Red light-regulated reversible nuclear localization of proteins in mammalian cells and zebrafish
|
|
- Géza Orsós
- 6 évvel ezelőtt
- Látták:
Átírás
1 Red light-regulated reversible nuclear localization of proteins in mammalian cells and zebrafish Hannes M. Beyer,1,2,3,, Samuel Juillot,1,2,3, Kathrin Herbst,4,5, Sophia L. Samodelov 1,2,3, Konrad Müller 1, Wolfgang W. Schamel 1,2,3,6, Winfried Römer 1,2,3, Eberhard Schäfer 1, Ferenc Nagy 1,7, Uwe Strähle 4, Wilfried Weber 1,2,3,8 and Matias D. Zurbriggen 1,2 * 1Faculty of Biology, University of Freiburg, Schänzlestrasse 1, Freiburg, Germany 2BIOSS - Centre for Biological Signalling Studies, University of Freiburg, Schänzlestrasse 18, Freiburg, Germany 3SGBM - Spemann Graduate School of Biology and Medicine (SGBM), University of Freiburg, Albertstrasse 19a, Freiburg, Germany 4Institute of Toxicology and Genetics, Karlsruhe Institute of Technology and University of Heidelberg, D Eggenstein-Leopoldshafen, Germany 5BIF-IGS - BioInterfaces International Graduate School; Hermann-von-Helmholtz-Platz 1; Eggenstein-Leopoldshafen, Germany 6CCI, Centre for Chronic Immunodeficiency, University Clinincs Freiburg; Breisacher Strasse 117; Freiburg, Germany 7Biological Research Centre, Institute of Plant Biology, H-6726 Szeged, Hungary 8ZBSA - Centre for Biosystems Analysis, University of Freiburg, Habsburgerstrasse 49, Freiburg, Germany These authors contributed equally to this work. *Correspondence should be addressed to Matias D. Zurbriggen, matias.zurbriggen@biologie.unifreiburg.de Supplementary Table 1 Detailed description of plasmids used in this study. The genotype and the cloning strategy of the plasmids are described. Supplementary Fig. 1 Additional Information for the characterization of the red lightcontrolled nuclear localization system by confocal microscopy. Supplementary Fig. 2 Red light-induced nuclear import of full-length phytochrome B mediated by PIF3 in mammalian cells. Supplementary Fig. 3 Red light-inducible protein localization with engineered biosynthesis of phycocyanobilin (PCB). Supplementary Fig. 4 Additional kinetic information on live-cell monitoring of red lightinduced nuclear protein import. Supplementary Fig. 5 Additional information on red light-inducible, far-red light-reversible transgene expression based on the light-inducible nuclear localization of transcription factors in mammalian cells. Supplementary Fig. 6 Microscopic analysis of red light-controlled nuclear import in zebrafish embryos. Supplementary Fig. 7 Additional information on red light-inducible, far-red light-reversible transgene expression based on the light-inducible nuclear localization of transcription factors in zebrafish. Supplementary Movie 1 Time-lapse movie of red light-controlled nuclear import in mammalian cells. Supplementary Movie 2 Time-lapse movie of reversible red light-controlled nuclear import and export in mammalian cells. 1
2 Supplementary Table 1. Plasmids used in this study. The genotype and the cloning strategy of the plasmids are described. Abbreviations: IRESPV, polioviral internal ribosome entry site; MTS, mitochondrial targeting signal; pa, polyadenylation signal; PEF1α, human elongation factor 1α promoter; PSV40, simian virus 40 promoter; PT3, T3 bacteriophage promoter; SEAP, human placental secreted alkaline phosphatase; teto, TetR-responsive operator; VP16, Herpes simplex virus-derived transactivation domain; Zip(+), one half of a heterodimerizing antiparallel leucine zipper; Zip(-), corresponding second half of the leucine zipper. Plasmid Description 1858 pgad24- PIF3 1930_pP PO43_ph yb pgemhe -XfA4- megfp Plasmid encoding full-length phytochrome interacting factor 3 (PIF3, Genbank accession No. NM_ ). Kindly provided by Andreas Hiltbrunner. P35S promoter-driven plant expression vector containing the full-length coding sequences of phytochrome B (Genbank accession No. NM_127435) and mcerulean. ). Kindly provided by Andreas Hiltbrunner. Vector for in vitro transcription and expression in Xenopus oocytes containing the coding sequence of monomerizing enhanced GFP (megfp A206K, Genbank accession No. KC896843). Kindly provided by Maximilian Ulbrich. Reference unpublished unpublished Ulbrich et al. 1 pmz300 Plasmid encoding the monomeric red fluorescent protein mcherry (Genbank accession unpublished No. EU855181). pmz333 PSV40 driven mammalian expression vector derived from XbaI/NotI digested psam unpublished pmz348 PSV40::AtPIF3-pA. Full-length AtPIF3 (Genbank accession No. NM_ ) was amplified from 1858 pgad24-pif3 (kindly provided by A. Hiltbrunner, Freiburg) using oligos omz363 (5 - GTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCGAATTGCGGCCGCAGGAGGCGCCACCA TGCCTCTGTTTGAGCTTTTCAGGCTC-3 ) and omz365 (5 -TTATCATGTCTGGATCGAAGCTT GGGCTGCAGGTCGACTCTAGATTATCACGACGATCCACAAAACTGATCAGAAG-3 ). The gene was Gibson-cloned into XbaI/NotI digested pmz333 thereby resulting in a PSV40-driven PIF3 expression vector. pmz354 Plasmid encoding AtPIF3 (Genbank accession No. NM_ ), derived from plasmid unpublished 1858 pgad24-pif3. pmz358 Plasmid encoding AtPHYB (amino acids 1-908, Genbank accession No. NM_127435) and unpublished VP16 (Genbank accession No. CVU89929). pmz701 PSV40::AtPHYB(1-908)-L-mCherry-pA. mcherry was first amplified from pmz300 with oligos omz701 (5 - GATAGTGCTGGTAGTGCTGGTAGTGCTGGTTCCGCGTACAGCATGGTGAGCAAGGGCGAGGAG G-3 ) and omz706 (5 -CTTGTACAGCTCGTCCATGCCGC-3 ), further amplified using the oligos omz704(5 -TATTGGGGCTTTCTGTTTCTTGCAAATCCCGAGCGAATTCGATAGTGCTG GTAGTGCTGGTAGTG-3 ) and omz707 (5 -TCTGGATCGAAGCTTGGGCTGCAGGTCGACTCTA GATTACTACTTGTACAGCTCGTCCATGCCGC-3 ) and Gibson-cloned into XbaI/EcoRI digested pmz358 thereby resulting in a PSV40-driven expression vector for PhyB (amino acids 1-908) fused via a linker (L, EFDSAGSAGSAGSAYS) to mcherry. pmz703 PSV40:: AtPHYB(1-908)-L-mCherry-NES-pA. mcherry was PCR amplified from pmz300 using the oligos omz701/omz706 and then further amplified using omz704/omz708 (5 -GATGGTCAGGGTGCCGAACTTCTTGGTCATC TTGTACAGCTCGTCCATGCCGC-3 ). The product was Gibson-cloned into XbaI/EcoRI digested pmz358 thereby resulting in a PSV40-driven expression vector for PhyB (amino acids 1-908) fused via a linker (L, EFDSAGSAGSAGSAYS) to mcherry and the minute virus of mice derived nuclear export signal (NES, MTKKFGTLTI). pmz725 PSV40::AtPIF3-mEGFP-pA. megfp (Genbank accession No. KC896843), but with the monomerizing pointmutation K207A was first amplified from pgemhe-xfa4-megfp (kindly provided by M. Ulbrich, Freiburg) using oligos omz728 (5 -TTTGTGGATCGTCGGGCAGCATGGTGAGCAAGGGCGAG GAG-3 ) and omz729 (5 -TGCAGGTCGACTCTAGACTATTACTTGTACAGCTCGTCCATGCCG- 3 ). The backbone of pmz354 was amplified with omz726 (5 ACGAGCTGTACAAGTAATAG TCTAGAGTCGACCTGCAGCCCAAG-3 ) and omz727 (5 -TCCTCGCCCTTGCTCACCATGCTGC CCGACGATCCACAAAACTGAT-3 ) and both PCR fragments were joined by Gibson cloning thereby resulting in a PSV40-driven expression vector for PIF3 fused to monomeric EGFP. 2
3 pmz802 teto13 422bp Pmin::Luc pa. Expression vector encoding Firefly luciferase under the control of a modified tetracycline-responsive promoter. phb042 PSV40::PhyB(1-908)-L1-VP16-L2-Zip(+)-pA. VP16 was amplified from pmz358 using oligos ohb089 (5 -GAAAGGTTATTGGGGCTTTCT GTTTCTTGC-3 ) and ohb086 (5 -CCCACCGTACTCGTCAATTCCAAG-3 ). Zip+ was amplified from XW54_Punc_4c_NLS_Q (kindly provided by X. Wei 4 ) using ohb087 (5 -GT TTACCGATGCCCTTGGAATTGACGAGTACGGTGGGGGATCCGGATCTGGATCTGGATCTG-3 ) and ohb088 (5 -CTTATCATGTCTGGATCGAAGCTTGGGCTGCAGGTCGACTCTAGATTACTGA GCCAGTTCTTTCTTCAGTGCC-3 ). The products were Gibson-cloned into XbaI/EcoRI digested pmz358 thereby resulting in a PSV40-driven expression vector for PhyB (amino acids 1-908) fused to VP16 via a linker (L1, EFDSAGSAGSAGSAYSR) and via a second linker (L2, GSGSGSGSGSGS) to the Zip(+) leucine zipper (ALKKELQANKKELAQLKWELQAL KKELAQ). phb043 PSV40::PhyB(1-908)-L3-VP16-NES-L4-Zip(+)-pA. VP16 was amplified from pmz358 using oligos ohb0089 and ohb090 (5 - GATGGTCAGGGTGCCGAACTTCTTGGTCATAGATCCAGATCCCCCACCGTACTCGTCAATTCCA AG-3 ). Zip+ was amplified from XW54_Punc_4c_NLS_Q (kindly provided by Kang Shen 4 ) using ohb091 (5 -GGATCTATGACCAAGAAGTTCGGCACCCTGACCATCGGATCCGGATCTGG ATCTGGATCTG-3 ) and ohb088 thereby attaching the minute virus of mice derived nuclear export signal (NES, MTKKFGTLTI amino acid sequence). The products were Gibson-cloned into XbaI/EcoRI digested pmz358 thereby resulting in a PSV40-driven expression vector for PhyB (amino acids 1-908) fused to VP16 and the minute virus of mice derived nuclear export signal (NES) via a linker (L3, EFDSAGSAGSAGSAYSR) and via a second linker (L4, GSGSGSGSGSGS) to the Zip(+) leucine zipper (ALKKELQANKKELAQLKWELQALKKELAQ). phb045 PSV40::TetR-T7tag-L-Zip(-)-pA. TetR-T7tag was amplified from pww801 5 using oligos ohb094 (5 - GTCTTTTTGTCTTTTATTTCAGGTCCCGGATCGAATTGCGGCCGCAGGAGGCGCCACCATGTCT AGATTAGATAAAAGTAAAGTGATTAACAGCGC-3 ) and ohb095 (5 -CTTTTTCTCGAGAGCC TGGAGTTTCTTCTCCAGCTGCTCGCTGGCGGTACCGGAACCAGATCCAGATCCAGATCCAGATC CCTGGTCGCGACCCATTTGCTGTC-3 ). The product was reamplified using ohb094 and ohb096 (5 -TGTCTGGATCGAAGCTTGGGCTGCAGGTCGACTCTAGATTACTGTGCCAGTTTCT TCTCCAGTGCCTGGTTCTTCCACTCAAGCTGTGCCAGCTTTTTCTCGAGAGCCTGGAGTTTCTT C-3 ) to attach Zip(-). The product was Gibson-cloned into XbaI/NotI digested pmz333 thereby resulting in a PSV40-driven expression vector for the tetracycline repressor TetR fused to the T7tag and via a linker (L, GSGSGSGSGSGT) to the Zip(-) leucine zipper (EQLEKKLQALEKKLAQLEWKNQALEKKLAQ) 4. phb102 PT3::PhyB(1-908)-L1-VP16-L2-Zip(+)-pA. The open reading frame of phb042 was subcloned by Gibson Cloning using PCR with the oligos ohb231 (5 -GATATTGTATATATCGTAACAATAGGAGGTTCAACAATGGTTTCCGGAG TCGGGGG-3 ) and ohb232 (5 -TTAGTGGTAACCAGATCCTAGTCAGTCACTAGCCTATTA CTGAGCCAGTTCTTTCTTCAGTGCC-3 ). The target vector RCIscript-GoldyTALEN was prepared by PCR using the oligos ohb229 (5 -TAGGCTAGTGACTGACTAGGATCTGG-3 ) and ohb230 (5 - TGTTGAACCTCCTATTGTTACGATATATACAATATC-3 ). phb103 PT3::PhyB(1-908)-L3-VP16-NES-L4-Zip(+)-pA. The open reading frame of phb043 was subcloned by Gibson Cloning using PCR with the oligos ohb231 (5 -GATATTGTATATATCGTAACAATAGGAGGTTCAACAATGGTTTCCGGAG TCGGGGG-3 ) and ohb232 (5 -TTAGTGGTAACCAGATCCTAGTCAGTCACTAGCCTATTA CTGAGCCAGTTCTTTCTTCAGTGCC-3 ). The target vector RCIscript-GoldyTALEN was prepared by PCR using the oligos ohb229 (5 -TAGGCTAGTGACTGACTAGGATCTGG-3 ) and ohb230 (5 - TGTTGAACCTCCTATTGTTACGATATATACAATATC-3 ). phb104 PT3::AtPIF3-mEGFP-pA. The open reading frame of pmz725 was subcloned by Gibson Cloning using PCR with the oligos ohb233 (5 -GATATTGTATATATCGTAACAATAGGAGGTTCAACAATGCCTCTGTTTG AGCTTTTCAGGC-3 ) and ohb234 (5 -TTAGTGGTAACCAGATCCTAGTCAGTCACTAGCCTA TTACTTGTACAGCTCGTCCATGCC-3 ). The target vector RCIscript-GoldyTALEN was prepared by PCR using the oligos ohb229 (5 -TAGGCTAGTGACTGACTAGGATCTGG-3 ) and ohb230 (5 - TGTTGAACCTCCTATTGTTACGATATATACAATATC-3 ). Müller et al. 3 3
4 phb107 PT3::TetR-T7tag-L-Zip(-)-pA. The open reading frame of phb045 was subcloned by Gibson Cloning using PCR with the oligos ohb237 (5 - GATATTGTATATATCGTAACAATAGGAGGTTCAACAATGTCTAGATTAG ATAAAAGTAAAGTGATTAACAGCGC-3 ) and ohb238 (5 - TTAGTGGTAACCAGATCCTAGTC AGTCACTAGCCTATTACTGTGCCAGTTTCTTCTCCAGTG-3 ). The target vector RCIscript- GoldyTALEN was prepared by PCR using the oligos ohb229 (5 -TAGGCTAGTGACTGAC TAGGATCTGG-3 ) and ohb230 (5 - TGTTGAACCTCCTATTGTTACGATATATACAATATC- 3 ). pkm006 teto13-422bp-pmin::seap-pa. Expression vector encoding the secreted alkaline phosphatase (SEAP) under the control of a modified tetracycline-responsive promoter. pkm078 teto13-422bp-pmin::mcherry-pa. Expression vector encoding the fluorescent protein mcherry under the control of a modified tetracycline-responsive promoter. pkm087 PEF1α::MTS-PcyA-IRESPV-MTS-HO1-pA Bicistronic vector encoding mitochondria-localized PCB:ferredoxin oxidoreductase (MTS- PcyA) and mitochondria-localized heme oxygenase 1 (MTS-HO1) for PCB biosynthesis RCIscript - GoldyTA- LEN psj025 XW54_Pu nc_4c_nl S_Q Müller et al. 6 Müller et al. 6 Müller et al. 7 under the control of PEF1α. Destination vector for the Golden Gate TALEN kit, for in vitro synthesis of TALEN mrnas. Carlson et al. 8 PSV40::AtPHYB(full-length)-L-mCherry-pA. mcherry was first PCR amplified from pmz300 using oligos omz701(5 - GATAGTGCTGGTAGTGCTGGTAGTGCTGGTTCCGCGTACAGCATGGTGAGCAAGGGCGAGGAG G-3 ) and omz707 (5 -TCTGGATCGAAGCTTGGGCTGCAGGTCGACTCTAGATTACTACTTGT- ACAGCTCGTCCATGCCGC-3 ), PhyB(lull-length) was PCR amplified from 1930_pPPO43_phyB using the oligos omz300 (5 -GTTTAGTCTTTTTGTCTTTTATTTCAGG- TCCCGGATCGAATTGCGGCCGCAGGAGGCGCCACCATGGTTTCCGGAGTCGGGGGTAG-3 ) and osj028 (5 -GCGGAACCAGCACTACCAGCACTACCAGCACTATCATATGGCATCATCAGCATCA- TGTCACCAC-3 ) for Gibson cloning into NotI/XbaI digested pmz333. Punc4C-driven expression vector for Caenorhabditis elegans encoding the Qf transcription factor and the Zip(+) leucine zipper. Kindly provided by Kang Shen. Wei et al. 4 4
5 Supplementary Figure 1. Characterization of the red light-controlled nuclear localization system. (a) Dependence of the nuclear transport on phytochrome-interacting factor 3 (PIF3) and on phycocyanobilin (PCB). NIH/3T3 cells were cotransfected with plasmids pmz701 (PhyB(1-908)-mCherry) and pmz348 (PIF3). 24 h post-transfection, the medium was exchanged with fresh medium supplemented with 15 µm PCB, incubated for 1 h in darkness and subsequently illuminated at 660 nm light (20 µmol m -2 s -1 ) for 30 min prior to fixation, DAPI staining and analysis by confocal microscopy. In control samples, either PIF3 (-PIF3) or PCB (-PCB) were omitted. Scale bar, 5 µm. (b) Plasmids used in (a). Abbreviations: pa, polyadenylation signal; PSV40, simian virus 40 promoter. 5
6 Supplementary Figure 2. Red light-induced nuclear import of full-length phytochrome B mediated by PIF3 in mammalian cells. (a-b) HeLa cells were co-transfected with (a) plasmids psj025 (PhyB-mCherry) and pmz725 (PIF3-mEGFP), or with (b) psj h post-transfection, the medium was exchanged with fresh medium supplemented with 15 µm PCB, incubated for 1 h in darkness and subsequently illuminated at 660 nm light (20 µmol m-2 s-1) for 60 min prior to fixation, DAPI staining and analysis by confocal microscopy. (c) Plasmids used in (a-b). Scale bar, 5 µm. For abbreviations see Supplementary Figure 1. 6
7 Supplementary Figure 3. Red light-inducible protein localization with engineered biosynthesis of phycocyanobilin (PCB). (a) CHO-K1 cells with knocked-down levels of the PCB-degrading enzyme biliverdin reductase A (BVRA) 7 were cotransfected with plasmids pmz701 (PhyB(1-908)-mCherry), pmz725 (PIF3-mEGFP) and pkm087 (PEF1α-MTS-PcyA- IRESPV-MTS-HO1-pA) encoding the biosynthesis pathway from heme to PCB. 53 h post-transfection cells were illuminated at 660 nm light (20 µmol m -2 s -1 ) for 1.5 h prior to fixation and confocal imaging. In control cells, the PCB biosynthesis plasmid pkm087 was omitted (-PCB). Scale bar, 5 µm. (b) Plasmids used in (a). Abbreviations: HO1, heme oxygenase 1; IRES, internal ribosome entry site; MTS, mitochondrial targeting signal; PcyA, PCB:ferredoxin oxidoreductase; PEF1α, human elongation factor 1α. For further abbreviations see Supplementary Figure 1. 7
8 Supplementary Figure 4. Additional live-cell monitoring of red light-induced nuclear protein import. Representative single cell of Fig. 2b. Plasmid pmz703 encoding fluorescently labeled PhyB(1-908) with a C-terminally fused nuclear export sequence was co-transfected with plasmid pmz725 encoding PIF3 into NIH/3T3 cells. Cells were incubated in the presence of 15 µm PCB under 740 nm illumination for 5 min before nuclear import was induced with 660 nm light at time point 0 for 50 min. Confocal microscope images were acquired every 5 min. Scale bar, 5 µm. 8
9 Supplementary Figure 5. Additional information on red light-inducible, far-red light-reversible transgene expression based on the light-inducible nuclear localization of transcription factors in mammalian cells. (a) Light-responsive gene expression in different mammalian cell-lines. The indicated cell-lines were transfected with plasmids phb045 (TetR-Tip-), phb042 (PhyB-VP16-Zip+), pmz725 (PIF3-mEGFP) and pkm006 (SEAP reporter), 24 h post-transfection, the medium was exchanged for fresh medium supplemented with 15 µm PCB, kept for 1 h in the dark and subsequently illuminated at 660 nm (20 µmol m -2 s -1 ) or further kept in the dark for 24 h prior quantifying SEAP production. Absolute SEAP values after 660 nm light illumination were 6.93 U L -1 (CHO-K1), 0.88 U L -1 (NIH/3T3), 0.09 U L -1 (COS-7) and 2.47 U L -1 (HEK-293T). n = 4, error bars represent one standard deviation of the mean. (b) Reversible induction of transgene expression in CHO-K1 cells. CHO-K1 cells were transfected with plasmids phb045, phb042, pmz725 and pkm h post-transfection, the medium was supplemented with 15 µm PCB. Next, the cells were kept in the dark for 1 h and subsequently illuminated with 660 nm light (20 µmol m -2 s -1 ) or with 740 nm light (20 µmol m -2 s -1 ) for 24 h. Subsequently, the medium was replaced by fresh PCB-containing medium and illumination was either continued at the same wavelength or the wavelength was swapped. SEAP production was quantified after the first and the second 24 h illumination cycle. n = 4, error bars represent one standard deviation of the mean. 9
10 Supplementary Figure 6. Protein localization in zebrafish. (a) Red light-inducible nuclear transport in zebrafish embryos. Plasmids pmz703 and pmz725 were injected into single-cell stage zebrafish embryos. 33 h post-fertilization embryos were transferred to E3 medium supplemented with 150 µm PCB overnight prior to illumination at 660 nm (20 µmol m -2 s -1 ) for 1 h. Embryos were fixed and analyzed by confocal microscopy. As a control, embryos grown in the absence of PCB were used. Note microinjection of plasmid DNA results in expression in well-separated cells in the zebrafish embryo. Scale bar, 7 µm. (b) Localization of the analyzed cells in the zebrafish embryo. Scale bar, 100 µm. 10
11 Supplementary Figure 7 Additional information on red light-inducible, far-red light-reversible transgene expression based on the light-inducible nuclear localization of transcription factors in zebrafish. (a-b) Induction of Firefly luciferase expression in (a) 24 h staged, or (b) 48 h staged zebrafish embryos. Single cell stage embryos were injected with plasmid pmz802 (Luc reporter) and mrna transcribed from phb102 (PhyB-VP16-Zip+) or phb103 (PhyB-VP16-NES-Zip+) and pb107 (TetR-Zip-). mrna for PIF3 (derived from phb104) was injected, where indicated. Embryos were soaked in medium containing 150 µm PCB for 2 h in the dark and were subsequently illuminated at 660 nm (20 µmol m -2 s -1 ) or further kept in the dark for additional 2 h before luminescence of individual fish was determined. n = 7-9, error bars indicate one standard error of the mean, non-responsive embryos resulting from an unsuccessful injection were identified statistically, as described elsewhere 9. For abbreviations see Fig
12 Supplementary Movie 1. Time-lapse movie of red light-controlled nuclear import in mammalian cells is available online. Supplementary Movie 2. Time-lapse movie of reversible red light-controlled nuclear import and export in mammalian cells is available online. 12
13 Supplementary References [1] Ulbrich, M. H., and Isacoff, E. Y. (2007) Subunit counting in membrane-bound proteins, Nat. Methods 4, [2] Fussenegger, M., Moser, S., Mazur, X., and Bailey, J. E. (1997) Autoregulated multicistronic expression vectors provide one-step cloning of regulated product gene expression in mammalian cells, Biotechnol. Prog. 13, [3] Müller, K., Siegel, D., Rodriguez Jahnke, F., Gerrer, K., Wend, S., Decker, E. L., Reski, R., Weber, W., and Zurbriggen, M. D. (2014) A red light-controlled synthetic gene expression switch for plant systems, Mol. BioSyst. 10, [4] Wei, X., Potter, C. J., Luo, L., and Shen, K. (2012) Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans, Nat. Methods 9, [5] Weber, W., Stelling, J., Rimann, M., Keller, B., Daoud-El Baba, M., Weber, C. C., Aubel, D., and Fussenegger, M. (2007) A synthetic time-delay circuit in mammalian cells and mice, PNAS 104, [6] Müller, K., Engesser, R., Metzger, S., Schulz, S., Kampf, M. M., Busacker, M., Steinberg, T., Tomakidi, P., Ehrbar, M., Nagy, F., Timmer, J., Zubriggen, M. D., and Weber, W. (2013) A red/far-red light-responsive bi-stable toggle switch to control gene expression in mammalian cells, Nucleic Acids Res. 41, e77. [7] Müller, K., Engesser, R., Timmer, J., Nagy, F., Zurbriggen, M. D., and Weber, W. (2013) Synthesis of phycocyanobilin in mammalian cells, Chem. Commun. 49, [8] Carlson, D. F., Tan, W., Lillico, S. G., Stverakova, D., Proudfoot, C., Christian, M., Voytas, D. F., Long, C. R., Whitelaw, C. B., and Fahrenkrug, S. C. (2012) Efficient TALEN-mediated gene knockout in livestock, PNAS 109, [9] Jacobs, J. L., and Dinman, J. D. (2004) Systematic analysis of bicistronic reporter assay data, Nucleic Acids Res. 32, e
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo Yuma Oka and Thomas N. Sato Supplementary Figure S1. Whole-mount smfish with and without the methanol pretreatment.
Suppl. Materials. Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids. Germany
Suppl. Materials Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids Stephanie Bresan 1, Anna Sznajder 1, Waldemar Hauf 2, Karl Forchhammer 2, Daniel Pfeiffer 3 and Dieter Jendrossek 1 1 Institute
Modular Optimization of Hemicellulose-utilizing Pathway in. Corynebacterium glutamicum for Consolidated Bioprocessing of
[Supplementary materials] Modular Optimization of Hemicellulose-utilizing Pathway in Corynebacterium glutamicum for Consolidated Bioprocessing of Hemicellulosic Biomass Sung Sun Yim 1, Jae Woong Choi 1,
Supporting Information
Supporting Information Plasmid Construction DNA cloning was carried out according to standard protocols. The sequence of all plasmids was confirmed by DNA sequencing and amplified using the E. coli strain
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
University of Bristol - Explore Bristol Research
Al-Salihi, S. A. A., Scott, T. A., Bailey, A. M., & Foster, G. D. (2017). Improved vectors for Agrobacterium mediated genetic manipulation of Hypholoma spp. and other homobasidiomycetes. Journal of Microbiological
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
kpis(ppk20) kpis(ppk46)
Table S1. C. elegans strains used in this study Strains carrying transgenes Strain Transgene Genotype Reference IT213 tcer-1 prom:tcer-1orf:gfp:tcer-1 3'utr unc-119(ed3) III; kpis(ppk6) This study IT283
Expression analysis of PIN genes in root tips and nodules of Lotus japonicus
Article Expression analysis of PIN genes in root tips and nodules of Lotus japonicus Izabela Sańko-Sawczenko 1, Dominika Dmitruk 1, Barbara Łotocka 1, Elżbieta Różańska 1 and Weronika Czarnocka 1, * 1
Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and
1 2 3 4 5 Journal name: Applied Microbiology and Biotechnology Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and evaluation of its effect on lignocellulosic
A cell-based screening system for RNA Polymerase I inhibitors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information A cell-based screening system for RNA Polymerase I inhibitors Xiao Tan,
Forensic SNP Genotyping using Nanopore MinION Sequencing
Forensic SNP Genotyping using Nanopore MinION Sequencing AUTHORS Senne Cornelis 1, Yannick Gansemans 1, Lieselot Deleye 1, Dieter Deforce 1,#,Filip Van Nieuwerburgh 1,#,* 1 Laboratory of Pharmaceutical
Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and
WT sham Trpv4 -/- sham Saline 10µM GSK1016709A P value Saline 10µM GSK1016709A P value Number 10 10 8 8 Intercontractile interval (sec) 143 (102 155) 98.4 (71.4 148) 0.01 96 (92 121) 109 (95 123) 0.3 Voided
Supplementary: A strategy to optimize the generation of stable chromobody cell lines for
Supplementary: A strategy to optimize the generation of stable chromobody cell lines for visualization and quantification of endogenous proteins in living cells Bettina-Maria Keller 1, Julia Maier 1, Melissa
Flowering time. Col C24 Cvi C24xCol C24xCvi ColxCvi
Flowering time Rosette leaf number 50 45 40 35 30 25 20 15 10 5 0 Col C24 Cvi C24xCol C24xCvi ColxCvi Figure S1. Flowering time in three F 1 hybrids and their parental lines as measured by leaf number
University of Bristol - Explore Bristol Research
Tan, B. G., Wellesley, F. C., Savery, N. J., & Szczelkun, M. D. (2016). Length heterogeneity at conserved sequence block 2 in human mitochondrial DNA acts as a rheostat for RNA polymerase POLRMT activity.
(A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5
Fig. S1. Brg1 ablation leads to abnormal villous structure in the duodenum in the perinatal period (A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5 (B, E), and P0.5
Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites
Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites Selwyn Quan *, Ole Skovgaard, Robert E. McLaughlin, Ed T. Buurman,1, and Catherine L. Squires * Department
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
Construction of a cube given with its centre and a sideline
Transformation of a plane of projection Construction of a cube given with its centre and a sideline Exercise. Given the center O and a sideline e of a cube, where e is a vertical line. Construct the projections
Supplemental Information. Investigation of Penicillin Binding Protein. (PBP)-like Peptide Cyclase and Hydrolase
Cell Chemical Biology, Volume upplemental Information Investigation of Penicillin Binding Protein (PBP)-like Peptide Cyclase and ydrolase in urugamide on-ribosomal Peptide Biosynthesis Yongjun Zhou, Xiao
tccattaattcgacagaccagagttaaataatccttgtatgccattgtgatcacatctacagttcagattttgtatttca
Figure Legends for Supplementary Materials: Fig. 1. Nucleotide sequence of the zebrafish lumican (zlum) gene. Exons are indicated by uppercase letters, and introns are indicated by lowercase letters. The
Whole mount in situ hybridization, sectioning, and immunostaining Ribonuclease protection assay (RPA) Collagen gel tube formation assay
Whole mount in situ hybridization, sectioning, and immunostaining In situ hybridization for tie-1 and lncrna tie-1as and sectioning of ISH stained embryos were performed according to previously published
Horizontal gene transfer drives adaptive colonization of apple trees by the fungal pathogen Valsa mali. Zhiyuan Yin, Baitao Zhu, Hao Feng, Lili Huang*
Supplementary Information Horizontal gene transfer drives adaptive colonization of apple trees by the fungal pathogen Valsa mali Zhiyuan Yin, Baitao Zhu, Hao Feng, Lili Huang* State Key Laboratory of Crop
Feloldóképesség 2009.12.08. Mikroszkópos módszerek. DIC mikroszkópia. Fáziskontraszt mikroszkópia. Barkó Szilvia A MIKROSZKÓPIA RÖVID TÖRTÉNETE
A MIKROSZKÓPIA RÖVID TÖRTÉNETE Mikroszkópos módszerek Barkó Szilvia 1667: Robert Hooke cellulákat ír le parafában összetett mikroszkóp segítségével. 1674: Antony van Leeuwenhoek élő mikróbákat figyel meg
pleics-06 Amp pleics-13 Amp/Zeo N-His 10/ 3 x
Protease Sequence primers Vector Name AR Tag/Flag cleavage Tag and linker pleics-01 Amp N-His 6 TEV Extra SM His6-SSGVDLGT-TEV site-1 T7 Promoter pleics-01-seq-r pleics-02 Amp N-GST TEV Extra SM GST-SS-TEV
AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, TILLING
Hagyomány és haladás a növénynemesítésben AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, BÁLINT ANDRÁS FERENC 1, SZIRA FRUZSINA 1, ANDREAS BÖRNER 2, KERSTIN
SOLiD Technology. library preparation & Sequencing Chemistry (sequencing by ligation!) Imaging and analysis. Application specific sample preparation
SOLiD Technology Application specific sample preparation Application specific data analysis library preparation & emulsion PCR Sequencing Chemistry (sequencing by ligation!) Imaging and analysis SOLiD
Összefoglalás. Summary. Bevezetés
A talaj kálium ellátottságának vizsgálata módosított Baker-Amacher és,1 M CaCl egyensúlyi kivonószerek alkalmazásával Berényi Sándor Szabó Emese Kremper Rita Loch Jakab Debreceni Egyetem Agrár és Műszaki
DECLARATION OF PERFORMANCE No. GST REV 1.03 According to Construction Products Regulation EU No. 305/2011
DECLARATION OF PERFORMANCE No. According to Construction Products Regulation EU No. 305/2011 This declaration is available in the following languages: English Declaration of Performance Page 2-3 Hungarian
The beet R locus encodes a new cytochrome P450 required for red. betalain production.
The beet R locus encodes a new cytochrome P450 required for red betalain production. Gregory J. Hatlestad, Rasika M. Sunnadeniya, Neda A. Akhavan, Antonio Gonzalez, Irwin L. Goldman, J. Mitchell McGrath,
pjnc-pgluc Codon-optimized Gaussia luciferase (pgluc) Vector backbone: JM83 pjnc-pgluc is resistant to ampicillin and neomycin High or low copy:
pjnc-pgluc Gene/Insert name: Codon-optimized Gaussia luciferase (pgluc) Vector backbone: pcmv-jnc Vector type: Mammalian cells Backbone size w/o insert (bp): 5375 Bacterial resistance: Ampicillin and neomycin
Mapping Sequencing Reads to a Reference Genome
Mapping Sequencing Reads to a Reference Genome High Throughput Sequencing RN Example applications: Sequencing a genome (DN) Sequencing a transcriptome and gene expression studies (RN) ChIP (chromatin immunoprecipitation)
Mangalica: The VM-MOE Treaty. Olmos és Tóth Kft. Monte Nevado
Mangalica: The VM-MOE Treaty The agreement 2013 the Goverment of Hungary decided to launch a strategic cooperation with the MOE. The deal is based in the Hungarian Pig Development Strategy (3 to 6 millon
MELLÉKLET / ANNEX. EU MEGFELELŐSÉGI NYILATKOZAT-hoz for EU DECLARATION OF CONFORMITY
TRACON BUDAPEST KFT. TRACON BUDAPEST LTD. 2120 DUNAKESZI, PALLAG U. 23. TEL.: (27) 540-000, FAX: (27) 540-005 WWW.TRACON.HU EU MEGFELELŐSÉGI NYILATKOZAT, a 79/1997. (XII. 31.) IKIM számú és a 374/2012.
ANNEX V / V, MELLÉKLET
ANNEX V / V, MELLÉKLET VETERINARY CERTIFICATE EMBRYOS OF DOMESTIC ANIMALS OF THE BOVINE SPECIES FOR IMPORTS COLLECTED OR PRODUCED BEFORE 1 st JANUARY 2006 ÁLLAT-EGÉSZSÉGÜGYI BIZONYÍTVÁNY 2006. JANUÁR 1-JE
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Supplementary Figure S1.
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress Sheila I. Jensen 1*, Rebecca M. Lennen 1, Markus J. Herrgård 1, Alex T. Nielsen 1*
General information for the participants of the GTG Budapest, 2017 meeting
General information for the participants of the GTG Budapest, 2017 meeting Currency is Hungarian Forint (HUF). 1 EUR 310 HUF, 1000 HUF 3.20 EUR. Climate is continental, which means cold and dry in February
IES TM Evaluating Light Source Color Rendition
IES TM-30-15 Evaluating Light Source Color Rendition "Original" "CRI = 80" Desaturated "CRI = 80" Saturated More metrics Color Fidelity Color Discrimination Color Preference Metrics/Measures R f (IES TM-30-15)
The role of aristolochene synthase in diphosphate activation
Supporting information for The role of aristolochene synthase in diphosphate activation Juan A. Faraldos, Verónica González and Rudolf K. Allemann * School of Chemistry, Cardiff University, Main Building,
Bird species status and trends reporting format for the period (Annex 2)
1. Species Information 1.1 Member State Hungary 1.2.2 Natura 2000 code A634-B 1.3 Species name Ardea purpurea purpurea 1.3.1 Sub-specific population East Europe, Black Sea & Mediterranean/Sub-Saharan Africa
Supplementary Figure 1
Supplementary Figure 1 Plot of delta-afe of sequence variants detected between resistant and susceptible pool over the genome sequence of the WB42 line of B. vulgaris ssp. maritima. The delta-afe values
Ültetési és öntözési javaslatok. Planting and watering instructions
Ültetési és öntözési javaslatok Planting and watering instructions 1 Önöntöző-rendszer Sub-irrigation 2 Kedves növénykedvelő A LECHUZA önöntöző rendszerrel növényeink természetüknél fogva gyönyörű virágokat
Formula Sound árlista
MIXERS FF-6000; FF6000P Formula Sound 160 6 channel dual format DJ mixer with removable fader panel. (Supplied with linear faders) Formula Sound 160P As above but with PRO X crossfade fitted. Formula Sound
NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING
Anyagmérnöki Tudományok, 39/1 (2016) pp. 82 86. NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING LEDNICZKY
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit.
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit. MYB Primer pairs TC AtMYB Forward Reverse TC199266 MYB12 AGGCTCTTGGAGGTCGTTACC CAACTCTTTCCGCATCTCAATAATC
Using the CW-Net in a user defined IP network
Using the CW-Net in a user defined IP network Data transmission and device control through IP platform CW-Net Basically, CableWorld's CW-Net operates in the 10.123.13.xxx IP address range. User Defined
Animal welfare, etológia és tartástechnológia
Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 9 Issue 3 Különszám/Special Issue Gödöllő 2013 64 BIOSZENZOR ZEBRADÁNIÓ VONAL PAJZSMIRIGY MŰKÖDÉST ZAVARÓ
FATERMÉSI FOK MEGHATÁROZÁSA AZ EGÉSZÁLLOMÁNY ÁTLAGNÖVEDÉKE ALAPJÁN
4. évfolyam 2. szám 2 0 1 4 101 107. oldal FATERMÉSI FOK MEGHATÁROZÁSA AZ EGÉSZÁLLOMÁNY ÁTLAGNÖVEDÉKE ALAPJÁN Veperdi Gábor Nyugat-magyarországi Egyetem, Erdômérnöki Kar Kivonat A fatermési fok meghatározása
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
On The Number Of Slim Semimodular Lattices
On The Number Of Slim Semimodular Lattices Gábor Czédli, Tamás Dékány, László Ozsvárt, Nóra Szakács, Balázs Udvari Bolyai Institute, University of Szeged Conference on Universal Algebra and Lattice Theory
Tutorial 1 The Central Dogma of molecular biology
oday DN RN rotein utorial 1 he entral Dogma of molecular biology Information flow in genetics:» ranscription» ranslation» Making sense of genomic information Information content in DN - Information content
4-42 ELECTRONICS WX210 - WX240
4-42 ELECTRONICS WX210 - WX240 PCS 40000499-en Fig. 8 WX210 - WX240 ELECTRONICS 4-43 PCS COMPONENTS 40000471-en Load-limit regulator Legend Fig. 1 Fig. 2 1 Power supply 2 PWM1 output, proportional valve
Oszvald Mária. A búza tartalékfehérjék tulajdonságainak in vitro és in vivo vizsgálata rizs modell rendszerben
Budapesti Műszaki és Gazdaságtudományi Egyetem Alkalmazott Biotechnológia és Élelmiszertudományi Tanszék PHD ÉRTEKEZÉS TÉZISEI Készítette: Oszvald Mária A búza tartalékfehérjék tulajdonságainak in vitro
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.
First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this
TELJESÍTMÉNY NYILATKOZAT 0832-CPD-1651
E-mail: info@fulleon.co.uk Web: www.cooperfulleon.co m TELJESÍTMÉNY NYILATKOZAT 0832-CPD-1651 Termék azonosító kód: ROLP/SV és ROLP/SV/WP Típus, adagszám vagy gyári szám, illetve bármilyen más elem, amely
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon
A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,
EN United in diversity EN A8-0206/419. Amendment
22.3.2019 A8-0206/419 419 Article 2 paragraph 4 point a point i (i) the identity of the road transport operator; (i) the identity of the road transport operator by means of its intra-community tax identification
Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz
Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz Kvantumkapuk, áramkörök 2016. március 3. A kvantummechanika posztulátumai (1-2) 1. Állapotleírás Zárt fizikai rendszer aktuális állapota
MINO V2 ÁLLVÁNY CSERÉJE V4-RE
MINO V2 remote controlled MINO V2 ÁLLVÁNY CSERÉJE V4-RE Mino V3 circuit board replacement Mino V2-V4 csere készlet ezüst Art# 59348S, Mino V2-V4 csere készlet fehér Art# 59348W V4 áramköri lap Art# 75914
Supplementary Figure 1
Supplementary Figure 1 Barcode analysis for the identification of mirnas that break B cell tolerance. (a) Barcode identification method. Genomic DNA samples from purified splenic B cells that escaped tolerance
(AD) β (A ) (2) ACDP ACDP ACDP APP. APP-C99 γ (3) A 40 A 42 A A A A 42/A 40. in vivo A A A A
(AD) β (A) A AAPP APP-C99 γ A A40 A42 A AA42/A40 γ A A γ AD A A A A APP APP APP A A A A A A (1)AD A42 A AD AD (2) ACDP AACDP ACDP A A ACDP (3) (1)A in vivo A APP Gray and Whittaker 1962; Perez-Otano et
Computer Architecture
Computer Architecture Locality-aware programming 2016. április 27. Budapest Gábor Horváth associate professor BUTE Department of Telecommunications ghorvath@hit.bme.hu Számítógép Architektúrák Horváth
CLUSTALW Multiple Sequence Alignment
Version 3.2 CLUSTALW Multiple Sequence Alignment Selected Sequences) FETA_GORGO FETA_HORSE FETA_HUMAN FETA_MOUSE FETA_PANTR FETA_RAT Import Alignments) Return Help Report Bugs Fasta label *) Workbench
Architecture of the Trypanosome RNA Editing Accessory Complex, MRB1
Architecture of the Trypanosome RNA Editing Accessory Complex, MRB1 Michelle L. Ammerman, Kurtis M. Downey, Hassan Hashimi, John C. Fisk, Danielle L. Tomasello, Drahomíra Faktorová, Lucie Hanzálková, Tony
Correlation & Linear Regression in SPSS
Correlation & Linear Regression in SPSS Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise 1 - Correlation File / Open
4 vana, vanb, vanc1, vanc2
77 1) 2) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 12 7 17 4 8 2003 1 2004 7 3 Enterococcus 5 Enterococcus faecalis 1 Enterococcus avium 1 Enterococcus faecium 2 5 PCR E. faecium 1 E-test MIC 256 mg/ml vana MRSA MRSA
TELJESÍTMÉNY NYILATKOZAT 0333-CPD
E-mail: info@fulleon.co.uk TELJESÍTMÉNY NYILATKOZAT 0333-CPD-075441 Termék azonosító kód: Típus, adagszám vagy gyári szám, illetve bármilyen más elem, amely lehetővé teszi az építési termékek azonosítását
Hasznos és kártevő rovarok monitorozása innovatív szenzorokkal (LIFE13 ENV/HU/001092)
Hasznos és kártevő rovarok monitorozása innovatív szenzorokkal (LIFE13 ENV/HU/001092) www.zoolog.hu Dr. Dombos Miklós Tudományos főmunkatárs MTA ATK TAKI Innovative Real-time Monitoring and Pest control
KN-CP50. MANUAL (p. 2) Digital compass. ANLEITUNG (s. 4) Digitaler Kompass. GEBRUIKSAANWIJZING (p. 10) Digitaal kompas
KN-CP50 MANUAL (p. ) Digital compass ANLEITUNG (s. 4) Digitaler Kompass MODE D EMPLOI (p. 7) Boussole numérique GEBRUIKSAANWIJZING (p. 0) Digitaal kompas MANUALE (p. ) Bussola digitale MANUAL DE USO (p.
Oxacillin MIC µ g ml borderline oxacillin-resistant Staphylococcus aureus. oxacillin Staphylococcus aureus MRSA
oxacillin Staphylococcus aureus MRSA 8 17 11 1 Oxacillin MIC 1248 µ gml borderline oxacillin-resistant Staphylococcus aureus BORSA79 NCCLS CLSIM100-S142004 cefoxitin disk oxacillin cefoxitin methicillin-resistant
FAMILY STRUCTURES THROUGH THE LIFE CYCLE
FAMILY STRUCTURES THROUGH THE LIFE CYCLE István Harcsa Judit Monostori A magyar társadalom 2012-ben: trendek és perspektívák EU összehasonlításban Budapest, 2012 november 22-23 Introduction Factors which
NFFKÜ - Nemzetközi Fejlesztési és Forráskoordinációs Ügynökség Zártkörűen Működő Részvénytársaság (1037 Budapest, Montevideo u. 16/A.
NFFKÜ - Nemzetközi Fejlesztési és Forráskoordinációs Ügynökség Zártkörűen Működő Részvénytársaság (1037 Budapest, Montevideo u. 16/A.) REGISZTRÁCIÓS FELHÍVÁS a Megbízási szerződés a Hulladék mennyiségének
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Karancsi Lajos Gábor Debreceni Egyetem Agrár és Gazdálkodástudományok Centruma Mezőgazdaság-, Élelmiszertudományi és Környezetgazdálkodási
- Supplementary Data
1 Open Access Asian Australas. J. Anim. Sci. Vol. 29, No. 3 : 321-326 March 2016 http://dx.doi.org/10.5713/ajas.15.0331 www.ajas.info pissn 1011-2367 eissn 1976-5517 Analysis of Swine Leukocyte Antigen
Statistical Dependence
Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent
SUPPLEMENTAL DATA. Structure and specificity of the Type VI secretion system ClpV-TssC interaction in enteroaggregative Escherichia coli.
SUPPLEMENTAL DATA Structure and specificity of the Type VI secretion system ClpV-TssC interaction in enteroaggregative Escherichia coli. B. Douzi, Y.R. Brunet, S. Spinelli, V. Lensi, P. Legrand, S. Blangy,
Széchenyi István Egyetem www.sze.hu/~herno
Oldal: 1/6 A feladat során megismerkedünk a C# és a LabVIEW összekapcsolásának egy lehetőségével, pontosabban nagyon egyszerű C#- ban írt kódból fordítunk DLL-t, amit meghívunk LabVIEW-ból. Az eljárás
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.
Correlation & Linear Regression in SPSS Petra Petrovics PhD Student Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise
Márkaépítés a YouTube-on
Márkaépítés a YouTube-on Tv+ Adj hozzá YouTube-ot, Google Ground, 2016 Március 7. Bíró Pál, Google - YouTube 9,000,000 INTERNETTEL BÍRÓ ESZKÖZÖK VOLUMENE GLOBÁLISAN WEARABLES OKOS TV 8,000,000 7,000,000
TELJESÍTMÉNY NYILATKOZAT 0333-CPD
E-mail: info@ fu leon.co.uk TELJESÍTMÉNY NYILATKOZAT 0333-CPD-075444 Termék azonosító kód: Típus, adagszám vagy gyári szám, illetve bármilyen más elem, amely lehetővé teszi az építési termékek azonosítását
Limitations and challenges of genetic barcode quantification
Limitations and challenges of genetic barcode quantification Lars hielecke, im ranyossy, ndreas Dahl, Rajiv iwari, Ingo Roeder, Hartmut eiger, Boris Fehse, Ingmar lauche and Kerstin ornils SUPPLEMENRY
A évi fizikai Nobel-díj
A 2012. évi fizikai Nobel-díj "for ground-breaking experimental methods that enable measuring and manipulation of individual quantum systems" Serge Haroche David Wineland Ecole Normale Superieure, Párizs
Erdészettudományi Közlemények
Erdészettudományi Közlemények 2. évfolyam 1. szám 2012 73 80 oldal AZ EZÜSTHÁRS FATERMÉSI TÁBLÁJÁNAK MÓDOSÍTÁSA Peszlen Roland József és Veperdi Gábor Nyugat-magyarországi Egyetem, Erdőmérnöki Kar, Erdővagyon-gazdálkodási
Baranyáné Dr. Ganzler Katalin Osztályvezető
Budapesti Műszaki és Gazdaságtudományi Egyetem Biokémiai és Élelmiszertechnológiai Tanszék Kapilláris elektroforézis alkalmazása búzafehérjék érésdinamikai és fajtaazonosítási vizsgálataira c. PhD értekezés
Mock Orc2. NPE sperm pre-rc replication
Time (min): HSS + M13 0 30 50 70 Orc2 HSS NPE sperm pre-rc repliction c % Repliction 60 40 20 0 HSS + sp NPE Orc2 Fig. S1: M13 ssdna-induced destruction of does not require ORC. S1: M13 ssdna ws incuted
RÉSZLETES BESZÁMOLÓ Az OTKA által támogatott konzorcium működésében az Uzsoki utcai Kórház feladata a szövetminták gyűjtése, előzetes feldolgozása, ill. a betegek utánkövetése, valamint az utánkövétésre
Excel vagy Given-When-Then? Vagy mindkettő?
TESZT & TEA BUDAPEST AGILE MEETUP Pénzügyi számítások automatizált agilis tesztelése: Excel vagy Given-When-Then? Vagy mindkettő? NAGY GÁSPÁR TechTalk developer coach Budapest, 2014 február 6. SpecFlow
Animal welfare, etológia és tartástechnológia
Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 5 Issue 4 Különszám Gödöllı 2009 459 MORFOLÓGIAI ÉS GENETIKAI VIZSGÁLATOK MAGYARORSZÁGI TÖRPEHARCSÁKON
Kezdőlap > Termékek > Szabályozó rendszerek > EASYLAB és TCU-LON-II szabályozó rendszer LABCONTROL > Érzékelő rendszerek > Típus DS-TRD-01
Típus DS-TRD FOR EASYLAB FUME CUPBOARD CONTROLLERS Sash distance sensor for the variable, demand-based control of extract air flows in fume cupboards Sash distance measurement For fume cupboards with vertical
Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI
Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance
Regional Expert Meeting Livestock based Geographical Indication chains as an entry point to maintain agro-biodiversity
How Code of Practice can address the question of biodiversity (indigenous breeds, peculiarities of feeding, rearing traditional or marginalized systems)? Rendek Olga, Kerekegyháza 2009 október 20. 1 2
FIATAL MŰSZAKIAK TUDOMÁNYOS ÜLÉSSZAKA
FIATAL ŰSZAKIAK TUDOÁNYOS ÜLÉSSZAKA Kolozsvár, 1999. március 19-20. Zsákolt áruk palettázását végző rendszer szimulációs kapacitásvizsgálata Kádár Tamás Abstract This essay is based on a research work
sikeresnek bizonyult, és ami a legfontosabb az onkoterápiában, hogy a vegyület nem toxikus, ezért igen magas dózissal is eredményesn alkalmazható.
Turmeric Live Extract 30db A teljes kurkuma kivonat hatásának rövid jellemzése A Turmeric Live Extract bonyolult, számos eltérő molekulát tartalmazó összetett hatóanyag. A turmeron/ol különböző formáit,
Utolsó frissítés / Last update: február Szerkesztő / Editor: Csatlós Árpádné
Utolsó frissítés / Last update: 2016. február Szerkesztő / Editor: Csatlós Árpádné TARTALOM / Contents BEVEZETŐ / Introduction... 2 FELNŐTT TAGBÉLYEGEK / Adult membership stamps... 3 IFJÚSÁGI TAGBÉLYEGEK
A forrás pontos megnevezésének elmulasztása valamennyi hivatkozásban szerzői jogsértés (plágium).
A szakirodalmi idézések és hivatkozások rendszere és megadásuk szabályai A bibliográfia legfontosabb szabályai Fogalma: Bibliográfiai hivatkozáson azoknak a pontos és kellően részletezett adatoknak az