A csirke tobozmirigy vizsgálata, mint az experimentális jet lag modellje

EGYETEMI DOKTORI (PH. D.) ÉRTEKEZÉS TÉZISEI A csirke tobozmirigy vizsgálata, mint az experimentális jet lag modellje Dr. Siri Kommedal PTE ÁOK Anatómiai Intézet Elméleti Orvostudományok Doktori Iskola Doktori Iskola vezető: Dr. Lénárd László Neuroendokrinológia és Neurohisztológia Doktori Program Programvezető: Dr. Csernus Valér Témavezető: Dr. Csernus Valér 2013

1

BEVEZETÉS A Föld tengelykörüli rotációjához igazodó, megközelítőleg 24 órás periódusidejű biológiai ritmust cirkadián ritmusnak nevezzük (circa diem körülbelül egy nap). A cirkadián ritmus az élőlényekben veleszületett, endogén jelenség, amely periodikus környezeti inger hiányában is megmarad (szabadon fut). A cirkadián ritmus fázisa igazodik a periodikus, ún. zeitgeber ingerek által meghatározott környezeti ciklushoz. A cirkadián ritmus az élővilág ősi, konzervált jelensége, ami valószínűleg már a fotoszintetizáló ősbaktériumokban megjelent: ezekben az organizmusokban - sejtorganellumok hiányában az óra fontos szerepet játszhatott az egymással nem kompatibilis biokémiai mechanizmusok térbeli elkülönítésében és az UV fény DNSkárosító hatásával szembeni védekezésben, ezáltal evolúciós előnyt jelenthetett. Emlősökben a cirkadián rendszert egy központi és számos perifériás óra, valamint afferenseik és efferenseik alkotják (1.ábra). A központi alkotórészek pontos feltérképezésének egyik jelentős állomása a pécsi Anatómiai Intézet munkatársainak léziós kísérlete volt: megfigyelték, hogy a hypothalamicus magvak közötti kapcsolatok megszakítását számos neuroendokrin ritmus megszűnése követte. A fény-sötét viszonyok váltakozása és a hypothalamus közötti kapcsolat további feltérképezésében a tractus retinohypothalamicus (RHT) azonosítása fontos lépést jelentett. A retina és a hypothalamus között kapcsolatot létesítő pálya rostjai a hypothalamus mediális zónájának anterior magvai közé tartozó nucleus suprachiasmaticuson (SCN) végződnek. Emlősökben az SCN ablációját az élettani folyamatok cirkadián ritmusának megszűnése követte, SCN-ablált patkányba ültetett SCN-graft a donor cirkadián ritmusának megfelelő mintázatot hozott létre. In vitro más sejtekkel ellentétben az SCN neuronok zeitgeber hiányában is képesek szinkronizált, robusztus amplitúdójú ritmus fenntartására. Ezen eredmények igazolták, hogy az emlősök központi oszcillátora az SCN-ban helyezkedik el. Az SCN neuronjai közötti kiterjedt intercelluláris kommunikáció biztosítja a sejtek oszcillátorainak szinkronitását, és ezen keresztül a megfelelő amplitúdójú output szignált a perifériás oszcillátorok részére. 2

A fényexpozíció időpontjától és időtartamától függően az óra válasza szignifikánsan eltérő lehet. Diurnális életmódot folytató állatokban a hajnali fényexpozíció késlelteti, az esti megvilágítás sietteti a ritmus fázisát, ezzel szemben éjszakai életmódú állatokban ez a jelenség éppen ellenkező irányú változásokat okoz. Ennek hátterében az óraproteinek és a jelátviteli messengerek napszakonként eltérő elérhetősége állhat. A rövid időtartamú fényimpulzusok a cirkadián ritmus fáziseltolását eredményezik, míg a tartós megvilágítás az SCN neuronok működését deszinkronizálja az sejtek intercelluláris kommunikációjának befolyásolásával. fény fény RHT iprgc RHT iprgc SCN SCN Tobozmirigy Perifériás oszcillátorok Tobozmirigy Perifériás oszcillátorok MEL MEL 1. ábra A cirkadián rendszer. Bal oldalon az emlős, jobb oldalon a madár óramodell sematikus ábrázolása látható. Rövidítések: iprgc= intrinsically photosensitive retinal ganglion cells, RHT=tractus retinohypothalamicus, SCN=nucleus suprachiasmaticus, MEL=melatonin A cirkadián biológiai oszcillátor sejtszintű működtetése az óragének, valamint az általuk kódolt transzkripciós faktorok, az óraproteinek feladata. Ezek a faktorok aktiválják vagy gátolják az óragének expresszióját, ezáltal egy önfenntartó, 3

transzkripcionális szintű feedback-hurokrendszert alkotnak, amelyben a ciklus utolsó eleme az elsőt aktiválja. Az óragén feedback-hurkok többszörös összefonódása biztosítja a rendszer nagyfokú redundanciáját, azon túlmenően felerősíti a ritmus amplitúdó-változásait. A ciklus pozitív szabályozói a CLOCK (circadian locomotor output cycles kaput) és a BMAL1 (brain and muscle ARNT-like) óraproteinek, fő gátló elemei a PER (Period) és a CRY (Cryptochrome) óraproteinek. CLOCK:BMAL1 PER, CRY ROR? REV-ERB? E-box, RORE SIRT1 PPAR-? PPAR-? Melatonin (AA-NAT) Metabolikus hatások Génexpresszió Zeitgeber NAD + NADH 2. ábra A molekuláris oszcillátor. A ciklus kezdetén a CLOCK:BMAL1 aktiválja a cry és per gének promotereit. Transzkripciót és transzlációt követően a PER és CRY óraprotein komplexek a sejtmagba transzlokálódnak, ahol gátolják a CLOCK:BMAL1 aktivitását. Ezáltal a Cry és Per mrns- és fehérjeszintek fokozatosan csökkennek, így a CLOCK:BMAL1 felszabadul a gátlás alól és újraindul a ciklus. A perifériás oszcillátorok óragénkészlete a központival azonos, azonban a ritmusosan expresszált génkészlet az eltérő fukciók és igénybevétel következtében nagymértékben szövetspecifikus. A perifériás oszcillátorok feladata a lokális génexpresszió ritmusának amplifikálása és szinkronizálása a neurohumorális zeitgeberek által meghatározott 4

ciklushoz. Perifériás oszcillátort tartalmaz többek között a tobozmirigy, a máj, a vesék és a mellékvesék, a szív és a zsírszövet. A tobozmirigynek jelentős szerepe van mind a központi, mind a perifériás oszcillátorok szabályozásában: az SCN-ből a vegetatív idegrendszer közvetítésével érkező információ hatására melatonint (MEL) választ el, ami keringő zeitgeberként minden sejtnek jelzi a környezeti fényviszonyok aktuális állapotát. A MEL MT 1 és MT 2 receptorai a központi idegrendszerben (így az SCN-ben is) és a perifériás szövetekben egyaránt jelen vannak. Madarakban a cirkadián rendszer multioszcillátoros felépítésű (1.ábra): a retina, az SCN és a tobozmirigy fajonként eltérő mértékben vesz részt a ritmus szabályozásában. A tobozmirigy-ablált madarak számos élettani folyamata ritmustalanná válik, ezzel szemben emlősökben a mirigy eltávolítása nem okoz szignifikáns változást. Emlősöktől eltérően a madár tobozmirigyet az SCN-ből érkező órajelen kívül a közvetlen megvilágítás is befolyásolja. A csirke tobozmirigy a cirkadián ritmusok vizsgálatára alkalmas kísérleti modell, mert: 1. Endogén oszcillátort tartalmaz, amely in vitro körülmények között, zeitgeberek hiányában is képes szinkronizált működésre az emlős SCN-hez hasonlóan. Ezzel szemben az emlős tobozmirigy hasonló körülmények között néhány ciklus alatt deszinkronizálódik. 2. Fotopigment-tartalmának (pinopszin, melanopszin) köszönhetően működését a megvilágítás közvetlenül befolyásolja, így in vitro is képes a megváltozott fénysötét viszonyokhoz való alkalmazkodásra. 3. A madár tobozmirigy izolálása technikailag egyszerűbben kivitelezhető, mint az emlős SCN eltávolítása. 4. A madarak biológiai ritmusainak kialakulását embrionális korban az anyai humorális környezet nem befolyásolja, azaz a tojások kontrollált körülmények közötti inkubálása további előnyt biztosít a kísérletek kivitelezésének szempontjából. 5

A jet lag rapid, több időzónán átívelő utazás következtében fellépő tünetegyüttes, melynek hátterében az akutan megváltozott környezeti ciklushoz késéssel adaptálódó cirkadián óra áll. Míg ez a jelenség a populáció kisebb hányadát érinti, a krónikus jet lag, azaz a váltóműszak megközelítőleg a Föld lakosságának 20%-ának életmódját, egészségét befolyásolja. Mindkét jelenség cirkadián diszrupcióhoz (CD) vezet. A CD az élettani, biokémiai és magatartási cirkadián ritmusok és a 24 órás környezeti ciklusok közötti fázisszinkron kapcsolat megszakadásaként definiálható. Ez az állapot a ritmusos működés teljes megszűnését, a centrális és perifériás oszcillátorok deszinkronizálódását vagy a ciklus fáziseltolását is jelentheti. A CD kialakulásában szerepet játszó faktorok a kronodiszruptorok. Ilyen faktor többek között a jet lag és a váltóműszak, valamint az alvásmegvonás, az éjszakai étkezés és a fényszennyezés. Az endogén óra által jelzett belső idő és a környezet közötti inkongruencia akutan jelentkező tünetekben (fáradékonyság, szomnolencia, gasztrointesztinális tünetek), valamint a metabolikus szindróma, kardiovaszkuláris és bizonyos daganatos betegségek kialakulásának magasabb rizikójában nyilvánulhat meg. 2007-ben az IARC a karcinogének 2A csoportjába, azaz a lehetséges rákkeltő tényezők közé sorolta a cirkadián diszrupciót involváló váltóműszakot. Mindezek alapján a CD több népbetegség patogenezisében szerepet játszhat. 6

Célkitűzések Az experimentális jet-lagnek az óragének mrns expressziójára gyakorolt hatása korábban nem került leírásra. Miután a CLOCK központi szerepet tölt be a cirkadián molekuláris oszcillátor működésében, valamint újabb adatok szerint népbetegségek potenciális patogenetikai tényezője, ezért a kísérlet során az volt a célunk, hogy a clock mrns expresszióját vizsgáljuk csirke tobozmirigy modellben akutan változó fény-sötét viszonyok között, azaz experimentális jet lag során. Munkánk során arra kerestük a választ, hogy a clock transzkripció alkalmazkodik-e az akutan megfordított megvilágítási rezsimhez, továbbá az esetleges adaptáció sebességéről is adatokat kívántunk gyűjteni. Ezenkívül szándékunkban állt megvizsgálni, hogy a csirke tobozmirigy eltérő fény-sötét viszonyokhoz való alkalmazkodása mennyiben tekinthető a mirigy intrinsic képességének, vagyis ezt az adaptációt mennyiben befolyásolhatják az extrapineális neurohumorális szignálok. Ezen kérdéseink megválaszolása céljából in vivo és in vitro kísérleteket terveztünk. ANYAGOK ÉS MÓDSZEREK Kísérleti állatok Kísérleteink során Hubbard típusú tyúkok megtermékenyített tojásait normál fény-sötét viszonyok között keltettük (14 óra fény, 10 óra sötétség, továbbiakban: LD). Szemikvantitatív RT-PCR Az izolált csirke tobozmirigyek RNS-extraktumainak vizsgálata egylépéses RT-PCR eljárással történt (MMLV Reverz Transzkriptáz/Life Technologies, RedTaq DNSpolimeráz/Sigma-Aldrich). A reverz transzkripció változó hatékonyságából és az egyes minták eltérő RNS-mennyiségeiből adódó különbségek normalizálására belső standardként β-aktint használtunk, mivel az mrns-expressziója nem mutat cirkadián ritmust a csirke tobozmirigyben. A reverz transzkripció (42 C/15 perc, 94 C/5 perc) és az amplifikáció (26 ciklus 94 C/30 s, 60 C/30 s, 72 C/1 min) csirkespecifikus clock (5 primer: TCCCAGTCTCTTGGACAACC, 3 primer: GCTGTTGCTGGATCATG- 7

TGT) és β-aktin (5 primer: GATGGACTCTGGTGATGGTG, 3 primer: AGGGCTGTGATCTC CTTCTG) primerek jelenlétében történt. A cdns-specifikus primerpárok tervezését és validálását munkacsoportunk már ezt megelőzően elvégezte. A PCR-termékeket 1,5%-os agaróz gélen, TBE pufferben szeparáltuk, a gélt SYBR Green-nel festettük. A megfestett gélt kék fénnyel (Dark Reader, Clare Chemicals, USA) világítottuk meg, a fluoreszcens jel dokumentálásához egy egyedileg összeállított rendszert használtunk. A DNS-hez kötődött festék fluoreszcenciáját a gélfotókon látható DNS-csíkok pixel-intenzitása alapján határoztuk meg (ImageJ software, NIH). In vivo kísérlet. Az in vivo kísérleteknél az előzőleg LD viszonyok között tartott állatokat 10 óra megvilágítás/ 14 óra sötétség DL környezetbe helyeztük, ezzel modellezve a jet laget. Minden vizsgálati csoportból azonos fejlődési stádiumú csirkéket (n=3) dekapitáltunk 4 óránként, majd eltávolítottuk a tobozmirigyeket. Az izolált tobozmirigyeket egészben, egyenként homogenizáltuk 0.5 ml TRI reagensben. A homogenizált minták tárolása -70 C-on történt a további vizsgálatokig. In vitro kísérlet. Az in vitro vizsgálatoknál LD környezetben tartott 6 hetes csirkéket a kísérlet napján 12:00-kor dekapitáltuk. Minden egyes izolált tobozmirigyet (n=6) egyenként 3-4 darabra vágtunk, ezt követően a mirigydarabokból egy csoportot alkottunk. Az így nyert keveréket 6 egyenlő részre osztottuk fel, majd a mintákat a perifúziós rendszer ( 3. ábra Perifúziós rendszer (sémás rajz és fotó). A vízfürdőben tartott lombikból a médium egy négyállású csapon keresztül áramlik a cellákban található szövetmintákhoz, majd a perisztaltikus pumpán át a gyűjtőedénybe. A rajzot Matkovits Attila készítette.) 6 cellájába helyeztük. A cellákon a szövettenyésztő médium (Sigma Medium 199) átáramlási sebessége 4 ml/óra, hőmérséklete 37,8 C volt. A rendszer másnap 20:00-ig LD (14 óra 225 Lux, 10 óra sötét) viszonyok között működött, ezt követően DL (10 óra 225 Lux, 14 óra sötét) környezetet biztosítottunk. A mintavétel 30 órával a rendszer elindítása után (másnap 18:00) kezdődött, amelynek során 4 óránként egy-egy cella tartalmát nyertük ki. 8

3. ábra Perifúziós rendszer (sémás rajz és fotó). A vízfürdőben tartott lombikból a médium egy négyállású csapon keresztül áramlik a cellákban található szövetmintákhoz, majd a perisztaltikus pumpán át a gyűjtőedénybe. A rajzot Matkovits Attila készítette. 9

Statisztikai módszerek A statisztikai próbákat a β-aktinhoz normalizált fluoreszcencia-értékeken végeztük. A különböző időpontokban gyűjtött minták közti különbségeket variancia-analízissel (egyutas ANOVA) és kétmintás t-próbával (kétmintás, kétvégű, egyenlőtlen varianciájú) vizsgáltuk meg. Az LD és DL csoportok közti különbségek analizálása varianciaanalízissel (két-utas ANOVA) és Tukey-féle post hoc teszttel történt. Minden statisztikai próbánál szignifikancia-határnak p=0,05-öt tekintettük. EREDMÉNYEK Éjszakai megvilágítás akut hatása a clock mrns-expressziójára in vivo LD körülmények között tartott 6 hetes csirkéket (n=18) két csoportra (n=9) osztottuk fel. A kontroll csoportot továbbra is LD környezetben tartottuk, míg az exponált csoport esetében a megvilágítást 20:00 órától további 6 órán át folytattuk. A tobozmirigy mintákat (n=3) 4 órás időközönként gyűjtöttük 18:00 órától, azaz 2 órával a 20:00 órakor alkalmazott akut fényexpozíciót megelőzően. A kontroll csoport esetében a clock mrns szintek megemelkedtek a sötét fázisban, egy csúccsal 2:00-kor, ezzel szemben a 18:00-kor és a 22:00-kor kimutatott mrns-mennyiség nem mutatott jelentős eltérést. Az exponált csoportban a clock expresszió 18:00-kor és 2:00-kor lényegében nem változott a kontrollhoz képest, azonban 22:00-kor magasabb volt a kontrollhoz viszonyítva. A clock mrns-expressziós mintázata fordított fény-sötét viszonyok között in vivo LD körülmények között tartott 6 hetes csirkéket (n=36) két csoportra (n=18) osztottuk fel. A kontroll csoportot továbbra is LD környezetben tartottuk, míg a DL csoport esetében a kísérletet megelőző napon 20:00 órától a fény-sötét viszonyokat megfordítottuk. A tobozmirigy mintákat (n=3) 4 órás időközönként gyűjtöttük 6:00 órától 2:00 óráig. A kontroll LD csoportban nappal alacsony clock mrns szinteket mértünk, a sötét fázisban a clock expressziója 2:00-kor érte el a maximumot. DL viszonyok között a kontrollhoz képest a nappali sötétség végén magasabb, míg a második éjszakai megvilágítás során alacsonyabb clock mrns szinteket mutattunk ki. 10

A clock mrns-expressziós mintázata fordított fény-sötét viszonyok között in vitro LD körülmények között tartott 6 hetes csirkékből izolált tobozmirigyek darabjait (n=18) perifúziós rendszerbe helyeztük (n=3 cellánként) és továbbra is LD viszonyok között. A kísérlet második napján 20:00-kor megfordítottuk a fény-sötét viszonyokat (DL). Kontrollként (LD) egy másik in vitro kísérletet is végeztünk, amely az eredeti LD ciklusokban futott. A cellákból a mintagyűjtést 4 órás időközönként, 18:00-14:00 között végeztük. A kontroll csoport (LD) esetében a clock mrns tartalom a sötét fázisban, 22:00-kor ért el csúcsértéket, nappal a génexpresszió alacsony volt. DL viszonyokra való átállást követően a ciklus első 12 órájában a clock mrns szintek egyenletesek maradtak, csúcsértéket nem észleltünk. Az akutan fáziseltolást szenvedett ciklus első 12 órájában a DL és az LD értékek között nem mutatkozott szignifikáns különbség, míg a DL mintákban 10:00-kor magasabb clock mrns szinteket mértünk. DISZKUSSZIÓ Az in vivo kontroll (LD) kísérletek adatai alapján a csirke tobozmirigyben a clock mrns expressziós mintázata cirkadián ritmust mutat, éjszakai expressziós csúcsértékkel. Ez a clock transzkripció sötétséghez köthető aktivációjára utal, amit alátámaszt, hogy az éjszakai aktiváció eltűnik az in vivo második fordított (DL) ciklusban, valamint az aktiváció megjelenik nappali sötétségkor Ezen megfigyelés ellentétes néhány korábbi adattal, ugyanakkor összhangban áll más eredményekkel. Ezek alapján a csirke tobozmirigy clock mrns expressziós mintázata hasonló az emlős SCN esetében leírt ritmushoz. Ezt a hasonlóságot már korábban a per, cry és bmal óragének esetében is megfigyelték. Egyes közlemények szerint a clock óragén transzkripciója nem mutat cirkadián oszcillációt a csirke tobozmirigyben, ami azzal magyarázható, hogy a clock mrns expresszió oszcillációjának az amplitúdója viszonylag alacsony más óragénekhez viszonyítva (vizsgálatunkban 1.5-szörös). 11

A clock mrns expressziójának vizsgálatával a cirkadián oszcillátor működésének változásai jól mérhetők. In vivo a fordított fényviszonyok már az első két órában szignifikáns eltérést okoztak, azaz in vivo az mrns-expresszió akutan megváltozik éjszakai megvilágítás hatására, ami megerősíti hipotézisünket, hogy a clock mrns expresszió vizsgálatával a cirkadián óra működésének akut változásai jól mérhetők. In vivo az éjszakai megvilágításnak kitett kísérletes csoport ( exponált ) esetében a clock mrns szint már 22:00-kor szignifikáns emelkedést mutatott, azaz a váratlanul érkező éjszakai fényexpozíciót követő második órában. A clock mrns expressziójában bekövetkezett rapid változás az első DL ciklusban azt jelzi, hogy a clock gén transzkripciós szabályozása akutan megváltozott a periódikus környezeti stimulus akut fáziseltolása miatt. Ezenkívül míg in vivo az első fordított (DL) ciklusban éjszakai fényexpozíció hatására növekszik a clock mrns expressziója, a másodikban ugyanilyen behatásra csökken, ami arra utalhat, hogy az első ciklusban váratlanul jelentkező fényexpozíció és a második ciklus kevésbé váratlan expozíciója eltérő transzkripciós szabályozást vált ki. Az mclock promoter konzervált szekvenciái a molekuláris óraszerkezet mind represszor (RRE: Rev/Erbα-ROR-binding Element), mind aktivátor komplexeinek a kötőhelyeit (E-box) tartalmazzák. További vizsgálatokra lesz szükség, hogy meghatározzuk, hogy ezen komplexek felelősek a clock transzkripció gyors fénydependens válaszáért a csirke tobozmirigyben in vivo vagy egy eddig ismeretlen mechanizmusra fog fény derülni. Az in vitro kísérlet során a kontroll csoport (LD) esetében a clock mrns expresszió a sötét fázisban ért el csúcsértéket (22 órakor). Eredményeink egybevágnak korábban leírt vizsgálatokkal, melyek szerint az in vitro körülmények között a clock mrns maximumértékének az időpontja megegyezik az in vivo észlelttel. DL viszonyokra való átállást követően a clock mrns szintek egyenletesek maradtak, az első DL ciklusban csúcsértéket nem észleltünk. Az akutan megfordított fény-sötét viszonyok között az első 12 órában a DL és az LD értékek között nem mutatkozott szignifikáns különbség. Ez az eredmény arra utal, hogy a Per2-vel ellentétben a clock expressziót nem indukálja közvetlenül a fényexpozíció, hasonlóan az emlős SCN-ben leírtakhoz. In vivo DL 12

viszonyok között mért clock mrns szintek esetében a kontrollcsoporthoz képest szignifikáns változást mutattunk ki, ezzel szemben in vitro DL körülmények között az mrns expresszió nem mutatott szignifikáns változást. Ebből az a következtetés vonható le, hogy a környezeti fényviszonyok akut változásaira adott rapid clock expresszió-változás neurohumorális szignálok szabályozása alatt állhat. In vitro DL körülmények között a fényviszonyok megváltoztatását követő napon 10 és 14 órakor a kontrollhoz képest magasabb clock mrns értékeket mértünk, ami azt jelzi, hogy a clock mrns expressziója neurohumorális szignálok hiányában is megváltozik, azonban az in vivo esetben észleltekhez képest később és más mintázattal. Ezek az adatok arra is utalnak, hogy az experimentális jet lag során a clock expressziója a csirke tobozmirigyben csak a retinából származó fényinformációhoz képes gyorsan alkalmazkodni. Kísérletünk megerősíti azt az elméletet, miszerint a clock és más óragének 24 órás mrns expressziós mintázata alapján a csirke tobozmirigy molekuláris oszcillátora nem az emlős tobozmirigyéhez, hanem az emlős SCN-éhez hasonló, így ezen a modellen nyert adatok az emberi óramű pontosabb megismerését is segíthetik. A cirkadián óramű intra- és intercelluláris mechanizmusainak további feltárása a jövőben lehetőséget nyújthat az oszcillátor molekuláris szintű befolyásolására, az óragén-expresszió megváltoztatására. Ez számos népbetegségben és pszichiátriai kórképben szenvedő beteg és kezelőorvosaik számára biztosíthatna új terápiás lehetőséget. 13

KÖZLEMÉNYEK A dolgozathoz kapcsolódó lektorált folyóiratcikkek: 1. S. Kommedal, G. Bódis, A. Matkovits, V. Csernus, A.D. Nagy: Expression pattern of clock under acute phase-delay of the light/dark cycle in the chicken pineal model. Gen. Comp. Endocrinol. 172: 170-172. 2011. [IF: 3.267] 2. S. Kommedal, V Csernus, AD Nagy.: The embryonic pineal gland of the chicken as a model for experimental jet lag - Gen Comp Endocrinol 188: 226-231. 2013. [IF: 2.823] Egyéb lektorált cikkek: 3. A. D. Nagy, S. Kommedal, K. Seomangal and V. Csernus: Circadian Expression of clock genes clock and cry1 in the embryonic chicken pineal gland. - Annals N.Y. Acad. Sci. 1163: 484-487. 2009. [IF: 2.303] 4. A. D. Nagy, K. Seomangal, S. Kommedal and V. Csernus: Expression of cry2 in the chicken pineal gland: effects of changes in the light/dark conditions. - Annals N.Y. Acad. Sci. 1163: 488-490. 2009. [IF: 2.303] 5. Lengyel Zs., Lovig Cs, Kommedal S, Keszthelyi R, Szekeres Gy, Battyáni Z, Csernus V, Nagy AD. Altered expression patterns of clock gene mrnas and clock proteins in human skin tumors. Tumour Biol. 2013 Apr;34(2):811-9. [IF: 2.568] Konferencia Absztraktok 1. Nagy A. D., Kommedal S., Csernus V.: Effects of PACAP exposure on the pineal clock gene expression in birds. - Clin Neurosci/Ideggy Szle 60 (S1). 47. 2007. 2. Nagy A.D., Kommedal S., Csernus V.: PACAP hatása az óragén-expresszió cirkadián ritmusára csirke tobozmirigyben. - Magyar Idegtudományi Társaság 12. Kongresszusa, Szeged, 2007. január 26-29. 3. Nagy A.D., Kommedal S., Seomangal K., Csernus V.: Az óragén expresszió cirkadián ritmusának kialakulása csirke tobozmirigyben. - XIV. Sejt- és Fejlődésbiológiai Napok, Balatonfüred, 2007. április 15-17. 14

4. Kommedal S., Seomangal K., Nagy A.D., Csernus V.: An insight into the development of the circadian clock in the chicken pineal model - Magyar Élettani Társaság Vándorgyűlése, Pécs, 2007. június 8-11. (poster) 5. Seomangal K., Kommedal S., Nagy A.D., Csernus V.: Expression of Cry2 in the chicken pineal gland: Effects of changes in the light/dark conditions. - Magyar Élettani Társaság Vándorgyűlése, Pécs, 2007. június 8-11. 6. Nagy A.D., Kommedal S., Seomangal K., Matkovits A., Csernus V.: Expression of clock genes in the embryonic chicken pineal gland. 11 th Biennial Meeting of the Society for Research on Biological Rhythms, Destin, Florida, USA. May 17-22. 2008. 7. Kommedal S., Seomangal K., Nagy A.D., Csernus V.: Expression of Cry2 in the chicken pineal gland: Effects of changes in the light/dark conditions. 24 th Conference of the European Comparative Endocrinologists, Genoa, Italy, Sept 1-6. 2008. (poster) 8. Nagy A.D., Kommedal S., Seomangal K., Matkovits A., Csernus V.: Expression of clock genes in the embryonic chicken pineal gland. 24 th Conference of the European Comparative Endocrinologists, Genoa, Italy, Sept 1-6. 2008. 9. Nagy A.D., Kommedal S., Butenschön V., Bódis G., Csernus V.: The pineal oscillators in chicken embryos need no LD cycles to start. XI th Conference of the European Biological Rhythms Society, Strasbourg, France, Aug 22-28. 2009. 10. Kommedal S., Bódis G., Matkovits A., Nagy A.D., Csernus V.: An insight into the development of the circadian clock in the chicken pineal model 25 th Conference of the European Comparative Endocrinologists, Pécs, Hungary, Aug 31-Sept 4. 2010. (oral) 11. Bódis G., Kommedal S., Matkovits A., Nagy A.D., Csernus V.: Clock mrna expression patterns in the chick pineal gland under experimental jet lag 25 th Conference of the European Comparative Endocrinologists, Pécs, Hungary, Aug 31-Sept 4. 2010. 12. Lengyel Zs., Kommedal S. (presenting author), Lovig Cs., Battyáni Z., Keszthelyi R., Szekeres Gy., Csernus V., Nagy A.D.: Expression of circadian clock genes per1, per2, clock, and cry1 in human melanoma skin biopsies. 13 th Biennial Meeting of the Society for Research on Biological Rhythms, Destin, Florida, USA. May 19-24. 2012. (poster) 13. Lengyel Zs., Kommedal S., Lovig Cs., Battyáni Z., Keszthelyi R., Szekeres Gy., Csernus V., Nagy A.D.: Expression of circadian clock genes per1, per2, clock, and cry1 in human melanoma skin biopsies. 26 th Conference of the European Comparative Endocrinologists, Zürich, Switzerland, Aug 21-25. 2012. 14. Kommedal S., Lengyel Zs., Mattkovitcs A, Csernus V., Nagy A.D.: The Embryonic Chicken Pineal Gland as a Model for Experimental Jet Lag. 26 th Conference of the European Comparative Endocrinologists, Zürich, Switzerland, Aug 21-25. 2012. (Oral) 15. Kommedal S., Csernus V., Nagy A.D.: The embryonic pineal gland of the chicken as a model for experimental jet lag. 13 th Conference of the European Biological Rhythms Society, Munich, Germany, Aug 18-23. 2013. (poster) 15

PH.D. THESIS (SUMMARY) Investigation of the embryonic chicken pineal gland as a model for experimental jet lag Siri Kommedal M.D. University of Pécs, Faculty of Medicine Department of Anatomy Supervisor: Csernus Valér M.D., Ph.D., DSc Theoretical Medical Sciences Doctoral School Head of Doctoral School: Lénárd László M.D., Ph.D., DSc Neuroendocrinology and Neurohistology Doctoral Program Program leader: Dr. Csernus Valér M.D., Ph.D., DSc University of Pécs 2013.

1

INTRODUCTION: Biological Rhythms: Most biological rhythms are periodically recurring, with a typical period length, and are rhythmic in nature. They can be classified according to their duration/length: - Ultradian rhythms last less than a day; examples being breathing and heart rate regulation - Infradian rhythms last for longer than a day, such as the menstural cycle - Circadian (circa = approximately, diem =day) rhythms last roughly 24 hours and include rhythms such as sleep/wake cycle, and regulation of hormone levels such as cortisol Circadian Rhythms: Circadian rhythms are amongst others regulated by the light dark cycle (LD). To be classified as circadian a rhythm: - Must last roughly 24 hours - Be endogenous, meaning it persists even under constant conditions such as constant darkness (DD) - Have a phase which can be shifted by rhythmic environmental stimuli called Zeitgebers (ZT) (time-givers) such as light. Circadian clock: Circadian rhythms are driven by so called biological clocks which contain all the components of the pacemaker oscillator, allowing them to control the circadian time with amazing accuracy. The oscillating system relies on a combination of positive and negative feed-back loops which are composed of (fig 1): Clock/bmal1 Per/cry REV-ERBα E-box, RORE SIRT1 PPAR-α, PPARϒ Melatonin via AANAT Metabollic Output Gene Expression Zeitgeber NAD NADH fig 1. Schematic outline of the molecular oscillator in mammals. Clock/bmal1 activates the cry and per promoters. Next there is transcription/translation of per and cry, before they enter the nucleus and in turn inhibit the clock/bmal1 activity. The key output is an E-box mediated transcriptional activation of hundreds of target genes on a daily basis such as AANAT. - - - Activation complex: consists of genes that act as positive regulators and activate the expression of other genes. In the circadian clock of mammals this most 2

frequently consist of Clock/Bmal heterodimer which binds an E-box promoter in the nucleus and thereby induces transcription. - Inhibitory complex: consists of genes that act as negative regulators by counteracting the function of the activation complex. In mammals this is most commonly a per/cry heterodimer which can interact with clock/bmal and inhibit their activity. A fundamental part of circadian rhythms is that they follow changes in environmental periodic stimuli by a shift in the phase of the rhythm. Thus a change in the light dark schedule will trigger a change in the circadian rhythmic expression of clock genes and clock controlled genes. The time at which light is applied is important with regards to which change is seen. Light in the early night causes phase delay of the rhythm, and light at late night causes a phase advance of the rhythm. The phase advance and phase delay of circadian rhythms in response to changes in the light schedule are a popular area of study. Incongruence between the internal clock time and the rhythmic environmental stimuli is called chronodisruption and this can lead to a variety of symptoms such as those associated with jet-lag. People that are constantly exposed to chronodisruption, e.g. shift workers, have an increased risk of a variety of disorders such as metabolic disease and certain cancers. Circadian rhythms play an integral part in physiology and disease. Amongst others circadian clocks are involved in maintaining normal homeostasis and they have been shown to be involved in regulation of the cell cycle. Diseases such as cardiovascular emergency cases, asthma attacks and rise in blood glucose in diabetic patients all show predominance in the early morning hours when there is a rise in hormonal levels, which is regulated by the circadian system. Chronotherapy focuses on administering drugs to patients at appropriate time of neuro-humoral conditions to minimize the dose and side-effects of the drugs. Models of the circadian clock: Classical laboratory models to study the inner clock mechanisms and its rhythms include (fig. 2): the study of growth dynamics of fungi, the metabolism of unicellular eukaryotic organisms, the growth and flowering of plants, timing of metamorphosis of insects and the locomotor and endocrine functions of vertebrates. Common features in all of these models are that there is a roughly 24 hour rhythm found also under DD, and that the rhythms are regulated by positive and negative feedback loops. Differences include the exact period length of the rhythm, diurnal or nocturnal zenith, factors which entrain the rhythm, clock genes and the localization and interaction of the components of the clock mechanisms. In mammals the master pacemaker is found within the suprachiasmatic nucleus (SCN) in the hypothalamus. Information about the light dark schedule arrives here via the retinohypothalamic tract from the retina. The SCN can entrain to light dark conditions, and SCN neurons contain oscillators that stay synchronized to each other even without a Zeitgeber. The SCN in turn sends information to a variety of nuclei in the hypothalamus which regulate a variety of physiological process such as hormonal release and locomotion. Fibers from the SCN also go the pineal gland where they secrete norepinephrine in a rhythmic manner which in turn leads to a rhythmic release of melatonin. In most birds the master pacemaker is the pineal gland itself. The pineal gland of birds has several advantages to the mammalian system when it comes to circadian research which makes it a favored model for many. These advantages include: 1) It is directly light sensitive. 2) It oscillates in vitro under DD conditions for more than five cycles 3) It provides an in vitro model which can be completely isolated from the surrounding neuroendocrine and paracrine environment. 3

4) Embryonic chicken are isolated in eggs and are thus not affected by maternal hormonal rhythms during ontogenesis. Melatonin: Melatonin is the so called darkness hormone in vertebrates as it peaks during the night phase both within the pineal gland and the plasma in diurnal and nocturnal species. It is the key messenger hormone of the circadian system. It functions to spread the photoperiodic signal giving the organism information about the day/night cycle as well as reflecting the seasonal changes in daily length. Rhythmic changes in the serum level of melatonin are known to play a key role in the sleep wake cycle. Melatonin has also been shown to be a part of the entrainment of the circadian system to phase advance and phase delay. The avian pineal gland can generate rhythmic expression of melatonin both under in vivo and in vitro conditions. In birds the expression of melatonin can be detected from the second week of embryonic development. In birds the production of melatonin corresponds directly to changes in mrna expression of AANAT (arylalkylamine-n-acetyltranseferase), therefore measuring AANAT levels is sufficient to study the rhythmic production of melatonin in this species. Development of the embryonic clock in chicken: The study of the circadian clock under development has been done in a variety of species. Previous experiments have shown the presences of clock genes whose rhythm is responsive to changes in light already from the 1st day in the developing Senegalese sole. In rats HIOMT, AANAT and melatonin have been shown to be rhythmic already from an early stage of development and the rhythm of these are also light responsive. In zebra fish studies have 4

shown that already 22 h after fertilization the master pacemaker, the pineal gland, is developed, and already 2 days after fertilization melatonin is rhythmic in expression as long as the fish are exposed to light and dark. Earlier we have shown that the embryonic chicken pineal gland has a working clock mechanism which is synchronized to environmental stimuli by embryonic day (ED) 17. However as of yet the effect of phase advance on the expression of clock and clock controlled genes within the embryonic chicken pineal glands have not been studied. Aims: - Determine if the transcriptional regulation of the circadian clock gene clock shows any response to acute changes in the environmental light-dark conditions both in vivo and in vitro - To prove that the embryonic chicken pineal gland is a suitable model for studying circadian rhythm-related disorders at the molecular level by investigating the expression of genes involved in melatonin synthesis such as AANAT and HIOMT (hydroxyindole-o-methyltransferase) and circadian clock gene clock under DD, LD and LD+4 MATERIALS AND METHODS: 1) Animals: a. Experiments with adult chicken Newly hatched white leghorn chickens were kept under 14/10 hour light dark schedule for 6 weeks. For the in vivo experiments chickens were placed in a DL 10/14 schedule at 20:00. The chickens were sacrificed by decapitation every four hours and the pineal glands were collected from 18:00. For the in vitro experiments adult chicken were decapitated at 12:00 and the pineal glands were placed in a multichannel perifusion system. The light schedule was changed from LD to DL at 20:00 on the second day in vitro. Pineal glands were removed from the perifusion chambers every four hours starting from 18:00. b. Experiments with embryonic chicken Fertilized eggs of white leghorn chickens were incubated from embryonic day 1 at constant temperature (37.5C) and humidity (70%) with mechanical rocking. Control eggs were kept under LD conditions. Experimental eggs were subjected to DD or LD+4 conditions from ED19, prior to this they had been housed under normal LD conditions. The embryos were sacrificed by decapitation every four hours between ED19-21. 2) Semi quantitative RT-PCR: Total RNA was extracted from pineal glands of post-hatch chicken with Sigma s TRI Reagent following the manufacturer s protocol (T9424, Sigma Aldrich, and St. Louis, Missouri, USA). Absorbance was measured at 260nm with Ultrospec 2100 instrument. Total RNA extracts (200 ng) of each pineal specimen were analyzed with primers for clock mrna (forward: TCCCAGTCTCTTGGACAACC, reverse: GCTGTTGCTGGATCATGTGT) and b-actin mrna (forward: GATGGACTCTGGTGATGGTG, reverse: AGGGCTGTGATCTCCTTCTG) as an internal standard. The one-step semi-quantitative RT-PCR was run with 5 U MMLV Reverse Transcriptase (Life Technologies, Carlsbad, California, USA) and 0.2 U RedTaq DNA polymerase (Sigma); this protocol was optimized and standardized previously (Nagy A.D., 2007). The conditions were as follows: RT 42 o C 15 min, 94 5

o C 5 min; and PCR 26 cycles of 94 o C 30 min, 60 o C 30min, and 72 o C 1min. End products were separated on agarose gels stained with SYBR Green I. Gels were transilluminated with blue light. The fluorescence of PCR products was measured as the mean pixel intensities of the DNA bands on gel pictures (ImageJ software, National Institutes of Health, USA). 3) Real-time quantitative RT-PCR: Total RNA of embryonic chicken pineal glands was extracted as mentioned above. cdna was generated by reverse transcription using 500 ng of total RNA in a total of 50 µl reaction volumes following the instructions of the manufacturer (Applied Biosystems, SuperScript RT enzyme, 4374966). Real-time PCR was run using 3 µl cdna solution per 15 µl reaction volume with Applied Biosystems_ TaqMan gene expression assays for AANAT, HIOMT and clock and also for internal reference gene β-actin. Composition of reaction mixture was made based on the instructions of the manufacturer (Applied Biosystems, 4370048). StepOne Real-Time PCR instrument (Applied Biosystems) was used with default cycling parameters (50 o C 2 min, 95 o C 10 min, 40 cycles of 95 o C 15 sec and 60 o C 1 min). For quantitation calculations the delta-delta Ct method was used, after control measurements for reaction efficiency normalizations. 4) Data Analysis: Group differences were evaluated using two-way ANOVA followed by Tukey s post hoc test. P < 0.05 was considered as statistically significant difference. RESULTS: 1. In vivo effect of DD compared to normal LD on the expression of AANAT in the embryonic chicken pineal gland: On ED 19 the eggs were placed under DD. Glands were collected starting from zeitgeber time (ZT) 12, 12 h prior to the switch in the lighting conditions, every four hours until ED 21. The control group was kept under LD conditions. AANAT showed a robust daily rhythm, even under DD conditions (fig. 3A). Lack of light at ZT 4:00 does not cause a significant change in the expression of AANAT. In fact there is no significant difference in the expression of AANAT between the LD and DD groups throughout the duration of the experiment. 2. In vivo effect of DD compared to normal LD on the expression of HIOMT in the embryonic chicken pineal gland Eggs of ED19 chicken were placed under DD. Pineal glands were collected every four hours until ED21. For the LD group HIOMT has a high amplitude rhythm with a peak during the light phase at ZT4 (fig. 3B). Under DD conditions at ZT4 the absence of light causes a shift in the expression of HIOMT compared to that seen under LD (fig. 1B). Then in the second cycle of DD there is a lower expression of HIOMT at ZT4, compared that seen under LD conditions. 6

fig. 3. In vivo effect of DD compared to LD on the expression of Aanat, Hiomt and clock. in the embryonic chicken pineal gland. Pineal glands were collected every four hours starting from ED 19 at ZT12. Graphs represent the relative mrna level of the pineal glands at each time point (mean of n = 3, ±SEM) collected from chicken exposed to DD ( ) and the control group LD (- -) 7

3. In vivo effect of DD compared to normal LD on the expression of clock in the embryonic chicken pineal gland The eggs were placed under DD at ED 19, and the pineal glands were collected every four hours until ED21. In the control group, which was kept under normal LD conditions, clock mrna shows a peak during the light phase (fig. 3C). In the DD group at ZT 4, four hours after a change in the light schedule, there was no significant difference in the level of clock mrna compared to the LD group. Then at ZT8 there is an increase in the expression of clock mrna compared to that seen under LD conditions. In the second cycle of DD the expression of clock mrna is suppressed (fig. 1C). 4. In vivo effect of four hour phase delay on the expression of AANAT in the embryonic chicken pineal gland compared to normal LD conditions On ED19 the light schedule was changed in such a way that lights were left on for 4 h longer (LD + 4) than in the control LD group, effectively causing a four hour phase delay. Pineal glands were collected every four hours starting from ZT12 which is prior to the phase delay. Samples were collected over a 48 h period. In the LD group AANAT shows a clear robust 24 h rhythm (fig. 4A). In the LD + 4 group during the first four hours of phase delay, at ZT16, there was no acute change in the expression of AANAT when compared to the LD group. However, looking at the second cycle of LD + 4 conditions a clear phase delay of the expression of AANAT is observed. 5. In vivo effect of four hour phase delay on the expression of HIOMT in the embryonic chicken pineal gland compared to normal LD conditions ED19 eggs were subjected to a four phase delay (LD + 4). Pineal glands were collected every four hours, with the first time point being at ZT12, prior to the change in the light schedule. In the LD group HIOMT shows a high amplitude rhythm with a peak during the light phase (fig. 4B). In the LD + 4 group there is no acute change seen in HIOMT expression within the first four hours of prolonged light exposure (ZT16) when compared to the LD group. At ZT8 the peak for HIOMT expression shows phase delay in the LD + 4 group compared with the LD group (fig. 4B). 6. In vivo effect of four hour phase delay on the expression of clock in the embryonic chicken pineal gland compared to normal LD conditions On ED19 eggs were subjected to a 4 h phase delay (LD + 4) of the light schedule. Pineal glands were collected every four hours from ED19-ED21, and the first collection occurred prior to the phase delay. Under LD conditions clock shows a clear 24 h pattern with a peak during the light phase (fig. 4C). Within the first four hours of phase delay at ZT16, clock mrna expression shows acute change with a clear peak in its expression. Furthermore the phase delay of the clock mrna expression is maintained until the end of the experiment, seen clearly by a shift of the rhythm compared to that of the LD control group (fig. 4C). 8

fig. 4. In vivo effect of 4 h phase delay (LD + 4) on the expression of Aanat, Hiomt and clock in the embryonic chicken pineal gland compared to LD. Pineal glands were collected every four hours starting from ED 19 at ZT12, prior to the change in light schedule. Graphs represent the relative mrna level of the pineal glands at each time point (mean of n = 3, ±SEM) collected from chicken exposed to LD + 4 ( ) and the control group LD (- -). 9

7) In vivo effects of acute inversion of the light/dark schedule on the 24 hour pattern of clock expression in the chicken pineal gland in post-hatch chicken: The pineal glands were collected over a 30 hour period every four hours. The first sample was taken 2 hours prior to the shift in the light/dark schedule at 20:00. In the LD group clock mrna levels increased during the dark phase with a peak at 2:00 which corresponds to ZT 20 (ZT 20 indicates the time 20 hours after the lights have been switched on). The DL group showed a significant increase in the clock mrna levels already at 22:00, merely two hours after the unexpected light exposure at night, which is assumed to be a response to the acute phase delay of the normal LD cycle (fig.5). However during the second DL cycle the levels of clock mrna is significantly decreased at 2:00 during the new light phase compared to the control group (fig 5). fig.5) In vivo effects of a phase-delayed light/dark schedule on the 24 h pattern of clock mrna expression in the chicken pineal gland. Graphs represent relative clock mrna levels of pineal glands at each time point (mean of n = 3, ±SEM) collected from chickens exposed to a reversed LD cycle (DL) from 20:00 ( ) or kept under LD conditions (- - -) as a control group. Horizontal bars show the light/dark conditions for each group (black indicates darkness). Significant differences (p < 0.05) between groups are indicated with *. 8.) In vitro effects of acute inversion of the light/dark schedule on the 24 hour pattern of clock expression in the chicken pineal gland in post hatch chicken: Pineal glands were collected over a 20 hour period every four hours. The first sample was taken 2 hours prior to switching the LD conditions to DL at 20:00. In the LD group the peak of clock mrna was seen at subjective night at 22:00/ZT6 (fig. 6). In the DL group the levels of clock mrna remained stable during the first cycle, without any significant peaks., There was no significant change in the clock mrna levels between the LD and the DL groups within the first 12 hours of the new DL schedule (fig. 6). 10

fig. 6) In vitro effects of a phase-delayed light/dark schedule on the 24 h pattern of clock mrna expression in the chicken pineal gland. Graphs represent the relative clock mrna levels of pineal specimens (mean of n= 3, ±SEM) that have been subject to a reversed LD cycle (DL) from 20:00 (-) or kept under normal LD conditions (- -) as a control group. The keys are similar to those in fig. 5. Pineal samples were collected in vitro with four hour intervals, with the first sample being taken 2 hours prior to a switch from LD to DL. Significant differences (p < 0.05) between groups are indicated with *.ROR α DISCUSSION: In post-hatch chickens kept under normal LD cycles, the in vivo (control group) clock shows a peak in expression during night time (fig.5). Our data supports the idea, that under normal entrained conditions, the transcriptional activity of clock in the chicken pineal gland shows daily oscillations, with a maximum during the dark phase under in vivo conditions. The oscillation in clock mrna expression is known to have a small amplitude (it was around 1.5 fold in this study), which may explain why others have suggested earlier that clock is constitutively expressed within the chicken pineal gland. When the chickens were exposed to a reversed light cycle (DL), clock mrna expression showed an acute change within the second hour of unexpected light exposure in vivo (fig. 5). This indicates that there is a rapid change in the transcriptional control of clock in response to the acute phase-delay of the periodic environmental stimuli. Further studies should be carried out to determine the underlying mechanism of this sudden change to determine, which complexes are involved in the light dependent response of clock transcription in vivo in the chicken pineal model. When the chicken pineal glands were exposed to prolonged DL conditions, clock mrna levels decreased during the light phase (fig. 5). The difference between the mrna expression of clock during the first cycle of DL and the second cycle of DL conditions may indicate that unexpected light exposure and expected light exposure trigger different transcriptional mechanisms in the chicken pineal gland; similar mechanisms have earlier been described for cry1. In vitro under normal LD conditions clock mrna levels peak during dark phase (fig. 6). After placing the pineal glands under DL condition in vitro, the expression of clock mrna 11

showed no significant peak in the first cycle, and likewise in the second cycle, there was no significant difference, when compared to the control LD group. This suggests that clock is not directly light inducible. A clear difference is seen in the expression of clock mrna under DL in vivo (fig. 5), where there was a clear difference between the control and experimental group, and in vitro (fig. 6), where there was no similar difference between the DL and LD group. This may indicate that there are also neuroendocrine signals involved in the regulation of clock in response to acute changes in the environmental lighting conditions. In our experiments done on embryonic chicken pineal glands, AANAT, a key enzyme involved in the synthesis of melatonin, shows a robust rhythm with a peak during the dark phase (fig. 3A). The change of the light schedule from LD to DD did not cause a significant change in the expression of AANAT (fig. 3A), as expected. There was a lack of both acute changes to sudden darkness and a lack of a delayed response seen in the second cycle of DD. This supports the idea that AANAT in the embryonic chicken pineal model is regulated primarily by the pineal clock itself as opposed to being a light sensitive gene. Exposing the embryonic chicken to a phase-delay of 4 hours (LD+4), essentially prolonging lights on by four additional hours, did not cause an acute change in the expression of AANAT (fig.4a). The second cycle of LD+4 caused a phase delay of the expression of AANAT; the whole rhythm of AANAT mrna expression was shifted compared to that of the control LD group (fig.4a). This again suggests that AANAT is not directly light sensitive, as it did not respond acutely to prolonged light exposure, but that in fact it is regulated by the circadian clock itself. HIOMT is the other key enzyme of melatonin production. In our experiments on embryonic chicken pineal gland under normal LD conditions, the expression of HIOMT mrna shows a high amplitude rhythm with a peak during the light phase (fig. 3B). Once the chicken were placed under DD the expression of HIOMT mrna was shifted compared to that seen in the control group (fig. 3B). During the second cycle of DD there is a significant difference seen in the expression of HIOMT when compared with the LD group. There is a reduction of the rhythm amplitude of HIOMT under DD, but it still shows a peak during the light phase and a general 24 hour pattern. The exposure of the embryonic chicken to a 4-hour phase-delay did not cause any acute changes in the expression of HIOMT mrna (fig. 4B). However, during the second cycle of LD+4, there is a clear phase delay of the expression of HIOMT, indicating that also this gene is regulated by the circadian clock. Rhythmic expression of both AANAT and HIOMT under LD, DD and LD+4 in this experimental protocol proves that the chicken embryonic clock at ED19-21 has a functioning clock mechanism, and that it is a good model for phase shifting experiments as well as experiments on the ontogenesis of the circadian clock in the chicken pineal gland. Clock is a clock gene acting as a positive regulator together with Bmal1 and Npas2. Amongst its functions, it acts together with Bmal1 as a heterodimer to regulate the expression of AANAT. Knockdown of clock has been shown to cause a decrease of AANAT activity, as well as Npas2 and Per2 demonstrating that this is an essential component of the circadian clock. Placing the embryonic chicken under DD did not cause any acute changes in the expression of clock mrna during the first four hours (fig. 3C), when compared to the LD group. However 8 hours later, there is a peak in the expression of clock, which indicates some role for clock in light-dependent synchronization in vivo. In the second cycle of DD, the expression of clock was reduced, but it still maintained a rhythmic pattern. This correlates well with the results seen for AANAT, which did not show a change in its rhythm under DD compared to LD. 12