignments) Return Help Report Bugs Fasta label *) Workbench
Abigail Norfleet James, Ph.D.
Abigail Norfleet James, Ph.D. Left side of brain develops first in girls, right in boys o Probably source of girls verbal skills o And source of boys spatial skills Pre-frontal lobes Control impulses and
16F628A megszakítás kezelése
16F628A megszakítás kezelése A 'megszakítás' azt jelenti, hogy a program normális, szekvenciális futása valamilyen külső hatás miatt átmenetileg felfüggesztődik, és a vezérlést egy külön rutin, a megszakításkezelő
Oxacillin MIC µ g ml borderline oxacillin-resistant Staphylococcus aureus. oxacillin Staphylococcus aureus MRSA
oxacillin Staphylococcus aureus MRSA 8 17 11 1 Oxacillin MIC 1248 µ gml borderline oxacillin-resistant Staphylococcus aureus BORSA79 NCCLS CLSIM100-S142004 cefoxitin disk oxacillin cefoxitin methicillin-resistant
OLYMPICS! SUMMER CAMP
OLYMPICS! SUMMER CAMP YOUNG BUSINESS CAMP 3D DESIGN CAMP OLYMPICS SUMMER CAMP 20 24 JUNE AND 27 JUNE 1 JULY AGE: 6-14 Our ESB native-speaking teachers will provide a strong English learning content throughout
OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA ÁGH TAMÁS DR., MÉSZÁROS ÁGNES DR.
ALL RIGHTS RESERVED SOKSZOROSÍTÁSI CSAK A MTT ÉS A KIADÓ ENGEDÉLYÉVEL Az asthmás és COPD-s betegek életminõségét befolyásoló tényezõk OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA Semmelweis Egyetem
Szívkatéterek hajlékonysága, meghajlítása
Szívkatéterek hajlékonysága, meghajlítása Összefoglalás A szívkatéter egy olyan intravaszkuláris katéter, amelyet a szívbe vezetnek, ültetnek be diagnosztikus vagy terápiás célból. A katéterek felvezetés/eltávolítás
ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY
ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY A feladatsor három részbol áll 1. A vizsgáztató társalgást kezdeményez a vizsgázóval. 2. A vizsgázó egy szituációs feladatban vesz részt a
Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz
Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz Kvantumkapuk, áramkörök 2016. március 3. A kvantummechanika posztulátumai (1-2) 1. Állapotleírás Zárt fizikai rendszer aktuális állapota
EGÉSZSÉGTUDOMÁNY, LVII. ÉVFOLYAM, 2013. 4. SZÁM 2013/4
Part II: Seasonal variations in human infections with Puumula hantavirus in Styria II. rész: Évszakos változások a Puumula hantavirus okozta humán fertőzésekben Stájerországban PROF. SIXL WOLF DIETER,
3. MINTAFELADATSOR KÖZÉPSZINT. Az írásbeli vizsga időtartama: 30 perc. III. Hallott szöveg értése
Oktatáskutató és Fejlesztő Intézet TÁMOP-3.1.1-11/1-2012-0001 XXI. századi közoktatás (fejlesztés, koordináció) II. szakasz ANGOL NYELV 3. MINTAFELADATSOR KÖZÉPSZINT Az írásbeli vizsga időtartama: 30 perc
Új temékek az UD- GenoMed Kft. kínálatában!
Új temékek az UD- GenoMed Kft. kínálatában! Szolgáltatásaink: Medical Genomic Technologies Kft. Betegtoborzás és biobanking Bioinformatika o Adatelemzés/adatbányászás o Integrált adatbázis készítés Sejtvonal
EN United in diversity EN A8-0206/482. Amendment
21.3.2019 A8-0206/482 482 Recital 13 g (new) (13g) In recognition of the need for specific treatment for the transport sector, in which movement is the very essence of the work undertaken by drivers, the
DI-, TETRA- ÉS HEXAPLOID TRITICUM FAJOK GENOMJAINAK ELEMZÉSE ÉS AZOK ÖSSZEHASONLÍTÁSA FLUORESZCENS IN SITU HIBRIDIZÁCIÓVAL
Hagyomány és haladás a növénynemesítésben DI-, TETRA- ÉS HEXAPLOID TRITICUM FAJOK GENOMJAINAK ELEMZÉSE ÉS AZOK ÖSSZEHASONLÍTÁSA FLUORESZCENS IN SITU HIBRIDIZÁCIÓVAL VARGA MÓNIKA, MOLNÁR ISTVÁN ÉS KOVÁCS
Performance Modeling of Intelligent Car Parking Systems
Performance Modeling of Intelligent Car Parking Systems Károly Farkas Gábor Horváth András Mészáros Miklós Telek Technical University of Budapest, Hungary EPEW 2014, Florence, Italy Outline Intelligent
The beet R locus encodes a new cytochrome P450 required for red. betalain production.
The beet R locus encodes a new cytochrome P450 required for red betalain production. Gregory J. Hatlestad, Rasika M. Sunnadeniya, Neda A. Akhavan, Antonio Gonzalez, Irwin L. Goldman, J. Mitchell McGrath,
A vitorlázás versenyszabályai a 2013-2016. évekre angol-magyar nyelvű kiadásának változási és hibajegyzéke
A vitorlázás versenyszabályai a 2013-2016. évekre angol-magyar nyelvű kiadásának változási és hibajegyzéke A dokumentum A vitorlázás versenyszabályai a 2013-2016. évekre angol-magyar nyelvű kiadásában
7 th Iron Smelting Symposium 2010, Holland
7 th Iron Smelting Symposium 2010, Holland Október 13-17 között került megrendezésre a Hollandiai Alphen aan den Rijn városában található Archeon Skanzenben a 7. Vasolvasztó Szimpózium. Az öt napos rendezvényen
Tudományos Ismeretterjesztő Társulat
Sample letter number 5. International Culture Festival PO Box 34467 Harrogate HG 45 67F Sonnenbergstraße 11a CH-6005 Luzern Re: Festival May 19, 2009 Dear Ms Atkinson, We are two students from Switzerland
Széchenyi István Egyetem www.sze.hu/~herno
Oldal: 1/6 A feladat során megismerkedünk a C# és a LabVIEW összekapcsolásának egy lehetőségével, pontosabban nagyon egyszerű C#- ban írt kódból fordítunk DLL-t, amit meghívunk LabVIEW-ból. Az eljárás
Can/be able to. Using Can in Present, Past, and Future. A Can jelen, múlt és jövő idejű használata
Can/ Can is one of the most commonly used modal verbs in English. It be used to express ability or opportunity, to request or offer permission, and to show possibility or impossibility. A az egyik leggyakrabban
Néhány folyóiratkereső rendszer felsorolása és példa segítségével vázlatos bemutatása Sasvári Péter
Néhány folyóiratkereső rendszer felsorolása és példa segítségével vázlatos bemutatása Sasvári Péter DOI: http://doi.org/10.13140/rg.2.2.28994.22721 A tudományos közlemények írása minden szakma művelésének
Bioinformatics: Blending. Biology and Computer Science
Bioinformatics: Blending Biology and Computer Science MDNMSITNTPTSNDACLSIVHSLMCHRQ GGESETFAKRAIESLVKKLKEKKDELDSL ITAITTNGAHPSKCVTIQRTLDGRLQVAG RKGFPHVIYARLWRWPDLHKNELKHVK YCQYAFDLKCDSVCVNPYHYERVVSPGI DLSGLTLQSNAPSSMMVKDEYVHDFEG
BÍRÁLATOK ÉS KONFERENCIÁK
BÍRÁLATOK ÉS KONFERENCIÁK Sass Bálint sass.balint@itk.ppke.hu témavezető: dr. Prószéky Gábor Doktoranduszi szeminárium 2008. november 7. 1 BÍRÁLATOK 2 KONFERENCIÁK 3 CFP DB 1 BÍRÁLATOK 2 KONFERENCIÁK 3
Személyes adatváltoztatási formanyomtatvány- Magyarország / Personal Data Change Form - Hungary
Személyes adatváltoztatási formanyomtatvány- Magyarország / Personal Data Change Form - Hungary KITÖLTÉSI ÚTMUTATÓ: A formanyomtatványon a munkavállaló a személyes adatainak módosítását kezdeményezheti.