|
|
- Renáta Bodnárné
- 8 évvel ezelőtt
- Látták:
Átírás
1
2 2 / :52 6. Mócsai A, Kovács L, Gergely P What is the future of targeted therapy in rheumatology: biologics or small molecules? BMC MEDICINE 12: p. Article Number: UNSP p. (2014) IF: 7.276* Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 1 Összesen: 1 1 Selmi C, Shoenfeld Y Open questions in autoimmunity: Discussions from the 2013 Controversies in Rheumatology and Autoimmunity Meeting BMC Medicine (ISSN: ) 12: (1) Paper 50. (2014) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 7. Schwab L, Goroncy L, Palaniyandi S, Gautam S, Triantafyllopoulou A, Mócsai A, Reichardt W, Karlsson FJ, Radhakrishnan SV, Hanke K, Schmitt-Graeff A, Freudenberg M, von Loewenich F, Wolf P, Leonhardt F, Baxan N, Pfeifer D, Schmah O, Schönle A, Martin SF, Mertelsmann R, Duyster J, Finke J, Prinz M, Henneke P, Häcker H, Hildebrandt GC, Häcker G, Zeiser R Neutrophil granulocytes recruited upon translocation of intestinal commensal bacteria enhance graft-versus-host disease via local tissue damage. NATURE MEDICINE 20:(6) pp (2014) IF: * Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 2 Függő idéző: 1 Összesen: 3 1 Kugelberg E Neutrophils: Bugging transplantation Nat. Rev. Immunol. (ISSN: ) 14: (7) p (2014) Folyóiratcikk /Hozzászólás, helyreigazítás /Tudományos [ ] 2 Filippini P, Rutella S Recent advances on cellular therapies and immune modulators for graft-versus-host disease EXPERT REVIEW OF CLINICAL IMMUNOLOGY (ISSN: X) 10: (10) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 3 * Stickel N, Zeiser R The role of micrornas for immunoregulation after allogeneic hematopoietic cell transplantation DEUTSCHE MEDIZINISCHE WOCHENSCHRIFT (ISSN: ) 139: (33) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 8. Csolle C, Ando RD, Kittel A, Goloncser F, Baranyi M, Soproni K, Zelena D, Haller J, Nemeth T, Mocsai A, Sperlagh B The absence of P2X7 receptors (P2rx7) on non-haematopoietic cells leads to selective alteration in mood-related behaviour with dysregulated gene expression and stress reactivity in mice INTERNATIONAL JOURNAL OF NEUROPSYCHOPHARMACOLOGY 16:(1) pp (2013) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] Csolle C és Ando R megosztott első szerző a közleményben [ Hitelesített ] Független idéző: 7 Függő idéző: 2 Összesen: Volonte C, Apolloni S, Skaper SD, Burnstock G P2X7 Receptors: Channels, Pores and More CNS AND NEUROLOGICAL DISORDERS. DRUG TARGETS (ISSN: ) 11: (6) pp (2012) Folyóiratcikk [ ] 2 * Csölle C, Baranyi M, Zsilla G, Kittel Á, Gölöncsér F, Illes P, Papp E, Vizi ES, Sperlágh B Neurochemical Changes in the Mouse Hippocampus Underlying the Antidepressant Effect of Genetic Deletion of P2X7 Receptors PLoS ONE 8: (6) Paper e (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Bhattacharya A, Wang Q, Ao H, Shoblock JR, Lord B, Aluisio L, Fraser I, Nepomuceno D, Neff RA, Welty N, Lovenberg TW, Bonaventure P, Wickenden AD, Letavic MA Pharmacological characterization of a novel centrally permeable P2X7 receptor antagonist: JNJ British Journal of Pharmacology 170: (3) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 Letavic MA, Lord B, Bischoff F, Hawryluk NA, Pieters S, Rech JC, Sales Z, Velter AI, Ao H, Bonaventure P, Contreras V, Jiang XH, Morton KL, Scott B, Wang Q, Wickenden AD, Carruthers NI, Bhattacharya A Synthesis and Pharmacological Characterization of Two Novel, Brain Penetrating P2X(7) Antagonists ACS MEDICINAL CHEMISTRY LETTERS (ISSN: ) 4: (4) pp (2013) Folyóiratcikk [ ] 5 Ma M, Ren Q, Zhang J-C, Hashimoto K Effects of brilliant blue G on serum tumor necrosis factor-α levels and depression-like behavior in mice after lipopolysaccharide administration Clinical Psychopharmacology and Neuroscience (ISSN: ) 12: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Chrovian CC, Rech JC, Bhattacharya A, Letavic MA P2X7 Antagonists as potential therapeutic agents for the treatment of CNS disorders Progress in Medicinal Chemistry (ISSN: ) 53: pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ]
3 3 / :52 7 * Sperlágh B, Illes P P2X7 receptor: An emerging target in central nervous system diseases Trends Pharmacol. Sci. (ISSN: ) 35: (10) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 8 Lord B, Aluisio L, Shoblock JR, Neff RA, Varlinskaya EI, Ceusters M, Lovenberg TW, Carruthers N, Bonaventure P, Letavic MA, Deak T, Drinkenburg W, Bhattacharya A Pharmacology of a novel central nervous system-penetrant P2X7 antagonist JNJ J. Pharmacol. Exp. Ther. (ISSN: ) 351: (3) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Carhuatanta KAK, Shea CJA, Herman JP, Jankord R Unique genetic loci identified for emotional behavior in control and chronic stress conditions Front. Behav. Neurosci. (ISSN: ) 8: (OCT) Paper 341. (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 9. Futosi K, Fodor S, Mócsai A Reprint of Neutrophil cell surface receptors and their intracellular signal transduction pathways INTERNATIONAL IMMUNOPHARMACOLOGY 17:(4) pp (2013) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 4 Összesen: 4 1 Talbott H, Delaney A, Zhang P, Yu Y, Cushman RA, Cupp AS, Hou X, Davis JS Effects of IL8 and immune cells on the regulation of luteal progesterone secretion Reproduction (ISSN: ) 148: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Taglieri DM, Ushio-Fukai M, Monasky MM P21-activated kinase in inflammatory and cardiovascular disease CELLULAR SIGNALLING (ISSN: ) 26: (9) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 3 Linnartz-Gerlach B, Kopatz J, Neumann H Siglec functions of microglia Glycobiology (ISSN: ) 24: (9) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 4 Lojek A, Denev P, Ciz M, Vasicek O, Kratchanova M The effects of biologically active substances in medicinal plants on the metabolic activity of neutrophils Phytochem. Rev. (ISSN: X) 13: (2) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 10. Gambardella L, Anderson KE, Jakus Z, Kovács M, Voigt S, Hawkins PT, Stephens L, Mócsai A, Vermeren S Phosphoinositide 3-OH kinase regulates integrin-dependent processes in neutrophils by signaling through its effector ARAP3 JOURNAL OF IMMUNOLOGY 190:(1) pp (2013) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Hitelesített ] Független idéző: 2 Függő idéző: 1 Összesen: 3 1 * Gambardella L, Vermeren S Molecular players in neutrophil chemotaxis-focus on PI3K and small GTPases Journal of Leukocyte Biology 94: (4) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 2 Kim D, Haynes CL The role of p38 MAPK in neutrophil functions: Single cell chemotaxis and surface marker expression Analyst 138: (22) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Perike S, Özkucur N, Sharma P, Staroske W, Bläsche R, Barth K, Funk RHW Phospho-NHE3 forms membrane patches and interacts with beta-actin to sense and maintain constant direction during cell migration Experimental Cell Research (ISSN: ) 324: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 11. Gomez-Puerta JA, Mócsai A Tyrosine kinase inhibitors for the treatment of rheumatoid arthritis CURRENT TOPICS IN MEDICINAL CHEMISTRY 13:(6) pp (2013) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Hitelesített ] Független idéző: 3 Összesen: 3 1 Zhang Z, Chu S-F, Chen N-H Biological functions and drug development of Pyk2 ZHONGGUO YAOLIXUE TONGBAO (ISSN: ) 30: (6) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 2 Lundquist LM, Cole SW, Sikes ML Efficacy and safety of tofacitinib for treatment of rheumatoid arthritis WORLD JOURNAL OF ORTHOPEDICS (ISSN: ) 5: (4) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ]
4 4 / :52 3 Malemud CJ, Blumenthal DE Protein kinase small molecule inhibitors for rheumatoid arthritis: Medicinal chemistry/clinical perspectives WORLD JOURNAL OF ORTHOPEDICS (ISSN: ) 5: (4) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 12. Krisztina Futosi, Szabina Fodor, Attila Mócsai Neutrophil cell surface receptors and their intracellular signal transduction pathways INTERNATIONAL IMMUNOPHARMACOLOGY 17:(3) pp (2013) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Hitelesített ] Független idéző: 7 Összesen: 7 1 Chen C-Y, Liaw C-C, Chen Y-H, Chang W-Y, Chung P-J, Hwang T-L A novel immunomodulatory effect of ugonin U in human neutrophils via stimulation of phospholipase C Free Radical Biology and Medicine (ISSN: ) 72: pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Heger M, Van Golen RF, Broekgaarden M, Van Den Bos RR, Neumann HAM, Van Gulik TM, Van Gemert MJC Endovascular laser-tissue interactions and biological responses in relation to endovenous laser therapy Lasers in Medical Science (ISSN: X) 29: (2) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 3 Santos EOL, Kabeya LM, Figueiredo-Rinhel ASG, Marchi LF, Andrade MF, Piatesi F, Paoliello-Paschoalato AB, Azzolini AECS, Lucisano-Valim YM Flavonols modulate the effector functions of healthy individuals' immune complex-stimulated neutrophils: A therapeutic perspective for rheumatoid arthritis International Immunopharmacology (ISSN: ) 21: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 Paoliello-Paschoalato AB, Azzolini AECS, Cruz MFC, Marchi LF, Kabeya LM, Donadi EA, Lucisano-Valim YM Isolation of healthy individuals' and rheumatoid arthritis patients' peripheral blood neutrophils by the gelatin and Ficoll-Hypaque methods: Comparative efficiency and impact on the neutrophil oxidative metabolism and Fcγ receptor expression J. Immunol. Methods (ISSN: ) 412: pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Shepardson KM, Jhingran A, Caffrey A, Obar JJ, Suratt BT, Berwin BL, Hohl TM, Cramer RA Myeloid Derived Hypoxia Inducible Factor 1-alpha Is Required for Protection against Pulmonary Aspergillus fumigatus Infection PLOS PATHOGENS (ISSN: ) 10: (9) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Stacey MA, Marsden M, Pham N TA, Clare S, Dolton G, Stack G, Jones E, Klenerman P, Gallimore AM, Taylor PR, Snelgrove RJ, Lawley TD, Dougan G, Benedict CA, Jones SA, Wilkinson GWG, Humphreys IR Neutrophils recruited by IL-22 in peripheral tissues function as TRAIL-dependent antiviral effectors against MCMV Cell Host and Microbe (ISSN: ) 15: (4) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 7 Gazendam RP, Van Hamme JL, Tool ATJ, Van Houdt M, Verkuijlen PJJH, Herbst M, Liese JG, Van De Veerdonk FL, Roos D, Van Den Berg TK, Kuijpers TW Two independent killing mechanisms of Candida albicans by human neutrophils: Evidence from innate immunity defects Blood (ISSN: ) 124: (4) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 13. Mocsai A Diverse novel functions of neutrophils in immunity, inflammation and beyond. JOURNAL OF EXPERIMENTAL MEDICINE 210:(7) pp (2013) IF: Nyelv: Angol Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] [ Hitelesített ] Független idéző: 24 Függő idéző: 2 Összesen: 26 1 * Futosi K, Fodor S, Mócsai A Neutrophil cell surface receptors and their intracellular signal transduction pathways International Immunopharmacology 17: (3) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 * Futosi K, Fodor S, Mócsai A Reprint of Neutrophil cell surface receptors and their intracellular signal transduction pathways International Immunopharmacology (ISSN: ) 17: (4) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Tibrewal S, Sarkar J, Jassim SH, Gandhi S, Sonawane S, Chaudhary S, Byun Y-S, Ivanir Y, Hallak J, Horner JH, Newcomb M, Jain S Tear fluid extracellular dna: Diagnostic and therapeutic implications in dry eye disease Investigative Ophthalmology and Visual Science 54: (13) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 Price PJR, Luckow B, Torres-Domínguez LE, Brandmüller C, Zorn J, Kirschning CJ, Sutter G, Lehmann MH Chemokine (C-C Motif) receptor 1 is required for efficient recruitment of neutrophils during respiratory infection with modified vaccinia virus Ankara JOURNAL OF VIROLOGY (ISSN: X) 88: (18) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Tseng CW, Liu GY Expanding roles of neutrophils in aging hosts Current Opinion in Immunology (ISSN: ) 29: (1) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 6 Dutra FF, Bozza MT Heme on innate immunity and inflammation FRONTIERS IN PHARMACOLOGY (ISSN: ) 5 MAY: Paper 115. (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ]
5 5 / :52 7 Allaeys I, Gymninova I, Canet-Jourdan C, Poubelle PE IL-32γ delays spontaneous apoptosis of human neutrophils through MCL-1, regulated primarily by the P38 MAPK pathway PLoS ONE (ISSN: ) 9: (10) Paper e (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Wang W, Jian Z, Guo J, Ning X Increased levels of serum myeloperoxidase in patients with active rheumatoid arthritis Life Sci. (ISSN: ) 117: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Mori DN, Kreisel D, Fullerton JN, Gilroy DW, Goldstein DR Inflammatory triggers of acute rejection of organ allografts Immunological Reviews (ISSN: ) 258: (1) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 10 Urbaczek AC, Toller-Kawahisa JE, Fonseca LM, Costa PI, Faria CMQG, Azzolini AECS, Lucisano-Valim YM, Marzocchi-Machado CM Influence of FcγRIIIb polymorphism on its ability to cooperate with FcγRIIa and CR3 in mediating the oxidative burst of human neutrophils HUMAN IMMUNOLOGY (ISSN: ) 75: (8) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 Casanova-Acebes M, A-González N, Weiss LA, Hidalgo A Innate immune cells as homeostatic regulators of the hematopoietic niche INTERNATIONAL JOURNAL OF HEMATOLOGY (ISSN: ) 99: (6) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 12 Diana J, Lehuen A Macrophages and β-cells are responsible for CXCR2-mediated neutrophil infiltration of the pancreas during autoimmune diabetes EMBO MOLECULAR MEDICINE (ISSN: ) 6: (8) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 13 Jones CM, Baker-Groberg SM, Cianchetti FA, Glynn JJ, Healy LD, Lam WY, Nelson JW, Parrish DC, Phillips KG, Scott-Drechsel DE, Tagge IJ, Zelaya JE, Hinds MT, McCarty OJT Measurement science in the circulatory system Cellular and Molecular Bioengineering (ISSN: ) 7: (1) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 14 Davey MS, Morgan MP, Liuzzi AR, Tyler CJ, Khan MWA, Szakmany T, Hall JE, Moser B, Eberl M Microbe-specific unconventional t cells induce human neutrophil differentiation into antigen cross-presenting cells JOURNAL OF IMMUNOLOGY (ISSN: ) 193: (7) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 15 Demers M, Wagner DD NETosis: A new factor in tumor progression and cancer-associated thrombosis Seminars in Thrombosis and Hemostasis (ISSN: ) 40: (3) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 16 Thobakgale CF, Ndung'U T Neutrophil counts in persons of African origin Current Opinion in Hematology 21: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 17 Baluk P, Phillips K, Yao L-C, Adams A, Nitschké M, McDonald DM Neutrophil dependence of vascular remodeling after Mycoplasma infection of mouse airways American Journal of Pathology (ISSN: ) 184: (6) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 18 Battaglia M Neutrophils and type 1 autoimmune diabetes Current Opinion in Hematology 21: (1) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 19 Fulop T, Witkowski JM, Pawelec G, Alan C, Larbi A On the immunological theory of aging INTERDISCIPLINARY TOPICS IN GERONTOLOGY (ISSN: ) 39: pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 20 Michel J-B, Martin-Ventura JL, Nicoletti A, Ho-Tin-Noé B Pathology of human plaque vulnerability: Mechanisms and consequences of intraplaque haemorrhages Atherosclerosis (ISSN: ) 234: (2) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 21 Jo J, Garssen J, Knippels L, Sandalova E Role of cellular immunity in cow's milk allergy: Pathogenesis, tolerance induction, and beyond MEDIATORS OF INFLAMMATION (ISSN: ) 2014: Paper (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 22 Mackiewicz-Wysocka M, Araszkiewicz A, Wierusz-Wysocka B Skin dysfunction in diabetes. Part 1 - Function of skin cells Dia. Kli. (ISSN: ) 3: (3) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 23 Scapini P, Cassatella MA Social networking of human neutrophils within the immune system Blood (ISSN: ) 124: (5) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 24 Bardoel BW, Kenny EF, Sollberger G, Zychlinsky A The balancing act of neutrophils Cell Host and Microbe (ISSN: ) 15: (5) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 25 Gunzer M Traps and hyper inflammation - new ways that neutrophils promote or hinder survival British Journal of Haematology (ISSN: ) 164: (2) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 26 Kalyan S, Kabelitz D When neutrophils meet T cells: Beginnings of a tumultuous relationship with underappreciated potential Eur. J. Immunol. (ISSN: ) 44: (3) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ]
6 6 / : Borbely G, Huszar M, Varga A, Futosi K, Mocsai A, Orfi L, Idei M, Mandl J, Keri G, Vantus T Optimization of Important Early ADME(T) Parameters of NADPH Oxidase-4 Inhibitor Molecules MEDICINAL CHEMISTRY 8:(2) pp (2012) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 1 Összesen: 1 1 Kofler PA, Pircher H, Von Grafenstein S, Diener T, Höll M, Liedl KR, Siems K, Jansen-Dürr P Characterisation of Nox4 Inhibitors from Edible Plants Planta Medica 79: (3-4) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 15. Futosi K, Nemeth T, Pick R, Vantus T, Walzog B, Mocsai A Dasatinib inhibits pro-inflammatory functions of mature human neutrophils. BLOOD 119:(21) pp (2012) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 7 Függő idéző: 4 Összesen: 11 1 Zarbock A The shady side of dasatinib Blood 119: (21) pp (2012) Folyóiratcikk /Rövid közlemény /Tudományos [ ] 2 Oriana C, Martin H, Toby P, Chris C, Ruth G, Claudius R, Rod T Complete cytogenetic response and major molecular response as surrogate outcomes for overall survival in first-line treatment of chronic myelogenous leukemia: A case study for technology appraisal on the basis of surrogate outcomes evidence Value in Health 16: (6) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Baccarani M, Deininger MW, Rosti G, Hochhaus A, Soverini S, Apperley JF, Cervantes F, Clark RE, Cortes JE, Guilhot F, Hjorth-Hansen H, Hughes TP, Kantarjian HM, Kim D-W, Larson RA, Lipton JH, Mahon F-X, Martinelli G, Mayer J, Müller MC, Niederwieser D, Pane F, Radich JP, Rousselot P, Saglio G, Saußele S, Schiffer C, Silver R, Simonsson B, Steegmann J-L, Goldman JM, Hehlmann R European LeukemiaNet recommendations for the management of chronic myeloid leukemia: 2013 Blood 122: (6) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 4 * Futosi K, Fodor S, Mócsai A Neutrophil cell surface receptors and their intracellular signal transduction pathways International Immunopharmacology 17: (3) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 * Futosi K, Fodor S, Mócsai A Reprint of Neutrophil cell surface receptors and their intracellular signal transduction pathways International Immunopharmacology (ISSN: ) 17: (4) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Rozovski U, Keating MJ, Estrov Z Targeting inflammatory pathways in chronic lymphocytic leukemia Critical Reviews in Oncology/Hematology 88: (3) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 7 Baccarani M, Castagnetti F, Gugliotta G, Palandri F, Rosti G Definition and treatment of resistance to tyrosine kinase inhibitors in chronic myeloid leukemia Expert Review of Hematology (ISSN: ) 7: (3) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 8 * Jani PK, Kajdácsi E, Megyeri M, Dobó J, Doleschall Z, Futosi K, Tímár CI, Mócsai A, Makó V, Gál P, Cervenak L MASP-1 induces a unique cytokine pattern in endothelial cells: A novel link between complement system and neutrophil granulocytes PLoS ONE (ISSN: ) 9: (1) Paper e (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Buchner M, Müschen M Targeting the B-cell receptor signaling pathway in B lymphoid malignancies Current Opinion in Hematology (ISSN: ) 21: (4) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 10 * Kovacs M, Nemeth T, Jakus Z, Sitaru C, Simon E, Futosi K, Botz B, Helyes Z, Lowell CA, Mocsai A The Src family kinases Hck, Fgr, and Lyn are critical for the generation of the in vivo inflammatory environment without a direct role in leukocyte recruitment JOURNAL OF EXPERIMENTAL MEDICINE (ISSN: ) 211: (10) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 Baccarani M, Castagnetti F, Gugliotta G, Palandri F, Rosti G Treatment recommendations for chronic myeloid leukemia Mediterranean Journal of Hematology and Infectious Diseases (ISSN: ) 6: (1) Paper e (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 16. Kertesz Z, Gyori D, Kormendi S, Fekete T, Kis-Toth K, Jakus Z, Schett G, Rajnavolgyi E, Dobo-Nagy C, Mocsai A Phospholipase Cγ2 is required for basal but not oestrogen deficiency-induced bone resorption EUROPEAN JOURNAL OF CLINICAL INVESTIGATION 42:(1) pp (2012) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 5 Függő idéző: 3 Összesen: 8 1 Lo Vasco VR, Leopizzi M, Chiappetta C, Puggioni C, Di Cristofano C, Della Rocca C
7 7 / :52 Expression of Phosphoinositide-specific phospholipase C enzymes in human osteosarcoma cell lines Journal of Cell Communication and Signaling 7: (2) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Mebarek S, Abousalham A, Magne D, Do LD, Bandorowicz-Pikula J, Pikula S, Buchet R Phospholipases of mineralization competent cells and matrix vesicles: Roles in physiological and pathological mineralizations International Journal of Molecular Sciences 14: (3) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 3 Lo Vasco VR, Leopizzi M, Puggioni C, Della Rocca C Ezrin silencing remodulates the expression of Phosphoinositide-specific Phospholipase C enzymes in human osteosarcoma cell lines J. Cell Commun. Signal. (ISSN: ) 8: (3) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 Kim J-Y, Cheon Y-H, Oh HM, Rho MC, Erkhembaatar M, Kim MS, Lee CH, Kim JJ, Choi MK, Yoon K-H, Lee MS, Oh J Oleanolic acid acetate inhibits osteoclast differentiation by downregulating PLCγ2-Ca2+-NFATc1 signaling, and suppresses bone loss in mice Bone 60: pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 * Dullaart RPF, Al-Daghri NM, Ashina M, Bouzas-Mosquera A, Brunetti ND, Buechler C, Chen HS, Corrales JJ, D'Archivio M, Cas AD, Pino GG, Gomez-Abril SA, Gyori D, Haslacher H, Herder C, Kerstens MN, Koutsilieris M, Lombardi C, Lupattelli G, Mocsai A, Msaouel P, Orfao A, Ormazabal P, Pacher R, Perkmann T, Peteiro J, Plischke M, Reynaert NL, Ricci MA, Robles NR, Rocha M, Rutten EPA, Sabico S, Santamaria F, Santoro F, Schmid A, Schmidt M, Schytz HW, Shyu KG, Tada H, Thorand B, Valerio G, Vesely DL, Wu TE, Yamagishi M, Yeh YT Research update for articles published in EJCI in 2012 EUROPEAN JOURNAL OF CLINICAL INVESTIGATION (ISSN: ) 44: (10) pp (2014) Folyóiratcikk /Sokszerzős vagy csoportos szerzőségű közlemény /Tudományos [ ] 6 Lo Vasco VR, Leopizzi M, Stoppoloni D, Della Rocca C Silencing of Phosphoinositide-specific Phospholipase C epsilon Remodulates the Expression of the Phosphoinositide Signal Transduction Pathway in Human Osteosarcoma Cell Lines ANTICANCER RESEARCH (ISSN: ) 34: (8) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 7 * Györi D, Csete D, Benkö S, Kulkarni S, Mandl P, Dobõ-Nagy C, Vanhaesebroeck B, Stephens L, Hawkins PT, Mõcsai A The phosphoinositide 3-kinase isoform pi3kβ regulates osteoclast-mediated bone resorption in humans and mice ARTHRITIS AND RHEUMATOLOGY (HOBOKEN) (ISSN: ) 66: (8) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 * Kova cs M, Ne meth T, Jakus Z, Sitaru C, Simon E, Futosi K, Botz B, Helyes Z, Lowell CA, Mo csai A The Src family kinases Hck, Fgr, and Lyn are critical for the generation of the in vivo inflammatory environment without a direct role in leukocyte recruitment JOURNAL OF EXPERIMENTAL MEDICINE (ISSN: ) 211: (10) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 17. Nemeth T, Mocsai A The role of neutrophils in autoimmune diseases. IMMUNOLOGY LETTERS 143:(1) pp (2012) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 39 Függő idéző: 4 Összesen: 43 1 * Futosi K, Németh T, Pick R, Vántus T, Walzog B, Mócsai A Dasatinib inhibits proinflammatory functions of mature human neutrophils Blood 119: (21) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Zhou L, Somasundaram R, Nederhof RF, Dijkstra G, Faber KN, Peppelenbosch MP, Fuhler GM Impact of human granulocyte and monocyte isolation procedures on functional studies Clinical and Vaccine Immunology 19: (7) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Sackmann EK, Berthier E, Young EWK, Shelef MA, Wernimont SA, Huttenlocher A, Beebe DJ Microfluidic kit-on-a-lid: A versatile platform for neutrophil chemotaxis assays Blood 120: (14) pp. e45-e53. (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 Madhavi V, Navis M, Chung AW, Isitman G, Wren LH, De Rose R, Kent SJ, Stratov I Activation of NK cells by HIV-specific ADCC antibodies: Role for granulocytes in expressing HIV-1 peptide epitopes Human Vaccines and Immunotherapeutics 9: (5) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Dalboni TM, Abe AE, de Oliveira CE, Lara VS, Campanelli AP, Gasparoto CT, Gasparoto TH Activation profile of CXCL8-stimulated neutrophils and aging Cytokine 61: (3) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Sideras P, Apostolou E, Stavropoulos A, Sountoulidis A, Gavriil A, Apostolidou A, Andreakos E Activin, neutrophils, and inflammation: Just coincidence? Seminars in Immunopathology 35: (4) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 7 Horinouchi CDDS, Mendes DAGB, Soley BDS, Pietrovski EF, Facundo VA, Santos ARS, Cabrini DA, Otuki MF Combretum leprosum Mart. (Combretaceae): Potential as an antiproliferative and anti-inflammatory agent Journal of Ethnopharmacology 145: (1) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 De Oliveira S, Reyes-Aldasoro CC, Candel S, Renshaw SA, Mulero V, Calado A Cxcl8 (IL-8) mediates neutrophil recruitment and behavior in the zebrafish inflammatory response Journal of Immunology 190: (8) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Zhu X, Xiao L, Huo R, Zhang J, Lin J, Xie J, Sun S, He Y, Sun Y, Zhou Z, Shen B, Li N Cyr61 is involved in neutrophil infiltration in joints by inducing IL-8 production by fibroblast-like synoviocytes in rheumatoid arthritis Arthritis Research and Therapy 15: (6) Paper R187. (2013) Folyóiratcikk /Szakcikk /Tudományos [ ]
8 8 / :52 10 * Mócsai A Diverse novel functions of neutrophils in immunity, infammation, and beyond Journal of Experimental Medicine 210: (7) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 11 Laurence A, Aringer M Effector Mechanisms in Autoimmunity In: The Autoimmune Diseases: Fifth Edition. Elsevier Inc., (ISBN ) pp Könyvrészlet /Könyvfejezet /Tudományos [ ] 12 Daniel AE, Van Buul JD Endothelial junction regulation: A prerequisite for leukocytes crossing the vessel wall Journal of Innate Immunity 5: (4) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 13 Bosch X, Ramos-Casals M Granulocytes: Neutrophils, Basophils, Eosinophils In: The Autoimmune Diseases: Fifth Edition. Elsevier Inc., (ISBN ) pp Könyvrészlet /Könyvfejezet /Tudományos [ ] 14 Figueiredo-Rinhel ASG, Kabeya LM, Bueno PCP, Jorge-Tiossi RF, Azzolini AECS, Bastos JK, Lucisano-Valim YM Inhibition of the human neutrophil oxidative metabolism by Baccharis dracunculifolia DC (Asteraceae) is influenced by seasonality and the ratio of caffeic acid to other phenolic compounds Journal of Ethnopharmacology 150: (2) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 15 Pick R, Brechtefeld D, Walzog B Intraluminal crawling versus interstitial neutrophil migration during inflammation Molecular Immunology 55: (1) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 16 Figueiredo J, Ferreira AE, Silva RL, Ulloa L, Grieco P, Cunha TM, Ferreira SH, Cunha FDQ, Kanashiro A NDP-MSH inhibits neutrophil migration through nicotinic and adrenergic receptors in experimental peritonitis Naunyn-Schmiedeberg's Archives of Pharmacology 386: (4) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 17 * Futosi K, Fodor S, Mócsai A Neutrophil cell surface receptors and their intracellular signal transduction pathways International Immunopharmacology 17: (3) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 18 Shelef MA, Tauzin S, Huttenlocher A Neutrophil migration: Moving from zebrafish models to human autoimmunity Immunological Reviews 256: (1) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 19 Voisin M-B, Nourshargh S Neutrophil transmigration: Emergence of an adhesive cascade within venular walls Journal of Innate Immunity 5: (4) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 20 Ryan SO, Johnson JL, Cobb BA Neutrophils confer T cell resistance to myeloid-derived suppressor cell-mediated suppression to promote chronic inflammation Journal of Immunology 190: (10) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 21 Tintinger GR, Anderson R, Feldman C Pharmacological approaches to regulate neutrophil activity Seminars in Immunopathology 35: (4) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 22 Wu Y-C, Sureshbabu M, Fang Y-C, Wu Y-H, Lan Y-H, Chang F-R, Chang Y-W, Hwang T-L Potent inhibition of human neutrophil activations by bractelactone, A novel chalcone from Fissistigma bracteolatum Toxicology and Applied Pharmacology 266: (3) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 23 Pang L, Hayes CP, Buac K, Yoo D-G, Rada B Pseudogout-associated inflammatory calcium pyrophosphate dihydrate microcrystals induce formation of neutrophil extracellular traps Journal of Immunology 190: (12) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 24 Valle A, Giamporcaro GM, Scavini M, Stabilini A, Grogan P, Bianconi E, Sebastiani G, Masini M, Maugeri N, Porretti L, Bonfanti R, Meschi F, De Pellegrin M, Lesma A, Rossini S, Piemonti L, Marchetti P, Dotta F, Bosi E, Battaglia M Reduction of circulating neutrophils precedes and accompanies type 1 diabetes Diabetes 62: (6) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 25 * Futosi K, Fodor S, Mócsai A Reprint of Neutrophil cell surface receptors and their intracellular signal transduction pathways International Immunopharmacology 17: (4) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 26 Weber FC, Martin SF Series "The small 1 x 1 of immunology" - Part 6. Neutrophil granulocytes: central pillar of the innate immune system Allergo Journal 22: (2) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 27 Jog NR, Caricchio R, Cohen PL The neutrophil: An underappreciated but key player in SLE pathogenesis Current Immunology Reviews (ISSN: X) 9: (4) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 28 Galligan CL, Fish EN The role of circulating fibrocytes in inflammation and autoimmunity Journal of Leukocyte Biology 93: (1) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 29 Carnuccio R, Maiuri MC, De Stefano D The role of NF-κB in chronic inflammation In: Chronic Inflammation: Causes, Treatment Options and Role in Disease. Nova Science Publishers, Inc., (ISBN ) pp Könyvrészlet /Könyvfejezet /Tudományos [ ]
9 9 / :52 30 Silva Quinteiro M, Henrique Napimoga M, Gomes Macedo C, Furtado Freitas F, Balassini Abdalla H, Bonfante R, Trindade Clemente- Napimoga J 15-deoxy- 12,14-prostaglandin J2reduces albumin-induced arthritis in temporomandibular joint of rats EUROPEAN JOURNAL OF PHARMACOLOGY (ISSN: ) 740: pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 31 Önnheim K, Christenson K, Gabl M, Burbiel JC, Müller CE, Oprea TI, Bylund J, Dahlgren C, Forsman H A novel receptor cross-talk between the ATP receptor P2Y2 and formyl peptide receptors reactivates desensitized neutrophils to produce superoxide Experimental Cell Research (ISSN: ) 323: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 32 Sackmann EK-H, Berthier E, Schwantes EA, Fichtinger PS, Evans MD, Dziadzio LL, Huttenlocher A, Mathur SK, Beebe DJ Characterizing asthma from a drop of blood using neutrophil chemotaxis Proceedings of the National Academy of Sciences of the United States of America (ISSN: ) 111: (16) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 33 Borges LDS, Bortolon JR, Santos VC, De Moura NR, Dermargos A, Cury-Boaventura MF, Gorjão R, Pithon-Curi TC, Hatanaka E Chronic inflammation and neutrophil activation as possible causes of joint diseases in ballet dancers Mediators of Inflammation (ISSN: ) 2014: Paper (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 34 Al-Ghoul WM, Kim MS, Fazal N, Azim AC, Ali A Evidence for simvastatin anti-inflammatory actions based on quantitative analyses of NETosis and other inflammation/oxidation markers Results in Immunology (ISSN: ) 4: (1) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 35 Burke SJ, Lu D, Sparer TE, Masi T, Goff MR, Karlstad MD, Collier JJ NF-κB and STAT1 control CXCL1 and CXCL2 gene transcription AMERICAN JOURNAL OF PHYSIOLOGY-ENDOCRINOLOGY AND METABOLISM (ISSN: ) 306: (2) pp. E131-E149. (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 36 Sun B, Hu X, Liu G, Ma B, Xu Y, Yang T, Shi J, Yang F, Li H, Zhang L, Zhao Y Phosphatase wip1 negatively regulates neutrophil migration and inflammation Journal of Immunology (ISSN: ) 192: (3) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 37 Sun Y, Caplazi P, Zhang J, Mazloom A, Kummerfeld S, Quinones G, Senger K, Lesch J, Peng I, Sebrell A, Luk W, Lu Y, Lin Z, Barck K, Young J, Del Rio M, Lehar S, Asghari V, Lin W, Mariathasan S, DeVoss J, Misaghi S, Balazs M, Sai T, Haley B, Hass PE, Xu M, Ouyang W, Martin F, Lee WP, Zarrin AA PILRα negatively regulates mouse inflammatory arthritis JOURNAL OF IMMUNOLOGY (ISSN: ) 193: (2) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 38 Ishizuka T, Hisada T, Hatori M, Koike A, Hanabuchi K, Matsuzaki S, Kamide Y, Utsugi M, Aoki H, Yoshino R, Yanagitani N, Koga Y, Ono A, Kaira K, Sunaga N, Dobashi K, Tsuburai T, Akiyama K, Yamada M, Suzuki K, Mori M Safety and efficacy of high-dose leukocytapheresis in patients with refractory asthma INFLAMMATION RESEARCH (ISSN: ) 63: (9) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 39 Shang L, Daubeuf B, Triantafilou M, Olden R, Dépis F, Raby AC, Herren S, Dos Santos A, Malinge P, Dunn-Siegrist I, Benmkaddem S, Geinoz A, Magistrelli G, Rousseau F, Buatois V, Salgado-Pires S, Reith W, Monteiro R, Pugin J, Leger O, Ferlin W, Kosco-Vilbois M, Triantafilou K, Elson G Selective antibody intervention of toll-like receptor 4 activation through Fc γ receptor tethering Journal of Biological Chemistry (ISSN: X) 289: (22) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 40 Baldini M, Manfredi AA, Maugeri N Targeting platelet-neutrophil interactions in giant-cell arteritis Current Pharmaceutical Design (ISSN: ) 20: (4) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 41 Bardoel BW, Kenny EF, Sollberger G, Zychlinsky A The balancing act of neutrophils Cell Host and Microbe (ISSN: ) 15: (5) pp (2014) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 42 Figueiredo-Rinhel ASG, Santos EOL, Kabeya LM, Azzolini AECS, Simões-Ambrosio LMC, Lucisano-Valim YM The flavonols quercetin, myricetin, kaempferol, and galangin inhibit the net oxygen consumption by immune complex-stimulated human and rabbit neutrophils ZEITSCHRIFT FÜR NATURFORSCHUNG C-A JOURNAL OF BIOSCIENCES (ISSN: ) 69 C: (7-8) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 43 Catz SD The role of Rab27a in the regulation of neutrophil function CELLULAR MICROBIOLOGY (ISSN: ) 16: (9) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 18. Boyle KB, Gyori D, Sindrilaru A, Scharffetter-Kochanek K, Taylor PR, Mocsai A, Stephens LR, Hawkins PT Class IA phosphoinositide 3-kinase β and δ regulate neutrophil oxidase activation in response to Aspergillus fumigatus hyphae. JOURNAL OF IMMUNOLOGY 186:(5) pp (2011) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 19 Függő idéző: 2 Összesen: 21 1 Shuttleworth SJ, Silva FA, Cecil ARL, Tomassi CD, Hill TJ, Raynaud FI, Clarke PA, Workman P Progress in the Preclinical Discovery and Clinical Development of Class I and Dual Class I/IV Phosphoinositide 3-Kinase (PI3K) Inhibitors CURRENT MEDICINAL CHEMISTRY 18: (18) pp (2011) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 2011
10 10 / :52 2 Vethanayagam RR, Almyroudis NG, Grimm MJ, Lewandowski DC, Pham CTN, Blackwell TS, Petraitiene R, Petraitis V, Walsh TJ, Urban CF, Segal BH Role of NADPH Oxidase versus Neutrophil Proteases in Antimicrobial Host Defense PLOS ONE 6: (12) Paper e (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 3 Li X, Utomo A, Cullere X, Choi MM, Milner DA, Venkatesh D, Yun SH, Mayadas TN The beta-glucan Receptor Dectin-1 Activates the Integrin Mac-1 in Neutrophils via Vav Protein Signaling to Promote Candida albicans Clearance CELL HOST & MICROBE 10: (6) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 4 Bagaitkar J, Matute JD, Austin A, Arias AA, Dinauer MC Activation of neutrophil respiratory burst by fungal particles requires phosphatidylinositol 3-phosphate binding to p40 phox in humans but not in mice Blood 120: (16) pp (2012) Folyóiratcikk /Rövid közlemény /Tudományos [ ] 5 * Boyle KB, Stephens LR, Hawkins PT Activation of the neutrophil NADPH oxidase by Aspergillus fumigatus Annals of the New York Academy of Sciences 1273: (1) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Braddock M Cambridge Healthtech Institute's Third Annual Anti-inflammatories: Small Molecules Meeting, April 17 th 18 th 2012, San Diego, USA Expert Opinion on Investigational Drugs 21: (9) pp (2012) Folyóiratcikk /Ismertetés /Tudományos [ ] 7 Sunose M, Bell K, Ellard K, Bergamini G, Neubauer G, Werner T, Ramsden N Discovery of 5-(2-amino-[1,2,4]triazolo[1,5-a]pyridin-7-yl)-N-(tert-butyl) pyridine-3-sulfonamide (CZC24758), as a potent, orally bioavailable and selective inhibitor of PI3K for the treatment of inflammatory disease Bioorganic and Medicinal Chemistry Letters 22: (14) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 8 * Juss JK, Hayhoe RP, Owen CE, Bruce I, Walmsley SR, Cowburn AS, Kulkarni S, Boyle KB, Stephens L, Hawkins PT, Chilvers ER, Condliffe AM Functional Redundancy of Class I Phosphoinositide 3-Kinase (PI3K) Isoforms in Signaling Growth Factor-Mediated Human Neutrophil Survival PLoS ONE 7: (9) Paper e (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Leal Jr SM, Vareechon C, Cowden S, Cobb BA, Latgé J-P, Momany M, Pearlman E Fungal antioxidant pathways promote survival against neutrophils during infection Journal of Clinical Investigation 122: (7) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 10 LeibundGut-Landmann S, Wüthrich M, Hohl TM Immunity to fungi Current Opinion in Immunology 24: (4) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 11 Foster JG, Blunt MD, Carter E, Ward SG Inhibition of PI3K signaling Spurs new therapeutic opportunities in inflammatory/autoimmune diseases and hematological malignancies Pharmacological Reviews 64: (4) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 12 Blunt MD, Ward SG Pharmacological targeting of phosphoinositide lipid kinases and phosphatases in the immune system: Success, disappointment, and new opportunities Frontiers in Immunology 3: (AUG) Paper Article 226. (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 13 Blunt MD, Ward SG Targeting PI3K isoforms and SHIP in the immune system: New therapeutics for inflammation and leukemia Current Opinion in Pharmacology 12: (4) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 14 Honda F, Kano H, Kanegane H, Nonoyama S, Kim ES, Lee SK, Takagi M, Mizutani S, Morio T The kinase Btk negatively regulates the production of reactive oxygen species and stimulation-induced apoptosis in human neutrophils NATURE IMMUNOLOGY 13: (4) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 15 Jhingran A, Mar K, Kumasaka D, Knoblaugh S, Ngo L, Segal B, Iwakura Y, Lowell C, Hamerman J, Lin X, Hohl T Tracing Conidial Fate and Measuring Host Cell Antifungal Activity Using a Reporter of Microbial Viability in the Lung Cell Reports 2: (6) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 16 Fumagalli L, Campa CC, Germena G, Lowell CA, Hirsch E, Berton G Class i phosphoinositide-3-kinases and Src kinases play a nonredundant role in regulation of adhesion-independent and -dependent neutrophil reactive oxygen species generation Journal of Immunology 190: (7) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 17 Grimm MJ, Vethanayagam RR, Almyroudis NG, Dennis CG, Khan ANH, D'Auria AC, Singel KL, Davidson BA, Knight PR, Blackwell TS, Hohl TM, Mansour MK, Vyas JM, Röhm M, Urban CF, Kelkka T, Holmdahl R, Segal BH Monocyte- and macrophage-targeted NADPH oxidase mediates antifungal host defense and regulation of acute inflammation in mice Journal of Immunology 190: (8) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 18 Balla T Phosphoinositides: Tiny lipids with giant impact on cell regulation Physiological Reviews 93: (3) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 19 Nunes P, Demaurex N, Dinauer MC Regulation of the NADPH Oxidase and Associated Ion Fluxes During Phagocytosis Traffic 14: (11) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ]
11 11 / :52 20 Dupré-Crochet S, Erard M, Nüße O ROS production in phagocytes: Why, when, and where? Journal of Leukocyte Biology 94: (4) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 21 McMillan SJ, Sharma RS, Richards HE, Hegde V, Crocker PR Siglec-E promotes β2-integrin-dependent NADPH oxidase activation to suppress neutrophil recruitment to the lung JOURNAL OF BIOLOGICAL CHEMISTRY (ISSN: ) 289: (29) pp (2014) Folyóiratcikk /Szakcikk /Tudományos [ ] 19. Kulkarni S, Sitaru C, Jakus Z, Anderson KE, Damoulakis G, Davidson K, Hirose M, Juss J, Oxley D, Chessa TA, Ramadani F, Guillou H, Segonds-Pichon A, Fritsch A, Jarvis GE, Okkenhaug K, Ludwig R, Zillikens D, Mocsai A, Vanhaesebroeck B, Stephens LR, Hawkins PT PI3Kβ Plays a Critical Role in Neutrophil Activation by Immune Complexes. SCIENCE SIGNALING 4:(168) Paper ra p. (2011) IF: Nyelv: Angol Folyóiratcikk /Szakcikk /Tudományos [ ] [ Érvényesített ] Független idéző: 25 Függő idéző: 15 Összesen: 40 1 Norman P Selective PI3K delta inhibitors, a review of the patent literature EXPERT OPINION ON THERAPEUTIC PATENTS 21: (11) pp (2011) Folyóiratcikk /Szakcikk /Tudományos [ ] 2 Woodman I SIGNALLING PI3K beta - linking signals for neutrophil activation NATURE REVIEWS IMMUNOLOGY 11: (6) Paper 369. (2011) Folyóiratcikk /Rövid közlemény /Tudományos [ ] 3 Vadas O, Burke JE, Zhang XX, Berndt A, Williams RL Structural Basis for Activation and Inhibition of Class I Phosphoinositide 3-Kinases SCIENCE SIGNALING 4: (195) Paper re2. (2011) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 4 Braddock M Cambridge Healthtech Institute's Third Annual Anti-inflammatories: Small Molecules Meeting, April 17 th 18 th 2012, San Diego, USA Expert Opinion on Investigational Drugs 21: (9) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 5 Vergez F, Recher C, Payrastre B Class i phosphoinositide 3-kinases in normal and pathologic hematopoietic cells Current Topics in Microbiology and Immunology 362: pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 6 Nigorikawa K, Hazeki K, Kumazawa T, Itoh Y, Hoshi M, Hazeki O Class-IA phosphoinositide 3-kinase p110β triggers GPCR-induced superoxide production in p110γ-deficient murine neutrophils Journal of Pharmacological Sciences 120: (4) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 7 Gonzalez-Lopez De Turiso F, Shin Y, Brown M, Cardozo M, Chen Y, Fong D, Hao X, He X, Henne K, Hu Y-L, Johnson MG, Kohn T, Lohman J, McBride HJ, McGee LR, Medina JC, Metz D, Miner K, Mohn D, Pattaropong V, Seganish J, Simard JL, Wannberg S, Whittington DA, Yu G, Cushing TD Discovery and in vivo evaluation of dual PI3Kβ/δ inhibitors Journal of Medicinal Chemistry 55: (17) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 8 Sunose M, Bell K, Ellard K, Bergamini G, Neubauer G, Werner T, Ramsden N Discovery of 5-(2-amino-[1,2,4]triazolo[1,5-a]pyridin-7-yl)-N-(tert-butyl) pyridine-3-sulfonamide (CZC24758), as a potent, orally bioavailable and selective inhibitor of PI3K for the treatment of inflammatory disease Bioorganic and Medicinal Chemistry Letters 22: (14) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 9 Cazzola M, Page CP, Calzetta L, Matera MG Emerging anti-inflammatory strategies for COPD European Respiratory Journal 40: (3) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 10 * Juss JK, Hayhoe RP, Owen CE, Bruce I, Walmsley SR, Cowburn AS, Kulkarni S, Boyle KB, Stephens L, Hawkins PT, Chilvers ER, Condliffe AM Functional Redundancy of Class I Phosphoinositide 3-Kinase (PI3K) Isoforms in Signaling Growth Factor-Mediated Human Neutrophil Survival PLoS ONE 7: (9) Paper e (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 11 Dbouk HA, Vadas O, Shymanets A, Burke JE, Salamon RS, Khalil BD, Barrett MO, Waldo GL, Surve C, Hsueh C, Perisic O, Harteneck C, Shepherd PR, Harden TK, Smrcka AV, Taussig R, Bresnick AR, Nürnberg B, Williams RL, Backer JM G protein-coupled receptor-mediated activation of p110b by Gβγ is required for cellular transformation and invasiveness Science Signaling 5: (253) Paper ra89. (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 12 * Csorba K, Sitaru S, Sitaru C Granulocyte-dependent autoantibody-induced skin blistering Journal of Visualized Experiments 2012: (68) p. alszám. (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 13 Foster JG, Blunt MD, Carter E, Ward SG Inhibition of PI3K signaling Spurs new therapeutic opportunities in inflammatory/autoimmune diseases and hematological malignancies Pharmacological Reviews 64: (4) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ]
12 12 / :52 14 Kenzel S, Mergen M, Von Süßkind-Schwendi J, Wennekamp J, Deshmukh SD, Haeffner M, Triantafyllopoulou A, Fuchs S, Farmand S, Santos- Sierra S, Seufert J, Van Den Berg TK, Kuijpers TW, Henneke P Insulin modulates the inflammatory granulocyte response to streptococci via phosphatidylinositol 3-kinase Journal of Immunology 189: (9) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 15 * Ludwig RJ Model systems duplicating epidermolysis bullosa acquisita: A methodological review AUTOIMMUNITY 45: (1) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 16 Blunt MD, Ward SG Pharmacological targeting of phosphoinositide lipid kinases and phosphatases in the immune system: Success, disappointment, and new opportunities Frontiers in Immunology 3: (AUG) Paper Article 226. (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 17 Blunt MD, Ward SG Targeting PI3K isoforms and SHIP in the immune system: New therapeutics for inflammation and leukemia Current Opinion in Pharmacology 12: (4) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 18 * Nemeth T, Mocsai A The role of neutrophils in autoimmune diseases IMMUNOLOGY LETTERS 143: (1) pp (2012) Folyóiratcikk /Szakcikk /Tudományos [ ] 19 * Banham-Hall E, Clatworthy MR, Okkenhaug K The therapeutic potential for PI3K inhibitors in autoimmune rheumatic diseases Open Rheumatology Journal 6: (SPEC. ISSUE 2) pp (2012) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 20 Liz R, Zanatta L, Dos Reis GO, Horst H, Pizzolatti MG, Silva FRMB, Fröde TS Acute effect of β-sitosterol on calcium uptake mediates anti-inflammatory effect in murine activated neutrophils Journal of Pharmacy and Pharmacology 65: (1) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 21 Fumagalli L, Campa CC, Germena G, Lowell CA, Hirsch E, Berton G Class i phosphoinositide-3-kinases and Src kinases play a nonredundant role in regulation of adhesion-independent and -dependent neutrophil reactive oxygen species generation Journal of Immunology 190: (7) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 22 Burke JE, Williams RL Dynamic steps in receptor tyrosine kinase mediated activation of class IA phosphoinositide 3-kinases (PI3K) captured by H/D exchange (HDX-MS) Advances in Biological Regulation 53: (1) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 23 * Ludwig RJ, Kalies K, Köhl J, Zillikens D, Schmidt E Emerging treatments for pemphigoid diseases Trends in Molecular Medicine 19: (8) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 24 Kummer R, Fachini-Queiroz FC, Estevão-Silva CF, Grespan R, Silva EL, Bersani-Amado CA, Cuman RKN Evaluation of anti-inflammatory activity of citrus latifolia Tanaka essential oil and limonene in experimental mouse models Evidence-based Complementary and Alternative Medicine 2013: Paper (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 25 Thomas Stief Human IgG can modulate blood ROS generation In: Photonic Hemostasis - Physiology of Light Signals in the Neutrophil. Nova Science Publishers, Inc., (ISBN ) pp Könyvrészlet /Könyvfejezet /Tudományos [ ] 26 * Schönig S, Recke A, Hirose M, Ludwig RJ, Seeger K Metabolite analysis distinguishes between mice with epidermolysis bullosa acquisita and healthy mice Orphanet Journal of Rare Diseases 8: (1) Paper 93. (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 27 * Futosi K, Fodor S, Mócsai A Neutrophil cell surface receptors and their intracellular signal transduction pathways International Immunopharmacology 17: (3) pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ] 28 Winkler DG, Faia KL, Dinitto JP, Ali JA, White KF, Brophy EE, Pink MM, Proctor JL, Lussier J, Martin CM, Hoyt JG, Tillotson B, Murphy EL, Lim AR, Thomas BD, MacDougall JR, Ren P, Liu Y, Li L-S, Jessen KA, Fritz CC, Dunbar JL, Porter JR, Rommel C, Palombella VJ, Changelian PS, Kutok JL PI3K-δ and PI3K-γ inhibition by IPI-145 abrogates immune responses and suppresses activity in autoimmune and inflammatory disease models Chemistry and Biology 20: (11) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 29 Fritsch R, De Krijger I, Fritsch K, George R, Reason B, Kumar MS, Diefenbacher M, Stamp G, Downward J RAS and RHO families of GTPases directly regulate distinct phosphoinositide 3-kinase isoforms Cell 153: (5) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 30 * Futosi K, Fodor S, Mócsai A Reprint of Neutrophil cell surface receptors and their intracellular signal transduction pathways International Immunopharmacology 17: (4) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 31 * Okkenhaug K Rules of engagement: Distinct functions for the four class I PI3K catalytic isoforms in immunity Annals of the New York Academy of Sciences 1280: (1) pp (2013) Folyóiratcikk /Szakcikk /Tudományos [ ] 32 * Okkenhaug K Signaling by the phosphoinositide 3-kinase family in immune cells Annual Review of Immunology 31: pp (2013) Folyóiratcikk /Összefoglaló cikk /Tudományos [ ]
Doktori. Semmelweis Egyetem
a Doktori Semmelweis Egyetem z Hivatalo Dr Helyes Zsuzsanna egyetemi docens, az MTA doktora Dr Dr tagja Szi Dr az MTA doktora Dr, az MTA rendes, PhD Budapest 2012 A neutrofil granuloci PhDvel foglalkoztam
Jelátviteli folyamatok vizsgálata neutrofil granulocitákban és az autoimmun ízületi gyulladás kialakulásában
Jelátviteli folyamatok vizsgálata neutrofil granulocitákban és az autoimmun ízületi gyulladás kialakulásában Doktori tézisek Dr. Németh Tamás Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola
LEGYEN MÁS A SZENVEDÉLYED!
E g y ü t t m z k ö d é s i a j á n l a t L E G Y E N M Á S A S Z E N V E D É L Y E D! 2. E F O P - 1. 8. 9-1 7 P á l y á z a t i t e r v e z e t 3. 0 ( F o r r á s : w w w. p a l y a z a t. g o v. h u
A hízósejtek szerepe az immunológiai folyamatokban
A hízósejtek szerepe az immunológiai folyamatokban Berki Timea Boldizsár F, Bartis D, Talabér G, Szabó M, Németh P, University of Pécs, Department of Immunology & Biotechnology, Pécs, Hungary Additon of
Induló egyetemi spin-off vállalkozások mozgástere. Ferdinandy Péter. www.cardiovasc.com www.pharmahungary.com
Induló egyetemi spin-off vállalkozások mozgástere Ferdinandy Péter kari innovációs igazgató, Orvostudományi Kar, Szegedi Tudományegyetem, alapító, ügyvezet igazgató, PharmaHungary 2000 Kft e-mail: peter.ferdinandy@pharmahungary.com
There are no translations available. CURRENT APPOINTMENT(S):
There are no translations available. CURRENT APPOINTMENT(S): Research fellow of Biochemistry and Molecular Biology, Department of Biochemistry and Molecular Biology, Medical and Health Science Center (MHSC),
Szakmai önéletrajz. Tanulmányok: Tudományos minısítés:
Dr. Benyó Zoltán, Egyetemi Tanári Pályázat 2009, Szakmai Önéletrajz, 1. oldal Szakmai önéletrajz Név: Dr. Benyó Zoltán Születési hely, idı: Budapest, 1967. június 15. Családi állapot: nıs, 2 gyermek (Barnabás,
DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA
DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA TÓTH ADÉL TÉMAVEZETŐ: DR. GÁCSER ATTILA TUDOMÁNYOS FŐMUNKATÁRS
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
Report on esi Scientific plans 7 th EU Framework Program. José Castell Vice-President ecopa, ES
Report on esi Scientific plans 7 th EU Framework Program José Castell Vice-President ecopa, ES the Seventh Framework Programme (2007-2013) Ecopa scientific plans for 2007-2008?
Pályázatok/Grants 2012-
2012-2015 OTKA Pál Gábor/ Pályázatok/Grants 2012-49 984 NK 100769 A komplementrendszer aktiválódási mechanizmusa és élettani szerepe: átfogó vizsgálat irányított evolúcióval kifejlesztett, útvonal-szelektív
Hemopoetikus eredetű sejtek jelátvitele egészséges és kóros körülmények között. Dr. Mócsai Attila
MTA DOKTORI ÉRTEKEZÉS TÉZISEI Hemopoetikus eredetű sejtek jelátvitele egészséges és kóros körülmények között Dr. Mócsai Attila SEMMELWEIS EGYETEM Budapest 2011 A címlapon a Syk (vörös) és a CD18 (zöld)
3 sz. Gyógyszertudományok Doktori Iskola.sz. Program. és kurzuscím Óra
3 sz. Gyógyszertudományok Doktori Iskola.sz. Program Kód Kurzusvezetö és kurzuscím Óra 2012-13/1 2012-13/2 2013-14/1 2013-14/2 2014-15/1 2014-15/2 0032- KV Dr. Tóthfalusi László 3208 Dr. Farsang Csaba
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
(AD) β (A ) (2) ACDP ACDP ACDP APP. APP-C99 γ (3) A 40 A 42 A A A A 42/A 40. in vivo A A A A
(AD) β (A) A AAPP APP-C99 γ A A40 A42 A AA42/A40 γ A A γ AD A A A A APP APP APP A A A A A A (1)AD A42 A AD AD (2) ACDP AACDP ACDP A A ACDP (3) (1)A in vivo A APP Gray and Whittaker 1962; Perez-Otano et
E F O P
E g y ü t t m z k ö d é s i a j á n l a t K ö z ö s é r t é k e i n k s o k s z í n z t á r s a d a l o m E F O P - 1.3.4-1 6 P á l y á z a t i t e r v e z e t 2. 0 ( F o r r á s : w w w. p a l y a z a
Élő szervezetek külső sztatikus mágneses tér expozícióra adott biológiai válaszai
Élő szervezetek külső sztatikus mágneses tér expozícióra adott biológiai válaszai készült az ELTE Alkalmazott Matematikus M. Sc. Önálló Projekt című tárgy témakiírására Dr. László János, Debreceni Egyetem
A Magyar Nemzeti Bank H-EN-III-275/2019. számú határozata tőkepiaci közvetítők Bszt. szerinti hatósági nyilvántartásba vétele tárgyában
A Magyar Nemzeti Bank H-EN-III-275/2019. számú határozata tőkepiaci közvetítők Bszt. szerinti hatósági nyilvántartásba vétele tárgyában A Magyar Posta Befektetési Szolgáltató Zártkörűen Működő Részvénytársaság
KLINIKAI ÉS EGÉSZSÉG- GAZDASÁGTANI EVIDENCIÁK A VASTAGBÉLSZŰRÉSBEN
Vastagbélszűrési disszeminációs workshop Szeged, 2015. május 12. KLINIKAI ÉS EGÉSZSÉG- GAZDASÁGTANI EVIDENCIÁK A VASTAGBÉLSZŰRÉSBEN Prof. Dr. Boncz Imre PTE ETK Egészségbiztosítási Intézet AZ ELŐADÁS TÉMÁJA
Udvardyné Tóth Lilla intézeti biológus
Udvardyné Tóth Lilla intézeti biológus Tudományos közlemények Közlemények idegen nyelven TÓTH, L. GÁCSI, M. TOPÁL, J. MIKLÓSI, Á.: Playing styles and possible causative factors in dogs behaviour when playing
Készült a Gazdasági Versenyhivatal Versenykultúra Központjának támogatásával. 2010. november
A 2 -e g y b e n, 3-e g y b e n c s o m a g a j á n l a t o k f o g y a s z t ó i m e g í t é l é s e é s h a t áv se a r s a e n y r e a h í r k ö z l é s i p i a c o n Készült a Gazdasági Versenyhivatal
Együttműködési ajánlat Kulturális intézmények a köznevelés eredményességéért EFOP Véglegesített pályázat 3.0 (Forrás:
E g y ü t t m z k ö d é s i a j á n l a t K u l t u r á l i s i n t é z m é n y e k a k ö z n e v e l é s e r e d m é n y e s s é g é é r t E F O P - 3. 3. 2-1 6 V é g l e g e s í t e t t p á l y á z a
Dr. Fittler András, Ph.D. 2014. március 03. Publikációk Összesített impakt faktor: 14,624 Összes független idézés: 17 Önidézés: 1
Dr. Fittler András, Ph.D. 2014. március 03. Publikációk Összesített impakt faktor: 14,624 Összes független idézés: 17 Önidézés: 1 1. Fittler A.: Amfotericin B tartalmú orrspray orrpolyp kezelésére. Gyógyszerészet
Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and
1 2 3 4 5 Journal name: Applied Microbiology and Biotechnology Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and evaluation of its effect on lignocellulosic
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
Heart ra te correc ti on of t he QT interva l d ur i ng e xercise
Heart ra te correc ti on of t he QT interva l d ur i ng e xercise Gáb or Andrássy, Attila S zab o, 1 Andrea Duna i, Es zter Sim on, Ádá m T a hy B u d a p e s t i S z e nt Ferenc Kó r há z, K a r d io
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
PRA/282000/M. SMART - HENGER Beépített szeleppel és érzékel vel PRA/282000/M Kétoldali m ködés Ø 32... 100 mm
ISO 6431 és VDMA 24562 szerinti szabványos henger Összeépített, kpl. egység LED kijelz vel ASI busz vagy multipólusú csatlakozás Beépített 5/2 vagy 5/3 útszelepek (többféle m ködéssel) Fojtószelepek sebességszabályozáshoz
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
Tudományos állásfoglalás
Tudományos állásfoglalás Tudományos állásfoglalás az étrend-kiegészítıkben, egyéb anyagokkal dúsított élelmiszerekben alkalmazni kívánt Nelumbo nucifera levél biztonságosságának értékeléséhez benyújtott
Tóth István Balázs személyi adatai és szakmai önéletrajza
Személyi adatok Tóth István Balázs személyi adatai és szakmai önéletrajza Név: Tóth István Balázs Születési hely, idő: Debrecen, 1978. december 30. Családi állapot: nős, két gyermek édesapja Szakmai önéletrajz
A SZEROTONIN-2 (5-HT 2 ) RECEPTOROK SZEREPE A SZORONGÁS ÉS ALVÁS SZABÁLYOZÁSÁBAN. Kántor Sándor
A SZEROTONIN-2 (5-HT 2 ) RECEPTOROK SZEREPE A SZORONGÁS ÉS ALVÁS SZABÁLYOZÁSÁBAN Ph.D. értekezés tézisei Kántor Sándor Témavezetők: Prof. Dr. Bagdy György és Prof. Dr. Halász Péter Semmelweis Egyetem Idegtudományok
Pacemaker készülékek szoftverének verifikációja. Hesz Gábor
Pacemaker készülékek szoftverének verifikációja Hesz Gábor A szív felépítése http://hu.wikipedia.org/w/index.php?title=fájl:diagram_of_the_human_heart_hu.svg http://en.wikipedia.org/wiki/file:conductionsystemoftheheartwithouttheheart.png
Földi mandula (Cyperus esculentus L.)
Földi mandula (Cyperus esculentus L.) A földi mandulát (Cyperus esculentus L.) értékes gumójáért már az ókori egyiptomiak, a görögök és nem utolsó sorban a rómaiak is termesztették és előszeretettel fogyasztották.
EPILEPSY TREATMENT: VAGUS NERVE STIMULATION. Sakoun Phommavongsa November 12, 2013
EPILEPSY TREATMENT: VAGUS NERVE STIMULATION Sakoun Phommavongsa November 12, 2013 WHAT IS EPILEPSY? A chronic neurological disorder characterized by having two or more unprovoked seizures Affects nearly
CML: A KEZELÉS MELLÉKHATÁSAI
CML: A KEZELÉS MELLÉKHATÁSAI 2 MILYEN MELLÉK- HATÁSOK JELENTKEZ- HETNEK? KÖZELMÚLTBAN DIAGNOSZTIZÁLT, CML- ES BETEGKÉNT KEZDETBEN MILYEN MELLÉKHATÁSOKRA SZÁMÍTHATOK? A krónikus mieloid leukémiás (CML-es)
Diabéteszes redox változások hatása a stresszfehérjékre
Semmelweis Egyetem Molekuláris Orvostudományok Tudományági Doktori Iskola Pathobiokémia Program Doktori (Ph.D.) értekezés Diabéteszes redox változások hatása a stresszfehérjékre dr. Nardai Gábor Témavezeto:
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK Despite enormous challenges many developing countries are service exporters Besides traditional activities such as tourism;
M Sulyok Gábor A HUMANITÁRIUS INTERV ENC IÓ EL MÉ L ETE É S G Y AK O RL ATA P h.d. é r t e k e z é s t é z i s e i i s k o l c 2 0 0 3. M I. A KUTATÁSI FELADAT A k u t a t á s a h u ma n i t á r i u s
A sejtfelszíni FasL és szolubilis vezikulakötött FasL által indukált sejthalál gátlása és jellemzése
A sejtfelszíni FasL és szolubilis vezikulakötött FasL által indukált sejthalál gátlása és jellemzése Doktori értekezés tézisei Hancz Anikó Témavezetők: Prof. Dr. Sármay Gabriella Dr. Koncz Gábor Biológia
Bevezetés. 2. Rhinitises/asthmás betegek kiemelése 880 dolgozót (695 beköltözot és 185 oslakost) kérdoív alapján emeltem ki ipari populációból Pakson.
Bevezetés Inhalatív úton a légutakba jutó anyagok sora eredményez az arra érzékeny szervezetben kóros, megváltozott és specifikus légúti rendellenességet. A légúti allergia globális egészségügyi problémát
HELYSZÍNEK PROGRAM ÁPRILIS 20. csütörtök SZÁLLÁS
HELYSZÍNEK PROGRAM SZÁLLÁS 1 (6721 Szeged, Maros u. 1.) 2 Matrix Hotel (6721 Szeged, Zárda u. 8.) 3 Partium Hotel (6722 Szeged, Honvéd tér 3.) 4 Tisza Hotel (6720 Szeged, Széchenyi tér 3.) 5 Oázis Apartmanház
ú ľ ľ ä ú ľł Łř äľľ ź ź ó ľ ú Ö ö ó ó ó ź ę ő ö ő ö ó ö ę ó ó óö ö óö ö ő ő ő ő ć ö ó ő ő ó ö Á ľ ö ó ő ő ü ö ű ö ő ö ó ľ ú Ö ü ű ö ö ö ń ź ü ľ ö ľő ő ü ę ö ő ó ö ö ö ę ľü ľ ö ü ö ö ó ü ľ ö ö ú ö ő ő ź
A fiziológiás terhesség hátterében álló immunológiai történések
A fiziológiás terhesség hátterében álló immunológiai történések APAI Ag ANYAI Ag FERTŐZÉS AUTOIMMUNITÁS MAGZATI ANTIGEN ALACSONY P SZINT INFERTILITAS BEÁGYAZÓDÁS ANYAI IMMUNREGULÁCIÓ TROPHOBLAST INVÁZIÓ
fi*ggrfifi*rfi # qüt4t aas g gg E.H EüI Í,* El gql ühe Hfi {l ajr s<t ñrli 3il Éd ; I.e! Ffd 'á ru ;Én 5c'ri n ír^ -Ei =: t^ úu o 4
r < 7, 3t f. 3il d ; &2 t^ u l)", 1l' t, ; t ) * {l: r,ü d,. ti ó. n ír^ ;n.e! 5r fd 'á \D *N 5'ri ñrli -i : N:, i! l f,. (, u.r f p C,) ] i'{ p t..l rl) in f ü,! () r s
INVITATION. The cost of adherence: quality of life and health economic impacts. Corvinus Health Policy and Health Economics Conference Series 2014/3
Corvinus Health Policy and Health Economics Conference Series 2014/3 Health Economics Study Circle, Health and Health Care Economics Section of the Hungarian Economic Association in cooperation with: Semmelweis
Tapasztalataink súlyos pikkelysömör adalimumab kezelésével* Adalimumab treatment of severe psoriasis
BÔRGYÓGYÁSZATI ÉS VENEROLÓGIAI SZEMLE 85. ÉVF. 6. 283 288. Szegedi Tudományegyetem, Általános Orvostudományi Kar, Szent-Györgyi Albert Klinikai Központ, Bôrgyógyászati és Allergológiai Klinika (igazgató:
Pro- és antioxidáns hatások szerepe az endoplazmás retikulum eredetű stresszben és apoptózisban
Pro- és antioxidáns hatások szerepe az endoplazmás retikulum eredetű stresszben és apoptózisban Az endoplazmás retikulum (ER) számos környezeti és metabolikus hatás szenzora. Mindazon tényezők, melyek
XLVI. Irinyi János Középiskolai Kémiaverseny 2014. február 6. * Iskolai forduló I.a, I.b és III. kategória
Tanuló neve és kategóriája Iskolája Osztálya XLVI. Irinyi János Középiskolai Kémiaverseny 201. február 6. * Iskolai forduló I.a, I.b és III. kategória Munkaidő: 120 perc Összesen 100 pont A periódusos
OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA ÁGH TAMÁS DR., MÉSZÁROS ÁGNES DR.
ALL RIGHTS RESERVED SOKSZOROSÍTÁSI CSAK A MTT ÉS A KIADÓ ENGEDÉLYÉVEL Az asthmás és COPD-s betegek életminõségét befolyásoló tényezõk OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA Semmelweis Egyetem
Oroszlán u. 4. Szeged H6720. mandi.yvette@med.u-szeged.hu. Szegedi Tudományegyetem Általános Orvostudományi Kar
Europass Önéletrajz Személyi adatok Vezetéknév / Utónév(ek) Dr Mándi Yvette Cím(ek) Oroszlán u. 4. Szeged H6720 Telefonszám(ok) +36 62 545 115 Mobil: +36 20 326 5569 Fax(ok) +36 62 545 113 E-mail(ek) mandi.yvette@med.u-szeged.hu
Expansion of Red Deer and afforestation in Hungary
Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi www.vmi.szie.hu Background and importance large herbivores are overpopulated
Computational Neuroscience
Computational Neuroscience Zoltán Somogyvári senior research fellow KFKI Research Institute for Particle and Nuclear Physics Supporting materials: http://www.kfki.hu/~soma/bscs/ BSCS 2010 Lengyel Máté:
FOLYÓIRATOK, ADATBÁZISOK
Szakkönyvtár FOLYÓIRATOK, ADATBÁZISOK 2013. szeptember Acta Oeconomica Állam- és Jogtudomány Élet és Irodalom Figyelő Gazdaság és Jog Határozatok Tára HVG Közgazdasági Szemle Külgazdaság Magyar Hírlap
Current Weed Control strategies in sorghum I
Current Weed Control strategies in sorghum I In Pre-planting/pre-emergence chemichal fallow use of seed safeners residual herbicides efficacy uncertain high dependency on rains Current Weed Control strategies
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
History. Barcelona 11 June 2013 HLASA 1
History 1893 National Ornithological Centre (Ottó Herman) New ways of breeding and use of laboratory animals (Dr.Kállai László A laboratoriumiállat-tenyésztés és felhasználás új útjai. In: A biológia aktuális
PLATTÍROZOTT ALUMÍNIUM LEMEZEK KÖTÉSI VISZONYAINAK TECHNOLÓGIAI VIZSGÁLATA TECHNOLOGICAL INVESTIGATION OF PLATED ALUMINIUM SHEETS BONDING PROPERTIES
Anyagmérnöki Tudományok, 37. kötet, 1. szám (2012), pp. 371 379. PLATTÍROZOTT ALUMÍNIUM LEMEZEK KÖTÉSI VISZONYAINAK TECHNOLÓGIAI VIZSGÁLATA TECHNOLOGICAL INVESTIGATION OF PLATED ALUMINIUM SHEETS BONDING
Hogyan gyógyítja a test önmagát?
Hogyan gyógyítja a test önmagát? Sejtkárosodás ismétlődően történik nap, mint nap. A napfény, a toxinok, a vegyi anyagok, a fertőzések és más irritáló anyagok naponta károsítják a sejtjeinket. Vágások,
: : : :.C32 E32 Q43 :JEL
25-42 39 4 :80 39 27 : 39 0 :. 970. 990.... 984.. :.C32 E32 Q43 :JEL Dr.bakhshi@gmail.com Javid_bahrami@yahoo.com farzanehmousavi@ymail.com 4 26.... - -........». «... 90 27......... 2000 70 960-2007.....2...
Ivóvíz arzénmentesítése nanoszűréssel
Szent István Egyetem Ivóvíz arzénmentesítése nanoszűréssel Doktori (PhD) értekezés tézisei Gergely Surd Budapest 2001 ELŐZMÉNYEK ÉS CÉLKITŰZÉSEK Magyarország egyes területein jelentős gondot okoz az arzénnal
Glyma10g15850 aagggatccattctggaaccatatcttgctgtg ttgggtacccttggatgcaggatgacacg AtMKK6, AT5g56580
Supplemental table 1. Soybean MAPK, MAPKK, and MAPKKK genes and primers for VIGS cloning Gene_ID Forward Primer Reverse Primer Arabidopsis Ortholog Glyma04g03210 aagggatcctgcagcaagaaccagttcat ttgggtaccctaatggatgcgcattaggataaag
Együttműködési ajánlat A társadalmi kohézió erősítése az egyházak közösségfejlesztő tevékenységének bővítésével EFOP Pályázati tervezet 2.
E g y ü t t m z k ö d é s i a j á n l a t A t á r s a d a l m i k o h é z i ó e r p s í t é s e a z e g y h á z a k k ö z ö s s é g f e j l e s z t p t e v é k e n y s é g é n e k b p v í t é s é v e l
Bird species status and trends reporting format for the period (Annex 2)
1. Species Information 1.1 Member State Hungary 1.2.2 Natura 2000 code A634-B 1.3 Species name Ardea purpurea purpurea 1.3.1 Sub-specific population East Europe, Black Sea & Mediterranean/Sub-Saharan Africa
STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:
STUDENT LOGBOOK 1 week general practice course for the 6 th year medical students Name of the student: Dates of the practice course: Name of the tutor: Address of the family practice: Tel: Please read
Chapter 10 Hungarian Summary. Az onkológiai gyógyszerfejlesztés eredetileg DNS-károsodást indukáló vegyületekre
10 Összefoglaló Összefoglaló Az onkológiai gyógyszerfejlesztés eredetileg DNS-károsodást indukáló vegyületekre összpontosított, melyek az osztódó rákos sejteket célozzák meg. Jelenleg, nagy hangsúly fektetődik
Az új SM terápiák szemészeti vonatkozásai
Az új SM terápiák szemészeti vonatkozásai Magyar Szemorvostársaság Neuroophthalmológiai Szekciójának Szimpóziuma 2011 Június 16. Terápia Gyulladáscsökkentés Neuroregeneráció Immunmoduláló kezelések Első
CT/MRI képalkotás alapjai. Prof. Bogner Péter
CT/MRI képalkotás alapjai Prof. Bogner Péter CT - computed tomography Godfrey N. Hounsfield Allan M. Cormack The Nobel Prize in Physiology or Medicine 1979 MRI - magnetic resonance imaging Sir Peter Mansfield
/01 1!"#$%&'!"#$%&'!"#$%&' () *+,-./ 01! :; CDE 6?289:; FGHIJKLMN O C ( PKL QRSTUV :;*W? CXY? Z[R \] ^ _ `a?o :;?boc^ *+ *+!"#
!"#$%&'!"#$%&' () *+,-./ 01! 234567289:; ?289:; @8ABCDE 6?289:; FGHIJKLMN O C ( PKL QRSTUV :;*W? CXY?Z[R \] ^ _ `a?o :;?boc^*+ *+!"#$%&'()* $%+, -./01 234+5 +,67* 894: ; "#
A verseny kérdése az oligopol távközlési piacokon
A verseny kérdése az oligopol távközlési piacokon (különös tekintettel a szélessávra) Pápai Zoltán 2 0 1 0. f e b r u á r T a r t a l o m 1. B e v e z e t é s...............................................................
Receptor Tyrosine-Kinases
Receptor Tyrosine-Kinases MAPkinase pathway PI3Kinase Protein Kinase B pathway PI3K/PK-B pathway Phosphatidyl-inositol-bisphosphate...(PI(4,5)P 2...) Phosphatidyl-inositol-3-kinase (PI3K) Protein kinase
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.
Correlation & Linear Regression in SPSS Petra Petrovics PhD Student Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise
Gondozási tevékenységek az irányelveknek megfelelően: alapés emelt szintű gyógyszerészi gondozás
Gondozási tevékenységek az irányelveknek megfelelően: alapés emelt szintű gyógyszerészi gondozás Vida Róbert György Pécsi Tudományegyetem, Gyógyszerészeti Intézet és Klinikai Központi Gyógyszertár Gyógyszerészet,
ú ľ Ę ú Ü ó Ą Í ő ź ť ö ľ í í ľ ú ý í ő ú ľ í ź ę í ľ ö ó Š źľ ĹÍ ö í ö ő ó ó ö í ú ł Á Á ľ Ü Ü ő í ő ú í ő ő Ó í Ü Ó Ü ú Ü Ö Ó Ö Ö Ö Ó í Ö í Ó Ö í Ü Ö Ó ó Ó ä Ö í Ö í Ü Ó í Ö Ü ö í ő Ö Ó Ü ó Ö Ó í Ó ó
MikroRNS-ek szerepe az autoimmun és reumatológiai kórképek kialakulásában
MikroRNS-ek szerepe az autoimmun és reumatológiai kórképek kialakulásában Butz Henriett SE Laboratóriumi Medicina Intézet MTA-SE Molekuláris Medicina Kutatócsoport 2017. április 20-21 Amiről szó lesz 1.
Ph.D thesis. Functional analysis of the effet of T cells and antigen presenting cells on humoral immune response of FcRn transgenic animals
Ph.D thesis Functional analysis of the effet of T cells and antigen presenting cells on humoral immune response of FcRn transgenic animals Anita Farkas Supervisor: Imre Kacskovics DVM, Ph.D János Matkó
KockaKobak Országos Matematikaverseny 8. osztály
KockaKobak Országos Matematikaverseny 8. osztály 2014. november 27. A feladatsort készítette: KÓSA TAMÁS, középiskolai tanár PÉCSI ISTVÁN, középiskolai tanár Lektorálta: SZÉP JÁNOS, középiskolai tanár
metzinger.aniko@chem.u-szeged.hu
SZEMÉLYI ADATOK Születési idő, hely: 1988. június 27. Baja Értesítési cím: H-6720 Szeged, Dóm tér 7. Telefon: +36 62 544 339 E-mail: metzinger.aniko@chem.u-szeged.hu VÉGZETTSÉG: 2003-2007: III. Béla Gimnázium,
Extraktív heteroazeotróp desztilláció: ökologikus elválasztási eljárás nemideális
Ipari Ökológia pp. 17 22. (2015) 3. évfolyam, 1. szám Magyar Ipari Ökológiai Társaság MIPOET 2015 Extraktív heteroazeotróp desztilláció: ökologikus elválasztási eljárás nemideális elegyekre* Tóth András
AZ ANYA-MAGZATI FELSZÍN IMMUNOLÓGIÁJA ÉS AZ ANYAI IMMUNRENDSZER SZISZTÉMÁS VÁLTOZÁSAI TERHESSÉG SORÁN
AZ ANYA-MAGZATI FELSZÍN IMMUNOLÓGIÁJA ÉS AZ ANYAI IMMUNRENDSZER SZISZTÉMÁS VÁLTOZÁSAI TERHESSÉG SORÁN AZ ANYAI IMMNVÁLASZT BEFOLYÁSOLÓ TÉNYEZŐK MAGZATI ANTIGEN BEMUTATÁS (TROPHOBLAST) B TH1/TH2 BALANCE
19.Budapest Nephrologiai Iskola/19th Budapest Nephrology School angol 44 6 napos rosivall@net.sote.hu
1.sz. Elméleti Orvostudományok Doktori Iskola 3 éves kurzus terve 2011/2012/ 2 félév - 2014/2015/1 félév 2011//2012 tavaszi félév Program sz. Kurzusvezető neve Kurzus címe magyarul/angolul Kurzus nyelve
AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, TILLING
Hagyomány és haladás a növénynemesítésben AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, BÁLINT ANDRÁS FERENC 1, SZIRA FRUZSINA 1, ANDREAS BÖRNER 2, KERSTIN
A kommunikáció és az információmegosztás mennyiségi vizsgálata a rehabilitációs teamben a kommunikáció mennyiségi vizsgálóeljárásnak bemutatása
Orvosi Rehabilitáció és Fizikális Medicina Magyarországi Társasága XXIX. Vándorgyűlése Szeged, 2010. szeptember 2-4. A kommunikáció és az információmegosztás mennyiségi vizsgálata a rehabilitációs teamben
A fog extracelluláris mátrixának és mikrocirculációjának vizsgálata
46793 SZÁMÚ IFJÚSÁGI OTKA PÁLYÁZAT ZÁRÓJELENTÉSE OTKA pályázat címe: A fog extracelluláris mátrixának és mikrocirculációjának vizsgálata Témavezető: Dr. Felszeghy Szabolcs 1 AZ EGYES CÉLTERÜLETEK KUTATÁS
Intelligens Ágensek Evolúciója (Evolution of Intelligent Agents) Készítette: Kovács Dániel László Budapest Műszaki és Gazdaságtudományi Egyetem V il l
DIPLOMATERV K o v á c s D á n i e l L á s z l ó 2 0 0 3. Intelligens Ágensek Evolúciója (Evolution of Intelligent Agents) Készítette: Kovács Dániel László Budapest Műszaki és Gazdaságtudományi Egyetem
A CMDh megvizsgálta a PRAC alábbi, a tesztoszteron tartalmú készítményekre vonatkozó ajánlását:
II. melléklet Tudományos következtetések és a forgalomba hozatali engedélyek feltételeinek feltételekhez kötésben álló módosításának indoklása, valamint a PRAC ajánlástól való eltérések tudományos indoklásának
A Zuprevo preventív hatékonysága a szarvasmarha légzôszervi betegségének Mannheimia haemolytica ráfertôzéssel végzett vizsgálatában
szarvasmarha 2012. szeptember 17. A Zuprevo preventív hatékonysága a szarvasmarha légzôszervi betegségének Mannheimia haemolytica ráfertôzéssel végzett vizsgálatában Markus Rose, Wibke Metz, Joachim Ullrich,
Oszvald Mária. A búza tartalékfehérjék tulajdonságainak in vitro és in vivo vizsgálata rizs modell rendszerben
Budapesti Műszaki és Gazdaságtudományi Egyetem Alkalmazott Biotechnológia és Élelmiszertudományi Tanszék PHD ÉRTEKEZÉS TÉZISEI Készítette: Oszvald Mária A búza tartalékfehérjék tulajdonságainak in vitro
Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)
0.1 Member State HU 0.2.1 Species code 4110 0.2.2 Species name Pulsatilla pratensis ssp. hungarica 0.2.3 Alternative species Pulsatilla flavescens scientific name 0.2.4 Common name magyar kökörcsin 1.
Az Európai Unió magánjogi irányelvei és az új Polgári Törvénykönyv
6C78 9N:;< =8>:?N7:8?@ B?D8F =7TI:?J@ 1@ K LKMPKQ KMRSKKP Az Európai Unió magánjogi irányelvei és az új Polgári Törvénykönyv G o Eo! "#$%&o$"'( Összefoglalás. A) *+ o, ö-ö.-)k$ -o $ #p o-$ + $-)$$ ' o
Áfa 4 Sílér, Felelős szerkesztő és laptulajdonos: Kun Béla. d. u. fél öt órakor a vásárféri pályán mérkőzést t a r t a n a k a
H 94* í 28 p V Á Á F í
The mechanism of T cell apoptosis caused by soluble and cellderived Gal-1; a comparative study to determine the physiological effect of Gal-1
The mechanism of T cell apoptosis caused by soluble and cellderived Gal-1; a comparative study to determine the physiological effect of Gal-1 Andrea Blaskó Ph.D. thesis Supervisor: Éva Monostori Ph.D.,
Az Src-típusú tirozin-kinázok nélkülözhetetlenek az autoantitest-függő gyulladásos betegségek kialakulásához
Az Src-típusú tirozin-kinázok nélkülözhetetlenek az autoantitest-függő gyulladásos betegségek kialakulásához Doktori tézisek dr. Kovács Miklós Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola
NANOEZÜST ALAPÚ ANTIBAKTERIÁLIS SZÓRHATÓ SZOL KIFEJLESZTÉSE MŰANYAG FELÜLETEKRE
NANOEZÜST ALAPÚ ANTIBAKTERIÁLIS SZÓRHATÓ SZOL KIFEJLESZTÉSE MŰANYAG FELÜLETEKRE Gábor Tamás1, Hermann Zsolt2, Hubai László3 1: PhD, 2: kutató, 3: kutató NANOCENTER Kft. BEVEZETÉS A nanorészecskéket tartalmazó
Correlation & Linear Regression in SPSS
Correlation & Linear Regression in SPSS Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise 1 - Correlation File / Open
repolarizációs tartalék
A projekt négy munkaévében, a kutatási tervben kitűzött céloknak megfelelően, az antiaritmiás és proaritmiás hatás mechanizmusában szereplő tényezők vizsgálatára került sor, amely az alábbi fontosabb új
Azobezitás és a sejtek metabolizmusának összefüggései, a diabetes és táplálkozás viszonya
Azobezitás és a sejtek metabolizmusának összefüggései, a diabetes és táplálkozás viszonya Máthé Endre, Sipos Péter, Remenyik Judit, Vígh Szabolcs, Horváth Brigitta Debreceni Egyetem, Mezőgazdaság, Élelmiszertudományi
dc_250_11 1. Bevezetés 3
MTA DOKTORI ÉRTEKEZÉS TÉZISEI TARTALOMJEGYZÉK NADPH-OXIDÁZ ÉS PEROXIDÁZ ENZIMEK VIZSGÁLATA EMLŐS SEJTEKBEN 1. Bevezetés 3 2. Tudományterületi háttér 3 2.1 Reaktív oxigén származékok (ROS) 3 2.2 A NADPH
1918 December 1 út, 15/H/4, Sepsiszentgyörgy (Románia) Mobil 0040 748239263 biro_biborka@yahoo.com
Europass Önéletrajz Személyi adatok Vezetéknév (nevek) / Utónév (nevek) Cím(ek) Bíró Bíborka Eszter 1918 December 1 út, 15/H/4, Sepsiszentgyörgy (Románia) Mobil 0040 748239263 E-mail(ek) biro_biborka@yahoo.com
A TAKARMÁNYOK FEHÉRJE TARTALMÁNAK ÉS AMINOSAV ÖSSZETÉTELÉNEK HATÁSA A TOJÓHIBRIDEK TELJESÍTMÉNYÉRE
A TAKARMÁNYOK FEHÉRJE TARTALMÁNAK ÉS AMINOSAV ÖSSZETÉTELÉNEK HATÁSA A TOJÓHIBRIDEK TELJESÍTMÉNYÉRE HORÁK A. P. HALAS V. CZÁR D. - TISCHLER A. TOSSENBERGER J. Összefoglalás A nagy teljesítményre képes genotípusok