University of Pannonia Georgikon Faculty, Keszthely. Doctoral School of Crop Production and Horticultural Sciences

Átírás

1 University of Pannonia Georgikon Faculty, Keszthely Doctoral School of Crop Production and Horticultural Sciences Thesis of Doctoral (PhD) Dissertation Occurrence of grapevine viruses in Hungary and molecular studies of some Hungarian Grapevine leafroll- associated virus 1 and 3 isolates Written by Eszter Cseh MSc in Doctor of the Plant Health Leading Professors Dr. Richard Gáborjányi Doctor of the Hungarian Academy of Sciences Professor emeritus Dr. habil. András Péter Takács Associate professor Keszthely 2012

2 1. Preliminaries and aims of the research work However, in the past decades new viruses emerged, some of them were here all the time, maybe they were not detected, and some can get into the country with infected propagation material. In the past fifty years first pioneering studies have made by Dr. János Lehoczky and his co-workers in the Research Institute for Viticulture, in Kecskemét. Until now fifteen virus diseases have been reported in Hungary. The names and taxonomy of viruses basically altered, and the identification methods are also completely changed. To clear up the present situation the aim of study was to offer a brief survey on the occurrence of the grapevine viruses in Hungary. With considerable experience, several other diseases can be reliably diagnosed based on field symptoms. Recently, molecular tests have been developed that directly target the genetic material (genome) of plant pathogens. The most sensitive methods are molecular tests for pathogen detection. The common rapid method was among them the RT-PCR. Commercial PCR testing is currently available for many viral pathogens of grapevines, but it is an expensive and time consuming method, so it is suggested just in extreme cases only. Still no grapevine viruses have been characterized by molecular methods in Hungary. The potential for using such procedures for routine diagnosis of grapevine viruses and virus-like diseases offers new opportunity for understanding the disease complexes and possibility controlling the diseases. The first aim was classification and identification of grapevine viruses in Hungary on recent molecular base. Further aim of the present study was the examination of frequency of virus infection in thirty one Hungarian vineyards with serological tests. The fourth aim was to characterize one GLRaV-1 and three GLRaV-3 isolates from the earlier collected and serological positive samples by molecular ways. 2. Materials and methods 2.1. Plant material Grapevine leaf samples showing disease symptoms were collected from different 31 vineyards of the 17 wine grooving region of Hungary from to symptoms bearing grapevine stocks were selected and marked twice in the vegetation period, first at the flowering and then in the second half of September. 2

3 2.2.Transmission to herbaceous hosts The viruses from infected samples were mechanically transmitted to Chenopodium quinoa, Ch. amaranticolor, Nicotiana benthamiana, N. glutinosa, Cucumis sativus and Gomphrena globosa in greenhouse using 0,067 M phosphate buffer (ph 7,2) containing 3% polyethylene glycol Serological methods Until ELISA test leaf samples were store for some days on 4 o C in special plastic bags. Virus content was checked by DAS ELlSA method using antisera from Agritest S.r.l. (Italy) and Bioreba AG (Switzerland), Loewe Biochemica (Germany). Substrate absorbances were measured at 405 nm wavelengths on Labsystem Multiscan ELISA reader. Samples were considered positive if the absorbance values exceeded three times those of the healthy controls. The presence of viruses was checked for Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato black ring virus (TBRV), Grapevine chrome mosaic virus (GCMV), for Grapevine leafroll-associated virus 1-3, (GLRaV 1-3), Grapevine virus A (GVA), Alfalfa mosaic virus (AMV) and Grapevine fleck virus (GFkV) using different specific antisera Molecular methods Four GLRaV-3 and one GLRaV-1 isolates originated from different geographical areas: North-West, Middle-West, part of Hungary (Kıszeg, Badacsonytomaj, Cserszegtomaj) were chosen to molecular tests. Rt- PCR. Total RNA was extracted and purified from grapevine leaf tissues by SPEKTRUM Plant Total RNA Kit (Sigma-Aldrich Chemie GmbH, Germany). The primer pairs were designed based on the nucleic sequence of isolates GLRaV-3 NY1 (GenBank accession number AF037268) and GLRaV-1 according the sequence data of GenBank Acc. No. AF The specific primers: 1FHSP70 5 -CAGGGCTCGTTTGTACTGG-3, 1RHSP70 5 -TCGGACAGCGTTTAAGTT CC-3 and in the case of GLRaV-3: LC1F 5 - CGCTAGGGCTGTGGAAGTATT-3, LC2R 5 -GTTGTCCCGGGTACCAGATAT-3. An 540 and an 546 bp fragments encompass from the central part of HSP70 gene. The cdna 3

4 synthesis was carried out by reverse transcription by M-MuLV enzyme. PCR conditions in a PCR Applied Biosystems GeneAmp PCR System were as follows: denaturation 94 ºC/1 min, followed 40 cycles of 94 ºC/1 min and 15 s, 52 ºC/30 s and 72 ºC/1 min. The final elongation step was at 72 ºC/10 min. Aliquots of PCR products were run on 1.5% agarose gel. PCR products were gel-purified using Roche High Pure Purification Kit, cloned into pgem-t Easy (Promega) cloning vector and sequenced by BAY-GEN (Hungary). P h yl o genetic an al ys is. Phylogenetic studies were performed using alignments of the HSP70h genes in both cases from several virus isolates. Constructions of the evolutionary models were performed using the CLC Sequence viewer (CLC bio, Denmark). The phylogenetic trees were also obtained with CLC Sequence Viewer using UPGMA method and 1000 bootstrap iterations as a confidence test. In order to assess the relationship of the four Hungarian GLRaV-3 isolates and one Hungarian GLRaV-1 isolate, their HSP70h gene sequences were used in a phylogenetic analysis in which the HSP70h sequences of isolates from elsewhere in the world were included Investigation of Aristochia clematitis leaf samples In the autumn of 2009, some Aristolcohia clematitis plants were detected and collected in vineyard in Pécs showing yellow mosaic symptoms. Electron microscopy: The test was done in Eötvös Lóránd University of Sciences by dr. Bóka Károly. Small pieces (1-2 mm) of the main vein contained parenchyma tissues were excised in a drop of 2,5 % glutaraldehyde in 0,1 M buffer (ph 7,2) and fixed for 3 hours at room temperature. After thorough rinsing in buffer, the samples were postfixed in 1% osmium tetroxide, dehydrated in graded ethanol dilutions and embedded in DURCUPAN AMC medium. Thin sections were cut with diamond knife and were double stained with 1% uranyl acetate and lead citrate before examination with Hitachi 7100 TEM electron microscope. RT- PCR: To the molecular test primers were designed and used TSWV-S CCCTCGAGGCTTTCAAGCAAGTTCTGC G-3 és TSWV-S GCTCTAGAGCCATCATGTCTAAGGTTAAGCTCAC New scientific results Until now fifteen virus diseases have been reported from Hungary. In the present study the disease symptoms were separated into six groups, and the seventh contains the diseases 4

5 where the pathogen was not characterised properly. The grapevine infectious degeneration caused by different Nepoviruses, namely the Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV) and the Grapevine Bulgarian latent virus (GBLV). The Grapevine fleck virus (GFkV) represents a separated group of symptoms. The third type, the leafroll symptoms caused by the members of Grapevine leafroll associated viruses (GLRaV 1-9). The causal agent of the fourth group of symptoms, the grapevine yellow mottle, was the Alfalfa mosaic virus (AMV). The line pattern symptoms caused by the infection of Grapevine line pattern virus (GLPV). The rugose wood symptoms provoked by the Grapevine virus A (GVA), Grapevine virus B (GVB) and the Rupestris stem pitting associated virus (RSPaV). In the eighth group the virus diseases were collected, which still did not detected in Hungary, but their appearance is prospected in the near future. Among the 277 leaf samples collected gave positive results in 76 samples. Viruses occurred alone in 61 samples, while complex virus infection was detected in 14 samples. Sixteen proved to be infected by GLRaV-1, one by GLRaV-2, and sixteen by GLRaV- 3. GCMV were found in eight cases. ArMV caused but only in seven cases. GFLV occurred five times, TBRV occurred in five samples. GFkV (Grapevine fleck virus) occurred more frequently in the wine growing regions of Eger, Mátra and Tokaj, but it was also present in the Tolna and Balaton-felvidék regions. GLRaV1 (Grapevine leafroll -associated virus 1) and GLRaV3 (Grapevine leafrollassociated virus 3) were found in Badacsony and Balaton-felvidék regions. These viruses were frequent in the Northwest part of Hungary (wine region of Sopron) in the South and Southwest part of the country (wine regions Pécs, Villány and Kunság). Leaf samples infected with AMV (Alfalfa mosaic virus) were collected in the most cases in wine regions of Balaton-felvidék, Zala and Tokaj. ArMV (Arabis mosaic virus) and GCMV (Grapevine chrome mosaic virus) both of them belong to Nepovirus genus - were more frequent than the GFLV (Grapevine fanleaf virus) especially in Zala region. Only five samples originated from wine growing regions of Balatonboglár, Balaton-felvidék, Balatonfüred- Csopak and Szekszárd were positive to antisera of GFLV. The phylogenetic analysis of GLRaV-1 HSP70 gene is corresponded to the results of Kominek and his co-worker s (2005). According to their results this cluster can be separated into two groups, an E and an A. Our results suggest that Hungarian isolate from Badacsonytomaj (6.4.1) belonged to the group E (Fig. 1.). This isolate showed the highest 5

6 homology to the (AY ) isolate from Czech Republic. The E group holds the isolates (AY ), (AY ), (AY ), (AY ) from Czech Republic; and the (AY ) and (AY ) isolates from Slovakia. The group A includes the Iranian (FJ ), an Australian (AF ), an American (AF ) and five (AY ), (AY ), (AY ), (AY ) and (AY ) isolates from Czech Republic. Phylogenetic analysis showed that the GLRaV-1 Hungarian isolate belonged to the European E group. Fig. 1. Phylogenetic tree reconstructed from 500 nt long fragment of HSP70 gene from GLRaV-1 isolates Abbreviations: AY (Czech Republic), AY (Czech Republic) AY (Czech Republic), AY (Czech Republic), AY (Czech Republic), AY (Slovakia), AY (Slovakia), FJ (Iran), AF (USA), AY (Czech Republic), AY (Czech Republic), AY (Czech Republic), AY (Czech Republic), AY (Czech Republic), AF (Australia), Hungarian isolate: Fig. 2. represents the relationship of 500 bp fragments of HSP70 gene of GLRaV-3 from twenty five isolates from different countries, included four Hungarian ones. 6

7 Fig. 2. Phylogenetic tree of the genomic region HSP70 GLRaV-3 constructed by UPGMA method Abbreviations: ef (New-Zealand), aj (Israel), aj (Italy), aj (Austria), aj (China), dq (China), dq (USA), gq (South Africa), aj (Austria), aj (Syria), eu (Chile), af (USA), aj (Tunisia), dq (China), aj (Austria), gq (South Africa), eu (South Africa), aj (Syria), aj (Austria), aj (Italy), gq (South Africa), Hungarian isolates: 3.5, 2.2, 4.2 and 1.4 Only one virus isolate (ef508151) from New-Zealand belongs to the first group. The largest second group contained fifteen isolates as Asian isolates: one (aj748524) from Israel; two Chinese (aj748514) and (dq780887); and one (aj748517) from Syria. Other members of this group were from America (North and South part), two from USA (dq780891) and (af037268) and one (eu344893) from Chile. South Africa was represented by one isolate (gq352631). Some sequence data of GLRaV from Europe showed high homology with the second group, as one (aj748521) Italian; two Austrian (aj748512) and (aj748511); one Tunisian (aj748522) and three Hungarian (3.5 from Badacsonytomaj; 2.2 from Kıszeg and 7

8 4.2 from Cserszegtomaj). Only one isolate from China (dq780889) represented the third group. Six isolates, (aj748513) and (aj748510) from Austria; (gq352632) and (eu259806) from South Africa; (aj748516) from Syria and one Hungarian isolate 1.4 from Kıszeg formed the fourth numerous group showed the highest homogeneity to the South African isolates. The two members of the fifth group are from Italy (aj748519) and South Africa (gq352633). Hungarian isolates (2.2; 4.2) showed homology to the isolates of China (dq780887) and Chile (eu344893). It is noteworthy that the Hungarian (3.5); the Israeli (aj748524); the Italian (aj748521) and the Austrian (aj748512) isolates showed no sequence differences with each other. The phylogenetic trees showed that the four Hungarian isolates 2.2, 3.5 and 4.2 isolates could be inserted into the earlier classified five groups of foreign GLRaV-3 isolates, into the group Nr. 2., but the isolate 1.4 belonged to the group Nr. 4. The GLRaV isolate could be classified into the earlier created group E. These sequence data of Hungarian Grapevine leafroll-associated virus isolates have been registered in the Gene Bank, under accession numbers of HE794021, HE794022, HE794023, HE and HE In the autumn of 2009, some Aristolcohia clematitis plants were detected showing symptoms of the TSWV infection. The presence of TSWV was proved by electron microscope and RT-PCR. This is the first report on the occurrence of TSWV on Aristolochia in Hungary. 4.Theses 1. New classification of grapevine viruses, occurring in Hungarian vineyards, has been made according to the symptoms and recent molecular data. Grapevine viruses and virus like agents has been classified on the basis of most characteristic symptoms as 1) virus degeneration, 2) leaf roll, 3) fleck, 4) rugose wood, 5) yellow mottle, 6) line pattern, 7) virus like diseases (enation, vein necrosis and vein mosaic). 2. Among 277 samples, seventy- six gave positive results in the serological tests. Among the Nepovirus group four viruses could be detected, but the occurrence of Grapevine fanleaf virus, Arabis mosaic virus, Tomato black ring virus and Grapevine chrome mosaic virus were not so frequent, than it was thought earlier. The ratio of Grapevine leafroll- associated virus 8

9 1, -2 and -3 were similar, as in case of Nepoviruses. High infection rates of Grapevine fleck virus were detected. Complex infections have been found in fifteen samples. 3. One GLRaV-1 and three GLRaV-3 isolates from the earlier collected and serological positive samples were characterised by molecular methods. The molecular data were run in a phylogenetic analysis in which the HSP70h genes of a large number of isolates from elsewhere in the world were included. The phylogenetic trees showed that the four Hungarian isolates 2.2, 3.5 and the 4.2. isolates could be inserted into the earlier classified five groups of foreign GLRaV-3 isolates into the group Nr. 2., but the isolate 1.4 belonged to the group Nr. 4. The GLRaV-1 CSE isolate belonged to the earlier created group E. These sequence data of Hungarian grapevine virus isolates get into the Gene bank under accession numbers of HE794021, HE794022, HE794023, HE and HE On bases of electron microscopic and molecular studies leaf samples of Aristolochia clematitis L. found in vineyards, which proved to be infected with Tomato spotted wilt virus (TSWV). 5. Publications and lectures connected with the dissertations Publications in Hungarian language Cseh E., Lázár J., Takács A., Kazinczi G. és Gáborjányi R. (2008): A szılı Magyarországon elıforduló és várhatóan megjelenı vírusos betegségeinek és kórokozóinak áttekintése. Növényvédelem 44: Cseh E., Daragó Á., Takács A. P. és Gáborjányi R. (2011): Szılıvírusok gyakoriságának felmérése magyarországi szılıültetvényekben. Kertgazdaság 43 (1): Cseh E., Daragó Á., Takács A. P., Csöndes I., Gáborjányi R., Kocsis L., Kazinczi G. és Horváth J. (2011): Magyarországi borvidékek vírusfertızöttségének vizsgálata. Növényvédelem 47: Cseh E., Palkovics L., Apró M., Gáborjányi R. és Takács A. P. (2012): Hazai szılı levélsodródás virus 3 izolátumok (Grapevine leafroll-associated virus 3, GLRaV-3) molekuláris jellemzése. Növényvédelem. 48:

10 Lectures in Hungarian language Cseh E., Takács A., Lázár J., Kazinczi G. és Gáborjányi R. (2008): Áttekintés a szılıpatogén vírusok hazai elıfordulásáról. XVIII. Keszthelyi Növényvédelmi Fórum, Keszthely (Abstr.) Cseh E., Takács A., Kazinczi G. és Gáborjányi R. (2009): Szılıvírusok elıfordulása néhány dunántúli ültetvényben. 55. Növényvédelmi Tudományos Napok, Budapest. 73. (Abstr.) Cseh E., Daragó Á., Takács A. P. és Gáborjányi R. (2010): Szılıvírusok elıfordulásának felmérése a magyarországi szılıültetvényekben. 56. Növényvédelmi Tudományos Napok, Keszthely. 74. (Abstr.) Juhász K. Cseh E., Daragó Á., Kocsis L., Gáborjányi R. és Takács A. P. (2011): Virológiai vizsgálatok Zala megyei szılıültetvényekben. XXI. Keszthelyi Növényvédelmi Fórum, Keszthely. 81. (Abstr.) Cseh E., Apró M., Bese G., Krizbai L., Bóka K., Gáborjányi R. és Takács A. P. (2012): A Paradicsom bronzfoltosság vírus (Tomato spotted wilt virus, TSWV) magyarországi kimutatása farkasalma (Aristolochia clematitis) növényben. XXII. Keszthelyi Növényvédelmi Fórum Keszthely (Abstr.) Cseh E., Palkovics L., Apró M., Takács A. P. és Gáborjányi R. (2012): Magyarországról származó szılı levélsodródás vírus 3 izolátumok (Grapevine leafroll- associated virus 3, GLRaV-3) molekuláris vizsgálata. 58. Növényvédelmi Tudományos Napok, Budapest. 37. (Abstr.) Publications in foreign languages Cseh, E., Takács, A. P., Kocsis, L. and Gáborjányi, R. (2012): General properties of grapevine viruses occurring in Hungary. J. Central Eur. Agricult. 13 (1): Cseh, E., Apró, M, Bese, G., Krizbai L., Bóka K., Gáborjányi, R. and Takács, A. P. (2012): Tomato spotted wilt virus (TSWV) in Birthwort (Aristolochia clematitis L.) in Hungary. Acta Phytopathol. Et Entomol. Hung. 48: (in press) 10

11 Lectures in foreign languages Cseh, E., Lázár, J., Takács, A., Kazinczi, G. and Gáborjányi, R. (2008): Survey of soil-borne virus diseases of grapevine in Hungary. Proceedings of the VII. Alps-Adria Scientific Workshop, Cer. Res. Com. Suppl. 36: (Abstr.) Cseh, E., Daragó, Á., Szerecz, A., Takács A. and Gáborjányi, R. (2009): Apprise the significance of grapevine viruses in West Hungary. Proceedings of the VIII. Alps-Adria Scientific Workshop, Cer. Res. Com. Suppl (Abstr.) Cseh, E., Daragó, Á., Takács, A., Szerecz, A. Gáborjányi, R. and Horváth J. (2010): Emerging grapevine virus diseases in Hungary: accessing future threats. 28. International Horticultural Congress, Lisbon 269. (Abstr.) Cseh, E., Palkovics, L., Apró, M., Gáborjányi, R. and Takács, A. P. (2012): Occurrennce and evolutionary relationship of Grapevine leafroll associated virus 3 isolates in Hungary.Proceedings of Patholux 2012 Conference on Impact of Plant Pathogens on the Quality of Crops and Wine (Abstr.) Publications and lectures on other topics Cseh E., Kadlicskó S. és Kovács O. (2007): Növényvédelmi tapasztalatok egy nagyradai szılıültetvényben 2006-ban. Növényvédelem 43: Hatala Á., Cseh E., Daragó Á. és Takács A. (2009): A dohányt károsító vírusbetegségek. XIX. Keszthelyi Növényvédelmi Fórum, Keszthely (Abstr.) Daragó Á., Nagy P., Cseh E., Gáborjányi R., Nádasy M. és Takács A. (2010): Vírusvektor fonálférgek kimutatásának módszertani különbségei. XX. Keszthelyi Növényvédelmi Fórum, Keszthely (Abstr.) Daragó, Á., Nagy, P., Cseh, E., Gáborjányi, R., Takács, A., Nádasy, M. and Répási, V. (2010): Studies on grapevine-virus-nematode associations in Hungary. 28. International Horticultural Congress, Lisbon (Abstr.) Apró M., Cseh E., Daragó Á., Papp M., Gáborjányi R., Horváth J. és Takács A. P. (2011): Búzaminták vírusfertızöttsége Dél- Magyarországon 2010-ben. XXI. Keszthelyi Növényvédelmi Fórum, Keszthely. 13. (Abstr.) 11

12 Harun, M. M., Cseh, E., Horváth, J., Gáborjányi, R., Fári M. and Takács A. (2011): Symptomatology and characterization of viruses in Heirloom tomato varieties as a potential source of resistance. XXI. Keszthelyi Növényvédelmi Fórum, Keszthely 165. (Abstr.) Daragó Á., Nagy P., Cseh E., Gáborjányi R., Takács A. P. és Répási V. (2011): Vírusvektor fonálférgek elıfordulása Magyarország szılıültetvényeiben. Növényvédelmi Tudományos Napok, Budapest. 9. (Abstr.) Harun, M. M., Cseh, E., Apró, M., Horváth, J., Gáborjányi, R., Fári, M. and Takács, A. (2011): Characterization of virus susceptibility of heirloom tomato varieties. IWGLVV Conference, Antequera (Abstr.) Daragó Á., Cseh E., Nagy P., Takács A. P., Répási V. és Gáborjányi R. (2011): A tőfonálférgek (Xiphinema spp.) elıfordulása egyes hazai szılıültetvényekben. Növényvédelem 47: Kazinczi G., Horváth J., Takács A., Gáborjányi R. és Cseh E. (2011): Vírusok alternatív gazdája: Ürömlevelő parlagfő (Ambrosia artemisiifolia L.). Növényvédelem 47: Cseh E. (2012): Magyarországon elıforduló macskagyökér fajok jellemzése, valamint termesztésük és felhasználásuk lehetıségei. Növénytermelés 61 (3):