37: (1981) IF

Hasonló dokumentumok
KÖZLEMÉNYEK: A vér-agy gát zárt koponyasérülést követ acut változásának nyomonkövetése MRvizsgálattal

Tudományos tevékenység 2005

Tudományos tevékenység 2009

Tudományos tevékenység 2007

Szakmai önéletrajz. Tanulmányok: Tudományos minısítés:

Computational Neuroscience

Doktori értekezés tézisei

Élvezeti szerekhez történő hozzászokás in vivo és in vitro vizsgálata

Conference presentations, abstracts and posters:

Anatómiai, Szövet-és Fejlődéstani Intézet tudományos diákkörének eredményei ( )

A SZEROTONIN-2 (5-HT 2 ) RECEPTOROK SZEREPE A SZORONGÁS ÉS ALVÁS SZABÁLYOZÁSÁBAN. Kántor Sándor

Gábor Takács Pharm.D., Ph.D Publication list

Udvardyné Tóth Lilla intézeti biológus

HELYSZÍNEK PROGRAM ÁPRILIS 20. csütörtök SZÁLLÁS

TUDOMÁNYOS TEVÉKENYSÉG

Szigeti Csaba M.Sc., Ph.D.

(AD) β (A ) (2) ACDP ACDP ACDP APP. APP-C99 γ (3) A 40 A 42 A A A A 42/A 40. in vivo A A A A

CURRICULUM VITAE Course abroad: two weeks long intensive course on the subject of bioethics in Udine.

Összesített impakt faktor: 15,816

Szent István Egyetem. Állatorvos-tudományi Doktori Iskola

Akt1 Akt kinase activity Creb signaling CCTTACAGCCCTCAAGTACTCATTC GGCGTACTCCATGACAAAGCA Arc Actin binding

There are no translations available. CURRENT APPOINTMENT(S):

A nemi különbségek vizsgálatáról lévén szó, elsődleges volt a nemi hormonok, mint belső környezetbeli különbségeket létrehozó tényezők szerepének

Ultrasound biomicroscopy as a diagnostic method of corneal degeneration and inflammation

A circadian melatonin (MT) szekréció kialakulásának vizsgálata

Irodalmazás. Szó szerinti idézés idézőjelben csak indokolt esetben.

EPILEPSY TREATMENT: VAGUS NERVE STIMULATION. Sakoun Phommavongsa November 12, 2013

KÖZLEMÉNYEK TELJES LISTÁJA Farkas Eszter

ZAJÁCZ EDIT publikációs lista

A motoros funkciók és a beszéd reorganizációja

Tudományos tevékenység 2008

SZTE ETSZK Publikációs lista 2010

Fügedi Balázs PhD. Szerz, cím, megjelenés helye, Szerz, cím, megjelenés. Szerz, cím, megjelenés helye, helye, PUBLIKÁCIÓ. Könyv, idegen nyelv

A KALMODULIN GÉNMŰKÖDÉS SZABÁLYOZÁSA OROFACIÁLIS BŐR EREDETŰ KRÓNIKUS GYULLADÁS ALATT ÉS AZT KÖVETŐ SZTEROID KEZELÉS SORÁN A

megerősítik azt a hipotézist, miszerint az NPY szerepet játszik az evés, az anyagcsere, és az alvás integrálásában.

Csábi Eszter. Egyetemi tanársegéd Kognitív és Neuropszichológiai Tanszék. Szoba: 0415 Telefon:

AZ INTRACEREBRÁLIS SZOMATOSZTATINERG INGERLÉSSEL KIVÁLTOTT ALVÁSGÁTLÁS ÉS IVÁS MECHANIZMUSA

Hughes, M.- Dancs, H.( 2007) (eds): Basics of Performance Analysis, Cardiff- Szombathely, Budapest

KÉRDŐÍV PÁLYÁZATOK ELBÍRÁLÁSÁNAK SZEMPONTJAIHOZ

SZAKMAI ÖNÉLETRAJZ. 6. viselkedéselemző/pszichológus (klinikai- és egészségpszichológia szakirány)

Az elért eredmények ismertetése 1. Csirkeembriók gerincvelő telepeiben kimutattuk, hogy az extracellularis matrix (ECM) egyik organizátor molekulája,

Ph.D. Tézisek összefoglalója. Dr. Paulik Edit. Szegedi Tudományegyetem Általános Orvostudományi Kar Népegészségtani Intézet

Irodalmazás Hivatkozás a szövegben: Szövegközi idézés f ormátumai: I. (Számozás), [Számozás]

Balogh András publikációs listája

DOKTORI ÉRTEKEZÉS TÉZISEI

ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma,

A halastavi tápanyag- gazdálkodás új szempontjai

1. Katona János publikációs jegyzéke

Asztrociták: a központi idegrendszer sokoldalú sejtjei Dr Környei Zsuzsanna

A neurogliaform sejtek szerepe az agykéregben

EREDETI KÖZLEMÉNYEK (FOLYÓIRATCIKK)

Élő szervezetek külső sztatikus mágneses tér expozícióra adott biológiai válaszai

Cerebrovaszkuláris elváltozások öregedésben és Alzheimer-kórban

Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li

Az fmri alapjai BOLD fiziológia. Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika

A fog extracelluláris mátrixának és mikrocirculációjának vizsgálata

A TÁPLÁLÉKFELVÉTEL SZABÁLYOZÁSA: BOMBESIN-TÍPUSÚ PEPTIDEK HATÁSA A LIMBICUS RENDSZERBEN

Eredeti közlemények. Eredeti közlemények Összesített impakt faktor: 28,24 Idézetek száma: 55 Független idézetek száma: 26 Függő idézetek szám: 29

A tanulási és emlékezési zavarok pathofiziológiája. Szeged,


MKE 2. Nemzeti Konferencia poszter Hajdúszoboszló, Jablonkai Erzsébet. poszter

A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban

A humán tripszinogén 4 expressziója és eloszlási mintázata az emberi agyban

Az ischaemiás-reperfúziós agyi károsodás korai fázisának vizsgálata szövettani, neurokémiai és funkcionális módszerekkel

DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA

Dr. Fittler András, Ph.D március 03. Publikációk Összesített impakt faktor: 14,624 Összes független idézés: 17 Önidézés: 1

A citokin egyensúly. Gyulladásgátló cytokinek. Gyulladáskeltő citokinek. Védelem és sejttúlélés. Gyulladás, sejtpusztulás NA DA.

MITT A Magyar Idegtudományi Társaság 11. Kongresszusa

Baranyáné Dr. Ganzler Katalin Osztályvezető

PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER

PARABOLIKUS HATÁSFÜGGVÉNY ÉRTELMEZÉSE

A kommunikáció és az információmegosztás mennyiségi vizsgálata a rehabilitációs teamben a kommunikáció mennyiségi vizsgálóeljárásnak bemutatása

PÉCSI TUDOMÁNYEGYETEM

Hiperlipidémia okozta neurodegeneratív és vér-agy gát-elváltozások ApoB-100 transzgenikus egerekben

A sejtmembrán szabályozó szerepe fiziológiás körülmények között és kóros állapotokban

Semmelweis Egyetem április Budapest, Üllői út 26. (Semmelweis University) 25 April Budapest, Üllői str. 26.

Eötvös Loránd Tudományegyetem Természettudományi Kar, Budapest, biológus angol szakfordító

Eredeti közlemények. Összesített impakt faktor: 25,129 Idézetek száma: 36 Független idézetek száma: 9 Függő idézetek szám: 27

19.Budapest Nephrologiai Iskola/19th Budapest Nephrology School angol 44 6 napos rosivall@net.sote.hu

Dr. Csábi Eszter. Egyetemi tanársegéd Kognitív és Neuropszichológiai Tanszék. Szoba: 0415 Telefon:

A Neurológiai Osztály tudományos tevékenysége

Tudományos segédmunkatárs (MTA TK SZI) nők a tudományban, műszaki tudományok, magánélet és munka egyensúlya, gyermekvállalás

(11) Lajstromszám: E (13) T2 EURÓPAI SZABADALOM SZÖVEGÉNEK FORDÍTÁSA

Az inzulin rezisztencia hatása az agyi vérkeringés szabályozására


PUBLIKÁCIÓS LISTA Frissítve:

STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:

Dr. Dezsõ Renáta Anna

A posztszinapszis és a PSD (posztszinaptikus. szinaptikus plaszticitásban játszott szerepük

Invitation. Hungarian Small Animal Veterinary Association (HSAVA) invite you to the. 33. National Congress of HSAVA. invited foreign speakers:

Szakmai tudományos életrajz

"A genius is one per cent inspiration and ninety nine per cent perspiration." Thomas A. Edison

Humán asztrociták. Nagyobb és komplexebb. idegrendszeri fejlődésben jelentős szerepű

Dr. Szücs Péter Születési hely és idő Debrecen, június 19 Családi állapot Állampolgárság / szucs@ibmc.up.

1918 December 1 út, 15/H/4, Sepsiszentgyörgy (Románia) Mobil biro_biborka@yahoo.com

A háti szakasz scoliosisának módosított instrumentálása Elsô klinikai tapasztalatok a CAB horgok alkalmazásával

A Magyar Tudományos Akadémia Természettudományi Kutatóközpontja

Mi is az funkcionális mágneses rezonanciás képalkotó vizsgálat

Oszvald Mária. A búza tartalékfehérjék tulajdonságainak in vitro és in vivo vizsgálata rizs modell rendszerben

Átírás:

PUBLIKÁCIÓS LISTA I. Folyóiratban megjelent közlemények 1. Mihály, A.: Alkalmazható-e az orvosképzésben a mikrotanitás koncepciója? (The applicability of the concept of microteaching in higher medical education). In Hungarian. Felsooktatási Szemle 27: 487-489 (1978) 2. Mihály, A., Pór, I., Csillik, B.: Perineuralisan alkalmazott cytostatikus, cytotoxikus és kelátképzõ vegyületek hatása a primer sensoros neuron perifériás és centralis nyúlványaira (Effects of perineurally applied chelating agents upon peripheral and central processes of the primary nociceptive neuron). In Hungarian. Kísérletes Orvostudomány 30: 246-255 (1978) 3. Mihály, A., Pór, I., Bencze Gy., Csillik, B.: Effects of perineurally applied chelating agents upon peripheral and central processes of the primary nociceptive neuron. Z. mikrosk.-anat. Forschung (Leipzig) 94: 531-544 (1980) 4. Mihály, A.: Light microscopic localization of acid phosphatase in different tissue cells of the albino rat. Z. mikrosk.-anat. Forschung (Leipzig) 94: 774-784 (1980) 5. Mihály, A.: Early morphological changes of the apical dendrites of neocortical pyramidal cells in albino rats subjected to 3-aminopyridine seizures. Adv. Physiol. Sci. 36: 65-73 (1981) 6. Mihály, A.: Early ultrastructural changes in the cerebral cortex of albino rats subjected to 3-aminopyridine seizures. Experientia 37: 870-871 (1981) IF: 1.615 7. Mihály, A.: Histochemistry and functional significance of putative neocortical transmitter substances: a review. Z. mikrosk.-anat. Forschung (Leipzig) 96: 916-936 (1982) 8. Mihály, A.: Kisérletes akut agykérgi görcsfókusz morfológiai jellemzése patkányban (Morphological characterization of experimental seizure focuses in the neocortex of the rat). In Hungarian. Kisérletes Orvostudomány 34: 255-264 (1982) 9. Kuhnt, U., Mihály, A., Joó, F.: Stimulation-dependent calcium binding sites in the guinea pig hippocampal slice: an electrophysiological and electron microscopic study. Brain Res. 279: 19-30 (1983) IF: 2.859 10. Mihály, A., Joó, F., Szente, M.: Neuropathological alterations in the neocortex of rats subjected to focal aminopyridine seizures. Acta Neuropathol. (Berl.) 61: 85-94 (1983) IF: 2.168

2 11. Mihály, A., Jójárt, I., Joó, F.: A vér-agy-gát fehérje permeabilitásának vizsgálata immunoperoxidaz módszerrel akut neocorticalis görcsfókuszban (Protein permeability of the blood-brain barrier in acute neocortical seizure focuses, as revealed with immunoperoxidase methods). In Hungarian. Morph. Ig. Orv. Szemle 23: 105-111 (1983) 12. Mihály, A., Bozóky, B.: Gliosis and serum albumin extravasation in human epileptic brains. Activ. nerv. sup. (Praha) 26: 222-223 (1984) 13. Mihály, A., Ágoston, D.: 4-aminopyridin hatása synaptosomák ultrastrukturájára (The effects of 4-aminopyridine on the ultrastructure of rat brain synaptosomes). In Hungarian. Kisérletes Orvostudomány 36: 79-86 (1984) 14. Mihály, A., Ágoston, D.: 4-aminopyridine-induced ultrastructural alterations of pinched-off nerve terminals from rat cerebral cortex. Exp. Brain Res. 54: 385-389 (1984) IF: 2.227 15. Mihály, A., Bozóky, B.: Immunohistochemical localization of extravasated serum albumin in the hippocampus of human subjects with partial and generalized epilepsies and epileptiform convulsions. Acta Neuropathol. (Berl.) 65: 25-34 (1984) IF: 2.168 16. Kuhnt, U., Mihály, A., Joó, F.: Increased binding of calcium in the hippocampal slice during log-term potentiation. Neurosci. Lett. 53: 149-154 (1985) IF: 2.703 17. Mihály, A., Tóth, G., Szente, M., Joó, F.: Neocortical cytopathology in focal aminopyridine seizures, as related to the intracortical diffusion of tritiated 4-aminopyridine. Electrophysiological and light microscopic studies. Acta Neuropathol. (Berl.) 66: 145-154 (1985) IF: 2.168 18. Mihály, A., Joó, F.: Ultrastructural characterization of the protein transport across the brain capillary wall during experimental seizures. Verh. Anat. Ges. 80: 931-932 (1986) 19. Mihály, A., Kuhnt, U., Siklós, L., Joó, F.: Semiquantitive evaluation of histochemically detectable calcium binding in mammalian brain slices. J. Neurosci. Meth. 20: 283-293 (1987) IF: 1.442 20. Mihály, A., Király, E., Nógrádi, A., Bencsik, K.: The semipermeable membrane technique in carbonic anhydrase histochemistry of the nervous system: a new modification of the method of Hansson. Histochemistry 88: 485-487 (1988) IF: 2.143 21. Nógrádi, A., Mihály, A.: Distribution of carbonic anhydrase activity in the rat central nervous system, as revealed by a new semipermeable technique. Acta histochem. (Jena) 84: 153-162 (1988) IF: 0.472 22. Kuhnt, U., Mihály, A., Siklós, L., Joó, F.: Increased retention of calcium in the dendrites of long-term potentiated CA1 neurons of the hippocampal slice. A combined

3 electrophysiological and electron histochemical study. Histochemistry 90: 185-193 (1988) IF: 2.143 23. Ferencsik, M., Garay, K., Mihály, A., Csillik, B.: Cobalt-complex ATP enhanced regeneration in the dorsal horn of the rat spinal cord. Exp. Brain Res. 76: 409-416 (1989) IF: 2.227 24. Nógrádi, A., Király, E., Mihály, A.: Neuronal carbonic anhydrase activity in the central nervous system of the rat. Light and electron histochemical investigations of the islands of Calleja. Acta histochem. (Jena) 85: 187-193 (1989) IF: 0.472 25. Siklós, L., Kuhnt, U., Mihály, A., Joó, F.: Elevation of intracellular calcium content in hippocampus CA1 in vitro is not directly correlated with the development of LTP. Neurosci. Lett. 107: 99-104 (1989) IF: 2.703 26. Mihály, A., Joó, F., Szente, M.: Vasogenic brain edema in focal 4-aminopyridine seizures: the role of neuronal hyperactivity. J. Hirnforsch. 31: 77-86 (1990) 27. Mihály, A., Bencsik, K., Solymosi, T.: Naltrexone potentiates 4-aminopyridine seizures in the rat. J. Neural. Transmiss. Gen. Sect. 79: 59-67 (1990) IF: 1.382 28. Nógrádi, A., Mihály, A.: Light microscopic histochemistry of the postnatal development and localization of carbonic anhydrase activity in glial and neuronal cell types of the rat central nervous system. Histochemistry 94: 441-447 (1990) IF: 2.143 29. Mihály, A., Oláh, Z., Krug, M., Matthies, H., Rapp, U.R., Joó, F.: Transient increase of raf protein kinase-like immunoreactivity in the rat dentate gyrus during long-term potentiation. Neurosci. Lett. 116: 45-50 (1990) IF: 2.703 30. Mihály, A., Kuhnt, U., Siklós, L.: The dendro-somatic gradient of loosely bound calcium content in hippocampal neurones, as detected by means of ultrastructural histochemistry. Verh. Anat. Ges. 84 (Anat. Anz. Suppl. 168): 635-636 (1991) 31. Mihály, A., Erdö, S.L., Kuhnt, U.: Time-dependent loss of tissue GABA content and immunreactivity in hippocampal slices. Brain Res. Bull. 26: 559-564 (1991) IF: 1.811 32. Mihály, A., Orawecz, T., Oláh, Z., Rapp. U.R.: Immunohistochemical localization of raf protein kinase in dendritic spines and spine apparatuses of the rat cerebral cortex. Brain Res. 547: 309-314 (1991) IF: 2.859 33. Mihály, A., Kuhnt, U., Oláh, Z., Rapp, U.R.: Induction of raf-1 protein immunoreactivity in guinea pig hippocampal slices during the in vitro maintenance. Histochemistry 96: 99-105 (1991) IF: 2.143

4 34. Mihaly, A., Erdo, S. L., Kuhnt, U.: Time-dependent loss of tissue GABA content and immunoreactivity in the hippocampal slice preparation. Verh. Anat. Ges. (Anat. Anz. Suppl. 170): 643-644 (1991) 35. Mihály, A.: A celluláris raf onkogén szerepe az idegszövet plaszticitásában. (The role of the cellular raf oncogene in the plasticity of the nervous system). In Hungarian. Lege Artis Medicinae 1(17): 1196-1202 (1991) 36. Nógrádi, A., Mihály, A.: Expression and quantitative changes of carbonic anhydrase in developing neurones of rat central nervous system. Int. J. Devl. Neuroscience 9: 555-561 (1991) IF: 1.557 37. Mihály, A., Rapp, U.R.: Neuronal expression of the raf protooncogene in the spinal cord of adult guinea pigs. Acta histochem. (Jena) 94: 71-78 (1993) IF: 0.472 38. Mihály, A., Kuhnt, U., Krenacs, T.: The astrocytic localization of protein kinase C in the neocortex, hippocampus and in vitro hippocampal slices of the guinea pig. Neurobiology 1: 65-82 (1993) 39. Mihály, A., Rapp, U.R., Kuhnt, U.: Immunohistochemical detection of raf protein kinase in cerebral cortical areas of adult guinea pigs and rats. Brain Res. 627: 225-238 (1993) IF: 2.859 40. Mihály, A., Rapp, U.R.: Expression of the raf protooncogene in glial cells of the adult rat cerebral cortex. Acta histochem. (Jena) 96: 155-164 (1994) IF: 0.472 41. Mihály, A., Bencsik, K., Nográdi, A.: Pharmacological inhibition of brain carbonic anhydrase protects against 4-aminopyridine seizures. Acta Physiol. Hung. 82: 99-108 (1994) 42. Mihály, A.: Az in situ hibridizáció alkalmazása az alapkutatásban és a gyakorlati orvostudományban (The use of in situ hybridization in basic research and medical practice). In Hungarian. Lege Artis Medicinae 1995 4(11): 1002-1010. 43. Mihály, A., Priestley, J.V., Molnár, E.: Expression of raf serine/threonine protein kinases in the cell bodies of primary sensory neurons of the rat. Cell Tiss Res 285: 261-271 (1996) IF: 2.065 44. Mihály, A., Szente, M., Dubravcsik, Zs., Boda, B., Király, E., Nagy, T., Domonkos, A.: Parvalbumin and calbindin containing neurons express c-fos protein in primary and secondary (mirror) epileptic focuses of the rat neocortex. Brain Res. 761: 135-145 (1997) IF: 2.859 45. Mihály, A., Szente, M., Dobó, E., Pór, I.: Early activation of inhibitory neurons of the thalamic reticular nucleus during focal neocortical seizures. Acta histochem. 100: 383-393 (1998) IF: 0.867

5 46. Mihály, A., Shihab Eldeen, A., Owunwanne, A., Ayesha, A., Mathew, M: Acute 4 aminopyridine seizures increase regional cerebral blood flow in the thalamus and neocortex, but not in the allocortex of the mouse brain. Acta Physiol. Hung. 87: 43-52 (2000) 47. Komáromi, Á., Kovács, A., Telegdy, Gy., Mihály A.: Increased extracellular concentration of transmitter amino acids following 4-aminopyridine treatment in rat striatum. Neurobiology 9: 47-49 (2001) 48. Kovács, A., Komáromi, Á., Mihály, A., Telegdy, Gy., Hartai, Zs.: Striatal catecholamine release induced by 4-aminopyridine. Neurobiology 9: 51-54 (2001) 49. Mihály, A., Endrész, V.: Neuronal expression of Raf protooncogene in the brain stem of the adult guinea pig. Acta histochem. 102: 203-217 (2000) IF: 0.867 50. Dudás, B., Mihály, A., Merchenthaler, I.: Topography and associations of luteinizing hormone-releasing hormone- and neuropeptide-y-immunoreactive neuronal systems in the human diencephalon. J. Comp. Neurol. 427: 593-603 (2000) IF: 3.764 51. Knyihár-Csillik, E., Tajti, J., Csillik, A.E., Chadaide, Z., Mihály, A., Vécsei, L.: Effects of eletripan on the peptidergic innervation of the cerebral dura mater, the trigeminal ganglion and on the expression of c-fos and c-jun in the caudal trigeminal nucleus of the rat in an experimental migraine model. Eur. J. Neurosci. 12: 3991-4002 (2000) IF: 4.95 52. Dudás, B., Mihály, A., Hanin, I..: Ventral approach to stereotaxy of the guinea pig brain. J. Neurosci. Meth. 99: 79-83 (2000) IF: 3.126 53. Mihály, A., Szakács, R., Bohata, Cs., Dobó, E., Krisztin-Péva, B.: Time-dependent distribution and neuronal localization of c-fos protein in the rat hippocampus following 4- aminopyridine seizures. Epilepsy Research 44: 97-108 (2001) IF: 2.193 54. Szakács, R., Weiczner, R., Mihály, A., Zádor, Zs., Zádor, E., Krisztin-Péva, B.: NMDA receptor antagonist drugs moderate seizure-induced c-fos expression in the rat cerebral cortex. Brain Res. Bull. 59: 485-493 (2003) IF: 2.283 55. Csillik, B., Pálfi, Á., Gulya, K., Mihály, A., Knyihár-Csillik, E.: Somato-dendritic synapses in the nucleus reticularis thalami of the rat. Acta Biol. Acad. Sci. Hung. (2002) IF: 0.291 56. Farkas, I.G., Czigner, A., Farkas, E., Dobó, E., Soós, K., Penke, B., Endrész, V., Mihály, A.: Beta-amyloid peptide induced blood-brain barrier disruption facilitates T-cell entry into the rat brain. Acta histochem. 105: 115-125 (2003) IF: 0.867

6 57. Csillik, B., Janka, Z., Boncz, I., Kálmán, J., Mihály, A., Vécsei, L., Knyihár, E.: Molecular plasticity of primary nociceptice neurons: relations of the NGF-c-jun system to neurotomy and chronic pain. Annals Anat. 185: 303-314 (2003) IF: 0. 434 58. Kovács, A., Mihály, A., Komáromi, Á., Gyengési, E., Szente, M., Weiczner, R., Krisztin-Péva, B., Szabó, G., Telegdy, G.: Seizure, neurotransmitter release, and gene expression are closely related in the striatum of 4-aminopyridine-treated rats. Epilepsy Res. 55: 117-129 (2003) IF: 2.355 59. Csillik, B., Mihály, A., Knyihar-Csillik, E.: Cytochemical correlates of the sleep-wake interface: concerted expression of brain-derived nitric oxide synthase (bnos) and the nicotinic acetylcholine receptor (nachr) in a columnoid organization of the primate prefrontal cortex. Annals Anat. 186: 217-221 (2004) IF: 0.434 60. Czigner, A., Mihály, A., Farkas, O., Büki, A., Krisztin-Péva, B., Dobó, E., Barzó, P.: Dynamics and regional distribution of c-fos protein expression in rat brain after closed head injury. Clinical Neuroscience/ Ideggy. Szle. 56 (5-6): 187-202 (2003) 61. Mihály, A., Borbély, S., Világi, I., Détári, L., Weiczner, R., Zádor, Zs., Krisztin-Péva, B., Bagosi, A., Kopniczky, Zs., Zádor, E.: Neoocortical c-fos mrna transcription in repeated, brief acute seizures: is c-fos a coincidence detector? Internat. J. Mol. Medicine (2005) nyomdában IF: 2.063 62. Farkas, E., Institóris, Á., Domoki, F., Mihály, A., Luiten, P.G.M., Bari, F.: Diazoxide and dimethyl sulphoxide prevent brain damage imposed by experimental cerebral hypoperfusion. Brain Res. 1008: 250-258 (2004) IF: 2.859 63. Farkas, E., Donka, G., de Vos, R.A.I., Mihály, A., Bari, F., Luiten, P.G.M.: Experimental cerebral hypoperfusion imposes white matter injury and microglial activation in the rat brain. Acta Neuropathol. 108: 57-64 (2004) IF: 2.168 64. Vizi, S., Bagosi, A., Krisztin-Péva, B., Gulya, K., Mihály, A.: Repeated 4- aminopyridine seizures reduce parvalbumin content in the medial mammillary nucleus of the rat brain. Mol. Brain Res. 131: 110-118 (2004) IF: 2.6 65. Czigner, A., Mihály, A., Farkas, O., Büki, A., Krisztin-Péva, B., Dobó, E., Barzó, P.: Dynamics and regional distribution of c-fos protein expression in rat brain after a closed head injury. Internat. J. Mol. Med. 14: 247-252 (2004) IF: 2.063 66. Farkas, E., Annaházi, A., Institoris, Á., Mihály, A., Luiten, P.G.M., Bari, F.: Diazoxide and dimethyl sulphoxide alleviate experimental cerebral hypoperfusion-induced white matter injury in the rat brain. Neurosci. Lett. 373: 195-199 (2005) IF: 2.703 II. Folyóiratokban megjelent (idézheto) eloadás absztraktok

7 1. Mihály, A.: Visualization of calcium binding sites in the neocortex of the rat treated with 3-aminopyridine. Royal Microsc. Soc. 15: p 436 (1981) 2. Mihály, A., Jójárt, I.: Late increase of blood-brain barrier permeability in acute neocortical seizure focus: possible relations to human epilepsy. Neuroscience Suppl. 7: S 147 (1982) IF: 4.626 3. Joó, F., Kuhnt, U., Mihály, A.: Long-term potentiation (LTP): electron histochemical localization of free and bound Ca in the hippocampal slice. Neurosci.Lett. Suppl. 18: S 379 (1984) IF: 2.703 4. Mihály, A., Joó, F., Kuhnt, U.: Protein transport of neocortical blood vessels during experimental focal seizures in rats. Neurosci. Lett. Suppl. 22: S 92 (1985) IF: 2.703 5. Mihály, A., Kuhnt, U., Joó, F.: NMDA-receptor antagonists inhibit calcium retention in CA1 of the hippocampus during tetanic stimulation. Neurosci. Lett. Suppl. 26: S 534 (1986) IF: 2.703 6. Mihály, A., Bencsik, K., Solymosi, T.: Pharmacology of convulsions mediated by potassium channels: the role of benzodiazepine and opiate receptors. Neuroscience Suppl. 22: 1982 P (1987) IF: 4.626 7. Mihály, A.: Possible mechanisms of blood-brain barrier (BBB) breakdown in focal aminopyridine seizures. Epilepsia 1985, 26: 503. 7. Siklós, L., Joó, F., Kuhnt, U., Mihály, A.: Electron histochemical localization of calcium in long-term potentiated CA1 region of hippocampal slices: effect of NMDA antagonists. Neuroscience Suppl. 22: S 127 (1987) IF: 4.626 8. Siklós, L., Mihály, A., Kuhnt, U.: Oxalate-pyroantimonate technique reveals a dendrosomatic gradient of loosely bound calcium in hippocampal CA1 neurones. Eur. J. Neurosci. Suppl. 2: P 65 (1989) IF: 4.951 9. Mihály, A., Kuhnt, U., Oláh, Z.: Immunohistochemical localization of serine/threonine specific protein kinases in the hippocampus and hippocampal slices of guinea pig. In: Elsner, N., Roth, G. (eds) Brain-Perception Cognition: Proceedings of the 18th Göttingen Neurobiology Conference. Georg Thieme Verlag, Stuttgart-New York, p. 414 (1990) 10. Mihály, A., Kuhnt, U.: Astrocytic localization of protein kinase C in guinea pig hippocampal slices, in vitro. Verh. Anat. Ges. (Anat. Anz. Suppl. 174): P 33 (1992) 11. Mihály, A., Kuhnt, U., Rapp, U.R.: Expression of raf protooncogene in the hippocampus and hippocampal slices of the guinea pig. Eur. J. Neurosci. Suppl. 5: P 68 (1992) IF: 4.951

8 12. Wotherspoon, G., Castro-Lopes, J.M., Coimbra, A., Mihály, A., Rattray, M., Priestley, J.V.: Somatostatin and GAP-43 expression increase in the dorsal horn following unilateral inflammation of the rat hindlimb. Soc. Neurosci. Abstracts Vol. 20 (24th Annual Meeting) P116 (1994) 13. Mihály, A., Priestley, J.V., Rapp, U.R.: Expression of the raf protooncogene in the spinal cord and dorsal root ganglia of the rat and guinea pig. Neurobiology 1995, 3, p. 156. 14. Szente, M., Boda, B., Dubravcsik, Zs., Király, E., Mihály, A.: Induction of c-fos protein immunoreactivity in acute neocortical epileptic foci of the rat. Characterization of the activated neuronal population with double labelling. Neurobiology 1995, 3, p. 158. 15. Szakács, R., Czigner, A., Bohata, Cs., Mihály, A.: Time-dependent expression of c-fos protein in the rat forebrain following 4-aminopyridine seizures. Cephalalgia Hungarica 1999, 5, R-195. 16. Farkas, I., Dudas, B., Baranyi, L., Mihaly, A., Okada, H.: Expression of the complement C5a receptor in the neurons of the control and Alzheimer brain. Eur. J. Neurosci. 2000, 12 (suppl): 211. 17. Szakács, R., Bohata, C., Dobó, E., Mihály, A.: Distribution of c-fos-positive neurons in the rat hippocampus after 4-aminopyridine-induced seizures. Cytometry 2001, 46: 212. 17. Farkas, I., Mihály, A., Shihab-Eldeen, A., Owunwanne, A.: Akute 4-Aminopyridine- Krämpfe steigern die regionale Durchblutung im Thalamus und im Neokortex, aber nicht im Allokortex der Maus. Verh. Anat. Ges. Suppl. 183. Annals Anat., 2001. 18. Mihaly, A. Shihab-Eldeen, A., Gopinath, S., Matthew, M., Ayesha, A., Owunwanne, A.: Autoradiographic study of the effects of acute 4-aminopyridine (4-APY) seizures on the regional cerebral blood flow (rcbf) of the mouse brain. Eur. J. Nucl. Med. 1999, 26: PS 323. 19. Kopniczky, Zs., Dobó, E., Krisztin-Péva, B., Mihály, A.: Effect of surgical ablation of the entorhinal cortex on seizure-induced c-fos-protein immunoreactivity in the rat hippocampus and temporal association cortex. Neurobiology, 9:327-328, 2001 20. Mihály, A., Weiczner, R., Krisztin-Péva, B., Dobó, E., Szakács, R., Czigner, A., Zádor, Zs., Bakota, L., Tóth, G.: Seizure-dependent expression of c-fos in neurons of the rat hippocampus. Neurobiology, 9: 339-340, 2001 21. Csillik B., Pálfi Á., Gulya K., Mihály A., Knyihár- Csillik E.:Somato-dendritic synapses in the reticular nucleus of the rat thalamus. Neurobiology, 9: 289, 2001

9 22. Mihály A., Weiczner R., Krisztin-Péva B., Dobó E., Zádor Zs.: Seizure-dependent expression of c-fos in neurons of rat cerebral cortex. Ital. J. Anat. Embriol. 107. Suppl. 1: 15, 2002 23. Csillik B., Pálfi Á., Gulya K., Samsam, M., Mihály A., Vécsei L., Knyihár- Csillik, E.: Parvalbumin-immunoreactive large presynaptic complexes in the reticular thalamic nucleus if the rat. Acta Physiol. Hung. 89: 12, 2002 24. Czigner, A., Mihály, A., Farkas, O., Büki, A., Krisztin-Péva, B., Dobó, E., Barzó, P.: C-fos génexpresszió dinamikája zárt koponyasérülést követoen, patkányban. Clinical Neurosci./Ideggy. Szle. 56 (2) 2003 25. Czigner, A., Samsam, M., Pálfi, Á., Gulya, K., Mihály, A., Vécsei, L., Knyihár-Csillik, E., Csillik, B.: Large, calyciform presynaptic complexes in the reticular nucleus of the rat thalamus expressing parvalbumin immunoreactivity. Clinical Neurosci./Ideggy. Szle. 56 (2) 2003 26. Csillik, B., Mihály, A., Gulya, K., Samsam, M., Gulya, K.: Parvalbuminimmunoreactive calyciform presynaptic complexes in the thalamic reticular nucleus. Verh. Anat. Ges. 186 (Suppl): p40. 2004. III. Egyetemi jegyzetek 1. Csillik, B., Tóth, L., Mihály, A.: Neurohisztologiai alapismeretek. Egyetemi jegyzet, 1993. 2. Mihály, A.: Myology Notes. Handout for Medical Students. Egyetemi jegyzet, 1999. 3. Mihály, A.: Human Anatomy, Histology and Development. Handout for Pharmacy Students. Egyetemi jegyzet, 1998. 4. Mihály, A.: Citológia és citomorfológia orvostanhallgatók számára. Egyetemi jegyzet, 1999. 5. Tóth, L., Mihály, A., Csillik, B., Farkas, I.: Einleitung in die mikroskopische Neuroanatomie. Egyetemi jegyzet, Szeged, 2002. 6. Mihály, A.: Selected topics from anatomy. Egyetemi jegyzet orvostanhallgatóknak. Szeged, 2005. IV. Könyvfejezetek

10 1. Joó, F., Mihály, A., Temesvári, P., Dux, E.: Basic molecular events underlying transendothelial transport in brain capillaries. In: Go, K.G., Baethmann, A. (eds) Recent Progress in the Study and Therapy of Brain Edema. Plenum Press, New york, pp. 107-116 (1984) 2. Joó, F., Mihály, A., Párducz, A.: Visualization of the activated synapses with calcium inclusion technique. In: Jones, D.G. (ed) Current Topics in Reseach on Synapses. Alan R. Liss, Inc., New York, pp. 119-163 (1984) 3. Siklós, L., Kuhnt, U., Joó, F., Mihály, A.: Electron histochemical localization of calcium in CA1 of hippocampal slices following high frequency stimulation: effects of excitatory amino acid antagonists. In: Haas, H.L., Buzsaki, G. (eds) Synaptic Plasticity in the Hippocampus. Springer Verlag, pp. 49-52 (1988) 4. Mihály, A., Kuhnt, U., Ágoston, D.V.: Histochemistry of pre- and postsynaptic calcium accumulation in synaptosomes and hippocampal slices. In: Rahmann, H. (ed) Fundamentals of Memory Formation: Neural Plasticity and Brain Function. Progress in Zoology Vol. 37: 397-400 (1989) V. Könyv Mihály András: Az emberi test anatómiája, szövettana és fejlodése. APC Kiadó, 2003. Putz, R., Pabst, R.: Sobotta. Az ember anatómiájának atlasza. I., II. Kötet. 2004. A fordítást lektorálta: Dr. Mihály András. VI. Kongresszusi- és felkért eloadások, amelyek nem jelentek meg nyomtatásban A Magyar Élettani Társaság Vándorgyulései: 1981. Budapest 1. Mihály, A., Jójárt, I., Joó, F.: A vér-agy gát permeabilitás változása akut neocorticalis görcsfókuszban. Poster 2. Ágoston, D., Mihály, A.: A 4-aminopyridin synaptosomákra gyakorolt in vitro hatásainak morfológiai elemzése. Poster 1986. Keszthely 3. Mihály, A., Bencsik, K.: A diazepam és a 4-aminopyridin antagonizmusa patkány görcsmodellben. Poster

11 1988. Szeged 4. Nógrádi, A., Király, E., Mihály, A.: Szénsavanhidráz hisztokémiai kimutatása a tuberculum olfactorium neuronjaiban. Poster 1995. Budapest 5. Dubravcsik, Zs., Szente, M., Mihály, A., Nagy, T.: A transzkripciót szabályozó c-fos protein neuronális expressziója akut epilepsziás görcsök során patkány agykéregben. Poster A Magyar Idegtudományi Társaság (MITT) Vándorgyulései: 6. Mihály, A.: Szerkezeti változások az agykéregben görcskeltok hatására. 1983. 7. Mihály, A.: Neuronális raf-kináz eloszlásának térképezése tengerimalac központi idegrendszerében. 1992. A MAHET Szegedi Kongresszusa, 1986: 8. Baráth, B., Mihály, A.: Hippocampal ultrastructure in systemic 4-aminopyridine seizures. 9. Bencsik, K., Mihály, A.: Morphometric analysis of neuronal changes in 4-aminopyridine seizures. 10. Mihály, A.: Ultrastructural changes of neocortical synapses in focal 3-aminopyridine seizures. 11. Mihály, A., Kuhnt, U., Siklós, L., Joó, F.: Electron histochemical localization of calcium in guinea pig hippocampal slices following high-frequency stimulation. Az Anatomische Gesellschaft Kongresszusai: 12. Mihály, A., Király, E., Bencsik, K..: The semipermeable membrane technique in carbonic anhydrase histochemistry: a new modification of the method of Hansson. Leipzig, 1987. 13. Nógrádi, A., Mihály, A.: Histochemical mapping of carbonic anhydrase (CA) activity in the central nervous system of the rat. Leipzig, 1987. 14. Mihály, A.: Immunohistochemical localization of raf protein kinase in dendritic spine apparatuses of the rat cerebral cortex. Szeged, 1991. 15. I. Farkas, A. Mihály, A. Shihab-Eldeen, A. Owunawanne : Akute 4- Aminopyridine- Krämpfe steigern die regionale Durchblutung im Thalamus und im Neokortex, aber nicht im Allokortex der Maus. Münster, 2001. 16. I. Farkas, A. Czigner, E. Dobó, V. Endrész, L. Krenács, A. Mihály : Aktivierte, nicht encephalitogene T- Lymphozyten gelangen ins Gehirngewebe nacht der schädigung der Blut-Gehirn Schranke bei der Ratte. Halle, 2002. 17. I. G. Farkas, E. Farkas, A. Czigner, E. Dobó, V. Endrész, A. Mihály: Intracarotid injection of TNFa produces swelling of perivascular astrocytic end-feet and enhances T- lymphocyte entry into the brain of rat. Dresden, 2003.

12 Egyéb eloadások, posterek: 18. Mihály, A., Kuhnt, U., Siklós, L.: Difference of dendritic and cell body calcium content as detected by ultrastructural histochemistry in hippocampal neurones. 17. Göttinger Neurobiologentagung, 1998. 19. Mihály, A.: Immunohistochemical localization of PKC and raf-kinase in the hippocampus. Akademie der Wissenscahften, Institut für Hirnforschung, Magdeburg, 1990. Eloadás. 20. Mihály, A., Krug, M., Oláh, Z., Rapp, U.R.: Transient increase of raf-protein-kinaselike immunoreactivity in the dentate gyrus during long-term potentiation. Neural Mechanisms of Learning and Memory. European Science Foundation Conference, London, 1990. 21. Mihály, A., Rapp, U.R.: Expression of the raf protooncogenes in the brain stem and spinal cord of the guinea pig. XXXIV. Symposium of the International Association of Histochemists, Munich, 1992. 22. Mihály, A.: Expression of the raf protooncogene in the neocortex of rats and cats. Ultrastructural studies. Structural and Functional Organization of the Neocortex. In Memoriam Otto D. Creutzfeldt. Göttingen, 1993. 23. Mihály, A., Dubravcsik, Zs.: A protoonkogének idegrendszeri lokalizációja. Elso Szent-Györgyi Napok, SZOTE, Szeged, 1994. 24. Mihály, A.: Protein kinázok intracelluláris eloszlása központi idegrendszeri neuronokban. SZOTE Tudományos Ülései, Szeged, 1992. 25. Mihály, A.: Long-term potentiation elektronhisztokémiai vizsgálata hippocampus szeleten, in vitro. Cserháti István Emlékkonferencia, Szeged, 1988. 26. Mihály, A., Bencsik, K.: Az ammónia neurotoxikus hatásának szerepe központi idegrendszeri görcsökben, patkányon. XVIII. Membrán Transzport Konferencia, Sümeg, 1988. 27. Mihály, A., Kuhnt, U., Joó, F.: A kalcium elektronhisztokémiai lokalizálása ingerelt hippocampus szeletben. SZOTE Tudományos Ülései, Dr. Csillik Bertalan 15 éves tanári muködése alkalmából. 1988. 28. Mihály, A.: A gége anatómiája és fejlodése. Továbbképzo eloadás anesthesiologusoknak, Szeged, 2000. 29. Mihály, A.: A nervus facialis anatómiája. Továbbképzo eloadás fül-orr-gégész szakorvosoknak, Szeged, 2000. 30. Mihály, A.: A gége anatómiája és szövettana. Továbbképzo eloadás gégemikrosebészeti kurzuson, Szeged, 2001. 31. Mihály András: Neuronhálózatok fokozatos aktiválódása eloagyi konvulziókban. SZAB Orvostudományi Szakbizottsága Ülései, 2001. május 8. Szeged. 32. Szakács, R., Mihály, A., Janka, Z.: A hippocampus organizációjának neuropatológiai és pszichiátriai aspektusai. SZTE Pszichiátriai Klinika Továbbképzo Eloadásai, 2002. április 10., Szeged 33. Farkas E., Farkas I., Tóth- Szuki V., Mihály A., Bari F.: Circulating TNFa increases cerebrocortical perfusion and imposes BBB damage. BBB 2003, Sixth Symposium on Signal Transduction in the Blood-Brain Barriers, 18-21, Sept. 2003, Szeged

13 34. Czigner A., Mihály A., Farkas O., Büki A., Krisztin-Péva B., Dobó E., Barzó P.: Dynamics of immediate early gene (IEG) expression in the rat brain after closed head injury. 2 nd Pannonian Symposium on CNS Injury, May 8-10, 2003, Szeged 35. Czigner A., Mihály A., Farkas O., Büki A., Krisztin-Péva B., Dobó E., BarzóP.: Dynamics of immediate early gene (IEG) expression ( c-fos protein) in rat brain after closed head injury. 12 th European Congress of Neurosurgery, 7-12 Sept. 2003, Lisboa, Portugal 36. Czigner A., Mihály A., Farkas O., Büki A., Krisztin-Péva B., Dobó E., Barzó P.: Cellular immune response following closed head injury T-cell and microglial activation. 12 th European Congress of Neurosurgery, 7-12 Sept. 2003, Lisboa, Portugal 37. Farkas, E., De Vos, R.A.I., Donka, G., Mihály, A., Luiten, P.G.M.: Histopathologic changes in the cerebral white matter in aging and dementia. First Congress of International Society for Vascular Bahavioural and Cognitive Disorders. Göteborg, Sweden, 2003. 38. Mihály, A., Kovács, A., Komáromi, Á., Gyengési, E., Szente, M., Weiczner, R., Krisztin-Péva, B., Szabó, Gy., Telegdy, Gy.: Seizure, neurotransmitter release and gene expression are closely related in the striatum of 4-aminopyridine treated rats. IBRO International Workshop on Neuronal Circuits. Budapest, 2004. 39. Mihály, A.: Animal models of epilepsy: neuropathological and clinical relavances. Bristol Neuroscience Seminars, 2004. szept. 13., University of Bristol, UK.