Proper gibberellin localization in vascular tissue is required to regulate adventitious root development in tobacco
|
|
- Hanna Mezei
- 6 évvel ezelőtt
- Látták:
Átírás
1 Journal of Experimental Botany, Vol. 64, No. 11, pp , 2013 doi: /jxb/ert186 This paper is available online free of all access charges (see for further details) Research paper Proper gibberellin localization in vascular tissue is required to regulate adventitious root development in tobacco Shihui Niu 1, Zhexin Li 1, Huwei Yuan 1, Pan Fang 1, Xiaoyang Chen 2, * and Wei Li 1, * 1 National Engineering Laboratory for Forest Tree Breeding, Key Laboratory for Genetics and Breeding of Forest Trees and Ornamental Plants of Ministry of Education, College of Biological Science and Technology, Beijing Forestry University, Beijing , PR China 2 Laboratory of Bio-technology of Tropical and Subtropical Forestry, College of Forestry, South China Agriculture University, Guangzhou, , PR China * To whom correspondence should be addressed. xychen@scau.edu.cn or bjfuliwei@bjfu.edu.cn Received 6 November 2012; Revised 27 April 2013; Accepted 22 May 2013 Abstract Bioactive gibberellins (GAs) are involved in many developmental aspects of the life cycle of plants, acting either directly or through interaction with other hormones. Accumulating evidence suggests that GAs have an important effect on root growth; however, there is currently little information on the specific regulatory mechanism of GAs during adventitious root development. A study was conducted on tobacco (Nicotiana tabacum) plants for altered rates of biosynthesis, catabolism, and GA signalling constitutively or in specific tissues using a transgenic approach. In the present study, PtGA20ox, PtGA2ox1, and PtGAI were overexpressed under the control of the 35S promoter, vascular cambium-specific promoter (LMX5), or root meristem-specific promoter (TobRB7), respectively. Evidence is provided that the precise localization of bioactive GA in the stem but not in the roots is required to regulate adventitious root development in tobacco. High levels of GA negatively regulate the early initiation step of root formation through interactions with auxin, while a proper and mobile GA signal is required for the emergence and subsequent long-term elongation of established primordia. The results demonstrated that GAs have an inhibitory effect on adventitious root formation but a stimulatory effect on root elongation. Key words: Adventitious root formation, auxin gibberellin interaction, gibberellin, Nicotiana tabacum, root elongation, vascular tissue. Introduction Gibberellins (GAs) are tetracyclic diterpenoid phytohormones that control a wide range of growth and developmental processes throughout the plant life cycle, acting either directly or through interactions with other hormones. Recently, impressive advances through molecular studies have elucidated the vital role of GAs in coordinating seed development and germination, seedling growth, stem elongation, leaf development and bud outgrowth, flower induction, and xylem expansion (Stavang et al., 2005; Gabriele et al., 2010; Ikezaki et al., 2010; Mauriat et al., 2011; Nadeau et al., 2011; Zhao et al., 2011). However, understanding the role of GAs in root formation and growth (Osmont et al., 2007) has progressed at a slower rate. This is probably due to the fact that GAs, compared with auxin, often exhibit an indeterminate or have an indistinguishable effect on root development. The effects of exogenous GA and inhibitors related to this hormone on root development vary depending on the plant species and the experiment. However, recent advances in molecular biology and plant physiology open up new horizons for regulation of root growth by GAs in plants. Several lines of evidence support the hypothesis that active GAs are critical for root development. Abbreviations: GA, gibberellic acid, gibberellin; GAI, 35S::PtGAI; 35:G20, 35S::PtGA20ox; 35:G2, 35S::PtGA2ox1; L:G20, LMX5::PtGA20ox; L:G2, LMX5::PtGA2ox1; NAA, α-naphthyl acetic acid; T:G20, TobRB7::PtGA20ox; T:G2, TobRB7::PtGA2ox1. The Author [2013]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( by-nc/3.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial reuse, please contact journals.permissions@oup.com
2 3412 Niu et al. GAs have been demonstrated to have a positive effect on primary root growth. A variety of GA-deficient mutant plants have been crucial for establishing the role of GAs in primary root development. Study of GA-deficient mutations in Arabidopsis shows that mutants have reduced levels of active GAs in roots compared with wild-type (WT) plants and this is associated with impaired root elongation (Fu and Harberd, 2003; Griffiths et al., 2006; Ueguchi- Tanaka et al., 2007; Willige et al., 2007). The flux of bioactive GAs is regulated by three dioxygenase enzymes, namely GA20-, GA3-, and GA2-oxidases. GA20-oxidases and GA3-oxidases catalyse the final steps in the synthesis of bioactive GAs, whereas GA2-oxidase is the major GA deactivation enzyme (Yamaguchi, 2008). Ectopic expression of the SoGA2ox3, OsGA2ox5, and OsGA2ox6 genes markedly inhibits root elongation in transgenic tobacco. Differences in root growth between WT and transgenic seedlings were most pronounced under continuous light (Lee and Zeevaart, 2005; Lo et al., 2008). Similarly, root morphology of transgenic Arabidopsis seedlings overexpressing CmGA7ox and CmGA3ox1 changed dramatically. CmGA7ox overexpressors develop much longer primary roots compared with WT plants. However, CmGA3ox1 transgenic lines develop more lateral roots that are thicker compared with WT plants (Radi et al., 2006). Recently, molecular studies have advanced our understanding of the regulatory mechanism and clearly suggest that GAs are involved in the control of root cell elongation (Ubeda- Tomas et al., 2008) and cell proliferation (Achard et al., 2009; Ubeda-Tomas et al., 2009). GA biosynthetic mutants are unable to increase their cell production rate and meristem size after germination, indicating that GA signalling controls cell division activity in the root meristem, thereby contributing to the regulation of root meristem growth (Ubeda-Tomas et al., 2009). Nevertheless, reports from various plant species suggest that in comparison with the primary root, GAs have an inhibitory effect on the regulation of lateral roots and adventitious root development. Several studies have examined GA responses in root formation using transgenic and physiological experiments, and provide insight into its regulatory mechanisms. It was shown that accelerated lateral root or adventitious root formation are common behaviours in GA-deficient mutants (Eriksson et al., 2000; Gou et al., 2010, 2011; El-Sharkawy et al., 2012). Overexpression of GA2ox led to increased lateral root proliferation and transcriptome changes consistent with increased growth and lateral root initiation in the transgenic roots, and RNA interference (RNAi) suppression of these genes led to a decrease in root biomass (Gou et al., 2010, 2011). Correspondingly, a deficiency of GAs in rice increased adventitious root formation, while exogenous application of GA 3 suppressed it (Lo et al., 2008). In contrast, overexpression of AtGA20ox1 and exogenous GA applications in aspen led to an increased concentration of bioactive GAs and suppression of lateral and adventitious root formation (Eriksson et al., 2000). A similar effect was also described in citrus plants overexpressing CcGA20ox1 (Fagoaga et al., 2007). Similarly, several studies suggest that inhibitors of GA biosynthesis can stimulate lateral roots (Berova and Zlatev, 2000; Chaney, 2003; Gilman, 2004). Considerable progress was made recently in elucidation of the molecular basis of GA action. DELLA proteins (DELLAs), major negative regulators of GA signalling, play a central role in GA response and appear to be a point of cross-talk with other signals (Achard et al., 2006; Nemhauser et al., 2006; Harberd et al., 2009). GA response in the endodermis and the effects of GA-regulated DELLAs on root growth have been well characterized recently (Ubeda-Tomas et al., 2012). Blockage of GA signalling via heterologous expression of DELLA-less versions of GAI and RGL1 in Populus elicited an increase in root biomass (Busov et al., 2006; Han et al., 2011). Previously, it was shown that GAs appear to affect cell expansion in the root elongation zone via destabilizing the DELLA-like repressor of GA 1. DELLAs restrain growth of organs, such as leaves and primary roots, by first decreasing the rate of division of proliferating cells, then by altering the rate of elongation of differentiated cells (Achard et al., 2009). Targeting the expression of gai (a non- GA-degradable mutant form of GAI) in the root meristem disrupts cell proliferation. Moreover, expressing gai in dividing endodermal cells was sufficient to block root meristem enlargement (Ubeda-Tomas et al., 2009). Subsequent studies revealed that the GA-mediated removal of DELLA repressor proteins only in the endodermis promotes anisotropic growth in the surrounding root tissues (Ubeda-Tomas et al., 2008). A number of physiological observations suggest cross-talk between GA signalling and auxin transport. It has long been known that indole acetic acid (IAA) can stimulate the expression of GA biosynthetic genes in various plants (Wolbang et al., 2001, 2004; Frigerio et al., 2006) and GAs also apparently mediate increased rates of polar IAA transport (Bjorklund et al., 2007). Auxin signalling was shown to induce the degradation of the negative GA signalling element RGA, thereby promoting GA signalling and root growth (Fu and Harberd, 2003). In GA-deficient and GA-insensitive transgenic Populus, modification of a differentially expressed gene encoding two efflux and one influx carrier involved in auxin transport suggests that modulation of lateral root development by GAs is at least partly imparted by polar auxin transport modification (Gou et al., 2010). Recent work implicated GAs and DELLAs in the control of auxin transport and the coordination between cell division and cell differentiation during this stage of root growth and differentiation (Moubayidin et al., 2010). To improve understanding of the role of GAs in root development, pharmacological and genetic approaches were used to investigate the effects of modification of the levels of bioactive GAs in specific tissues during root development in model tobacco (Nicotiana tabacum) plants. In this study, PtGA20ox and PtGA2ox1 were expressed under the control of two well-studied promoters, namely LMX5 and TobRB7, respectively, leading to expression on the xylem side of the cambial zone in the stem (Bjorklund et al., 2007) and the meristem and central cylinder regions in the root (Yamamoto et al., 1991). The results show that the precise tissue localization of GAs regulates adventitious root initiation and elongation in tobacco. These findings provide a more comprehensive
3 Gibberellin regulate adventitious root development in tobacco 3413 insight into understanding the role of GAs in root growth and development. Materials and methods Plant material and chemical treatments The previously characterized PtGA2ox1, PtGA20ox, and PtGAI genes (Busov et al., 2003; Israelsson et al., 2005; Han et al., 2011) were isolated from 1316 clones of Chinese white poplar (Populus tomentosa Carr.). Genetic studies were carried out using clone W38 from tobacco (N. tabacum cultivar Wisconsin 38). All plants were grown in hormone-free half-strength MS medium (Murashige and Skoog, 1962) containing 0.7% carrageenan and 2% sucrose, and maintained at 25 C under a 16:8 h photoperiod. For GA, paclobutrazol (PAC), and IAA treatments, preliminary experiments for the WT were carried out to determine suitable concentrations. The WT and transgenic tobacco plants were transferred to media containing 10 μm PAC, 10 μm GA 3, and 1 μm IAA, respectively, for 2 3 weeks. RNA extraction and cdna synthesis Plant material was ground to a fine powder with a mortar and pestle in liquid N 2. Approximately 100 mg of ground tissue were used for RNA extraction, using an SV Total RNA Isolation Kit (Promega, USA). A 2 μg aliquot of total RNA was used to synthesize single-stranded cdna using the M-MLV reverse transcriptase kit (Promega). cdna samples were diluted to a total volume of 100 μl. Plasmid constructs The open reading frames of PtGA2ox1, PtGA20ox, and PtGAI were amplified from the cdna of P. tomentosa vegetative tissue using Pyrobest DNA polymerase and the primers described in Supplementary Table S1 available at JXB online. The products were cloned into pyl322-d1-tobrb7, pyl322-d1-camv35s, or pyl322-d1-lmx5 and then recombined into pyltac380h, which contained the HPTII gene as a selectable marker with the Cre/ loxp system. The constructs were transformed into Agrobacterium strain LBA4404 via the freeze/thaw method (Holsters et al., 1978). Plant transformation Nicotiana tabacum plants were transformed with the seven constructs following a previously described protocol (Dayan et al., 2010). The leaves were transferred to fresh solidified MS medium containing 2 mg l 1 6-benzyladenine (6-BA), 0.1 mg l 1 α-naphthyl acetic acid (NAA), 300 mg l 1 cefotaxime, and 25 mg l 1 hygromycin B every 2 weeks until shoot regeneration. Regenerated shoots that rooted in the presence of 20 mg l 1 hygromycin B were potted. The presence and expression of the inserted genes were confirmed by PCR and reverse transcription PCR (RT PCR), respectively. At least three lines with the highest expression of the respective transgene were selected by qpcr with the primers described in Supplementary Table S1 at JXB online. Once again, shoots were regenerated from leaves of these screened plants to produce homozygous and aseptic transgenic plants. Regenerated plants were then transferred to antibiotic-free half-strength MS medium. Three independent lines and at least 10 ramets per line were used for the analysis in all experiments. Biometric measurements To measure root development, 4 cm cuttings were grown in vitro. Roots from 2- or 3-week-old treated plants were harvested. The number of adventitious roots was counted and the primary root length was measured. Each experiment was repeated three times and performed with at least three events and 10 ramets per event. Twotailed t-tests were performed with Microsoft Excel software. Culture of petiole sections in vitro Petioles of mature leaves were harvested and incubated on plates of MS medium containing 1 mg l 1 IAA at 25 C under a 16:8 h photoperiod. For application of GA, leaf sections were incubated on MS medium with 1 mg l 1 IAA and 1 mg l 1 GA 3. Phytohormone analysis A 3 g aliquot of roots and expanding leaves was harvested from 1-month-old transgenic plants, each line represented by three independent plants. The samples were immediately weighed (fresh), frozen, powdered in liquid nitrogen, and later analysed with a liquid chromatography mass spectrometry (LC-MS) system in the biotechnology laboratory of the forestry administration of China. The same approach had been previously described (Gou et al., 2010, 2011). Histology and microscopy Rooting stem cuttings from WT and transgenic plants were sampled and immediately fixed in FAA solution [containing 5% (v/v) formalin, 5% (v/v) acetic acid, and 50% (v/v) ethanol]. Samples were embedded in paraffin using a method described previously (Nakayama et al., 2002). The sections were stained with safranin fast-green for general tissue structure observation. Sections were analysed using a light microscope (modelba210; Motic, China). GenBank accession numbers Sequence data from this article can be found in the GenBank data libraries under accession numbers: AJ (PtGA20ox), JX (PtGA2ox1), JX (PtGAI), AB (NtGA2ox1), and AB (NtGA20ox1). Results Effects of GA and auxin and their interaction in adventitious root development The effects of GA and auxin in regulation of adventitious root formation in WT tobacco stem cuttings were examined. Exogenous application of bioactive GA (GA 3 ) in the medium significantly reduced the total number of adventitious roots in stem cuttings under the control conditions over 3 weeks (Fig. 1a, c). However, application of the GA biosynthesis inhibitor PAC (Rademacher, 2000) also reduced the number of adventitious roots, but to a lesser degree than GA 3 (Fig. 1a, c). Interestingly, exogenous application of IAA did not reverse the effects of GA 3 and PAC; simultaneous treatment with IAA and PAC has a marked effect on adventitious root formation similar to the individual and combined effects of GA 3 and IAA. In fact, WT tobacco stem cuttings with an apical bud can be easily rooted on hormone-free medium (100%). Application of exogenous auxin retarded root development in a dose-dependent manner; root elongation is more sensitive to auxin than root density (Fig. 1). GA 3 and PAC have opposite effects on root elongation (Fig. 1b). Treatment with IAA and PAC and with IAA and GA resulted in comparable phenotypes, but through different mechanisms. For root elongation, exogenous application of GA 3 significantly stimulated primary root elongation while PAC had the
4 3414 Niu et al. Fig. 1. Effects of GA and auxin on adventitious rooting of tobacco stem cuttings. (a) Average adventitious root number of WT plants grown in vitro on media with different treatments for 3 weeks. (b) Average length of the three longest primary roots of WT plants grown in vitro on media with different treatments for 3 weeks. Bars show the means and standard error over three events (at least 10 ramets per event). * and ** indicate significance as determined by Student s t-test at P < 0.05 and P < 0.01, respectively. (c) Roots of differently treated plants. The length of the sides of the square grids is 0.5 inches. opposite effect (Fig. 1b). Application of IAA+GA 3 significantly reduced primary root length, indicating that an appropriate amount of bioactive GAs and auxin is essential for root elongation (Fig. 1b). Taken together, these observations demonstrate that GAs have a significant effect on adventitious root development in tobacco. Alteration of GA synthesis and signalling in different tissues using the transgenic approach To establish a causative relationship between GAs and the observed root phenotypes caused by exogenous application of GA 3 and PAC and to gain insight into the specific regulatory mechanism of GAs during adventitious root development, the levels of bioactive GAs were modified in specific tissues of tobacco with PtGA20ox, PtGA2ox1, and PtGAI under the control of the promoters Cauliflower mosaic virus 35S, LMX5, and TobRB7, respectively. Transgenic tobacco plants were generated, namely 35S::PtGA20ox, 35S::PtGA2ox1, 35S::PtGAI, LMX5::PtGA20ox, LMX5::PtGA2ox1, TobRB7::PtGA20ox, and TobRB7::PtGA2ox1 (hereafter referred to as 35:G20, 35:G2, GAI, L:G20, L:G2, T:G20, and T:G2, respectively). These plants exhibited phenotypes similar to those found in earlier studies that used the same technique (Eriksson and Moritz, 2002; Israelsson et al., 2005; Mauriat and Moritz, 2009). 35:G20 plants exhibited the greatest increase in internode length and corresponding plant stature, typical of GA overproduction syndrome, while 35:G2 and GAI plants exhibited dwarfism and had small, dark green leaves, phenotypic hallmarks of GA-deficient mutants.
5 Gibberellin regulate adventitious root development in tobacco 3415 The phenotypes of L:G20 and T:G20 plants resembled that of 35:G20, but to a lesser extent; however, these responses were much lower in the L:G2 and T:G2 plants, which exhibited only a marginal decrease in height relative to WT plants (Fig. 2; Supplementary Fig. S1 at JXB online). To determine if the phenotype observed in transgenic plants corresponds to expression changes in exogenous genes and GA concentrations, the expression patterns of exogenous genes and their orthologues in the leaves, stems, and roots of WT and transgenic plants were assessed by qpcr (Fig. 3). A feedback and feed-forward regulatory mechanisms of the tobacco GA genes were identified as expected. Because all these genes are responsive to active GAs, the expression changes are the result of active GA content alteration. The GA concentrations were assessed using an LC-MS system (Fig. 4; Supplementary Fig. S2 at JXB online). The changes in concentration of bioactive GA 1 closely mirrored the observed phenotypic changes in the respective organs of predominant expression (Fig. 4). Interestingly, concentrations of GA 1 also increased and decreased in stems of T:G20 and T:G2 plants, respectively (Fig. 4c), and feedback regulation of NtGA20ox1 (Fig. 3f) and NtGA2ox1 (Fig. 3e) was observed; however, PtGA20ox and PtGA2ox1 expression was not detected in the stems (Fig. 3c). It is thought that this gene affects GA biosynthesis in other tissues, and the high levels of GA 1 in the other tissues move in a non-polar fashion to the stem. Analysis of the effect of excision of developing and mature leaves from cuttings on stem elongation indicated that these signals were not derived from the developing and mature leaves (Supplementary Fig. S3). Bioactive GA 4 exhibited more complex changes (Supplementary Fig. S2); however, it is generally a minor active GA in tobacco. Therefore, the phenotype of the transgenic plants is related more to changes in GA 1 concentration. The inactive GA 8, converted from GA 1, is the most abundant gibberellin in both wild-type and transgenic plants. It is noteworthy that the GA 1 content is relatively stable in roots, stems, and leaves; however, very substantial increases in GA 8 content from roots to leaves were identified in both WT and transgenic plants (Fig. 4b, d, f). These results indicate that different tissues may play disparate roles in GA homeostasis in the whole plant, and that exogenous gene expression induces homeostasis responses. Down-regulation of GA level in the vasculature but not in roots altered adventitious rooting Fig. 2. Phenotypic characterizations of WT and transgenic plants. One-month-old WT and transgenic plants grown in vitro are pictured. The top and bottom panels show the same plants with leaves and defoliated, respectively. The transgenic plants were significantly affected in terms of internode elongation. Bar=10 cm in the top panel and 5 cm in the bottom panel. WT, wild-type; 35:G20, 35S::PtGA20ox transgenic plants; 35:G2, 35S::PtGA2ox1 transgenic plants; T:G20, TobRB7::PtGA20ox transgenic plants; T:G2, TobRB7::PtGA2ox1 transgenic plants; L:G20, LMX5::PtGA20ox transgenic plants; L:G2, LMX5::PtGA2ox1 transgenic plants; GAI, 35S::PtGAI transgenic plants. (This figure is available in colour at JXB online.) Stem cuttings of transformed lines and WT controls were cultured in the same medium for 2 weeks to examine rooting ability. Similar to the effect produced by exogenous application of GA 3 and PAC, constitutive overexpression of PtGA20ox and PtGA2ox1 significantly reduced root number to varying degrees (Fig. 5). Interestingly, not all of the combinations of the PtGA20ox and PtGA2ox1 genes with the two tissue-specific promoters resulted in similar changes in rooting ability in overexpressing plants. Neither T:G20 nor T:G2 plants showed any obvious phenotypic changes in root number compared with the WT (Fig. 5). However, L:G2 and GAI transformants had similar rooting traits to 35:G2 (Fig. 5). This indicates that the presence of GAs in the vasculature is necessary for adventitious root formation. Additionally, the results indicate that GA plays a role in lateral root development (Fig. 5b) and root tip diameter regulation. Lateral root development was delayed for more than a week in L:G2 plants. Root tips of transgenic plants were observed under a microscope (n >150). The results indicated that GA negatively regulates the root tip diameter (data not shown). The root tip diameters of 35:G20 and 35:G2 were 314 ± 44 nm and 367 ± 49 nm, respectively, compared with 338 ± 34 nm in the WT. This difference can be reversed by exogenous application of GA 3 or PAC.
6 3416 Niu et al. Fig. 3. Expression levels of PtGA20ox, PtGA2ox1, PtGAI, and their orthologous genes in leaves, stems, and roots of wild-type and transgenic tobacco. (a i) qrt PCR analysis of PtGA20ox, PtGA2ox1, PtGAI (a, d, i), NtGA20ox1 (b, e, h), and NtGA2ox1 (c, f, i) in leaves (a, b, c), stems (e, d, f), and roots (g, h, i), respectively. The expression levels are relative to the Ntactin, and to the PtGA20ox of 35:G20 value (set at 1). Values are means ±SE of three biological replicates. To improve understanding of the role of GAs in the vasculature during root formation, the initiation and development of adventitious roots in tobacco were examined histologically. The results showed that in both WT and transgenic plants, all adventitious roots originated from the vascular cambium (Fig. 6). These findings reveal that a threshold level of GAs is required for adventitious root development. Up-regulation of GA level in the vasculature arrests adventitious root formation in conjunction with high levels of auxin A remaining open question was why both L:G20 and T:G20 did not display similar effects to 35:G20 and whether GAs have an inhibitory effect on adventitious root formation in conjunction with auxin or polar auxin transport. To answer this, the rooting ability of these transgenic plants grown in media supplemented with exogenous auxin was examined. The expected results were obtained using high levels of NAA-treated L:G20 plants, in terms of the substantial decreases in the adventitious rooting rate (Fig. 7a). Intriguingly, application of high levels of IAA (1 mg l 1 ) did not produce similar results (data not shown). However, a very substantial increase in endogenous IAA levels occurred in the lowest stem section in 35:G20 plants (Fig. 7b). High levels of IAA or NAA and GA result in arrest of adventitious root formation with greater callus formation at the base of the stem cutting (Supplementary Fig. S4 at JXB online). Considering the promoter used, it was no surprise that the phenotype of the L:G20 plants did not show any major modifications under normal conditions. Auxin is synthesized in the apical meristems of shoots and in young leaves, and moves in a polar fashion, preferentially downward, through phloem parenchyma cells of the stem to the base of the plant (Jacobs and Gilbert, 1983), and the effect of GAs on polar auxin transport is not found on the xylem side of the cambial zone. GA inhibited adventitious root formation by repressing primordium initiation When petiole sections from wild-type plants were incubated on MS medium containing 1 mg l 1 IAA, adventitious roots were often regenerated from the base of the sections.
7 Gibberellin regulate adventitious root development in tobacco 3417 Fig. 4. Gibberellin concentration in leaves, stems, and roots of wild-type and transgenic tobacco. Wild-type and transgenic plants were grown in vitro on hormone-free medium for 4 weeks. GA 1 (a, c, e) and GA 8 (b, d, f) concentrations in stems (c, d), roots (e, f), and leaves (a, b) were assessed using an LC-MS system. Values are means ±SE of three biological replicates. The formation of adventitious roots from petioles and midvein sections was inhibited by GA 3 and overexpression of PtGA20ox (Fig.8; Supplementary Fig. S5 at JXB online). When petiole sections of WT, 35:G2, and GAI plants were incubated under the above-described conditions with the addition of GA 3, root regeneration was significantly inhibited. Moreover, WT and 35:G2 petiole sections from plants pre-cultured in GA-containing medium were similarly inhibited in terms of root regeneration (Supplementary Fig. S5); incubation of 35:G20 petiole sections on PAC-containing medium did not relieve this inhibition (Fig. 8). To investigate whether the effect of GAs on adventitious root formation was a result of the suppressed initiation of root primordia or the arrest of already initiated root primordia, WT plant cuttings were transferred from hormone-free medium to a GA-containing medium in the first 0 5 d after pre-culture. Quantitative analysis of primary root numbers showed that the inhibitory effect of GAs dramatically attenuated to normal levels when the pre-culture time was >3 d (Fig. 9a). In addition, WT plant cuttings in hormonefree medium transferred from GA-containing medium still showed a significant GA-mediated inhibitory effect. Preculture in PAC-containing medium rescued root formation in 35:G20 plants (Fig. 9b). Taken together, these data suggest that the deleterious action of GAs is manifested at a very early stage of adventitious root formation and established primordia were least affected by GAs. A mobile GA signal is required for the emergence and subsequent long-term elongation of adventitious roots When each of the above-mentioned GA mutants was examined with regard to root elongation, it was noted that mutants containing PtGA2ox1 or PtGAI exhibited compromised primary root elongation compared with the WT control. In contrast, all transgenic types of PtGA20ox expressers displayed an increase in primary root length relative to the WT control (Fig. 10a, d). Although these results are not significant except for 35:G20 plants, they were reproducible; furthermore, exogenous application of GA 3 and PAC had similar effects (Fig. 1b). The distinct effects of GAs on tissue-specific expressers in terms of adventitious root formation and elongation suggest that root elongation relative to root formation is a long-term process and GAs are mobile elongation-promoting signals. Further evidence confirmed this view; WT plant cuttings transferred from hormone-free medium to a GA-containing
8 3418 Niu et al. Fig. 5. The primary and lateral roots of wild-type and transgenic plants. (a) Average primary root density of wild-type and transgenic plants. Wild-type and transgenic plants were grown in vitro on hormone-free medium for 2 weeks. Adventitious roots were harvested and quantitatively analysed. Bars show the means and standard errors over three events (at least 10 ramets per event). (b) The phenotype of primary and lateral roots of wild-type and transgenic plants. The length of the sides of the square grids is 0.5 inches.
9 Gibberellin regulate adventitious root development in tobacco 3419 Fig. 6. The anatomy of root initiation in stem cuttings of wild-type control and transgenic tobacco plants. Wild-type and transgenic plants were grown in vitro on hormone-free medium for 5 d and then harvested for analysis. It is evident that all adventitious roots originated from the vascular cambium in both wild-type and transgenic plants, and proper GA localization in this zone is required for development of adventitious roots. X, xylem; P, phloem; VC, vascular cambium; V, vessels; AR, adventitious root. Scale bars represent 100 μm. (This figure is available in colour at JXB online.) Fig. 7. Effect of exogenous NAA application on adventitious root development and endogenous IAA concentration in the lowest stem section of transgenic and wild-type plants. (a) The rooting rate of stem cuttings of wild-type control and transgenic tobacco plants after 3 weeks of NAA treatment. Bars represent the means and standard errors of three independent experiments where each experiment included at least 10 ramets per event. (b) IAA concentrations of the three lowest internodes were assessed using an LC-MS system. Values are means ±SE of three biological replicates. medium in the first 0 5 d after pre-culture did not show a decrease in root length (Fig. 10b). Upon application of PAC rather than GAs, cuttings of treated plants exhibited gradual and slight PAC-mediated inhibition of root elongation (Fig. 10c, d). Discussion Recent advances in molecular biology and plant physiology show that active GAs are important regulatory phytohormones in root development. Accumulating evidence suggests that GAs have an opposite effect on primary root growth (Fu and Harberd, 2003; Griffiths et al., 2006; UeguchiTanaka et al., 2007; Willige et al., 2007) relative to lateral root and adventitious root development (Eriksson et al., 2000; Gou et al., 2010, 2011; El-Sharkawy et al., 2012). To gain insight into the specific regulatory mechanism of GAs during root development, tobacco plants were examined for altered GA synthesis, catabolism, and signalling in different tissues using a transgenic approach. It was demonstrated that GAs
10 3420 Niu et al. Fig. 8. GA inhibited adventitious root formation from petioles and midvein sections of transgenic and wild-type plants. The petioles and midvein sections from the transgenic and wild-type plants were cut into 10 mm long segments and cultured for 3 weeks on MS medium. The concentrations of IAA, GA 3, and PAC were each 1 mg l 1. The explants did not generate roots on hormone-free medium. Bars=10 mm. Fig. 9. The inhibitory effect of GA is manifested in the early stages of adventitious root formation. (a) Quantitative analysis of adventitious root numbers of wild-type plant cuttings transferred from hormone-free medium to a GA-containing medium in the first 0 5 d of a 14 d period. (b) Quantitative analysis of adventitious root numbers of wild-type and 35:G20 plant cuttings grown on hormone-free medium transferred to GA-containing medium or PAC-containing medium.
11 Gibberellin regulate adventitious root development in tobacco 3421 Fig. 10. GAs are required for the emergence and subsequent long-term elongation of adventitious roots. (a) Average length of the three longest primary roots of wild-type and transgenic plants. Transgenic plants were grown in vitro on hormone-free medium for 2 weeks. Adventitious roots were harvested and quantitatively analysed. (b) Quantitative analysis of the three longest primary roots of wild-type plant cuttings transferred from hormone-free medium to a GA-containing medium in the first 0 5 d of a 14 d period. (c) Quantitative analysis of the three longest primary roots of wild-type plant cuttings transferred from hormone-free medium to a PAC-containing medium in the first 0 5 d of a 14 d period. (d) Quantitative analysis of adventitious root length of wild-type and 35:G20 plant cuttings grown on hormone-free medium transferred to GA-containing medium or PAC-containing medium. have an inhibitory effect on adventitious root formation but a stimulatory effect on root elongation. In this study, striking differences were found between transgenic tobacco and WT plants regarding adventitious root development. On the one hand, GA inhibits adventitious root formation. GA20ox overexpressers had poorer rooting capacity than their control counterparts; this was reported previously in trees (Eriksson et al., 2000; Gou et al., 2011). However, the negative effect on rooting efficiency during initial establishment of young plantlets in the growth chamber did not significantly affect root growth at later stages (Eriksson et al., 2000). Moreover, consistent with previous observations (Smith and Fedoroff, 1995; Busov et al., 2006) of the response to GA 3 treatment, the formation of adventitious roots in the WT, GA2ox-, and GAI-overexpressing plants was reduced dramatically. Therefore, a plausible explanation for the phenotype is that GAs negatively regulate the early initiation step of root formation, while PAC inhibits the emergence (and hence scoring) of roots, rather than their initiation. Consistent with this hypothesis, the distinct effects of GAs depend on the time of application. While it is an inhibitor during the pre-initiation phase, it strongly enhances rooting if applied at a time coincident with the first observable stage of root initiation (Smith and Thorpe, 1975). GA treatment seemed mainly to reduce intraprimordial cell division, the continued development of which the established primordia mostly depend on (Haissig, 1972). A previous study demonstrated that GAs primarily suppress lateral root formation at the early stages of lateral root primordium initiation (Gou et al., 2010). It is believed that reduced GA levels are necessary for maintenance of undetermined meristem cell fate (Sakamoto et al., 2001), whereas high GA concentrations promote cell differentiation and expansion (Jasinski et al., 2005; Shani et al., 2006). In contrast, GAs have a stimulatory effect on root elongation. Increases in endogenous GA content can induce significant increases in root elongation. Conversely, reduction of GA levels results in a decreased root growth rate (Lee and Zeevaart, 2005; Lo et al., 2008; Rieu et al., 2008). GA biosynthesis inhibitors are also known to inhibit root elongation, which is overcome by application of GA, providing further evidence that GAs are important for root growth (Yaxley et al., 2001). Subsequent studies revealed that regulation of GA-dependent elongation is restricted to cells of the root meristem and is not observed in the elongation or differentiation zone of the root (Ubeda-Tomas et al., 2008, 2009; Achard et al., 2009; Willige et al., 2011).
12 3422 Niu et al. Little information on the specific regulatory mechanism of GAs during adventitious root development is available. Studies on the effect of GAs on plant growth and development have been hindered by their low abundance and variation in form, time, and localization (El-Sharkawy et al., 2012). Modifying the levels of bioactive GAs in specific tissues by the expression of genes encoding enzymes involved in GA biosynthesis and catabolism provides an alternative approach to such investigations (Mauriat et al., 2011). To gain new insights into the role of GAs, transgenic plants with increased rates of biosynthesis and catabolism of GAs in specific parts of the vascular tissue and the root meristem, respectively, were investigated. The results showed that the presence of GAs in the vasculature is necessary for adventitious root formation. The main reason for this is that in both WT and transgenic plants, all adventitious roots originate from the vascular cambium and this process requires GA biosynthesis and DELLA repressor-mediated GA signalling. Earlier research suggested that the presence of bioactive GAs in the xylem is crucial for adventitious rooting (Mauriat et al., 2011). As mentioned above, GA treatment has an inhibitory effect on adventitious root formation; interestingly, the GA 1 levels are increased in all G20 lines but the effect on adventitious root density is just shown for 35:G20. The L:G20 and T:G20 lines have no reduction in adventitious root density. Previous studies had suggested that the GAs cannot transfer freely between different cell layers of the stem (Bjorklund et al., 2007), and their concentration is not distributed evenly between different types of cells in stem (Israelsson et al., 2005). In addition, the GAs have been shown to be a mobile signal (Ragni et al., 2011), and a new homeostasis will soon be achieved with the environmental change (Benschop et al., 2006; Toh et al., 2008). Therefore, as the sources of signal were different, it is speculated that the mechanisms in L:G20 and T:G20 plants are also different. These unexpected results regarding L:G20 may be due to interactions between GAs and auxin because of the well-known cross-talk between auxin and GA signalling at both the molecular and phenotypic levels (Wolbang and Ross, 2001; Bjorklund et al., 2007; Weiss and Ori, 2007). This case, therefore, raised the question as to whether the inhibitory effect of GAs on adventitious root formation is in conjunction with auxin, polar auxin transport, or both. Auxin moves down through phloem parenchyma cells to the base of the plant (Jacobs and Gilbert, 1983); therefore, GAs do not affect polar auxin transport located on the xylem side of the cambial zone. Based on the observation that NAAtreated L:G20 plants showed very substantial decreases in the total number of adventitious roots, the results support the hypothesis that the up-regulation of GAs, and the consequent auxin transport enhancement, and auxin gibberellin interactions in the vasculature, is causative of the 35:G20 phenotypes reported in the previous study. Therefore, the relationship between GAs and auxin appears to be both complex and context specific. Much progress has recently been made in corroborating auxin s promotion of root growth by enhancing the GA-induced destabilization of RGA, and perhaps of other DELLA proteins (Fu and Harberd, 2003; Gou et al., 2010; Moubayidin et al., 2010). However, the degree to which the specific effects of GAs are involved in root development remains unclear. Indeed, despite recent progress, there remains much to be learnt about these issues. Supplementary data Supplementary data are available at JXB online. Figure S1. Phenotypic characterizationof WT and transgenic plants grown in the greenhouse. Figure S2. Gibberellin concentrations in leaves, stems, and roots of wild-type and transgenic tobacco. Figure S3.The effects of excision of developing and mature leaves on stem elongation. Figure S4. The high levels of IAA or NAA and GA arrest adventitious root formation with more callus formation at the base of the stem cutting. Figure S5. The formation of adventitious roots from petioles and midvein sections of WT, 35:G20, and 35:G2 plants pre-cultured in GA3 or PAC-containing media. Table S1. Sequence information of PCR primers used for plasmid construction and qrt PCR. Acknowledgements The authors acknowledge Aimin Wu for comments on the article and for LMX5 promoters. This work was supported by the Fundamental Research Funds for the Central Universities of China (JD2010-4). References Achard P, Cheng H, De Grauwe L, Decat J, Schoutteten H, Moritz T, Van Der Straeten D, Peng J, Harberd NP Integration of plant responses to environmentally activated phytohormonal signals. Science 311, Achard P, Gusti A, Cheminant S, Alioua M, Dhondt S, Coppens F, Beemster GT, Genschik P Gibberellin signaling controls cell proliferation rate in Arabidopsis. Current Biology 19, Benschop JJ, Bou J, Peeters AJ, Wagemaker N, Guhl K, Ward D, Hedden P, Moritz T, Voesenek LA Long-term submergenceinduced elongation in Rumex palustris requires abscisic acid-dependent biosynthesis of gibberellin1. Plant Physiology 141, Berova M, Zlatev Z Physiological response and yield of paclobutrazol treated tomato plants (Lycopersicon esculentum Mill.). Plant Growth Regulation 30, 117. Bjorklund S, Antti H, Uddestrand I, Moritz T, Sundberg B Cross-talk between gibberellin and auxin in development of Populus wood: gibberellin stimulates polar auxin transport and has a common transcriptome with auxin. The Plant Journal 52, Busov VB, Meilan R, Pearce DW, Ma C, Rood SB, Strauss SH Activation tagging of a dominant gibberellin catabolism gene (GA 2-oxidase) from poplar that regulates tree stature. Plant Physiology 132, Busov V, Meilan R, Pearce DW, Rood SB, Ma C, Tschaplinski TJ, Strauss SH Transgenic modification of gai or rgl1 causes
13 Gibberellin regulate adventitious root development in tobacco 3423 dwarfing and alters gibberellins, root growth, and metabolite profiles in Populus. Planta 224, Chaney WR Tree growth retardants: arborists discovering new uses for an old tool. Tree Care Industry 54, 2 6. Dayan J, Schwarzkopf M, Avni A, Aloni R Enhancing plant growth and fiber production by silencing GA 2-oxidase. Plant Biotechnology Journal 8, El-Sharkawy I, El KW, Prasath D, Fernandez H, Bouzayen M, Svircev AM, Jayasankar S Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum. Journal of Experimental Botany 63, Eriksson ME, Israelsson M, Olsson O, Moritz T Increased gibberellin biosynthesis in transgenic trees promotes growth, biomass production and xylem fiber length. Nature Biotechnology 18, Eriksson ME, Moritz T Daylength and spatial expression of a gibberellin 20-oxidase isolated from hybrid aspen (Populus tremula L. P. tremuloides Michx.). Planta 214, Fagoaga C, Tadeo FR, Iglesias DJ, Huerta L, Lliso I, Vidal AM, Talon M, Navarro L, Garcia-Martinez JL, Pena L Engineering of gibberellin levels in citrus by sense and antisense overexpression of a GA 20-oxidase gene modifies plant architecture. Journal of Experimental Botany 58, Frigerio M, Alabadi D, Perez-Gomez J, Garcia-Carcel L, Phillips AL, Hedden P, Blazquez MA Transcriptional regulation of gibberellin metabolism genes by auxin signaling in Arabidopsis. Plant Physiology 142, Fu X, Harberd NP Auxin promotes Arabidopsis root growth by modulating gibberellin response. Nature 421, Gabriele S, Rizza A, Martone J, Circelli P, Costantino P, Vittorioso P The Dof protein DAG1 mediates PIL5 activity on seed germination by negatively regulating GA biosynthetic gene AtGA3ox1. The Plant Journal 61, Gilman EF Effects of amendments, soil additives, and irrigation on tree survival and growth. Journal of Arboriculture 30, Gou J, Ma C, Kadmiel M, Gai Y, Strauss S, Jiang X, Busov V Tissue-specific expression of Populus C19 GA 2-oxidases differentially regulate above- and below-ground biomass growth through control of bioactive GA concentrations. New Phytologist 192, Gou JQ, Strauss SH, Tsai CJ, Fang K, Chen YR, Jiang XN, Busov VB, Gibberellins regulate lateral root formation in Populus through interactions with auxin and other hormones. The Plant Cell 22, Griffiths J, Murase K, Rieu I, Zentella R, Zhang ZL, Powers SJ, Gong F, Phillips AL, Hedden P, Sun TP, Thomas SG Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis. The Plant Cell 18, Haissig BE Meristematic activity during adventitious root primordium development: influences of endogenous auxin and applied gibberellic acid. Plant Physiology 49, Han KM, Dharmawardhana P, Arias RS, Ma C, Busov V, Strauss SH Gibberellin-associated cisgenes modify growth, stature and wood properties in Populus. Plant Biotechnology Journal 9, Harberd NP, Belfield E, Yasumura Y The angiosperm gibberellin GID1 DELLA growth regulatory mechanism: how an inhibitor of an inhibitor enables flexible response to fluctuating environments. The Plant Cell 21, Holsters M, de Waele D, Depicker A, Messens E, van Montagu M, Schell J Transfection and transformation of Agrobacterium tumefaciens. Molecular and General Genetics 163, Ikezaki M, Kojima M, Sakakibara H, Kojima S, Ueno Y, Machida C, Machida Y Genetic networks regulated by ASYMMETRIC LEAVES1 (AS1) and AS2 in leaf development in Arabidopsis thaliana: KNOX genes control five morphological events. The Plant Journal 61, Israelsson M, Sundberg B, Moritz T Tissue-specific localization of gibberellins and expression of gibberellin-biosynthetic and signaling genes in wood-forming tissues in aspen. The Plant Journal 44, Jacobs M, Gilbert SF Basal localization of the presumptive auxin transport carrier in pea stem cells. Science 220, Jasinski S, Piazza P, Craft J, Hay A, Woolley L, Rieu I, Phillips A, Hedden P, Tsiantis M KNOX action in Arabidopsis is mediated by coordinate regulation of cytokinin and gibberellin activities. Current Biology 15, Lee DJ, Zeevaart JA Molecular cloning of GA 2-oxidase3 from spinach and its ectopic expression in Nicotiana sylvestris. Plant Physiology 138, Lo SF, Yang SY, Chen KT, Hsing YI, Zeevaart JA, Chen LJ, Yu SM A novel class of gibberellin 2-oxidases control semidwarfism, tillering, and root development in rice. The Plant Cell 20, Mauriat M, Moritz T Analyses of GA20ox- and GID1-overexpressing aspen suggest that gibberellins play two distinct roles in wood formation. The Plant Journal 58, Mauriat M, Sandberg LG, Moritz T Proper gibberellin localization in vascular tissue is required to control auxin-dependent leaf development and bud outgrowth in hybrid aspen. The Plant Journal 67, Moubayidin L, Perilli S, Dello IR, Di Mambro R, Costantino P, Sabatini S The rate of cell differentiation controls the Arabidopsis root meristem growth phase. Current Biology 20, Murashige T, Skoog F A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15, Nadeau CD, Ozga JA, Kurepin LV, Jin A, Pharis RP, Reinecke DM Tissue-specific regulation of gibberellin biosynthesis in developing pea seeds. Plant Physiology 156, Nakayama A, Park S, Zheng-Jun X, Nakajima M, Yamaguchi I Immunohistochemistry of active gibberellins and gibberellininducible alpha-amylase in developing seeds of morning glory. Plant Physiology 129, Nemhauser JL, Hong F, Chory J Different plant hormones regulate similar processes through largely nonoverlapping transcriptional responses. Cell 126, Osmont KS, Sibout R, Hardtke CS Hidden branches: developments in root system architecture. Annual Review of Plant Biology 58,
14 3424 Niu et al. Rademacher W Growth retardants: effects on gibberellin biosynthesis and other metabolic pathways. Annual Review of Plant Physiology and Plant Molecular Biology 51, Radi A, Lange T, Niki T, Koshioka M, Lange MJ Ectopic expression of pumpkin gibberellin oxidases alters gibberellin biosynthesis and development of transgenic Arabidopsis plants. Plant Physiology 140, Ragni L, Nieminen K, Pacheco-Villalobos D, Sibout R, Schwechheimer C, Hardtke CS Mobile gibberellin directly stimulates Arabidopsis hypocotyl xylem expansion. The Plant Cell 23, Rieu I, Eriksson S, Powers SJ, et al Genetic analysis reveals that C19-GA 2-oxidation is a major gibberellin inactivation pathway in Arabidopsis. The Plant Cell 20, Sakamoto T, Kamiya N, Ueguchi-Tanaka M, Iwahori S, Matsuoka M KNOX homeodomain protein directly suppresses the expression of a gibberellin biosynthetic gene in the tobacco shoot apical meristem. Genes and Development 15, Shani E, Yanai O, Ori N The role of hormones in shoot apical meristem function. Current Opinion in Plant Biology 9, Smith DL, Fedoroff NV LRP1, a gene expressed in lateral and adventitious root primordia of Arabidopsis. The Plant Cell 7, Smith DR, Thorpe TA Root initiation in cuttings of Pinus radiata seedlings. Journal of Experimental Botany 26, Stavang JA, Lindgard B, Erntsen A, Lid SE, Moe R, Olsen JE Thermoperiodic stem elongation involves transcriptional regulation of gibberellin deactivation in pea. Plant Physiology 138, Toh S, Imamura A, Watanabe A, et al High temperatureinduced abscisic acid biosynthesis and its role in the inhibition of gibberellin action in Arabidopsis seeds. Plant Physiology 146, Ubeda-Tomas S, Beemster GT, Bennett MJ Hormonal regulation of root growth: integrating local activities into global behaviour. Trends in Plant Science 17, Ubeda-Tomas S, Federici F, Casimiro I, Beemster GT, Bhalerao R, Swarup R, Doerner P, Haseloff J, Bennett MJ Gibberellin signaling in the endodermis controls Arabidopsis root meristem size. Current Biology 19, Ubeda-Tomas S, Swarup R, Coates J, Swarup K, Laplaze L, Beemster GT, Hedden P, Bhalerao R, Bennett MJ Root growth in Arabidopsis requires gibberellin/della signalling in the endodermis. Nature Cell Biology 10, Ueguchi-Tanaka M, Nakajima M, et al Molecular interactions of a soluble gibberellin receptor, GID1, with a rice DELLA protein, SLR1, and gibberellin. The Plant Cell 19, Weiss D, Ori N Mechanisms of cross talk between gibberellin and other hormones. Plant Physiology 144, Willige BC, Ghosh S, Nill C, Zourelidou M, Dohmann EM, Maier A, Schwechheimer C The DELLA domain of GA INSENSITIVE mediates the interaction with the GA INSENSITIVE DWARF1A gibberellin receptor of Arabidopsis. The Plant Cell 19, Willige BC, Isono E, Richter R, Zourelidou M, Schwechheimer C Gibberellin regulates PIN-FORMED abundance and is required for auxin transport-dependent growth and development in Arabidopsis thaliana. The Plant Cell 23, Wolbang CM, Chandler PM, Smith JJ, Ross JJ Auxin from the developing inflorescence is required for the biosynthesis of active gibberellins in barley stems. Plant Physiology 134, Wolbang CM, Ross JJ Auxin promotes gibberellin biosynthesis in decapitated tobacco plants. Planta 214, Yamaguchi S Gibberellin metabolism and its regulation. Annual Review of Plant Biology 59, Yamamoto YT, Taylor CG, Acedo GN, Cheng CL, Conkling MA Characterization of cis-acting sequences regulating rootspecific gene expression in tobacco. The Plant Cell 3, Yaxley JR, Ross JJ, Sherriff LJ, Reid JB Gibberellin biosynthesis mutations and root development in pea. Plant Physiology 125, Zhao C, Hanada A, Yamaguchi S, Kamiya Y, Beers EP The Arabidopsis Myb genes MYR1 and MYR2 are redundant negative regulators of flowering time under decreased light intensity. The Plant Journal 66,
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
Expression analysis of PIN genes in root tips and nodules of Lotus japonicus
Article Expression analysis of PIN genes in root tips and nodules of Lotus japonicus Izabela Sańko-Sawczenko 1, Dominika Dmitruk 1, Barbara Łotocka 1, Elżbieta Różańska 1 and Weronika Czarnocka 1, * 1
Flowering time. Col C24 Cvi C24xCol C24xCvi ColxCvi
Flowering time Rosette leaf number 50 45 40 35 30 25 20 15 10 5 0 Col C24 Cvi C24xCol C24xCvi ColxCvi Figure S1. Flowering time in three F 1 hybrids and their parental lines as measured by leaf number
Correlation & Linear Regression in SPSS
Correlation & Linear Regression in SPSS Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise 1 - Correlation File / Open
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo Yuma Oka and Thomas N. Sato Supplementary Figure S1. Whole-mount smfish with and without the methanol pretreatment.
University of Bristol - Explore Bristol Research
Al-Salihi, S. A. A., Scott, T. A., Bailey, A. M., & Foster, G. D. (2017). Improved vectors for Agrobacterium mediated genetic manipulation of Hypholoma spp. and other homobasidiomycetes. Journal of Microbiological
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.
Correlation & Linear Regression in SPSS Petra Petrovics PhD Student Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise
Construction of a cube given with its centre and a sideline
Transformation of a plane of projection Construction of a cube given with its centre and a sideline Exercise. Given the center O and a sideline e of a cube, where e is a vertical line. Construct the projections
FAMILY STRUCTURES THROUGH THE LIFE CYCLE
FAMILY STRUCTURES THROUGH THE LIFE CYCLE István Harcsa Judit Monostori A magyar társadalom 2012-ben: trendek és perspektívák EU összehasonlításban Budapest, 2012 november 22-23 Introduction Factors which
Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and
1 2 3 4 5 Journal name: Applied Microbiology and Biotechnology Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and evaluation of its effect on lignocellulosic
Supporting Information
Supporting Information Paired design of dcas9 as a systematic platform for the detection of featured nucleic acid sequences in pathogenic strains Yihao Zhang 1,2,8, Long Qian 4,8, Weijia Wei 1,3,7,8, Yu
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Nonparametric Tests
Nonparametric Tests Petra Petrovics Hypothesis Testing Parametric Tests Mean of a population Population proportion Population Standard Deviation Nonparametric Tests Test for Independence Analysis of Variance
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon
A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Hypothesis Testing. Petra Petrovics.
Hypothesis Testing Petra Petrovics PhD Student Inference from the Sample to the Population Estimation Hypothesis Testing Estimation: how can we determine the value of an unknown parameter of a population
Modular Optimization of Hemicellulose-utilizing Pathway in. Corynebacterium glutamicum for Consolidated Bioprocessing of
[Supplementary materials] Modular Optimization of Hemicellulose-utilizing Pathway in Corynebacterium glutamicum for Consolidated Bioprocessing of Hemicellulosic Biomass Sung Sun Yim 1, Jae Woong Choi 1,
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon
Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Karancsi Lajos Gábor Debreceni Egyetem Agrár és Gazdálkodástudományok Centruma Mezőgazdaság-, Élelmiszertudományi és Környezetgazdálkodási
Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and
WT sham Trpv4 -/- sham Saline 10µM GSK1016709A P value Saline 10µM GSK1016709A P value Number 10 10 8 8 Intercontractile interval (sec) 143 (102 155) 98.4 (71.4 148) 0.01 96 (92 121) 109 (95 123) 0.3 Voided
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Nonparametric Tests. Petra Petrovics.
Nonparametric Tests Petra Petrovics PhD Student Hypothesis Testing Parametric Tests Mean o a population Population proportion Population Standard Deviation Nonparametric Tests Test or Independence Analysis
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
Statistical Inference
Petra Petrovics Statistical Inference 1 st lecture Descriptive Statistics Inferential - it is concerned only with collecting and describing data Population - it is used when tentative conclusions about
Az fmri alapjai BOLD fiziológia. Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika
Az fmri alapjai BOLD fiziológia Dr. Kincses Tamás Szegedi Tudományegyetem Neurológiai Klinika T2* Az obszervált transzverzális relaxáció (T2*) több különböző komponens összege Many physical effects result
Étkezési búzák mikotoxin tartalmának meghatározása prevenciós lehetıségek
Étkezési búzák mikotoxin tartalmának meghatározása prevenciós lehetıségek Téren, J., Gyimes, E., Véha, A. 2009. április 15. PICK KLUB Szeged 1 A magyarországi búzát károsító Fusarium fajok 2 A betakarítás
EN United in diversity EN A8-0206/419. Amendment
22.3.2019 A8-0206/419 419 Article 2 paragraph 4 point a point i (i) the identity of the road transport operator; (i) the identity of the road transport operator by means of its intra-community tax identification
7 th Iron Smelting Symposium 2010, Holland
7 th Iron Smelting Symposium 2010, Holland Október 13-17 között került megrendezésre a Hollandiai Alphen aan den Rijn városában található Archeon Skanzenben a 7. Vasolvasztó Szimpózium. Az öt napos rendezvényen
Effect of sowing technology on the yield and harvest grain moisture content of maize (Zea mays L.) hybrids with different genotypes
A - MurányiE:Layout 1 2/18/16 9:34 AM Page 1 Effect of sowing technology on the yield and harvest grain moisture content of maize (Zea mays L.) hybrids with different genotypes Eszter Murányi University
Using the CW-Net in a user defined IP network
Using the CW-Net in a user defined IP network Data transmission and device control through IP platform CW-Net Basically, CableWorld's CW-Net operates in the 10.123.13.xxx IP address range. User Defined
Statistical Dependence
Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent
Angol Középfokú Nyelvvizsgázók Bibliája: Nyelvtani összefoglalás, 30 kidolgozott szóbeli tétel, esszé és minta levelek + rendhagyó igék jelentéssel
Angol Középfokú Nyelvvizsgázók Bibliája: Nyelvtani összefoglalás, 30 kidolgozott szóbeli tétel, esszé és minta levelek + rendhagyó igék jelentéssel Timea Farkas Click here if your download doesn"t start
Széchenyi István Egyetem www.sze.hu/~herno
Oldal: 1/6 A feladat során megismerkedünk a C# és a LabVIEW összekapcsolásának egy lehetőségével, pontosabban nagyon egyszerű C#- ban írt kódból fordítunk DLL-t, amit meghívunk LabVIEW-ból. Az eljárás
Glyma10g15850 aagggatccattctggaaccatatcttgctgtg ttgggtacccttggatgcaggatgacacg AtMKK6, AT5g56580
Supplemental table 1. Soybean MAPK, MAPKK, and MAPKKK genes and primers for VIGS cloning Gene_ID Forward Primer Reverse Primer Arabidopsis Ortholog Glyma04g03210 aagggatcctgcagcaagaaccagttcat ttgggtaccctaatggatgcgcattaggataaag
FÖLDRAJZ ANGOL NYELVEN
Földrajz angol nyelven középszint 0821 ÉRETTSÉGI VIZSGA 2009. május 14. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ OKTATÁSI ÉS KULTURÁLIS MINISZTÉRIUM Paper
Computer Architecture
Computer Architecture Locality-aware programming 2016. április 27. Budapest Gábor Horváth associate professor BUTE Department of Telecommunications ghorvath@hit.bme.hu Számítógép Architektúrák Horváth
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis
Factor Analysis Factor analysis is a multiple statistical method, which analyzes the correlation relation between data, and it is for data reduction, dimension reduction and to explore the structure. Aim
EGÉSZSÉGTUDOMÁNY, LVII. ÉVFOLYAM, 2013. 4. SZÁM 2013/4
Part II: Seasonal variations in human infections with Puumula hantavirus in Styria II. rész: Évszakos változások a Puumula hantavirus okozta humán fertőzésekben Stájerországban PROF. SIXL WOLF DIETER,
Expansion of Red Deer and afforestation in Hungary
Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi www.vmi.szie.hu Background and importance large herbivores are overpopulated
Horizontal gene transfer drives adaptive colonization of apple trees by the fungal pathogen Valsa mali. Zhiyuan Yin, Baitao Zhu, Hao Feng, Lili Huang*
Supplementary Information Horizontal gene transfer drives adaptive colonization of apple trees by the fungal pathogen Valsa mali Zhiyuan Yin, Baitao Zhu, Hao Feng, Lili Huang* State Key Laboratory of Crop
Supplementary Figure 1
Supplementary Figure 1 Plot of delta-afe of sequence variants detected between resistant and susceptible pool over the genome sequence of the WB42 line of B. vulgaris ssp. maritima. The delta-afe values
Mapping Sequencing Reads to a Reference Genome
Mapping Sequencing Reads to a Reference Genome High Throughput Sequencing RN Example applications: Sequencing a genome (DN) Sequencing a transcriptome and gene expression studies (RN) ChIP (chromatin immunoprecipitation)
SAJTÓKÖZLEMÉNY Budapest 2011. július 13.
SAJTÓKÖZLEMÉNY Budapest 2011. július 13. A MinDig TV a legdinamikusabban bıvülı televíziós szolgáltatás Magyarországon 2011 elsı öt hónapjában - A MinDig TV Extra a vezeték nélküli digitális televíziós
First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.
First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this
On The Number Of Slim Semimodular Lattices
On The Number Of Slim Semimodular Lattices Gábor Czédli, Tamás Dékány, László Ozsvárt, Nóra Szakács, Balázs Udvari Bolyai Institute, University of Szeged Conference on Universal Algebra and Lattice Theory
A cell-based screening system for RNA Polymerase I inhibitors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information A cell-based screening system for RNA Polymerase I inhibitors Xiao Tan,
FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY
Földrajz angol nyelven középszint 0623 ÉRETTSÉGI VIZSGA 2007. május 15. FÖLDRAJZ ANGOL NYELVEN GEOGRAPHY KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA INTERMEDIATE LEVEL WRITTEN EXAM JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ
Cashback 2015 Deposit Promotion teljes szabályzat
Cashback 2015 Deposit Promotion teljes szabályzat 1. Definitions 1. Definíciók: a) Account Client s trading account or any other accounts and/or registers maintained for Számla Az ügyfél kereskedési számlája
A katalógusban szereplő adatok változásának jogát fenntartjuk. 2015. 02-es kiadás
RUGÓKATALÓGUS A Biotek Kft. több mint 20 év tudásával és tapasztalatával valamint kiváló minőségű rögzítéstechnikai és gépépítő elemek nagy választékával kínál megoldásokat termékek tervezéséhez és gyártásához.
NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING
Anyagmérnöki Tudományok, 39/1 (2016) pp. 82 86. NYOMÁSOS ÖNTÉS KÖZBEN ÉBREDŐ NYOMÁSVISZONYOK MÉRÉTECHNOLÓGIAI TERVEZÉSE DEVELOPMENT OF CAVITY PRESSURE MEASUREMENT FOR HIGH PRESURE DIE CASTING LEDNICZKY
építészet & design ipari alkalmazás teherautó felépítmény
A Design-Composit egy kompozitpaneleket gyártó vállalat, mely teherautó felépítményekhez, az építészet számára és design termékekhez készít paneleket. We are an innovative manufacturer of composite panels
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit.
Supplemental Table S1. Overview of MYB transcription factor genes analyzed for expression in red and pink tomato fruit. MYB Primer pairs TC AtMYB Forward Reverse TC199266 MYB12 AGGCTCTTGGAGGTCGTTACC CAACTCTTTCCGCATCTCAATAATC
EPILEPSY TREATMENT: VAGUS NERVE STIMULATION. Sakoun Phommavongsa November 12, 2013
EPILEPSY TREATMENT: VAGUS NERVE STIMULATION Sakoun Phommavongsa November 12, 2013 WHAT IS EPILEPSY? A chronic neurological disorder characterized by having two or more unprovoked seizures Affects nearly
A vitorlázás versenyszabályai a 2013-2016. évekre angol-magyar nyelvű kiadásának változási és hibajegyzéke
A vitorlázás versenyszabályai a 2013-2016. évekre angol-magyar nyelvű kiadásának változási és hibajegyzéke A dokumentum A vitorlázás versenyszabályai a 2013-2016. évekre angol-magyar nyelvű kiadásában
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:
STUDENT LOGBOOK 1 week general practice course for the 6 th year medical students Name of the student: Dates of the practice course: Name of the tutor: Address of the family practice: Tel: Please read
Lexington Public Schools 146 Maple Street Lexington, Massachusetts 02420
146 Maple Street Lexington, Massachusetts 02420 Surplus Printing Equipment For Sale Key Dates/Times: Item Date Time Location Release of Bid 10/23/2014 11:00 a.m. http://lps.lexingtonma.org (under Quick
Report on esi Scientific plans 7 th EU Framework Program. José Castell Vice-President ecopa, ES
Report on esi Scientific plans 7 th EU Framework Program José Castell Vice-President ecopa, ES the Seventh Framework Programme (2007-2013) Ecopa scientific plans for 2007-2008?
Forensic SNP Genotyping using Nanopore MinION Sequencing
Forensic SNP Genotyping using Nanopore MinION Sequencing AUTHORS Senne Cornelis 1, Yannick Gansemans 1, Lieselot Deleye 1, Dieter Deforce 1,#,Filip Van Nieuwerburgh 1,#,* 1 Laboratory of Pharmaceutical
FÖLDRAJZ ANGOL NYELVEN
Földrajz angol nyelven középszint 1112 ÉRETTSÉGI VIZSGA 2014. május 15. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ EMBERI ERŐFORRÁSOK MINISZTÉRIUMA Paper
FORGÁCS ANNA 1 LISÁNYI ENDRÉNÉ BEKE JUDIT 2
FORGÁCS ANNA 1 LISÁNYI ENDRÉNÉ BEKE JUDIT 2 Hátrányos-e az új tagállamok számára a KAP támogatások disztribúciója? Can the CAP fund distribution system be considered unfair to the new Member States? A
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
Abigail Norfleet James, Ph.D.
Abigail Norfleet James, Ph.D. Left side of brain develops first in girls, right in boys o Probably source of girls verbal skills o And source of boys spatial skills Pre-frontal lobes Control impulses and
Contact us Toll free (800) fax (800)
Table of Contents Thank you for purchasing our product, your business is greatly appreciated. If you have any questions, comments, or concerns with the product you received please contact the factory.
FOSS4G-CEE Prágra, 2012 május. Márta Gergely Sándor Csaba
FOSS4G-CEE Prágra, 2012 május Márta Gergely Sándor Csaba Reklám helye 2009 óta Intergraph szoftverek felől jöttünk FOSS4G felé megyünk Békés egymás mellett élés több helyen: Geoshop.hu Terkep.torokbalint.hu
A modern e-learning lehetőségei a tűzoltók oktatásának fejlesztésében. Dicse Jenő üzletfejlesztési igazgató
A modern e-learning lehetőségei a tűzoltók oktatásának fejlesztésében Dicse Jenő üzletfejlesztési igazgató How to apply modern e-learning to improve the training of firefighters Jenő Dicse Director of
KÉPI INFORMÁCIÓK KEZELHETŐSÉGE. Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet. Összefoglaló
KÉPI INFORMÁCIÓK KEZELHETŐSÉGE Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet Összefoglaló Tanórákon és az önálló tanulás részeként is, az informatika világában a rendelkezésünkre álló óriási mennyiségű
Hasznos és kártevő rovarok monitorozása innovatív szenzorokkal (LIFE13 ENV/HU/001092)
Hasznos és kártevő rovarok monitorozása innovatív szenzorokkal (LIFE13 ENV/HU/001092) www.zoolog.hu Dr. Dombos Miklós Tudományos főmunkatárs MTA ATK TAKI Innovative Real-time Monitoring and Pest control
Összefoglalás. Summary
Parlagoltatásos, zöld- és istállótrágyázásos vetésforgók összehasonlítása a talajtömörödöttség tükrében Szőllősi István Antal Tamás Nyíregyházi Főiskola, Műszaki és Mezőgazdasági Főiskolai Kar Jármű és
Tudományos Ismeretterjesztő Társulat
Sample letter number 5. International Culture Festival PO Box 34467 Harrogate HG 45 67F Sonnenbergstraße 11a CH-6005 Luzern Re: Festival May 19, 2009 Dear Ms Atkinson, We are two students from Switzerland
IES TM Evaluating Light Source Color Rendition
IES TM-30-15 Evaluating Light Source Color Rendition "Original" "CRI = 80" Desaturated "CRI = 80" Saturated More metrics Color Fidelity Color Discrimination Color Preference Metrics/Measures R f (IES TM-30-15)
Teherviselő faszerkezet csavaros kapcsolatának tervezési tapasztalatai az európai előírások szerint
Teherviselő faszerkezet csavaros kapcsolatának tervezési tapasztalatai az európai előírások szerint Joó Balázs Designing olted connections according to European standards The suject of the article is the
4 vana, vanb, vanc1, vanc2
77 1) 2) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 12 7 17 4 8 2003 1 2004 7 3 Enterococcus 5 Enterococcus faecalis 1 Enterococcus avium 1 Enterococcus faecium 2 5 PCR E. faecium 1 E-test MIC 256 mg/ml vana MRSA MRSA
A jövedelem alakulásának vizsgálata az észak-alföldi régióban az 1997-99. évi adatok alapján
A jövedelem alakulásának vizsgálata az észak-alföldi régióban az 1997-99. évi adatok alapján Rózsa Attila Debreceni Egyetem Agrártudományi Centrum, Agrárgazdasági és Vidékfejlesztési Intézet, Számviteli
Rezgésdiagnosztika. Diagnosztika 02 --- 1
Rezgésdiagnosztika Diagnosztika 02 --- 1 Diagnosztika 02 --- 2 A rezgéskép elemzésével kimutatható gépészeti problémák Minden gép, mely tartalmaz forgó részt (pl. motor, generátor, szivattyú, ventilátor,
DECLARATION OF PERFORMANCE No. GST REV 1.03 According to Construction Products Regulation EU No. 305/2011
DECLARATION OF PERFORMANCE No. According to Construction Products Regulation EU No. 305/2011 This declaration is available in the following languages: English Declaration of Performance Page 2-3 Hungarian
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK Despite enormous challenges many developing countries are service exporters Besides traditional activities such as tourism;
AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, TILLING
Hagyomány és haladás a növénynemesítésben AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, BÁLINT ANDRÁS FERENC 1, SZIRA FRUZSINA 1, ANDREAS BÖRNER 2, KERSTIN
4-42 ELECTRONICS WX210 - WX240
4-42 ELECTRONICS WX210 - WX240 PCS 40000499-en Fig. 8 WX210 - WX240 ELECTRONICS 4-43 PCS COMPONENTS 40000471-en Load-limit regulator Legend Fig. 1 Fig. 2 1 Power supply 2 PWM1 output, proportional valve
TIOLKARBAMÁT TÍPUSÚ NÖVÉNYVÉDŐ SZER HATÓANYAGOK ÉS SZÁRMAZÉKAIK KÉMIAI OXIDÁLHATÓSÁGÁNAK VIZSGÁLATA I
Műszaki Földtudományi Közlemények, 83. kötet, 1. szám (2012), pp. 137 146. TIOLKARBAMÁT TÍPUSÚ NÖVÉNYVÉDŐ SZER HATÓANYAGOK ÉS SZÁRMAZÉKAIK KÉMIAI OXIDÁLHATÓSÁGÁNAK VIZSGÁLATA I. S-ETIL-N,N-DI-N-PROPIL-TIOLKARBAMÁT
A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE
KARSZTFEJLŐDÉS XIX. Szombathely, 2014. pp. 137-146. A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE ANALYSIS OF HYDROMETEOROLIGYCAL DATA OF BÜKK WATER LEVEL
A controlling és az értékelemzés összekapcsolása, különös tekintettel a felsőoktatási és a gyakorlati alkalmazhatóságra
A controlling és az értékelemzés összekapcsolása, különös tekintettel a felsőoktatási és a gyakorlati alkalmazhatóságra Dr. Szóka Károly Nyugat-magyarországi Egyetem Közgazdaságtudományi Kar Egyetemi docens
Descriptive Statistics
Descriptive Statistics Petra Petrovics DESCRIPTIVE STATISTICS Definition: Descriptive statistics is concerned only with collecting and describing data Methods: - statistical tables and graphs - descriptive
N É H Á N Y A D A T A BUDAPESTI ÜGYVÉDEKRŐ L
K Ö Z L E M É N Y E K N É H Á N Y A D A T A BUDAPESTI ÜGYVÉDEKRŐ L DR. HEINZ ERVIN A népesedésstatisztika igen fontos mutatószámai a népesség kormegoszlására és annak változására vonatkozó adatok. Ezért
EEA, Eionet and Country visits. Bernt Röndell - SES
EEA, Eionet and Country visits Bernt Röndell - SES Európai Környezetvédelmi Ügynökség Küldetésünk Annak elősegítése, hogy az EU és a tagállamok a szükséges információk alapján hozhassák meg a környezet
Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI
Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance
Decision where Process Based OpRisk Management. made the difference. Norbert Kozma Head of Operational Risk Control. Erste Bank Hungary
Decision where Process Based OpRisk Management made the difference Norbert Kozma Head of Operational Risk Control Erste Bank Hungary About Erste Group 2010. 09. 30. 2 Erste Bank Hungary Erste Group entered
FÖLDRAJZ ANGOL NYELVEN
Földrajz angol nyelven középszint 1411 ÉRETTSÉGI VIZSGA 2015. május 14. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ EMBERI ERŐFORRÁSOK MINISZTÉRIUMA Paper
EN United in diversity EN A8-0206/482. Amendment
21.3.2019 A8-0206/482 482 Recital 13 g (new) (13g) In recognition of the need for specific treatment for the transport sector, in which movement is the very essence of the work undertaken by drivers, the
ó Ú ő ó ó ó ö ó ó ő ö ó ö ö ő ö ó ö ö ö ö ó ó ó ó ó ö ó ó ó ó Ú ö ö ó ó Ú ú ó ó ö ó Ű ő ó ó ó ő ó ó ó ó ö ó ó ó ö ő ö ó ó ó Ú ó ó ö ó ö ó ö ő ó ó ó ó Ú ö ö ő ő ó ó ö ö ó ö ó ó ó ö ö ő ö Ú ó ó ó ü ú ú ű
Bird species status and trends reporting format for the period 2008-2012 (Annex 2)
1. Species Information 1.1 Member State Hungary 1.2.2 Natura 2000 code A129 1.3 Species name Otis tarda 1.3.1 Sub-specific population 1.4 Alternative species name 1.5 Common name túzok 1.6 Season Breeding
Animal welfare, etológia és tartástechnológia
Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 654 EGYEDILEG ÉS KETTESÉVEL ELHELYEZETT SZOPTATÓ KOCÁK TERMELÉSI EREDMÉNYEINEK
EN United in diversity EN A8-0206/445. Amendment
21.3.2019 A8-0206/445 445 Title Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL amending Directive 2006/22/EC as regards enforcement requirements and laying down specific rules with
Eladni könnyedén? Oracle Sales Cloud. Horváth Tünde Principal Sales Consultant 2014. március 23.
Eladni könnyedén? Oracle Sales Cloud Horváth Tünde Principal Sales Consultant 2014. március 23. Oracle Confidential Internal/Restricted/Highly Restricted Safe Harbor Statement The following is intended
A KELET-BORSODI HELVÉTI BARNAKŐSZÉNTELEPEK TANI VIZSGÁLATA
A KELET-BORSODI HELVÉTI BARNAKŐSZÉNTELEPEK TANI VIZSGÁLATA SZÉNKŐZET JUHÁSZ ANDRÁS* (3 ábrával) Összefoglalás: A szénkőzettani vizsgálatok céljául elsősorban a barnakőszéntelepek várható kiterjedésének
NEUTRÍNÓ DETEKTOROK. A SzUPER -KAMIOKANDE példája
NEUTRÍNÓ DETEKTOROK A SzUPER -KAMIOKANDE példája Kamiokande = Kamioka bánya Nucleon Decay Experiment = nukleon bomlás kísérlet 1 TÉMAKÖRÖK A Szuper-Kamiokande mérőberendezés A Nap-neutrínó rejtély Legújabb
Professional competence, autonomy and their effects
ENIRDELM 2014, Vantaa Professional competence, autonomy and their effects Mária Szabó szabo.maria@ofi.hu www.of.hu The aim and the planned activities at this workshop Aim: To take a European survey on
Suppl. Materials. Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids. Germany
Suppl. Materials Polyhydroxyalkanoate (PHA) Granules Have no Phospholipids Stephanie Bresan 1, Anna Sznajder 1, Waldemar Hauf 2, Karl Forchhammer 2, Daniel Pfeiffer 3 and Dieter Jendrossek 1 1 Institute
TDA-TAR ÉS O-TDA FOLYADÉKÁRAMOK ELEGYÍTHETŐSÉGÉNEK VIZSGÁLATA STUDY OF THE MIXABILITY OF TDA-TAR AND O-TDA LIQUID STREAMS
Anyagmérnöki Tudományok, 37. kötet, 1. szám (2012), pp. 147 156. TDA-TAR ÉS O-TDA FOLYADÉKÁRAMOK ELEGYÍTHETŐSÉGÉNEK VIZSGÁLATA STUDY OF THE MIXABILITY OF TDA-TAR AND O-TDA LIQUID STREAMS HUTKAINÉ GÖNDÖR
UNIVERSITY OF PUBLIC SERVICE Doctoral School of Military Sciences. AUTHOR S SUMMARY (Thesis) Balázs Laufer
DOI azonosító: 10.17625/NKE.2013.021 UNIVERSITY OF PUBLIC SERVICE Doctoral School of Military Sciences AUTHOR S SUMMARY (Thesis) Balázs Laufer LAW ENFORCEMENT AND NATIONAL SECURITY CHALLENGES POSED BY
(A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5
Fig. S1. Brg1 ablation leads to abnormal villous structure in the duodenum in the perinatal period (A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5 (B, E), and P0.5