MOLECULAR CHARACTERISATION OF APPLE VARIETIES AND IDENTIFICATION OF RESISTANCE GENE ANALOGS
|
|
- Bence Halász
- 9 évvel ezelőtt
- Látták:
Átírás
1 Szent István University Gödöllő Plant Science Phd School Head of the school: Dr. László Heszky Plant genetics and biotechnology Program leader: Dr. László Heszky MOLECULAR CHARACTERISATION OF APPLE VARIETIES AND IDENTIFICATION OF RESISTANCE GENE ANALOGS PHD THESIS Barnabás Wichmann Gödöllő 2010
2 PhD School: President: Szent István University Plant Science Doctoral School of Plant Science Dr. László Heszky, Professor, member of the Hungarian Academy of Science Szent István University Faculty of Agricultural and Environmental Sciences Institute of Genetics and Biotechnology Scientific branch: Crop and Horticultural Sciences PhD program: Plant genetics and biotechnology Supervisors: Dr. László Heszky, Professor, member of the Hungarian Academy of Science Szent István University Faculty of Agricultural and Environmental Sciences Institute of Genetics and Biotechnology Dr. Zsolt Galli, Research fellow, PhD, Syngenta Seeds Kft, Ócsa Dr. Galli Zsolt Supervisor Dr. Heszky László Supervisor Dr. Heszky László Head of School
3 BACKGROUND AND OBJECTIVES Apple is one of the most widely grown fruits in the world. A total of 71.7 million tons of apple was produced on million hectares in China was the leader of his own more than 2 million hectares and more than 31 million tons of crop quantity (FAOSTAT). Europe's apple production is approximately 16 million tons on 1.25 million hectares. A total of tons apple was produced on hectares of apples in Hungary in Based on this data Hungary was the 7 th according to apple quantity, ahead Romania, Spain and Austria as well (FAOSTAT 2010). With this volume of cropped area only grape proceeded apple production, however, the harvest volume were ahead 25 thousand tons of the 550 thousand tons of grapes in Over the past year, Hungary produced 894 thousand tons of fruit (without grapes) from which more than 60% was the apple s rate (FAOSTAT 2010). From geographical point of view, the most accepted gene center is Alma-Ata t (Father of Apples) in Kazakhstan. In the previous literature, however, many other regions are mentioned. According to others the gene center is in Western-Asia, Central-Asia, Middle-East or Siberia. In the formation of European cultivars: European paradise apple (Malus paradisiaca), European apple (M. sylvestris), Transylvanian crab (M. dasyphylla), Caucasian apple (M. orientalis) and the early crab (M. praecox) were possibly involved. Apple species are characterized by high heterozygosity and considerable genetic variability. Since apple is one of the most cultivated fruit, to solve problems related to its cultivation is a primary task. In our study we deal with solutions for problems in apple production related to plant breeding. During our research we focused on three major problems which will be presented separately. 1.) RESISTANCE GENE ASSOCIATED MARKERS In fruit production the diverse pathogens and pests can cause a significant loss of yield. The chemical control is important and indispensable in some cases, however, the need to reduce the environmental chemical exposure as well as support technologies which cause no danger on human health are increasingly set forth.
4 In these efforts resistance breeding has a priority role since its aims to develop diseases and pathogens resistant cultivars. Further important breeding objectives include self pollination, eco-tolerance, fertility, yield, transportability, storage life and to improve the quality of fruit. In case of resistance the main objectives include development of resistance in cultivars against the two most important fungal disease powdery mildew (Podosphaera leucotricha) and scab (Venturia inaequalis) as well as the bacterial disease fire blight (Erwinia amylovora). The most recent molecular strategies, such as development and application of resistance gene analog (RGA) markers serve this purpose. Resistance genes of various plants show a high degree of structural conservatism against pathogens, they are the so-called nucleotide-binding site (NBS) or leucine-rich repeat (LRR) sequences. Primers designed for these types of sequences allow us to identify markers which are linked to resistance genes in the genome. According to the related literature and the aforementioned results it seemed appropriate to identify and test markers which are closely linked to resistance genes in order to ascertain the presence or absence of resistance gene(s). 2.) MOLECULAR IDENTIFICATION OF HUNGARIAN APPLE GENBANK GENOTYPES AND COMMERCIAL VARIETIES BY SSR MARKERS Increasing number of apple varieties (more than 15 thousand types of the world) requires clear and precise identification of individual genotypes and their good severability from other clones, varieties, etc. For differentation two main groups of marker are used, morphological and molecular markers (now is increasingly common in use). In case of morphological markers the phenotypically appearing inherited properties are often not informative and reliably enough and they can be affected by the environment. In contrast, molecular markers are not influenced by environmental and epistatic effects and their number is unlimited since, in principle, all form of genome and their combinations are suitable for identification.
5 According to the related literature and the aforementioned results it seemed appropriate to develop metholody which is suitable to determine molecular fingerprint in case of each variety studied as well as the use to determine their origin (pedigree). 3.) MOLECULAR DIFFERENTATION OF BUD MUTANTS Bud mutations can also be the starting materials of new varieties. These mutations result phenotypic changes, such as fruit color or shape, size and shape of the tree, branching tendency etc. Bud mutants are basically considered as clones of the basic variety that only differ in one or a few mutant variant allel. According to the related literature and the aforementioned results it seemed appropriate to search and test molecular markers and techniques which could be successfully applied to detect the slight genetic differences existing among bud mutants. For this purpose AFLP (Amplified Fragment Length polymorphism), SSR (Simple Sequence Repeats) markers and a new S-SAP (Sequence-Specific Amplified polymorphism) technique have been involved in our study. Presence of retrotransposons is often revealed in bud mutations. S-SAP approach essentially is polymorphism detection of retrotransposon bordering DNA sequences which may allow the separation of molecular clones of each budmutant groups.
6 OBJECTIVES 1. Our purpose was to detect, analyze and test linked RGAs which are suitable to detect the presence or absence of resistance gene(s) in case of the two most important fungal diseases, powdery mildew (Podosphaera leucotricha), scab (Venturia inaequalis) and the bacterial disease fireblight (Erwinia amylovora). 2. Our purpose was to find SSR markers which are effective to prepare and detect microsatellite fingerprint from genotypes of Apple Genbank Hungary (40 cultivars and varieties). Also our goal was to compare dendrograms resulted by our 6 primers with the 9 SSR markers of the European standard set in case of 37 examined genotypes focusing on their affinity. 3. Our purpose was to find and test such molecular markers and techniques which can successfully detect mutations, their locations in the genome and differentiate among bud mutants. MATERIALS AND METHODS Plant material: Young apple leaves used for DNA purification were collected at the Research and Extension Centre for Fruit Growing, Újfehértó, Hungary. Since the experiments have three main areas the choice of plant material was also different. Resistance gene associated markers (3 resistant and 4 susceptible cultivars) Molecular identification of Hungarian apple genbank genotypes and commercial varieties by SSR markers (40 varieties and 66 commercial cultivars) Molecular differentiation of bud mutants (26 bud mutants from 3-3 bud mutant types and groups) DNA extraction: DNA was isolated from young apple leaves with DNeasy Plant mini kit (Qiagen, Biomarker Kft., Gödöllő) according to the manufacturer s protocol. After DNA isolation the approaches differed each of them are discussed separately:
7 RESISTANCE GENE ASSOCIATED MARKERS Design of degenerated primers From NCBI (National Center for Biotechnology Information) database 10 known resistance gene sequences isolated from different plant species were collected. Amino acid and nucleotide sequences were aligned with BioEdit software (version ) (Hall et al. 1999). The most conserved regions showing only small differences among plant species in their amino acid sequences were selected and degenerate primers were designed based on their nucleotide sequences. Designed oligonucleotides were synthesized by Csertex and BioScience Ltd. PCR reaction with degenerate primers The PCR (Polymerase Chain Reaction) reactions were performed with a Perkin-Elmer GeneAmp 9700 instrument in a final volume of 20 µl. The reaction mixture included the following components: 40 ng template DNA; 1 x PCR buffer; 3 µl dntp; 1.5 µl MgCl 2 ; µl each of the forward and reverse primers; 1.2 U Red-Taq DNA polimerase (Sigma). The cycling profile consisted of an initial denaturation step for 2 min followed by 35 cycles of 10 seconds at 94 C, 30 seconds at 59 C and 60 seconds at 72 C. The amplification process was finished with 5 min extension step at 72 C. Cloning fragments into plasmid vector PCR products were cloned into plasmid vectors by PGEM T-easy vector system (Promega). For ligation the following components were measured: 2 µl PCR product, 1 µl Teasy vector, 5 µl buffer, 1 µl T4 DNA ligase and 1 µl ligase buffer. Mixture was incubated overnight at 16 C. Transformation of competent cells To transform competent cells, Qiagen EZ competent cells (stored at -70 C) were used: 1.5 µl ligatures were added to 200 µl competent cells. After incubation on ice for one hour heat shock was used (90 seconds at 42 C) and 800 ml SOC medium was added. This was followed by culturing at 37 C for one hour then samples were centrifuged for 1 min. Cells were suspended in 100 ml of fresh SOC medium then solid LB medium containing ampicillin (50
8 µg/ml) and selection marker (10 µl X-gal (50 mg/ml); 40 µl (0,1M IPTG) were used for bluewhite selection. Testing of recombinant bacteria - Colony PCR From white colonies growing on selective LB a small part was taken with sterile toothpicks and was suspended in 50 µl sterile water. Then it was placed into boiling water for 5 minutes followed by a 1 minute centrifugation step. 4 µl of the supernatant was used as template for PCR reaction. The reactions contained the following components: 4 µl supernatant; 1 x PCR buffer; 3 µl dntp; 1.5 µl MgCl 2 ; µl of each forward and reverse degenerated primers; 1.2 U Red-Taq DNA polimerase (AgBiotech). The cycling profile consisted of an initial denaturation step of 2 min at 94 C followed by 35 cycles of 20 seconds at 94 C, 30 seconds at 62 C and 60 seconds at 72 C. The amplification process was finished with a 5 min polymerisation at 72 C. Plasmid isolation Plasmid was isolated from positive samples of colony PCR by Plasmid Miniprep kit (BioRad). Exact DNA concentration was determined by NanoDrop ND-1000 spectrophotometer. For sequencing the concentration was adjusted to 100 ng/µl, from which 5 µl (500 ng) was loaded to the capillary electrophoresis device. Sequencing and sequenogram analysis Sequencing reactions were carried out in MBK (Agricultural Biotechnology Center) by ABI Prism 310 (Applied Biosystems) device with the necessary degenerate primers for amplification. Chromas (version: 2.31) computer program was applied for chromatograms. BLAST (Basic Local Alignment Search Tool) analysis was performed at the NCBI website for sequence analysis. Designing and testing of SCAR markers For individual amplification of the previously obtained fragments SCAR (Sequence Characterised Amplified Region) markers were designed by Primer 3 software. After primer synthesis PCR reaction was started with SCAR primers. The PCR reaction differed from the previously described colony PCR only in the primers applied.
9 MOLECULAR IDENTIFICATION OF HUNGARIAN APPLE GENBANK GENOTYPES AND COMMERCIAL VARIETIES BY SSR MARKERS Microsatellite analysis: The PCR reactions were performed in a final volume of 20 µl, the reaction mixture contained the following components: 40 ng template DNA; 1 x PCR buffer; 3 µl dntp; 1.5 µl MgCl 2 ; µl of the forward and reverse SSR primers; 1.2 U Red-Taq DNA polimerase (Sigma). The cycling profile consisted of an initial denaturation step of 2 min followed by 35 cycles of 20 seconds at 94 C, 30 seconds at 57 C and 60 seconds at 72 C. The amplification process was finished with 5 min at 72 C. Microsatellite analysis was performed according to Galli et al. (2005) and Garkava-Gustavsson et al. (2008). Molecular markers used for the study: For microsatellite analysis fluorescent labeled primers were used as follows: CH03g07, CH04g10, CH04e03, CH05c02, CH05d11, CH05e03, CH01d03, CH01h02, CH02c06, CH02c09, CH02c11, CH02d08, CH04c06, CH04e05, COL (Liebhard et al. 2002). ALF-Automatic Laser Fluorescent analysis: PCR products were separated on a 5% denaturing polyacrylamide gel (Reprogel, GE Healthcare Biosciences, AP Hungary Kft., Budapest). Allele sizes were determined with ALFexpress II DNS analyzer (Amersham Biosciences, AP Hungary Kft., Budapest) using ALFexpress TM sizer as a molecular weight standard and Alwin Fragment analyzer software. Evaluation of allele size data: For cluster analysis, each detectable allele was scored as present (1) or absent (0) in all varieties. This resulted in a 40 X 71 matrix in case of the 6SSR marker and a 37 X 87 binary matrix in case of European markers. When commercial cultivars were involved into the comparison a 105 X 78 matrix was applied for similarity detection. All earlier described alleles (Galli et al. 2005) were present in case of varieties, however, some extra alleles were determined only in varieties. When the two set (6 and 8 SSR) were examined together a 37 X 158 matrix was applied. European markers were applied in case of bud mutants (27 X 107 matrix) as well. For further analysis unweighted pair group method using arithmetic means (UPGMA) was used and dendrogram was constructed based on Jaccard s similarity
10 coefficients (Jaccard 1908) by the statistic software package SPSS 17.0 for Windows (SPSS Inc., USA). Based on the frequencies of observed microsatellite alleles, Polymorphism Information Content (PIC) was calculated by the formula: PIC=1 pi 2, where pi is the frequency of the ith allele of each SSR marker (Anderson et al. 1993). It is essentially the same as the index of heterozygosity. To find the optimal combination and minimum set of markers for identification, 40 different varieties (N=40) were analyzed according to Tessier et al. (1999). The probability of identity (PI) of obtaining the same SSR profile for two randomly chosen apple cultivars was calculated by the: PI = j j= C j 1 formula. MOLECULAR DIFFERENTATION OF BUD MUTANTS Microsatellite analysis: The 9 applied pairs of oligonucleotide primers belong to the standard set defined by the European working group on apple genetic resources. The PCR reaction and the evaluation of alleles are identical with the previously descibed approach under the heading Molecular identification of hungarian apple genbank genotypes and commercial varieties by SSR markers. AFLP analysis: By using AFLP technique it is possible to detect one base pair difference. Restriction endonucleases (adaptors: EcoRI 33, EcoRI 36, EcoRI 37, EcoRI 44, MseI 48, MseI 55, MseI 60, MseI 61) were applied in order to increase sensitivity. Detection was performed in polyacrylamide gels. S-SAP analysis: Altogether, three Ret-LTR primers were designed (Ret-LTR1: 5 AAA TGG AGT GAC AGA CGG GT 3, Ret-LTR2: 5 GGA GGG TTT TGA GGG ATG TG 3, Ret-LTR3: 5 CCT TCG GGA TGG GGT GTG TC 3 ) for the long terminal repeat (LTR) regions of all available apple retrotransposon sequences (NCBI IDs: AJ291492, DQ898280, AM167520) until the start of this project. These primers were labeled by Cy-5 and were used in S-SAP
11 analysis with a combination of pne AFLP primer. PCR products were diluted to 20x and used for selective amplification where one labeled Ret-LTR primer was used in combination with an adaptorspecific primer that included three additional selective nucleotides at the 3 end (Mse-48: 5 ~ CAC 3 vagy Mse-55: 5 ~ CGA 3 vagy Mse-60: 5 ~ CTC 3 vagy Mse-61: 5 ~ CTG 3 vagy Eco-33: 5 ~AAG 3 vagy Eco-36: 5 ~ACC 3 vagy Eco-37: 5 ~ACG 3 vagy Eco-44: 5 ~ATC 3 ). RESULTS RESISTANCE GENE ASSOCIATED MARKERS The applied molecular approaches: bioinformatic analysis of NCBI database, design of degenerate primers and PCR reaction with degenerate primers. Cloning fragments into plasmid vector, then transforming competent cells. Testing recombinant bacteria - colony PCR. Plasmid isolation, sequencing and evaluation of sequences. SCAR marker design and testing. We were looking for sequences that are identical in different plant species or at least show a high rate of homology. We were seeking conserved regions of plant resistance genes in NCBI gene bank for designing degenerate primers. Bioedit software was applied for alignment of different conserved regions from different plants. With these primers we were able to amplify fragments from both TIR-NBS-LRR and CC- NBS-LRR type resistance genes. After designing the primers PCR reactions were started using isolated DNA from resistant and susceptible genotypes as template. Since it is wellknown that in plant genome hundreds of this kind of sequence exists we expected that we might obtain fragments which appear only in resistant genotypes. Unfortunately, we could not detect any size difference. Same size fragments were obtained in high copy number for disease resistant and susceptible genotypes as well. Subsequently, amplified fragments with TIR1 F-and P-loop-R degenerate primers were cloned into pgem T-easy vector. For ligation PCR products were used in order to clone all sequences which have the same size but differ in sequence. From white colonies regrown in selective medium masterplate was created.
12 PCR was started with the same degenerate primers from colonies which remained white after a few days. With these primers amplification of the fragments was performed. With this approach we have propagated the unique cloned sequences. Purified plasmid DNA was isolated from 12 colonies which were positive with colony PCR. For fragment sequencing T7 and SP6 universal primers were used. Their nucleotide sequences were converted into amino acid sequences by Bioedit software then similarity was examined with other RGA candidates at amino acid level. With BLAST application protein sequences which probably have an important role in various resistances were compared to our amino acid sequences. The evaluation revealed that 5 RGA candidates (NCBI ID: EF EF455017) do not contain any sequence motifs essential in resistance development according previous publications. These motifs are present in each resistance gene and RGA. However, in case of other 9 RGAs, the alignment proved that resistance patterns (P-loop, RNSB-A, Tyrosine kinase-2, RNSB-B,-C RNSB, GLPL) are present and show high level of homology at amino acid level with previously descibed RGA sequences. In order to identify these RGAs, these were converted to SCAR markers. In all cases (resistant, susceptible subjects) - except for one genotype - SCAR markers reproduced the same size of fragment. Since plant genome contains even hundreds of sequences which contain the conserved regions that we tested, it is possible that the isolated fragments are responsible for the general resistance of plants. Only in case of Arga-4 primer a fragment without difference between resistant and susceptible subjects was received. There was no amplified fragment in case of 'Remo' variety. As in the rest of resistant subjects amplified fragments were detected in all case, we conclude that a mutation might have happened at the primer hybridization site in case of 'Remo' and this is why Arga-4 SCAR marker is not successful for fragment amplification. Further tests are necessary.
13 MOLECULAR IDENTIFICATION OF HUNGARIAN APPLE GENBANK GENOTYPES AND COMMERCIAL VARIETIES WITH SSR MARKERS Applied molecular techniques: selection of SSR primers and start of PCR reaction. Determination of allele sizes on polyacrylamide gel, statistical evaluations and dendrogram preparation. Each of the applied 6 SSR generated reliable microsatellite alleles in all 40 genotypes (cultivars, varieties). A total of 71 polymorphic alleles were amplified (average 11.8 allele / locus) and average PIC values (0.8) of markers proved to be high. The repeated PCR reactions showed the same results. The probability of that two randomly chosen varieties display the same genotype at all investigated loci was calculated to be very low ( which means 1 : 39525). This confirms the high potential of SSRs for differenetation of apple varieties. In the next step the similarity matrices were calculated from 66 previously described commercial cultivars (Galli et al. 2005) in order to compare the results with that of the varieties. In case of commercial varieties PIC values were very high, especially in case of CH04e03, CH05d11 markers. However, according to PIC values the examined varieties (40) were more different from each other (average PIC: 0.8) than the commercial varieties (average PIC: 0.72). The comparison also showed that there are many more similarities among varieties than among the tested commercial cultivars. The comparison of PIC results also shows that the ancestors of commercial cultivars presumably with a much smaller plant material have been selected since the average PIC values showed a smaller value than in case of varieties. In the next step, "European Standard marker set was adopted for 37 varieties. A total of 84 polymorphic alleles were amplified (average 10.5 allele / locus) and average PIC values (0.72) of markers proved to be high. CH02c06 marker proved to be the best with its 15 alleles for distinction while CH04c06 proved to be the weakest with its 4 amplified alleles. Two markers (CH0406 and CH01h02) proved to be multi loci.
14 CH05d11 (0.86) and CH05e03 (0.84) markers showed high PIC values comparing with markers from European Standard set markers. In our opinion, it would be worth to replace multi loci markers (CH01h02 and CH04c06) to marker CH05d11 and CH05e03 and this would increase the suitability of the series (average PIC would increase from 0.78 to 0.84). When comparing the dendrogram results of the two marker sets, only Újvári őszi and Nyári fontos show high degree of resemblance. In case of other varieties, however, very significant differences observed. Results of the two analyses were not overlapping, only the extremely high homology can be detected in both cases. The technique because of the results of the two different series is not considered to determinate the relationship between species, however, as the results show, identification and isolation of varieties specifically suited to the SSR technique. With all of these data a webbased databank were established Hungarian Apple Microsatellite Databank (MAMA: Magyar Alma Mikroszatellit Adatbank) containing all SSR allele sizes of the examined cultivars (both commercial and cultivars from this study). Since the aforementioned markers showed enough power to discriminate the cultivars we recommend to employ these for determining the differences and phylogenetic distances of various apple cultivars. The webbased databank may be useful for breeders, breeding agencies and propagate institutes to determinate cultivars since their work could be done easier and more controllable. MOLECULAR DIFFERENTATION OF BUD MUTANTS Applied molecular techniques: SSR, AFLP and S-SAP. Results of fingerprints of varieties proved the reliability to differentiate apple genotypes using microsatellite markers. Based on these results, we tried to discriminate bud mutants molecularly using already described SSR markers. After the 6 set series of SSR markers (Galli et al. 2005) proved to be unsuitable for this purpose the new European SSR set (9 SSR markers) was involved in our experiment. However, we were not able to detect even a single base-pair difference within bud mutants by the high-resolution ALF Express II machine.
15 Subsequently, AFLP technique was applied which can detect one base pair difference. Different restriction enzymes were used in order to increase the resolution. In some cases, we were able to detect fragments successfully which were missing in other sports. However, SCAR markers converted from polymorphic AFLP fragments did not appear to be suitable for the separation of sports. The detectable differences remain unique and have non genotypespecific nature. In this way they were able to detect differences between individuals which was not included among our objectives and not between bud mutants. In conclusion, AFLP technique was not adaptable to detect polymorphism between sports. Since neither SSR nor AFLP techniques were suitable to achieve our goal we involved S-SAP technique for trial. With the development of S-SAP it became possible to detect displacements of retrotransposons within the genome. This technology combines the resolution ability of AFLP technique with selected primer sequence specificity (in this case, the target sequences for LTR elements in the genome). Altogether 24 primer combinations (3 Ret-LTR 8 adaptor specific primers) were carried out, their PCR products were visualized multiple bands were produced (altogether 4368 with the 24 primer combination) suggesting that the copy number of these retrotransposon elements is relatively high in apple genome. Ret-LTR3 + EcoRI-33 primer combination produced the most while Ret-LTR2 + MseI-55 primer combination the less multiple band. Surprisingly, only one combination (Eco- 33 and Ret-LTR1) was appropriate for identifying polymorphism between the progenitor Jonathan and its bud mutants. In other cases, the mutants were indistinguishable from each other; differences were not found even between different individuals within the same somatic mutants. Converting the found bands into a more reliable SCAR marker is under progress. NEW SCIENTIFIC RESULTS RESISTANCE GENE ASSOCIATED MARKERS 14 candidate RGA fragments were cloned and successfully uploaded to the NCBI database. Out of these, 9 sequences after sequencing demonstrated that they are conservative regions of known partially homologous or homologous resistance genes. From this we concluded that we cloned and tested RGA candidates that may be involved in the development of resistance.
16 From the examined 9-RGA markers 8 SCAR markers amplified fragments which were the same in both susceptible and resistant varieties. From this we concluded that we isolated and tested SCAR markers which are available in both resistant and susceptible varieties. They can be specific fragments of genes involved in the response against infection of plants. Only in one case (Arga-4 primer) we were not able to amplify fragment in resistant 'Remo'. Since in case of other cultivars we were able to amlify fragments we suppose that 'Remo' cultivar suffered mutations in the primer link region hereby designed Arga-4 SCAR primer can not amplificate. MOLECULAR IDENTIFICATION OF HUNGARIAN APPLE GENBANK GENOTYPES AND COMMERCIAL VARIETIES BY SSR MARKERS Molecular fingerprints of six loci in case of 40 genotypes (varieties, landraces, and clones) were determined from Hungarian apple gene bank maintained at Újfehértó. Applied primer-pairs for were able to distinguish all six genotypes from each other. Molecular fingerprints of eight loci (European Standard Set) in case of 37 genotypes (varieties, landraces, and clones) were determined from Hungarian apple gene bank maintained at Újfehértó. The results demonstrate that the primers used were useful in molecular characterization of each item. Results from 6 SSR standard and 8 SSR markers were compared and based on this, we proposed to substitute 2 multi-loci markers (CH01h02 and CH04c06) from the standard set to markers (CH05d11 CH05e03) which had given the best results in case of 6 SSR markers. These can further improve average PIC values (0.78 -> 0.84). 37 genotypes (varieties, landraces) from the Hungarian apple gene bank collection were analized with two different series of primers (6 and 8 SSR primers). Dendrograms demonstrated that SSR method is indeed capable of distinguishing among species, however, is unsuitable to determine genetic distance of species. We took part in the creation and expansion of Hungarian Apple Microsatellite Database. MOLECULAR DIFFERENTATION OF SPORTS Molecular technique (SSR, AFLP) failed to discriminate between different apple clones and their progenitors. This may lead to the conclusion that the testing methods of the genome noncoding part are unsuitable for the molecular detection of differences between sports.
17 The increasing number of experimental results indicates that retrotransposons are involved in the molecular background of bud mutants. With the use of retrotransposon sequencespecific approach (S-SAP method) we were able to differentiate between 'Jonathan' basic varietie from and bud mutants. REFERENCES Anderson JA, Churchill GA, Autrique JE, Tanksley SD & Sorrels ME (1993): Optimizing parental selection for genetic linkage maps. Genome 36: FAOSTAT szeptember 02.: Galli Z, Halász G, Kiss E, Dobránszki J, Heszky LE (2005) Molecular Identification of Commercial Apple Cultivars with Microsatellite Markers. HortScience 40 (7): Garkava-Gustavsson L, Kolodinska Brantestam A, Sehic J, Nybom H (2008). Molecular characterisation of indigenous Swedish apple cultivars based on SSR and S-allele analysis Hereditas 00: Lund, Sweden. eissn Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41: Jaccard P (1908): Nouvelles recherches sur la distribution florale. Bull. Soc. Vaud. Sci. Nat. 44: Liebhard R, L Gianfranceschi, B Koller, CD Ryder, R Tarchini, E Van De Weg, and C Gessler (2002) Development and characterization of 140 new microsatellites in apple (Malus domestica Borkh.). Mol. Breed. 10: Tessier CJ, David P, This J, Boursiquot M & Charrier A (1999): Optimization of the choice of molecular markers for varietal identification in Vitis vinifera L. Theor. Appl. Genet. 98:
18 Publications I. Publications related to the thesis: Articles (English): 1. Wichmann B, Galli Z, Molnár S, Galbács Z, Kiss E, Szabó T, Heszky L (2007). Molecular identification of old Hungarian apple varieties. International Journal of Horticultural Science 13 (3) Galli Z, Wichmann B, Molnár S, Galbács Z, Kiss E, Szabó T, Heszky L (2008). Molecular fingerprinting of apple sport mutants. International Journal of Horticultural Science 14 (3): Articles (Hungarian): 1. Wichmann B, Galli Zs, Kiss E, Szabó T, Heszky L (2008). Régi magyar alma tájfajták genetikai elkülönítése SSR primerek segítségével. Agrár és Vidékfejlesztési Szemle 3:(2) pp Wichmann B, Galli Zs, Szabó T, Kovács L, Heszky L, Kiss E (2010). Alma kereskedelmi és tájfajták elkülönítése európai standard SSR markerekkel. Kertgazdaság 42:(1) pp Lectures and abstracts: English: 1. Galli Zsolt, Wichmann Barnabás, Molnar Stella, Galbács Zsuzsanna, Kiss Erzsebet, Szabo Tibor, Heszky Laszlo (2008): Molecular Fingerprinting of Apple Sport Mutants, International Conference; Molecular Mapping and Marker Assisted Selection in Plants; Vienna, Austria, February 3-6, 2008 Abstract of Poster Presentation, p Galli Zs., Wichmann B., Halász G., Kiss E., Szabó T., Heszky L. (2008). Microsatellite fingerprinting of commercial apple cultivars and land varieties. Modern Variety Breeding for Present and Future Needs. Proceedings of 18th EUCARPIA General Congress. Valencia 9-12 September p Galli Zsolt, Wichmann Barnabás, Molnár Stella, Galbács Zsuzsanna, Kiss Erzsébet, Szabó Tibor, Heszky László (2008). Molecular Fingerprinting of Apple Sport Mutants. International Conference (Molecular mapping & marker assisted selection in plants), Vienna, 3-6 February. Book of abstracts p. 52. Hungarian 1. Galbács Zsuzsanna, Molnar Stella, Halasz Gabor, Hoffmann Sarolta, Veres Aniko, Galli Zsolt, Szıke Antal, Tóth Zsófia, Pilinszky Katalin, Wichmann Barnabas, Kiss Erzsebet, Kozma Pal, Heszky Laszlo (2006): Mikroszatellit ujjlenyomat alkalmazasa
19 hungaricum szőlőfajtak pedigre elemzesere. Uj tipusu gazdasagi kihivasok es valaszok a bolognai folyamatban. Debreceni Egyetem Mezıgazdaságtudományi Kar, Szent István Egyetem Mezıgazdságtudományi Kar közös tudományos ülése. Debrecen, december Galbács Zsuzsanna, Molnár Stella, Halász Gábor, Veres Anikó, Galli Zsolt, Szőke Antal, Koncz Tímea, Debreceni Diana, Wichmann Barnabas, Pilinszky Katalin, Tóth Zsófia, Szadeczky-Kardoss Bence, Kiss Erzsébet, Heszky Laszló (2007): Szőlőfajták genotipusának meghatározasa DNS markerekkel, VII. Magyar Genetikai Kongresszus, XIV. Sejt- és Fejlődésbiológiai Napok Balatonfüred április Összefoglalók, p Galbács Zsuzsanna, Molnár Stella, Halász Gábor, Veres Anikó, Galli Zsolt, Szőke Antal, Koncz Timea, Debreceni Diana, Wichmann Barnabas, Pilinszky Katalin, Tóth Zsófia, Szadeczky-Kardoss Bence, Kiss Erzsebet, Heszky Laszlo (2007): Szőlőfajtak genotipizalasa mikroszatellit, kloroplasztisz-specifikus, retrotranszpozon eredető es genspecifikus markerekkel, XIII. Növénynemesítési Tudományos Napok, XIII. Scientific Days of Plant Breeding Budapest MTA marcius 12. Osszefoglalok, p Wichmann Barnabas, Galli Zsolt, Balazs Barnabas David, Molnar Stella, Galbács Zsuzsanna, Kiss Erzsebet, Szabo Tibor, Heszky Laszlo (2007): Rezisztenciagen analog markerek azonositasa almaban. Lippay Janos- Ormos Imre- Vas Karoly Tudomanyos Ulesszak, Budapest, november 7-8. p Wichmann Barnabas, Galli Zsolt, Balazs Barnabas David, Galbács Zsuzsanna, Molnar Stella, Kiss Erzsebet, Szabo Tibor, Heszky Laszlo (2007): Rezisztenciagen analog (RGA) markerek azonositasa almaban, XIII. Növénynemesítési Tudományos Napok, XIII. Scientific Days of Plant Breeding Budapest MTA marcius 12. Összefoglalók, p Molnar Stella, Galbács Zsuzsanna, Halasz Gabor, Veres Aniko, Galli Zsolt, Szőke Antal, Hoffmann Sarolta, Wichmann Barnabas, Kiss Erzsebet, Heszky Laszlo, Kozma Pal (2007): A Muscadinia rotundifolia eredetű Run1 gennel kapcsolt DNS markerek alkalmazasa lisztharmattal szemben rezisztens szőlő genotipusok szelekciojara, VII. Magyar Genetikai Kongresszus, XIV. Sejt- és Fejlődésbiológiai Napok. Balatonfured aprilis Összefoglalók, p Wichmann Barnabás, Galli Zsolt, Balázs Dávid, Galbács Zsuzsanna, Molnár Stella, Szabó Tibor, Kiss Erzsébet, Heszky László (2007). Rezisztenciagén Analóg Markerek Azonosítása Almában. Lippay János Ormos Imre Vas Károly Tudományos Ülésszak, Budapest november Galli Zsolt, Wichmann Barnabas, Galbács Zsuzsanna, Molnar Stella, Kiss Erzsebet, Szabo Tibor, Heszky Laszlo (2008): Jonathan rugymutansok molekularis elkulonitese S- SAP markerekkel, XIV. Növénynemesítési Tudományos Napok, XIV. Scientific Days of Plant Breeding Budapest MTA marcius 12. Osszefoglalok, p Wichmann Barnabas, Galli Zsolt, Balazs David, Molnar Stella, Galbács Zsuzsanna, Kiss Erzsebet, Szabo Tibor, Heszky Laszlo (2008): Alma tajfajtak elkülönítése mikroszatellit ujjlenyomat segitségével XIV. Növénynemesítési Tudományos Napok, XIV. Scientific Days of Plant Breeding Budapest MTA marcius 12. Osszefoglalok, p Galli Zs., Penksza K., Wichmann B., Kiss E., Heszky L. (2008). Molekuláris taxonómiai és polimorfizmus vizsgálatok Festuca fajokon. Multifunctional Agriculture. International Scientific Conference, Hódmezővásárhely, április Agrár- és Vidékfejlesztési Szemle, 3 (1):27
20 11. Galli Zsolt, Wichmann Barnabás, Molnár Stella, Galbács Zsuzsanna, Kiss Erzsébet, Szabó Tibor, Heszky László (2008). Jonatán Rügymutánsok Molekuláris Elkülönítése S-SAP Markerekkel. XIV. Növénynemesítési Tudományos Napok Összefoglalók, p Wichmann Barnabás, Galli Zsolt, Balázs Dávid, Molnár Stella, Galbács Zsuzsanna, Kiss Erzsébet, Szabó Tibor, Heszky László (2008). Alma tájfajták elkülönítése mikroszatellit ujjlenyomat segítségével. XIV. Növénynemesítési Tudományos Napok Összefoglalók, p.63. II. Publications not related to the thesis: Articles (English): 1. Galamb O, Spisák S, Sipos F, Tóth K, Solymosi N, Wichmann B, Krenács T, Valcz G, Tulassay Z, Molnár B (2009). Reversal of gene expression changes in the colorectal normal-adenoma pathway by NS398 selective COX2 inhibitor. British Journal of Cancer. IF: 4,346. Times Cited: 3 2. Spisák S, Galamb B, Sipos F, Galamb O, Wichmann B, Solymosi N, Nemes B, Molnár J, Tulassay Z, Molnár B (2009). Applicability of antibody and mrna expression microarrays for idetifing diagnostic and progression markers of early and late stage colorectal cancer. Disease Markers. IF: Firneisz G, Varga T, Lengyel G, Fehér J, Ghyczy D, Wichmann B, Selmeci L, Tulassay Zs, Rácz K, Somogyi A(2010). Serum Dipeptidyl Peptidase-4 Activity in Insulin Resistant Patients with Non- Alcoholic Fatty Liver Disease: A Novel Liver Disease Biomarker. PLoS ONE 5(8): e doi: /journal.pone IF: Sipos F, Galamb O, Wichmann B, Krenács T, Tóth K, Leiszter K, Müzes Gy, Zágoni T, Tulassay Zs, Molnár B (2010). Peripheral blood based discrimination of Ulcerative colitis and Crohn s disease from non-ibd colitis by genome-wide gene expression profilling. Disease Markers. IF: Articles (Hungarian): 1. Galbács Zs., Molnár S., Halász G., Hoffmann S., Veres A., Galli Zs., Szőke A., Tóth Zs., Pilinszky K., Wichmann B., Kiss E., Kozma P., Heszky L. (2007). Mikroszatellit ujjlenyomat alkalmazása hungaricum szőlőfajták pedigré elemzésére. Debreceni Egyetem Agrártudományi Közlemények, Acta Agraria Debreceniens. 27: Spisák S, Galamb B, Wichmann B, Sipos F, Galamb O, Solymosi N, Nemes B, Tulassay Z, Molnár B (2009). Vastagbéldaganatok ellenanyag-microarray-vel kimutatott, TMA-validált progressziós markerei. Orvosi Hetilap; 150 (34): Tóth K, Galamb O, Spisák S, Wichmann B, Sipos F, Leiszter K, Molnár J, Molnár B, Tulassay Z (2009). Szabad DNS-alapú vastagbéldaganat-szűrés perifériás vérből: a metilált szeptin-9 génmarker lehetőségei. Orvosi Hetilap; 150 (34): Valcz G, Krenács T, Sipos F, Wichmann B, Tóth K, Leiszter K, Balogh Zs, Csizmadia A, Hagymási K, Műzes Gy, Masszi T, Molnár B, Tulassay Zs (2009). A csontvelői eredetű őssejtek megjelenése az ép vastagbélhámban és a gyulladást követő hámregenerációban. Orvosi Hetilap; 150 (40): Szentes Szilárd, Wichmann Barnabás, Házi Judit, Tasi Julianna, Penksza Károly (2009): Vegetáció és gyep produkció havi változása badacsonytördemici szürkemarha legelőkön és kaszálón. Tájökológiai lapok 7. évf. 2. sz:
21 6. Szentes Sz., Wichmann B., Házi J., Penksza K. (2009): Vegetáció és gyepprodukció havi változása badacsonytördemici szürkemarha legelőkön és kaszálón. Gyepgazdálkodási Közlemények 7: (in press) 7. Penksza K., Wichmann B., Szentes Sz. (2009): Legelők fajkészletének vizsgálata gyepgazdálkodási szempontokat figyelembe véve a Tapolcai és a Káli-medencében. Gyepgazdálkodási Közlemények 7: (in press) Lectures and abstracts: English: 1. Galamb O, Sipos F, Spisák S, Tóth K, Solymosi N, Wichmann B, Krenács T, Valcz G, Jász O, Molnár B, Tulassay Z (2009). Reversal of gene expression pattern changes in the colorectal normal-adenoma but less in the normal-carcinoma pathway by NS-398 selective COX-2 inhibitor. GASTRO 2009 (UEGW/WCOG), London. 2. Leiszter K, Sipos F, Galamb O, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B, Tóth K, Valcz G, Molnár B, Tulassay Z (2009). Evaluation of proliferative/apoptotic ratio and mitotic index in histologically intact children colon samples and in adult adenoma-dysplasia-carcinoma sequence. GASTRO 2009 (UEGW/WCOG), London. 3. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Jász O, Valcz G, Tulassay Z, Molnár B (2009). Septin 9 mrna, protein expression and methylated DNA level in colorectal adenomadysplasia-carcinoma sequence. GASTRO 2009 (UEGW/WCOG), London. 4. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Kalmár A, Valcz G, Tulassay Z, Molnár B (2009). Peripheral blood biomarkers of colorectal adenomas, circulating mononuclear cells enriched in follicles are the information transporters. GASTRO 2009 (UEGW/WCOG), London. 5. Galamb O, Sipos F, Wichmann B, Spisák S, Krenács T, Tóth K, Leiszter K, Jász O, Tulassay Z, Molnár B (2009). Colorectal cancer and adenoma specific discriminatory transcript sets validated on independent biopsy samples. 11th European Bridging Meeting in Gastroenterology, Belgrád. 6. Leiszter k, Sipos F, Galamb O, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B, Tóth K, Valcz G, Jász O, Kalmár A, Molnár B, Tulassay Z (2009). Evaluation of proliferative/apoptotic ratio and mitotic index in histologically intact children colon samples and in adult adenoma-dysplasia-carcinoma sequence. 11th European Bridging Meeting in Gastroenterology, Belgrád. 7. Galamb O, Sipos F, Spisák S, Tóth K, Solymosi N, Wichmann B, Krenács T, Molnár B, Tulassay Z (2009). Reverse effect of NS-398 selective COX2 inhibitor on adenoma- and CRC-associated gene expression changes. Magyar Gasztroenterológiai Társaság 51. Nagygyűlése, Tihany. 8. Spisak S, Galamb O, Wichmann B, Solymosi N, Sipos F, Toth K, Kalmar A, Tulassay Z, Molnar B (2009). Identification of methylation related biomarkers by whole genome microarrays from laser microdissected (LCM) colonic cells. Magyar Gasztroenterológiai Társaság 51. Nagygyűlése, Tihany. 9. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Valcz G, Tulassay Z, Molnár B (2009). mrna and protein expression of septin 9 gene and methylation analysis in colorectal adenomadysplasia-carcinoma sequence. Magyar Gasztroenterológiai Társaság 51. Nagygyűlése, Tihany. 10. Leiszter K, Sipos F, Galamb O, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B, Tóth K, Valcz G, Molnár B, Tulassay Z (2009). Evaluation of proliferative/apoptotic ratio in adult adenoma-dysplasiacarcinoma sequence and in histologically intact children colon samples. Magyar Gasztroenterológiai Társaság 51. Nagygyűlése, Tihany. 11. Galamb O, Sipos F, Spisák S, Tóth K, Solymosi N, Wichmann B, Krenács T, Molnár B, Tulassay Z (2009) Reversal of gene expression pattern changes in the colorectal normal-adenoma but less in the normal-carcinoma pathway by NS-398 selective COX-2 inhibitor Digestive Disease Week, USA, Chicago. 12. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Vlacz G, Tulassay Z, Molnár B (2009) Septin 9 mrna, protein expression and methylated DNA level in colorectal adenoma-dysplasiacarcinoma sequence Digestive Disease Week, USA, Chicago. 13. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Kalmár A, Valcz G, Tulassay Z, Molnár B (2010). Colorectal polyps screening in blood by array RT-PCR-circulating mononuclear cells enriched in follicles are the information transporters. 12th European Bridging Meeting in Gastroenterology, Berlin. 14. Leiszter K, Galamb O, Sipos F, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B, Tóth K, Valcz G, Patai ÁV, Kalmár A, Jász O, Tulassay Z, Molnár B (2010). Dissimilar apoptosis in healthy adults and
22 children colonic biopsy samples Gene expression imbalance of pro- and anti-apoptotic genes between colorectal cancer and normal epithelium. 12th European Bridging Meeting in Gastroenterology, Berlin. 15. Galamb O, Sipos F, Wichmann B, Spisák S, Krenács T, Tóth K, Leiszter K, Kalmár A, Tulassay Z, Molnár B (2010). Diagnostic tissue mrna marker sets for array real-time PCR based identification of colorectal adenomas and cancer. 18th United European Gastroenterology Week, Barcelona. 16. Galamb O, Wichmann B, Sipos F, Spisák S, Krenács T, Tóth K, Leiszter K, Kalmár A, Tulassay Z, Molnár B (2010). In silico verification of adenoma and colorectal cancer specific transcript panels on microarray datasets downloaded from Gene Expression Omnibus database. 18th United European Gastroenterology Week, Barcelona. 17. Sipos F, Galamb O, Wichmann B, Krenács T, Tóth K, Leiszter K, Patai ÁV, Műzes G, Zágoni T, Tulassay Z, Molnár B (2010). Peripheral blood based discrimination of ulcerative colitis and Crohn s disease from non-ibd colitis by genome-wide gene expression profiling. 18th United European Gastroenterology Week, Barcelona. 18. Patai ÁV, Galamb O, Kalmár A, Tóth K, Spsiák S, Wichmann B, Leiszter K, Valcz G, Sipos F, Patai Á, Tulassay Z, Molnár B (2010). DNA methylation profile in colorectal cancer versus normal colonic tissue finding new biomarkers for early detection of colorectal cancer. 18th United European Gastroenterology Week, Barcelona. 19. Kalmár A, Spisák S, Galamb O, Wichmann B, Sipos F, Tóth K, Leiszter K, Molnár B, Tulassay Z (2010). Methylation-related biomarker identification by gene expression analysis of lasre microdissected colonic cells. 18th United European Gastroenterology Week, Barcelona. 20. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Patai ÁV, Valcz G, Molnár B, Tulassay Z (2010). RT-PCR based colorectal adenoma screening from peripheral blood circulating mononuclear cells enriched in follicles are the information transporters. 18th United European Gastroenterology Week, Barcelona. 21. Valcz G, Sipos F, Krenacs T, Molnar J, Patai AV, Leiszter K, Toth K, Wichmann B, Molnar B, Tulassay Z (2010). Alteration of potential cell transition events during colorectal adenomadysplasiacarcinoma sequence (ADCS). 18th United European Gastroenterology Week, Barcelona. 22. Galamb O, Sipos F, Wichmann B, Spisák S, Krenács T, Tóth K, Leiszter K, Jász O, Kalmár, A, Schöller A, Tulassay Z, Molnár B (2010). Colorectal cancer and adenoma specific diagnostic biopsy mrna expression profiles confirmed on a large independent sample set. Magyar Gasztroenterológiai Társaság 52. Nagygyűlése, Tihany. 23. Leiszter K, Galamb O, Sipos F, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B, Tóth K, Valcz G, Patai A, Kalmár A, Schöller A, Molnár B, Tulassay Z (2010). Distinct apoptotic activity and mrna expression of pro- and anti-apoptotic genes in colorectal cancer and histologically intact adult and children colon biopsy samples. Magyar Gasztroenterológiai Társaság 52. Nagygyűlése, Tihany. 24. Patai VÁ, Galamb O, Tóth K, Kalmár A, Spisák S, Wichmann B, Jász O, Leiszter K, Valcz G, Sipos F, Schöller A, Tulassay Z, Molnár B (2010). DNA methylation profile in colorectal cancer versus normal colonic tissue-preliminary results. Magyar Gasztroenterológiai Társaság 52. Nagygyűlése, Tihany. 25. Kalmár A, Spisák S, Galamb O, Wichmann B, Sipos F, Tóth K, Schöller A, Molnár B, Tulassay Z (2010). Methylation-related biomarker identification by gene expression analysis of laser microdissected colinic cells. Magyar Gasztroenterológiai Társaság 52. Nagygyűlése, Tihany. 26. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Kalmár A, Valcz G, Schöller A, Tulassay Z, Molnár B (2010). Screening of colorectal polyps from blood mononuclear cells in follicles are the information transporters. Magyar Gasztroenterológiai Társaság 52. Nagygyűlése, Tihany. 27. Galamb O, Sipos F, Wichmann B, Spisák S, Krenács T, Tóth K, Leiszter K, Jász O, Kalmár A, Tulassay Z, Molnár B (2010). Diagnostic biopsy mrna expression profiles of colorectal cancers and polyps. Digestive Disease Week, USA, New Orleans. 28. Leiszter K, Galamb O, Sipos F, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B, Tóth K, Valcz G, Patai ÁV, Kalmar A, Jász O, Molnár B, Tulassay Z (2010). Dissimilar apoptosis in healthy adults and children colonic biopsy samples Gene expression imbalance of pro- and anti-apoptotic genes between colorectal cancer and normal epithelium. Digestive Disease Week, USA, New Orleans. 29. Spisák S, Galamb O, Kalmar A, Wichmann B, Solymosi N, Sipos F, Tóth K, Molnár B, Tulassay Z (2010). Methylation related biomarker identification by analysis of gene expression profile of laser microdissected colonic cells. Digestive Disease Week, USA, New Orleans. 30. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Kalmar A, Valcz G, Tulassay Z, Molnár B (2010). Colorectal polyps screening in blood by array RT-PCR - circulating mononuclear cells enriched in follicles are the information transporters. Digestive Disease Week, USA, New Orleans. 31. Leiszter K, Sipos, F, Galamb O, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B,Tóth K,Valcz G, Kalmar A, Jász O, Molnár B, Tulassay Z (2010). Analysis of proliferative/apoptotic ratio, mitotic index
23 Hungarian: and apoptotic index in histologically intact children colonic biopsy samples and colorectal adenomadysplasia-carcinoma sequence in adults. Digestive Disease Week, USA, New Orleans. 1. Wichmann B., Galli Zs., Penksza K., Kiss E., Krízsán V., Heszky L. (2004): Morfotaxonómiai és molekuláris vizsgálatok a Festuca pseudovaginata Penksza alakkör taxonjain. Botanikai Szakosztály április Galli Zs., Wichmann B., Kiss E., Penksza K., Heszky L (2004) Molekuláris taxonómiai vizsgálatok a Festuca nemzetség (Ovinae csoport) néhány faján. X. Növénynemesítési Tudományos Napok február MTA Budapest. Összefoglalók p Wichmann B., Galli Z., Kiss E., Penksza K., Heszky L.E. (2006) Molekuláris marker- és szekvencia összehasonlító vizsgálatok a Festuca ovinae csoport fajain. XII. Növénynemesítési Tudományos Napok március 7-8. MTA, Budapest. Összefoglalók, p Leiszter K, Sipos F, Krenács T, Galamb O, Spisák Sándor, Veres G, Kiss A, Németh AM, Zágoni T, Herszényi L, Wichmann B, Tóth K, Valcz G, Molnár B, Tulassay Z (2009). Az öregedés kapcsán kialakuló funkcionális és molekuláris elváltozások a vastagbélben, különös tekintettel a regenerációs sejtfrakció alakulására. Magyar Gasztroenterológiai Társaság Colon Szekció Tudományos Ülése, Szeged. 5. Tóth K, Galamb O, Spisák S, Wichmann B, Sipos F, Leiszter K, Valcz G, Juhász M, Miheller P, Molnár B, Tulassay Z (2009). Vastagbéldaganatok szűrésére alkalmas Septin9 gén működésének vizsgálata DNS, mrns és protein szinten. Magyar Gasztroenterológiai Társaság Colon Szekció Tudományos Ülése, Szeged. 6. Galamb O, Sipos F, Wichmann B, Spisák S, Krenács T, Tóth K, Leiszter K, Kalmár A, Tulassay Z, Molnár B (2010). A kolrektális adenoma- és a vastagbélrák valós idejű array PCR-alapú azonosítására alkalmas diagnosztikus szöveti mrns markerpanelek Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest. 7. Galamb O, Sipos F, S. Spisák, K. Tóth, B. Wichmann, T. Krenács, G. Valcz, B. Molnár, Z. Tulassay (2010). Az NS-398 szelektív COX-2-gátlószer megfordítja az ép-adenoma átmenetre jellemző génexpressziós változásokat, míh az ép-kolorektális carcinoma átmenetre jellemzőeket kevésbé. Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest. 8. Sipos F, Galamb O, Wichmann B, Krenács T, Tóth K, Leiszter K, Műzes G, Zágoni T, Tulassay Z, Molnár B (2010). A colitis ulcerosa és a Crohn-betegség elkülönítése egyéb colitisektől a perifériás vér teljes genom génexpressziós elemzésével. Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest. 9. Leiszter K, Galamb O, Sipos F, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B, Tóth K, Valcz G, Patai VÁ, Kalmár A, Jász O, Molnár B, Tulassay Z (2010). A proliferációs/apoptózis arány (PAR), mitotikus index (MI) és apoptotikus index (AI) vizsgálata szövettanilag ép gyermek vastagbél-biopsziás mintákon, valamint az adenoma-carcinoma szekvenciában (ACS) felnőttmintákon. Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest. 10. Leiszter K, Galamb O, Sipos F, Krenács T, Spisák S, Veres G, Kiss A, Wichmann B, Tóth K, Valcz G, Patai VÁ, Kalmár A, Molnár B, Tulassay Z (2010). Eltérő apoptotikus aktivitás gyermekek és felnőttek szövettanilag ép vastagbél-biopsziás mintáiban, valamint az adenoma-carcinoma szekvenciában (ACS). Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest. 11. Patai VÁ, Galamb O, Tóth K, Kalmár A, Spisák S, Wichmann B, Jász O, Leiszter K, Valcz G, Sipos F, Patai Á, Schöller A, Krenács T, Tulassay Z, Molnár B (2010). DNS-metilációs profilok normál vastagbélben és vastagbélrákban új biomarkerek a vastagbélrák korai felismeréséért. Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest. 12. Kalmár A, Spisák S, Galamb O, Wichmann B, Sipos F, Tóth K, Leiszter K, Peterfia B, Molnár B, Tulassay Z (2010). Metilációs szabályozás alatt álló gének azonosítása génexpressziós vizsgálatok alapján lézer-mikrodisszektált vastagbél-hámsejtekben. Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest. 13. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Kalmár A, Patai VÁ, Valcz G, Tulassay Z, Molnár B (2010). A vastagbél-adenoma szűrése vérből RT-PCR-rel keringő mononukleáris sejtekben gazdag follikulusok mint az infromáció közvetítői. Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest. 14. Tóth K, Spisák S, Galamb O, Sipos F, Wichmann B, Leiszter K, Valcz G, Kalmár A, Patai VÁ, Tulassay Z, Molnár B (2010). A vastagbéldaganatok szűrésére alkalmas szeptin-9 gén működésének vizsgálata DNS-, mrns- és proteinszinten. Magyar Belgyógyász Társaság 43. Nagygyűlése, Budapest.
ALMAFAJTÁK MOLEKULÁRIS ELKÜLÖNÍTÉSE ÉS
Szent István Egyetem Gödöllő Növénytudományi Doktori Iskola Doktori Iskola vezetője: Dr. Heszky László Növénynemesítés genetikai és biotechnológiai módszerekkel Programvezető: Dr. Heszky László DOKTORI
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
University of Bristol - Explore Bristol Research
Al-Salihi, S. A. A., Scott, T. A., Bailey, A. M., & Foster, G. D. (2017). Improved vectors for Agrobacterium mediated genetic manipulation of Hypholoma spp. and other homobasidiomycetes. Journal of Microbiological
Cluster Analysis. Potyó László
Cluster Analysis Potyó László What is Cluster Analysis? Cluster: a collection of data objects Similar to one another within the same cluster Dissimilar to the objects in other clusters Cluster analysis
SOLiD Technology. library preparation & Sequencing Chemistry (sequencing by ligation!) Imaging and analysis. Application specific sample preparation
SOLiD Technology Application specific sample preparation Application specific data analysis library preparation & emulsion PCR Sequencing Chemistry (sequencing by ligation!) Imaging and analysis SOLiD
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
Supplementary Figure 1
Supplementary Figure 1 Plot of delta-afe of sequence variants detected between resistant and susceptible pool over the genome sequence of the WB42 line of B. vulgaris ssp. maritima. The delta-afe values
Correlation & Linear Regression in SPSS
Correlation & Linear Regression in SPSS Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise 1 - Correlation File / Open
Mapping Sequencing Reads to a Reference Genome
Mapping Sequencing Reads to a Reference Genome High Throughput Sequencing RN Example applications: Sequencing a genome (DN) Sequencing a transcriptome and gene expression studies (RN) ChIP (chromatin immunoprecipitation)
Animal welfare, etológia és tartástechnológia
Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 468 EGYEDAZONOSÍTÁS ÉS SZÁRMAZÁSELLENİRZÉS HIPERPOLIMORF MIKROSZATELLITA
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis
Factor Analysis Factor analysis is a multiple statistical method, which analyzes the correlation relation between data, and it is for data reduction, dimension reduction and to explore the structure. Aim
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.
Correlation & Linear Regression in SPSS Petra Petrovics PhD Student Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise
Construction of a cube given with its centre and a sideline
Transformation of a plane of projection Construction of a cube given with its centre and a sideline Exercise. Given the center O and a sideline e of a cube, where e is a vertical line. Construct the projections
STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:
STUDENT LOGBOOK 1 week general practice course for the 6 th year medical students Name of the student: Dates of the practice course: Name of the tutor: Address of the family practice: Tel: Please read
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Hypothesis Testing. Petra Petrovics.
Hypothesis Testing Petra Petrovics PhD Student Inference from the Sample to the Population Estimation Hypothesis Testing Estimation: how can we determine the value of an unknown parameter of a population
A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon
A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,
Flowering time. Col C24 Cvi C24xCol C24xCvi ColxCvi
Flowering time Rosette leaf number 50 45 40 35 30 25 20 15 10 5 0 Col C24 Cvi C24xCol C24xCvi ColxCvi Figure S1. Flowering time in three F 1 hybrids and their parental lines as measured by leaf number
Statistical Inference
Petra Petrovics Statistical Inference 1 st lecture Descriptive Statistics Inferential - it is concerned only with collecting and describing data Population - it is used when tentative conclusions about
FAMILY STRUCTURES THROUGH THE LIFE CYCLE
FAMILY STRUCTURES THROUGH THE LIFE CYCLE István Harcsa Judit Monostori A magyar társadalom 2012-ben: trendek és perspektívák EU összehasonlításban Budapest, 2012 november 22-23 Introduction Factors which
Étkezési búzák mikotoxin tartalmának meghatározása prevenciós lehetıségek
Étkezési búzák mikotoxin tartalmának meghatározása prevenciós lehetıségek Téren, J., Gyimes, E., Véha, A. 2009. április 15. PICK KLUB Szeged 1 A magyarországi búzát károsító Fusarium fajok 2 A betakarítás
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo Yuma Oka and Thomas N. Sato Supplementary Figure S1. Whole-mount smfish with and without the methanol pretreatment.
On The Number Of Slim Semimodular Lattices
On The Number Of Slim Semimodular Lattices Gábor Czédli, Tamás Dékány, László Ozsvárt, Nóra Szakács, Balázs Udvari Bolyai Institute, University of Szeged Conference on Universal Algebra and Lattice Theory
Expression analysis of PIN genes in root tips and nodules of Lotus japonicus
Article Expression analysis of PIN genes in root tips and nodules of Lotus japonicus Izabela Sańko-Sawczenko 1, Dominika Dmitruk 1, Barbara Łotocka 1, Elżbieta Różańska 1 and Weronika Czarnocka 1, * 1
ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY
ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY A feladatsor három részből áll 1. A vizsgáztató társalgást kezdeményez a vizsgázóval. 2. A vizsgázó egy szituációs feladatban vesz részt a
Modular Optimization of Hemicellulose-utilizing Pathway in. Corynebacterium glutamicum for Consolidated Bioprocessing of
[Supplementary materials] Modular Optimization of Hemicellulose-utilizing Pathway in Corynebacterium glutamicum for Consolidated Bioprocessing of Hemicellulosic Biomass Sung Sun Yim 1, Jae Woong Choi 1,
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Nonparametric Tests
Nonparametric Tests Petra Petrovics Hypothesis Testing Parametric Tests Mean of a population Population proportion Population Standard Deviation Nonparametric Tests Test for Independence Analysis of Variance
Összefoglalás. Summary. Bevezetés
A talaj kálium ellátottságának vizsgálata módosított Baker-Amacher és,1 M CaCl egyensúlyi kivonószerek alkalmazásával Berényi Sándor Szabó Emese Kremper Rita Loch Jakab Debreceni Egyetem Agrár és Műszaki
Using the CW-Net in a user defined IP network
Using the CW-Net in a user defined IP network Data transmission and device control through IP platform CW-Net Basically, CableWorld's CW-Net operates in the 10.123.13.xxx IP address range. User Defined
DI-, TETRA- ÉS HEXAPLOID TRITICUM FAJOK GENOMJAINAK ELEMZÉSE ÉS AZOK ÖSSZEHASONLÍTÁSA FLUORESZCENS IN SITU HIBRIDIZÁCIÓVAL
Hagyomány és haladás a növénynemesítésben DI-, TETRA- ÉS HEXAPLOID TRITICUM FAJOK GENOMJAINAK ELEMZÉSE ÉS AZOK ÖSSZEHASONLÍTÁSA FLUORESZCENS IN SITU HIBRIDIZÁCIÓVAL VARGA MÓNIKA, MOLNÁR ISTVÁN ÉS KOVÁCS
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
7 th Iron Smelting Symposium 2010, Holland
7 th Iron Smelting Symposium 2010, Holland Október 13-17 között került megrendezésre a Hollandiai Alphen aan den Rijn városában található Archeon Skanzenben a 7. Vasolvasztó Szimpózium. Az öt napos rendezvényen
Performance Modeling of Intelligent Car Parking Systems
Performance Modeling of Intelligent Car Parking Systems Károly Farkas Gábor Horváth András Mészáros Miklós Telek Technical University of Budapest, Hungary EPEW 2014, Florence, Italy Outline Intelligent
Expansion of Red Deer and afforestation in Hungary
Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi www.vmi.szie.hu Background and importance large herbivores are overpopulated
Statistical Dependence
Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent
Hasznos és kártevő rovarok monitorozása innovatív szenzorokkal (LIFE13 ENV/HU/001092)
Hasznos és kártevő rovarok monitorozása innovatív szenzorokkal (LIFE13 ENV/HU/001092) www.zoolog.hu Dr. Dombos Miklós Tudományos főmunkatárs MTA ATK TAKI Innovative Real-time Monitoring and Pest control
Effect of sowing technology on the yield and harvest grain moisture content of maize (Zea mays L.) hybrids with different genotypes
A - MurányiE:Layout 1 2/18/16 9:34 AM Page 1 Effect of sowing technology on the yield and harvest grain moisture content of maize (Zea mays L.) hybrids with different genotypes Eszter Murányi University
Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI
Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance
A Fusarium solani-val szembeni ellenállóképesség vizsgálata különböző zöldborsó fajtákon és nemesítési kombinációkon
A Fusarium solani-val szembeni ellenállóképesség vizsgálata különböző zöldborsó fajtákon és nemesítési kombinációkon Mendlerné Drienyovszki Nóra 1 Mándi Lajosné 2 Debreceni Egyetem Agrártudományi Centrum,
Report on esi Scientific plans 7 th EU Framework Program. José Castell Vice-President ecopa, ES
Report on esi Scientific plans 7 th EU Framework Program José Castell Vice-President ecopa, ES the Seventh Framework Programme (2007-2013) Ecopa scientific plans for 2007-2008?
EEA, Eionet and Country visits. Bernt Röndell - SES
EEA, Eionet and Country visits Bernt Röndell - SES Európai Környezetvédelmi Ügynökség Küldetésünk Annak elősegítése, hogy az EU és a tagállamok a szükséges információk alapján hozhassák meg a környezet
Bioinformatics: Blending. Biology and Computer Science
Bioinformatics: Blending Biology and Computer Science MDNMSITNTPTSNDACLSIVHSLMCHRQ GGESETFAKRAIESLVKKLKEKKDELDSL ITAITTNGAHPSKCVTIQRTLDGRLQVAG RKGFPHVIYARLWRWPDLHKNELKHVK YCQYAFDLKCDSVCVNPYHYERVVSPGI DLSGLTLQSNAPSSMMVKDEYVHDFEG
HALLGATÓI KÉRDŐÍV ÉS TESZT ÉRTÉKELÉSE
HALLGATÓI KÉRDŐÍV ÉS TESZT ÉRTÉKELÉSE EVALUATION OF STUDENT QUESTIONNAIRE AND TEST Daragó László, Dinyáné Szabó Marianna, Sára Zoltán, Jávor András Semmelweis Egyetem, Egészségügyi Informatikai Fejlesztő
Supporting Information
Supporting Information Plasmid Construction DNA cloning was carried out according to standard protocols. The sequence of all plasmids was confirmed by DNA sequencing and amplified using the E. coli strain
építészet & design ipari alkalmazás teherautó felépítmény
A Design-Composit egy kompozitpaneleket gyártó vállalat, mely teherautó felépítményekhez, az építészet számára és design termékekhez készít paneleket. We are an innovative manufacturer of composite panels
Szent István University Gödöllı Plant Science PhD School Head of the School: Dr. László Heszky PHD THESIS
Szent István University Gödöllı Plant Science PhD School Head of the School: Dr. László Heszky PHD THESIS Marker assisted selection of powdery and downy mildew resistance grape genotypes STELLA MOLNÁR
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Karancsi Lajos Gábor Debreceni Egyetem Agrár és Gazdálkodástudományok Centruma Mezőgazdaság-, Élelmiszertudományi és Környezetgazdálkodási
EN United in diversity EN A8-0206/419. Amendment
22.3.2019 A8-0206/419 419 Article 2 paragraph 4 point a point i (i) the identity of the road transport operator; (i) the identity of the road transport operator by means of its intra-community tax identification
Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May
Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45
Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and
1 2 3 4 5 Journal name: Applied Microbiology and Biotechnology Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and evaluation of its effect on lignocellulosic
Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and
WT sham Trpv4 -/- sham Saline 10µM GSK1016709A P value Saline 10µM GSK1016709A P value Number 10 10 8 8 Intercontractile interval (sec) 143 (102 155) 98.4 (71.4 148) 0.01 96 (92 121) 109 (95 123) 0.3 Voided
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Nonparametric Tests. Petra Petrovics.
Nonparametric Tests Petra Petrovics PhD Student Hypothesis Testing Parametric Tests Mean o a population Population proportion Population Standard Deviation Nonparametric Tests Test or Independence Analysis
A cell-based screening system for RNA Polymerase I inhibitors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information A cell-based screening system for RNA Polymerase I inhibitors Xiao Tan,
ó Ú ő ó ó ó ö ó ó ő ö ó ö ö ő ö ó ö ö ö ö ó ó ó ó ó ö ó ó ó ó Ú ö ö ó ó Ú ú ó ó ö ó Ű ő ó ó ó ő ó ó ó ó ö ó ó ó ö ő ö ó ó ó Ú ó ó ö ó ö ó ö ő ó ó ó ó Ú ö ö ő ő ó ó ö ö ó ö ó ó ó ö ö ő ö Ú ó ó ó ü ú ú ű
First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.
First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this
Animal welfare, etológia és tartástechnológia
Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 5 Issue 4 Különszám Gödöllı 2009 459 MORFOLÓGIAI ÉS GENETIKAI VIZSGÁLATOK MAGYARORSZÁGI TÖRPEHARCSÁKON
NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING
Anyagmérnöki Tudományok, 39/1 (2016) pp. 82 86. NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING LEDNICZKY
Limitations and challenges of genetic barcode quantification
Limitations and challenges of genetic barcode quantification Lars hielecke, im ranyossy, ndreas Dahl, Rajiv iwari, Ingo Roeder, Hartmut eiger, Boris Fehse, Ingmar lauche and Kerstin ornils SUPPLEMENRY
ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY
ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY A feladatsor három részbol áll 1. A vizsgáztató társalgást kezdeményez a vizsgázóval. 2. A vizsgázó egy szituációs feladatban vesz részt a
Computer Architecture
Computer Architecture Locality-aware programming 2016. április 27. Budapest Gábor Horváth associate professor BUTE Department of Telecommunications ghorvath@hit.bme.hu Számítógép Architektúrák Horváth
EGÉSZSÉGTUDOMÁNY, LVII. ÉVFOLYAM, 2013. 4. SZÁM 2013/4
Part II: Seasonal variations in human infections with Puumula hantavirus in Styria II. rész: Évszakos változások a Puumula hantavirus okozta humán fertőzésekben Stájerországban PROF. SIXL WOLF DIETER,
DG(SANCO)/2012-6290-MR
1 Ensure official controls of food contaminants across the whole food chain in order to monitor the compliance with the requirements of Regulation (EC) No 1881/2006 in all food establishments, including
Emelt szint SZÓBELI VIZSGA VIZSGÁZTATÓI PÉLDÁNY VIZSGÁZTATÓI. (A részfeladat tanulmányozására a vizsgázónak fél perc áll a rendelkezésére.
Emelt szint SZÓBELI VIZSGA VIZSGÁZTATÓI PÉLDÁNY VIZSGÁZTATÓI PÉLDÁNY A feladatsor három részből áll 1. A vizsgáztató társalgást kezdeményez a vizsgázóval. 2. A vizsgázó egy vita feladatban vesz részt a
2. Local communities involved in landscape architecture in Óbuda
Év Tájépítésze pályázat - Wallner Krisztina 2. Közösségi tervezés Óbudán Óbuda jelmondata: Közösséget építünk, ennek megfelelően a formálódó helyi közösségeket bevonva fejlesztik a közterületeket. Békásmegyer-Ófaluban
PUBLIKÁCIÓS LISTA MAGYAR NYELVEN, LEKTORÁLT FOLYÓIRATBAN MEGJELENT:
PUBLIKÁCIÓS LISTA MAGYAR NYELVEN, LEKTORÁLT FOLYÓIRATBAN MEGJELENT: 1., Kalmárné Hollósi, E. Kalmár, S. (2000): Friss zöldségek és gyümölcsök értékesítési formái New Jersey államban. Gazdálkodás XLIV.
General information for the participants of the GTG Budapest, 2017 meeting
General information for the participants of the GTG Budapest, 2017 meeting Currency is Hungarian Forint (HUF). 1 EUR 310 HUF, 1000 HUF 3.20 EUR. Climate is continental, which means cold and dry in February
Utolsó frissítés / Last update: február Szerkesztő / Editor: Csatlós Árpádné
Utolsó frissítés / Last update: 2016. február Szerkesztő / Editor: Csatlós Árpádné TARTALOM / Contents BEVEZETŐ / Introduction... 2 FELNŐTT TAGBÉLYEGEK / Adult membership stamps... 3 IFJÚSÁGI TAGBÉLYEGEK
1) MÁJER J. LAKATOS A. GYÖRRFYNÉ JAHNKE G: (2007): A Furmint fajta helyzete Magyarországon. Borászati Füzetek 2007/2, Kutatási rovat 1-4. p.
Publikációs és oktatási tevékenységünk: Lektorált folyóiratban megjelent publikációk: 1) MÁJER J. LAKATOS A. GYÖRRFYNÉ JAHNKE G: (2007): A Furmint fajta helyzete Magyarországon. Borászati Füzetek 2007/2,
Publikációs lista Szabó Szilárd
Publikációs lista Szabó Szilárd Tanulmányok Börcsök Áron - Bernáth Zsolt - Kircsi Andrea - Kiss Márta - Kósa Beatrix - Szabó Szilárd 1998. A Kisgyőri - medence és galya egyedi tájértékei - A "Nem védett
AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, TILLING
Hagyomány és haladás a növénynemesítésben AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, BÁLINT ANDRÁS FERENC 1, SZIRA FRUZSINA 1, ANDREAS BÖRNER 2, KERSTIN
Decision where Process Based OpRisk Management. made the difference. Norbert Kozma Head of Operational Risk Control. Erste Bank Hungary
Decision where Process Based OpRisk Management made the difference Norbert Kozma Head of Operational Risk Control Erste Bank Hungary About Erste Group 2010. 09. 30. 2 Erste Bank Hungary Erste Group entered
OLYMPICS! SUMMER CAMP
OLYMPICS! SUMMER CAMP YOUNG BUSINESS CAMP 3D DESIGN CAMP OLYMPICS SUMMER CAMP 20 24 JUNE AND 27 JUNE 1 JULY AGE: 6-14 Our ESB native-speaking teachers will provide a strong English learning content throughout
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK Despite enormous challenges many developing countries are service exporters Besides traditional activities such as tourism;
Rotary District 1911 DISTRICT TÁMOGATÁS IGÉNYLŐ LAP District Grants Application Form
1 A Future Vision pilot célja a Future Vision Plan (Jövőkép terv) egyszerűsített támogatási modelljének tesztelése, és a Rotaristák részvételének növelése a segélyezési folyamatokban. A teszt során a districteknek
Bird species status and trends reporting format for the period (Annex 2)
1. Species Information 1.1 Member State Hungary 1.2.2 Natura 2000 code A634-B 1.3 Species name Ardea purpurea purpurea 1.3.1 Sub-specific population East Europe, Black Sea & Mediterranean/Sub-Saharan Africa
4 vana, vanb, vanc1, vanc2
77 1) 2) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 12 7 17 4 8 2003 1 2004 7 3 Enterococcus 5 Enterococcus faecalis 1 Enterococcus avium 1 Enterococcus faecium 2 5 PCR E. faecium 1 E-test MIC 256 mg/ml vana MRSA MRSA
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit.
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit. MYB Primer pairs TC AtMYB Forward Reverse TC199266 MYB12 AGGCTCTTGGAGGTCGTTACC CAACTCTTTCCGCATCTCAATAATC
ZAJÁCZ EDIT publikációs lista 2015.10.13.
ZAJÁCZ EDIT publikációs lista 2015.10.13. Tudományos folyóiratokban megjelent közlemény 1. E. Zajácz, Á. Zaják, E. M. Szalai, T. Szalai (2006): Nectar production of some sunflower hybrids. Journal of Apicultural
Skills Development at the National University of Public Service
Skills Development at the National University of Public Service Presented by Ágnes Jenei National University of Public Service Faculty of Public Administration Public Ethics and Communication 13. 12. 2013
Genome 373: Hidden Markov Models I. Doug Fowler
Genome 373: Hidden Markov Models I Doug Fowler Review From Gene Prediction I transcriptional start site G open reading frame transcriptional termination site promoter 5 untranslated region 3 untranslated
Angol Középfokú Nyelvvizsgázók Bibliája: Nyelvtani összefoglalás, 30 kidolgozott szóbeli tétel, esszé és minta levelek + rendhagyó igék jelentéssel
Angol Középfokú Nyelvvizsgázók Bibliája: Nyelvtani összefoglalás, 30 kidolgozott szóbeli tétel, esszé és minta levelek + rendhagyó igék jelentéssel Timea Farkas Click here if your download doesn"t start
Can/be able to. Using Can in Present, Past, and Future. A Can jelen, múlt és jövő idejű használata
Can/ Can is one of the most commonly used modal verbs in English. It be used to express ability or opportunity, to request or offer permission, and to show possibility or impossibility. A az egyik leggyakrabban
PIACI HIRDETMÉNY / MARKET NOTICE
PIACI HIRDETMÉNY / MARKET NOTICE HUPX DAM Másnapi Aukció / HUPX DAM Day-Ahead Auction Iktatási szám / Notice #: Dátum / Of: 18/11/2014 HUPX-MN-DAM-2014-0023 Tárgy / Subject: Változások a HUPX másnapi piac
A JUHTARTÁS HELYE ÉS SZEREPE A KÖRNYEZETBARÁT ÁLLATTARTÁSBAN ÉSZAK-MAGYARORSZÁGON
Bevezetés A JUHTARTÁS HELYE ÉS SZEREPE A KÖRNYEZETBARÁT ÁLLATTARTÁSBAN ÉSZAK-MAGYARORSZÁGON Abayné Hamar Enikő Marselek Sándor GATE Mezőgazdasági Főiskolai Kar, Gyöngyös A Magyarországon zajló társadalmi-gazdasági
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
CLUSTALW Multiple Sequence Alignment
Version 3.2 CLUSTALW Multiple Sequence Alignment Selected Sequences) FETA_GORGO FETA_HORSE FETA_HUMAN FETA_MOUSE FETA_PANTR FETA_RAT Import Alignments) Return Help Report Bugs Fasta label *) Workbench
Cashback 2015 Deposit Promotion teljes szabályzat
Cashback 2015 Deposit Promotion teljes szabályzat 1. Definitions 1. Definíciók: a) Account Client s trading account or any other accounts and/or registers maintained for Számla Az ügyfél kereskedési számlája
Széchenyi István Egyetem www.sze.hu/~herno
Oldal: 1/6 A feladat során megismerkedünk a C# és a LabVIEW összekapcsolásának egy lehetőségével, pontosabban nagyon egyszerű C#- ban írt kódból fordítunk DLL-t, amit meghívunk LabVIEW-ból. Az eljárás
Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz
Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz Kvantumkapuk, áramkörök 2016. március 3. A kvantummechanika posztulátumai (1-2) 1. Állapotleírás Zárt fizikai rendszer aktuális állapota
Lopocsi Istvánné MINTA DOLGOZATOK FELTÉTELES MONDATOK. (1 st, 2 nd, 3 rd CONDITIONAL) + ANSWER KEY PRESENT PERFECT + ANSWER KEY
Lopocsi Istvánné MINTA DOLGOZATOK FELTÉTELES MONDATOK (1 st, 2 nd, 3 rd CONDITIONAL) + ANSWER KEY PRESENT PERFECT + ANSWER KEY FELTÉTELES MONDATOK 1 st, 2 nd, 3 rd CONDITIONAL I. A) Egészítsd ki a mondatokat!
Abigail Norfleet James, Ph.D.
Abigail Norfleet James, Ph.D. Left side of brain develops first in girls, right in boys o Probably source of girls verbal skills o And source of boys spatial skills Pre-frontal lobes Control impulses and
A magyar racka juh tejének beltartalmi változása a laktáció alatt
A magyar racka juh tejének beltartalmi változása a laktáció alatt Nagy László Komlósi István Debreceni Egyetem Agrártudományi Centrum, Mezőgazdaságtudományi Kar, Állattenyésztés- és Takarmányozástani Tanszék,
Effect of the different parameters to the surface roughness in freeform surface milling
19 November 0, Budapest Effect of the different parameters to the surface roughness in freeform surface milling Balázs MIKÓ Óbuda University 1 Abstract Effect of the different parameters to the surface
Gabonacsíra- és amarant fehérjék funkcionális jellemzése modell és komplex rendszerekben
Budapesti Műszaki és Gazdaságtudományi Egyetem Biokémiai és Élelmiszertechnológiai Tanszék Gabonacsíra- és amarant fehérjék funkcionális jellemzése modell és komplex rendszerekben c. PhD értekezés Készítette:
AZ ÉGHAJLATVÁLTOZÁS KEDVEZ KÖRÜLMÉNYEKET HOZHAT ALMATERMESZTÉSÜNKNEK? ERDÉLYI É.
AZ ÉGHAJLATVÁLTOZÁS KEDVEZ KÖRÜLMÉNYEKET HOZHAT ALMATERMESZTÉSÜNKNEK? ERDÉLYI É. Összefoglalás Budapesti Corvinus Egyetem, Kertészettudományi Kar, 1118 Budapest, Villányi út 29-43. A termesztett növények
discosnp demo - Peterlongo Pierre 1 DISCOSNP++: Live demo
discosnp demo - Peterlongo Pierre 1 DISCOSNP++: Live demo Download and install discosnp demo - Peterlongo Pierre 3 Download web page: github.com/gatb/discosnp Chose latest release (2.2.10 today) discosnp
Professional competence, autonomy and their effects
ENIRDELM 2014, Vantaa Professional competence, autonomy and their effects Mária Szabó szabo.maria@ofi.hu www.of.hu The aim and the planned activities at this workshop Aim: To take a European survey on
USER MANUAL Guest user
USER MANUAL Guest user 1 Welcome in Kutatótér (Researchroom) Top menu 1. Click on it and the left side menu will pop up 2. With the slider you can make left side menu visible 3. Font side: enlarging font
Utolsó frissítés / Last update: Szeptember / September Szerkesztő / Editor: Csatlós Árpádné
Utolsó frissítés / Last update: 2018. Szeptember / September Szerkesztő / Editor: Csatlós Árpádné TARTALOM / Contents BEVEZETŐ / Introduction... 2 FELNŐTT TAGBÉLYEGEK / Adult membership stamps... 3 IFJÚSÁGI