Magyari E. K., Bálint M., Parducci L., Major Á., Nédli J., Rácz I

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Magyari E. K., Bálint M., Parducci L., Major Á., Nédli J., Rácz I. 2011.03.28. 1"

Átírás

1 İSI DNS ÉS POPULÁCIÓTÖRTÉNET: 11 ezer év demográfiai változásinak negatív hatása a lucfenyı (Picea abies) genetikai variabilitására egy kárpáti refúgium-területen Magyari E. K., Bálint M., Parducci L., Major Á., Nédli J., Rácz I

2 MOTIVÁCIÓ 2005: Molekuláris Taxonómiai Labor nyílik az MTM-ben Potenciális hasznosítás lehetıségei fosszilis témában? tavi üledékbe zárt fosszilis pollenek és makrofosszíliák

3 İSI DNS KUTATÁSOK rövid történeti áttekintés I. Özönvíz elıtti DNS Fosszilis, erısen fragmentálódott DNS szálak, melyek sokszor posztmortem bázis-transzformáción esnek át Higutchi et al. 1984: 150 éves múzeumi kvaggából sikeresen vontak ki és amplifikáltakısi DNS-t (Fokföldön 1800-as években kipusztult zebra alfaj) Hihetetlen korúısi DNS maradványok ( özönvíz elıtti DNS ): 100 millió évesnél is idısebb fosszíliák látszólagosan sikeres DNS analízise: pl. oligocén és kréta borostyánban talált rovarok, növényi maradványok ( ), miocén Magnolia fosszíliák ( ), 80 millió éves dinoszaurusz csont (1994), kréta korú dínó-tojás (1995) Egyiket sem sikerült reprodukálni, a 2000-es évek kutatásai szerint a DNS megtartás maximálisan néhány százezer éves idıtartományban lehetséges

4 İSI DNS KUTATÁSOK rövid történeti áttekintés II. Özönvíz utáni DNS a 2000-es évek Az ısi DNS vizsgálatok kettéágazó vizsgálati célja: 1. Populációgenetikai kérdések vizsgálata: pl. hogyan hat az elterjedési terület fluktuációja a genetikai diverzitásra, fajképzıdés, evolúció 2. Az egykoron élt fajspektrum kiderítése, diverzitás változás vizsgálata, ısi DNS használata fajmeghatározásra (metagenomika) Barlangi medve - mitokondriális genom hosszú szakaszai ismertek, barnamedvétıl 1.5 millió éve vált el, többszöri géndiverzitás csökkenés az utolsó glaciálisban Gyapjas mamut - teljes mitokondriális genom hajszálból, rövidebb mtdns szaksazok vizsgálata több faj együttes jelenlétét bizonyították az utolsó glaciálisban, 2011: japán kutatók Oroszországban tárolt mamut tetem sejtmagjait akarják elefánt petesejtbe ültetni: Jurasic Park helyett Pleistocene Park 4000 éves grönlandi ember - 3 billió bázispár hajból 2010-ben, mai szibériaiakkal rokonítható Neandervölgyi ember 4 billió bázispárt közöltek 2010-ben, 99,7%-os egyezés a modern emberrel, elválsái idı: ezr év, keveredhetett a modern emberrel Barlangi medve Gyapjas mamut Grönlandi emeber Neandervölgyi emeber

5 Taylor at al. (2010) Missing saiga on the taiga; Campos et al. (2010) Ancient DNA sequences point to a large loss of mitochondrial genetic diversity in the saiga antelope (Saiga tatarica) since the Pleistocene Szaiga antilop ısi DNS vizsgálat modern DNS vizsgálattal párhuzamosan - kihalás szélén álló fajról van szó, környezeti változásokra érzékenyen reagál, de kedvezı feltételek esetén gyorsan szaporodik és mobilis, kedvezıtlen környezetben viszont tömegesen pusztul - genetikia vizsgálat eredménye: hirtelen populációméret csökkenés 2000 és éve, elıbbit valószínőleg emberi hatásra utóbbit klimatikus hatásra bekövetkezı élıhely beszőkülés okozta. + dokumentált tömeges pusztulások betegség, téli nagy hóborítás hatására: 1971, 1987, az ısi DNS vizsgálat konzervációbiológiai jelentısége: ez a faj drámai populációméret csökkenéseket képes túlélni köszönhetıen a botlleneck utáni gyors szaporodásának, következésképpen védelmét leginkább az szolgálná ha a terjedését segítenék elı és nem a hirtelen elhalálozásokat próbálnák megakadályozni (élıhely összekötı folyosók létrehozása)

6 İSI NÖVÉNYI DNS VIZSGÁLATOK -KIS SZÁMÚ VIZSGÁLAT elsısorban metagenomika: milyen fajok voltak jelen? + Archeobotanika (pl. fıbb gabonák, szılı, kukorica)

7 VIZSGÁLT NÖVÉNYFAJ - LUCFENYİ (PICEA ABIES) Miért a lucfenyıt választottuk? 1) Európai populációnak genetikai mintázata részletesen tanulmányozott (kloroplaszt, mitokondriális és nukleáris régiók) 2) Az utolsó eljegesedés során fontos erdıalkotó a Kárpát-medencében, bizonyos helyeken feltételezhetı a folyamatos jelenléte (pl. hegyvidéken) 3) Fosszíliáinak elıkerülése várható glaciális és holocén tavi üledékekben 4) Pollenje nagy mérető ( mikron), relatíve könnyen izolálható az üledékbıl

8 Tollefsrud et al. (2008) A LUCFENYİ GENETIKAI CSOPORTJAI ÉS EZEK ALAPJÁN FELTÉTELEZETT POSZTGLACIÁLIS TERJEDÉSI ÚTVONALAK Mikor történt ez az elválás? Ezek a populációk nem terjedtek északra a holocén felmelegedés során, csak magassági övek közt mozogtak A PCA alapú lucfenyı genetikai csoportok földrajzi eloszlása, és a genetikai csoportok kapcsolata minimum-evolúciósfák alapján. 8 Retyezát-hegység Full glacial (LGM) distribution of Picea abies in the Carpathian Basin

9 Eemian interglacial (ca years BP) disribution of Picea abies in Central-Southern Europe. Taken from Ravazzi ( 2002) Maximum spruce expansion (Picea abies+picea omoricoides) during the early Weichselian ( kyr BP) Maximum expansion of Picea abies in southern Europe during middle pleniglacial interstadials (55 35 kyr cal BP) A LUCFENYİ ELTERJEDÉSI TERÜLETÉNEK VÁLTOZÁSAI AZ ELMÚLT 120,000 ÉVBEN EURÓPÁBAN Tentative range map of Picea abies in central and southern Europe during the LGM ( kyr cal BP). Ravazzi (2002) Lucfenyı (Picea abies) área

10 MOTIVÁCIÓ Ravazzi 2002 The time window used by most researchers (the postglacial) to evaluate the influence of historical events on genetic structure of European tree populations seems too short compared to the amount of genetic variability that was probably not eliminated by the restriction of populations during the LGM. This is especially important in the case of spruce, which was not reduced to a confined refugium but survived in large regions in southern Europe. Hope is now placed in fossil DNA extraction and identification, because this will allow a real integration of paleobotanical and molecular methods.

11 CÉLKITŐZÉSEK?? Az ısi és modern lucfenyı populáció DNS vizsgálata révén annak felderítése, hogy a késıglaciális és holocén idıszak (elmúlt ~ év) klímaváltozásai és az emberi tevékenység (erdıirtás) hogyan hatottak a fafaj genetikai összetételére a Déli-Kárpátokban, mely terület ma számos área-specifikus allélt hordoz közepes genetikai diverzitás mellett. A faj túlélése szempontjából kulcsfontosságú-e ezen área-specifikus allélek védelme? Hosszútávú cél: a paleobotanikai leletek alapján feltételezhetı DNY-ÉK irányú glaciális összeköttetés bizonyítása lucfenyı fosszíliák DNS vizsgálatával

12 KUTATÁSI TERÜLET - TAUL DINTRE BRAZI, RETYEZÁT-HG. T.sz.f.m. : 1740 m Terület : 0,5 ha Vízmélység: 80 cm ph: 5,7 Növényzet : Pinus mugo úszóláp, Rhododendron myrthillus, Sphagnum sp., Picea abies, Pinus cembra Fúrásmag: 5 m

13 A RETYEZÁT

14 MÓDSZER ÉS MUNKAFOLYAMAT Arche DNA lab Arche DNA lab A DNS laborban lucfenyıvel korábban nem dolgoztak A recens lucfenyı anyag elemzése a fosszilist követte (szennyezés elkerülése érdekében) A DNS ısiségének bizonyítása: minta kontroll, reagens kontroll, PCR reakciók és szekvenálás ismétlése külföldi laborban (Uppsala University) A pollen minták fagyasztást követıen közvetlen a PCR reakciók elıtt lettek összetörve (5 pollen egy PCR csıben)

15 Minták: 10 fosszilis lucfenyı mag 4 fosszilis tobozpikkely MÓDSZEREK PCR & SZEKVENÁLÁS 462 fosszilis lucfenyı pollen 58 modern lucfenyı tőlevél PCR mixes: 5 ul of the template solution), 1x reaction buffer, 1.5 mm MgCl2, 0.1 mm dntp (each), pmmole F and R primer, and 0.4 U of AmpliTaq Gold polymerase. PCR produktum tesztelése agaróz gélen ráamplifikálás szekvenálás Marker választás: pszeudo-gének, mikroszatelliták, intergénikus spacer-ek és intronok (rövid bázispáros szakaszok. ndhcp-ndhkp ndhk-for1 CACTTCAGTTCTTGTTGTTCC pseudogenes ndhc_ndhk-rev TCGCCACAGAACCAACGATG psbm-trnd psbm_trnd-f1 GTTCGAGTAACGGAATCTAAC intergene spacer psbm_trnd-rev1 CGAACGTCTTCTGGAGTAGC B: (ORF46b) B-for GCTTATGGCATTGTTGATGT B-rev TGGGCATTCTAGCTGTATTG D: Pt15169 D-for CTTGGATGGAATAGCAGCC D-rev GGAAGCGCATTAAGGTCATTA trnt-trnl trnt_trnl-sp-f1 CTGAGCTAAGCAGGCTCAATGG intergene spacer trnt_trnl-sp-brev GCATGTTATTATCCTCCCCTAG trnl-intron trnl-intron-f2 GAACGCTCTATTTACACC trnl-intron-rev ACACGTAGAATTGGACTCTATC trnl-trnf Aa_trnLF-for GGTTCAAGTCCCTCTATCCC intergene Aa_trnLF-rev ACTGATCAACTCAACTTGTCATAAG intron trnk2i-r1 CATGAGTCAGGAGAGCGATTGG 136 bp 200 bp bp PCR profile: 10 min at 94 ºC, 45 cycles of 20 sec at 94 ºC, 30 sec at 237 bp 55 ºC, 1 min at 72 ºC, final elongation 7 min at 72 ºC, with 10 spacer ATGG 186 bp ºC as end-temperature. matk-trnk trnk2i-f1 GCCCTCGTTCATGAGAATAACC bp 251 bp 197 bp

16 EREDMÉNYEK 58 modern szekvencia ~ 1550 bázispár össz-hossz + 2 Sweden 28 fosszilis pollen szekvencia bázispár hosszúak (összesen 462 próbálkozás) 22 fosszilis mag és tobozpikkely szekvencia, bázispár hosszúak

17 Recent haplotypes: 9 Region (position): Position (total): B(88) M CK B( ) D(77) 629 D( D(82) 634 TL(168) 834 TL(196) 872 TL(197) 873 TL(206) 882 Li(154) 1081 Li(157) 1084 LF(115) 1279 LF(133) 1297 K2i(134) 1464 Length (bp) MUTÁCIÓS POZÍCIÓK B11?? C 12A+5G A A C G T C G T C T T C 1551 Buk9?? C 11A+6G A A C G T C G T C A T C 1551 CP2?? C 11A+6G C A C G T C G T C A T C 1551 Gtk24?? C 10A+6G A A C G T C G T A A T T 1550 KR8-2?? C 13A+5G A A C G T C G T C A T C 1552 P9?? C 12A+5G C A C G T C G T C A T C 1551 St15?? C 10A+6G A A C G T C G T C A T C 1550 Z7?? C 12A+5G A A C G T C G T C A T C 1551 H12?? T 12A+4G+3A+G A C T G T A G C C A G C 1554 Arche cone: cone? C A C G T C G A T C 901 Arche seeds: seed3 A A C 124 seed4 T A 237 seed8? C A C G T C G 575 seed9? C 10A+7G G T C G A T C 990 seed10? A A C G T A G T C C 1016 Arche pollen grains: a-b-p1 C 10A+6G 212 a-d-p2 C A C 124 a-d-p3 C A C 124 a-tl-p4 G T C G 251 a-tl-p5 G T C G 251 a-tl-p6 G T C G 251 a-tl-p7 G T C G 251 a-tl-p8 G T C G 251 a-tl-p9 G T C G 251 a-tl-p10 G T C G 251 a-tl-p11 G T C G 251 a-tl-p12 G T A G 251 a-tl-p13 A G A A 251 a-ck-p14? 136 a-ck-p15? 136 a-m-p16? 200 a-m-p17? 200 Két fosszilis szekvencia kizárólag a fosszilis anyagban fordult elı A mai populáció gyakori és a ritka alléljei egyaránt elıkerültek a fosszilis mintákból, és érdekes jelenség, hogy a mai ritka allélek a fosszilis mintákban gyakoribbak voltak 13 pont mutációt észleltünk 5 in/del polimofizmust

18 A İSI DNS SZEKVENIÁK AUTENTIKUSSÁGÁT TÁMOGATÓ EREDMÉNYEK A reagens és minta kontrollok nem amplifikáltak DNS-t Az agaróz gélen tiszta és egyértelmő csíkok Olyan haplotipusok voltak jelen az ısi anyagban amik ma hiányoznak a területrıl A vizsgálatok replikálhatóak voltak egy független külföldi laborban

19 Alapstatisztikák: polimorfizmus, populációk differenciáltsága és génáramlás mérése az ısi és recens populációk közt No. haplotype s Haplotype diversity (Hd) Nucleotide diversity (π) Average no. differences (k) Fst Ks Kst B Ancient Recent ** D Ancient Recent ** TL Ancient Recent * Li Ancient Recent ** LF Ki Ancient Recent Ancient Recent A koraholocén populáció genetikai diverzitása magasabb volt mint a ma élı populációé ns ns ** - significant at p < 0.01 * - significant at p < 0.05 ns not significant

20 MAXIMUM PARSZIMÓNIA FÁK A KLOROPLASZT DNS SZEKVENCIÁK ALAPJÁN İsi DNS szekvenciák

21 A LUCFENYİ KÉSİGLACIÁLIS ÉS KORAHOLOCÉN POLLEN AKKUMULÁCIÓS RÁTÁJÁNAK (PAR) IDİBELI VÁLTOZÁSA A BRAZI-TÓ ÜLEDÉKSZELVÉNYÉBEN Picea abies PAR (grains cm-2 yr-1) Age (kyr cal yr BP) PAR zones positions Az ısi DNS of the minták adna pozíciója samples Populáció méret csökkenés A piros szaggatott vonal a PAR 3-tagú mozgó átlagát mutatja

22 A LUCFENYİ KÉSİGLACIÁLIS ÉS KORAHOLOCÉN POPULÁCIÓDINAMIKÁJA POLLEN, SZTÓMA ÉS MAKROFOSSZÍLIA ANALÍZIS ALAPJÁN Depth cm Picea abies (stomata) Timescale (cal yr BP) Picea abies (periderm) Picea abies (leaves) Picea abies (bud scale) Picea abies (pollen) Relative frequency (%) Concentration (number of remains per 10 cm 3 ) Sum Trees Sum Shrubs Concentration (number of remains on slide) First accurrance of Picea abies on lakeshore Sum Herbs TDB-1 (1770 m) Age cal yr BP Depth cm Picea abies Corylus Early Holocene warming 11,700-10, cal yr BP rapid increase in woody 400 cover, dense Larix forest around the lake Younger Dryas cooling 12,900-11, cal yr BP regional expanison of Artemisia and Chenopodiaceae; decreasing tree cover on the lakeshore, but Picea abies survives Bolling/Allerod warming 14,450-12,900 cal yr BP; establishment of Pinus mugo,larix decidua, Pinus cembra and Picea abies on the lakeshore Carpinus betulus Fagus Oldest Dryas cold phase > 14,450 cal yr BP lakeshore treless, 600 steppe tundra and alpine herbs (Soldanella, Primula) A lucefnyı 13,900 évvel ezelıtt telepedett meg a Brazi-tó partján, a késıglaciálisban majdnem folyamatos a jelenléte, a Fiatal Driász lehőlési fázis egy rövid szakaszán fosszíliái hiányoznak a térségben ekkor is jelen van, de a tó partjáról visszahúzódik Taul Zanogutii (1900 m) Picea 600 Holocén pollenszelvények a Brazitóból és a Zenóga-tóból. Arra utalnak, hogy a lucfenyı a Farcas hegységben et al az elmúlt évben gyakori volt, de kiterjedése jelentısen fluktuált

23 A RETYEZÁT-HEGYS HEGYSÉG ÉS A KÖRNYEZ RNYEZİ TERÜLETEK TÁJHASZN JHASZNÁLATI TÉRK RKÉPE A lucfenyvesek korlátozott kiterjedést érnek csak el a Retyezáthegységben, az északi oldalon nagyobb az állomány A hegyi rétek és legelık kiterjedés nagy a déli oldalon, erdıirtás? Forrás: Grodzinska et al. 2004

24 A Lolaia gleccser maximális kiterjedése 16 ezer éve A lucfenyı hipotetikus refúgiumai a gleccserek maximális kiterjedése idején Reuther et al Reuther et al Taul dinte Brazi (1740 m) A lucfenyı koraholocén expanziójának iránya A genetikai, pollen EREDMÉNYEK- akkumulációs fosszilis pollen, KONKLÚZIÓK ráták sztóma 3 és makrofosszília drasztikus Adataink arra populációméret utalnak, adatok együttesen hogy csökkenést a koraholocén, hogy még az elmúlt a terjedıben lucfenyı a lévı hegységben, évben lucfenyı arra utalnak, rögzítettek valószínőleg (bottleneck). populáció genetikai Ezek alacsonyabb nagy diverzitása tszf magasságokban nagyobb volt mint élte a túl hegységben az utolsó valószínőséggel hozzájárultak a ma élı eljegesedés populációé, maximumát, és a koraholocén a késıglaciális lucfenyı populáció több mára expanzió genetikai kihalt allélt ezekbıl variabilitásának is hordozott. a lokális populációkból csökkenéséhez, indult és elképzelhetı meg. hogy több ısi alléltípus is áldozatául esett a hirtelen állománycsökkenésnek, melyek közül a legerısebb a középkorra tehetı (antropogén erdıirtások sorozata).

25 KONZERVÁCIÓ-BIOLÓGIAI KÖVETKEZTETÉSEK A Kárpátokban a hegység szabdalt morfológiájának következtében, kis területen változatos génállományú fapopulációk élnek (a fenyıfajok esetében a populációk genetikai differenciáltsága is jóval nagyobb itt mint az Alpokban!!!) Ezt a különösen gazdag génállományt fokozottan védeni kell a jövı érdekében! İsi és modern DNS adataink a pollen alapú demográfiai rekonstrukcióval kiegészítve arra utaltak, hogy az erdıirtások MÁR CSÖKKENTETTÉK A LUCFENYİ GENETIKAI DIVERZITÁSÁT A RETYEZÁT- HEGYSÉGBEN, ami a faj alkalmazkodóképességének a csökkenését is maga után vonhatja. Fontos tehát a meglévı állományok fokozott védelme, a természetes terjedés elısegítése a déli oldalon a legeltetés korlátozásával. KORAHOLOCÉN (11000 ÉVE) MAI ÁLLAPOT

26 KÖSZÖNÖM M A FIGYELMET! Támogatóink: European Commission (MERG-CT Combining palaeoecology and palaeogenetics ), OTKA PD73234

LATE QUATERNARY QUNATITATIVE ENVIRONMENTAL AND CLIMATE RECONSTRUCTIONS IN THE SOUTH CARPATHIANS

LATE QUATERNARY QUNATITATIVE ENVIRONMENTAL AND CLIMATE RECONSTRUCTIONS IN THE SOUTH CARPATHIANS LATEQUATERNARYQUNATITATIVEENVIRONMENTALAND CLIMATERECONSTRUCTIONSINTHESOUTHCARPATHIANS PROLONGPROJEKT Eladóülésazslénytaniszakosztályszervezésében,DebrecenMTAATOMKI,2014.január6.10óra SeminarofHungarianPaleontologicalSociety,DebrecenMTAATOMKI,6thJanuary2014,10am

Részletesebben

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

POLLENEKBE ZÁRT Z. Dr. Magyari Enikő Paleontológiai Kutatócsoport

POLLENEKBE ZÁRT Z. Dr. Magyari Enikő Paleontológiai Kutatócsoport POLLENEKBE ZÁRT Z KLÍMAV MAVÁLTOZÁS: HIDEG-MELEG A JÉGKORSZAKBANJ Dr. Magyari Enikő MTA-MTM MTM-ELTE Paleontológiai Kutatócsoport Mi a pollen analízis és hogyan kapcsolódik a radiokarbon kormeghatározáshoz?

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

KE SO NEGYEDKORI KVANTITATI V KO RNYEZETI E S KLI MAREKONSTRUKCIO K

KE SO NEGYEDKORI KVANTITATI V KO RNYEZETI E S KLI MAREKONSTRUKCIO K LATE QUATERNARY QUNATITATIVE ENVIRONMENTAL AND CLIMATE RECONSTRUCTIONS IN THE SOUTH CARPATHIANS KE SO NEGYEDKORI KVANTITATI V KO RNYEZETI E S KLI MAREKONSTRUKCIO K A DE LI KA RPA TOKBAN PROLONG PROJEKT

Részletesebben

A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE

A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE KARSZTFEJLŐDÉS XIX. Szombathely, 2014. pp. 137-146. A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE ANALYSIS OF HYDROMETEOROLIGYCAL DATA OF BÜKK WATER LEVEL

Részletesebben

A genetikai sodródás

A genetikai sodródás A genetikai sodródás irányított, nem véletlenszerű Mindig a jobb nyer! természetes szelekció POPULÁCIÓ evolúció POPULÁCIÓ A kulcsszó: változékonyság a populáción belül POPULÁCIÓ nem irányított, véletlenszerű

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,

Részletesebben

dc_1016_15 MTA doktori értekezés tézisei Magyari Enikő

dc_1016_15 MTA doktori értekezés tézisei Magyari Enikő A Kárpát-medence és DK-Európa késő pleniglaciális és holocén vegetációfejlődése különös tekintettel a gyors felmelegedési és lehűlési hullámokra mutatott vegetációs válaszokra MTA doktori értekezés tézisei

Részletesebben

Cím: Éghajlattani tanszék honlapja oktatók Deák József Áron 3db link

Cím: Éghajlattani tanszék honlapja oktatók Deák József Áron 3db link Biogeográfia GY 02 07 Deák József Áron Követelmények: Órákon kötelezı megjelenés, max 2 DB hiányzás. Túllépése esetén, hiányzásonként -5p (100p-ból) 3db ZH lesz. Egy kivételével nem a gyak idıpontjában.

Részletesebben

Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai probléma vizsgálata genetikai módszerekkel

Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai probléma vizsgálata genetikai módszerekkel Földtan, őslénytan, flóra, fauna, természetvédelem www.mecsek.gportal.hu 2013.07.01. Szerkesztő: Fazekas Imre E-mail: fazekas.hu@gmail.com Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai

Részletesebben

Új temékek az UD-GenoMed Kft. kínálatában!

Új temékek az UD-GenoMed Kft. kínálatában! Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai

Részletesebben

A magyarok genetikai vizsgálata. Dr. Pamzsav Horolma (ISZKI)

A magyarok genetikai vizsgálata. Dr. Pamzsav Horolma (ISZKI) A magyarok genetikai vizsgálata Dr. Pamzsav Horolma (ISZKI) BEVEZETÉS Kérdés? DNS szerkezet Genetikai örökség Sejt és szervecskéi KROMOSZÓMA KÉSZLET Kariotípus: 23 pár kromoszóma 50 Mb GENOM GENOM = DNS

Részletesebben

AZ ERDÕ NÖVEKEDÉSÉNEK VIZSGÁLATA TÉRINFORMATIKAI ÉS FOTOGRAMMETRIAI MÓDSZEREKKEL KARSZTOS MINTATERÜLETEN

AZ ERDÕ NÖVEKEDÉSÉNEK VIZSGÁLATA TÉRINFORMATIKAI ÉS FOTOGRAMMETRIAI MÓDSZEREKKEL KARSZTOS MINTATERÜLETEN Tájökológiai Lapok 5 (2): 287 293. (2007) 287 AZ ERDÕ NÖVEKEDÉSÉNEK VIZSGÁLATA TÉRINFORMATIKAI ÉS FOTOGRAMMETRIAI MÓDSZEREKKEL KARSZTOS MINTATERÜLETEN ZBORAY Zoltán Honvédelmi Minisztérium Térképészeti

Részletesebben

EGÉSZSÉGTUDOMÁNY, LVII. ÉVFOLYAM, 2013. 4. SZÁM 2013/4

EGÉSZSÉGTUDOMÁNY, LVII. ÉVFOLYAM, 2013. 4. SZÁM 2013/4 Part II: Seasonal variations in human infections with Puumula hantavirus in Styria II. rész: Évszakos változások a Puumula hantavirus okozta humán fertőzésekben Stájerországban PROF. SIXL WOLF DIETER,

Részletesebben

Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 5 Issue 4 Különszám Gödöllı 2009 459 MORFOLÓGIAI ÉS GENETIKAI VIZSGÁLATOK MAGYARORSZÁGI TÖRPEHARCSÁKON

Részletesebben

A Leuce szekcióba tartozó hazai nyárak dunántúli természetes eredetű állományainak populációgenetikai vizsgálata

A Leuce szekcióba tartozó hazai nyárak dunántúli természetes eredetű állományainak populációgenetikai vizsgálata Nyugat-magyarországi Egyetem Erdőmérnöki Kar Doktori (PhD) értekezés tézisei A Leuce szekcióba tartozó hazai nyárak dunántúli természetes eredetű állományainak populációgenetikai vizsgálata Benke Attila

Részletesebben

Filogenetikai analízis. Törzsfák szerkesztése

Filogenetikai analízis. Törzsfák szerkesztése Filogenetikai analízis Törzsfák szerkesztése Neighbor joining (szomszéd összevonó) módszer A fában egymás mellé kerülı objektumok kiválasztása a távolságmátrix értékei és az objektumoknak az összes többivel

Részletesebben

A munkaerı-piaci helyzet alakulása a Nemzeti Foglalkoztatási Szolgálat legfrissebb adatai alapján 2012. július

A munkaerı-piaci helyzet alakulása a Nemzeti Foglalkoztatási Szolgálat legfrissebb adatai alapján 2012. július A munkaerı-piaci helyzet alakulása a Nemzeti Foglalkoztatási Szolgálat legfrissebb adatai alapján 2012. július A foglalkoztatók az illetékes kirendeltségeken 2012. július hónap folyamán összesen 37,9 ezer

Részletesebben

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45

Részletesebben

First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.

First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25. First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this

Részletesebben

A földtörténet évmilliárdjai nyomában 2010.11.22. FÖLDRAJZ 1 I. Ősidő (Archaikum): 4600-2600 millió évvel ezelőtt A földfelszín alakulása: Földkéreg Ősóceán Őslégkör kialakulása. A hőmérséklet csökkenésével

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

A munkaerı-piaci helyzet alakulása a Nemzeti Foglalkoztatási Szolgálat legfrissebb adatai alapján 2013. január

A munkaerı-piaci helyzet alakulása a Nemzeti Foglalkoztatási Szolgálat legfrissebb adatai alapján 2013. január A munkaerı-piaci helyzet alakulása a Nemzeti Foglalkoztatási Szolgálat legfrissebb adatai alapján 2013. január A támogatott munkaerıigények domináltak januárban Az év elsı hónapjában több mint három ezer

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

ZÁRÓJELENTÉS. című OTKA pályázathoz. A cirbolyafenyő populációi Európában mindenütt védettek!

ZÁRÓJELENTÉS. című OTKA pályázathoz. A cirbolyafenyő populációi Európában mindenütt védettek! ZÁRÓJELENTÉS a Genetikai diverzitás vizsgálatok őshonos Pinus cembra L. populációknál. Populációökológiai, populáció-genetikai, erdészeti-, táj-, és vegetációtörténeti vonatkozások. című OTKA pályázathoz

Részletesebben

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi

Részletesebben

MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN

MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN Molnár Tamás 1, Lanszki József 1, Magyary István 1, Jeney Zsigmond 2, Lehoczky István 2 1 Kaposvári Egyetem Állattudományi Kar,

Részletesebben

A klímaváltozás hatása a tartószerkezetekre és az építési szabványokra

A klímaváltozás hatása a tartószerkezetekre és az építési szabványokra A klímaváltozás hatása a tartószerkezetekre és az építési szabványokra Rózsás Árpád, Kovács Nauzika Ph.D., Vigh László Gergely Ph.D. Problémafelvetés, motiváció Épületek, civil infrastruktúra ~ 80% nemzeti

Részletesebben

Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben

Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben * BUDAPESTI EÖTVÖS LORÁND * TUDOMÁNYEGYETEM Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben DOKTORI ÉRTEKEZÉS TÉZISEI Készítette: Egyed

Részletesebben

AZ ORSZÁGOS ERDÔREZERVÁTUM-

AZ ORSZÁGOS ERDÔREZERVÁTUM- AZ ORSZÁGOS ERDÔREZERVÁTUM- HÁLÓZAT BEMUTATÁSA AZ ORSZÁGOS ERDÔÁLLOMÁNY- ADATTÁR ALAPJÁN PRESENTATION OF THE FOREST RESERVES NETWORK HUNGARY BASED ON THE HUNGARIAN FOREST RESOURCE DATABASE Bartha Dénes,

Részletesebben

Fehérnyárak vizsgálata Tompa város központi közparkjában

Fehérnyárak vizsgálata Tompa város központi közparkjában Szakvélemény Fehérnyárak vizsgálata Tompa város központi közparkjában Készült Tompa Város Polgármesteri Hivatal megbízásából 2009. június Készült 2 eredeti példányban. Ez a számú példány. Tartalom 1. Elızmények

Részletesebben

A JUHTARTÁS HELYE ÉS SZEREPE A KÖRNYEZETBARÁT ÁLLATTARTÁSBAN ÉSZAK-MAGYARORSZÁGON

A JUHTARTÁS HELYE ÉS SZEREPE A KÖRNYEZETBARÁT ÁLLATTARTÁSBAN ÉSZAK-MAGYARORSZÁGON Bevezetés A JUHTARTÁS HELYE ÉS SZEREPE A KÖRNYEZETBARÁT ÁLLATTARTÁSBAN ÉSZAK-MAGYARORSZÁGON Abayné Hamar Enikő Marselek Sándor GATE Mezőgazdasági Főiskolai Kar, Gyöngyös A Magyarországon zajló társadalmi-gazdasági

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

1.2.4.1.1 ÉLİHELYEK ELNEVEZÉSEI

1.2.4.1.1 ÉLİHELYEK ELNEVEZÉSEI 1. táblázat Általános Nemzeti Élıhely Rendszer kategóriái ÉLİHELYEK JELE TERMÉSZETES ÉLİHELYEK 1.2.4.1.1 ÉLİHELYEK ELNEVEZÉSEI A Hinarasok A1 Békalencsés, rucaörömös, tócsagazos úszóhínár A2 Rencés, kolokános

Részletesebben

N É H Á N Y A D A T A BUDAPESTI ÜGYVÉDEKRŐ L

N É H Á N Y A D A T A BUDAPESTI ÜGYVÉDEKRŐ L K Ö Z L E M É N Y E K N É H Á N Y A D A T A BUDAPESTI ÜGYVÉDEKRŐ L DR. HEINZ ERVIN A népesedésstatisztika igen fontos mutatószámai a népesség kormegoszlására és annak változására vonatkozó adatok. Ezért

Részletesebben

DEVELOPMENT OF HUNGARIAN AND AUSTRIAN ORGANIC FARMING. By: KOLTAI, JUDIT MAZÁN, MÁRIÓ CSATAI, RÓZSA

DEVELOPMENT OF HUNGARIAN AND AUSTRIAN ORGANIC FARMING. By: KOLTAI, JUDIT MAZÁN, MÁRIÓ CSATAI, RÓZSA DEVELOPMENT OF HUNGARIAN AND AUSTRIAN ORGANIC FARMING By: KOLTAI, JUDIT MAZÁN, MÁRIÓ CSATAI, RÓZSA Keywords: organic farming, development, support systems, marketing. Directive 2092/91/EEC of the European

Részletesebben

KÉPI INFORMÁCIÓK KEZELHETŐSÉGE. Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet. Összefoglaló

KÉPI INFORMÁCIÓK KEZELHETŐSÉGE. Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet. Összefoglaló KÉPI INFORMÁCIÓK KEZELHETŐSÉGE Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet Összefoglaló Tanórákon és az önálló tanulás részeként is, az informatika világában a rendelkezésünkre álló óriási mennyiségű

Részletesebben

Negyedidõszaki éghajlati ciklusok a Mecsek környéki löszök puhatestû faunájának változása alapján

Negyedidõszaki éghajlati ciklusok a Mecsek környéki löszök puhatestû faunájának változása alapján MALAKOLÓGIAI TÁJÉKOZTATÓ 2000 MALACOLOGICAL NEWSLETTER 18: 59 67 Negyedidõszaki éghajlati ciklusok a Mecsek környéki löszök puhatestû faunájának változása alapján Tóth Árpád Abstract: Qaternary Climatic

Részletesebben

A FEJÉR MEGYEI SÁRRÉT NEGYEDIDŐSZAKI VEGETÁCIÓJA. Molnár Marianna Témavezetők: Dr. Medzihradszky Zsófia Dr. Horváth Erzsébet

A FEJÉR MEGYEI SÁRRÉT NEGYEDIDŐSZAKI VEGETÁCIÓJA. Molnár Marianna Témavezetők: Dr. Medzihradszky Zsófia Dr. Horváth Erzsébet A FEJÉR MEGYEI SÁRRÉT NEGYEDIDŐSZAKI VEGETÁCIÓJA Molnár Marianna Témavezetők: Dr. Medzihradszky Zsófia Dr. Horváth Erzsébet Vázlat Kutatás célja Sárrét kutatása Mintavétel Kutatási eredmények Korábbi eredményekkel

Részletesebben

BALATONI NÁDASOK KLONÁLIS DIVERZITÁSÁNAK VIZSGÁLATA RAPD-PCR MÓDSZERREL

BALATONI NÁDASOK KLONÁLIS DIVERZITÁSÁNAK VIZSGÁLATA RAPD-PCR MÓDSZERREL Bot. Közlem. 94(1 2): 133 140, 2007. BALATONI NÁDASOK KLONÁLIS DIVERZITÁSÁNAK VIZSGÁLATA RAPD-PCR MÓDSZERREL LUKÁCS VIKTÓRIA 1, HERODEK SÁNDOR 1, MAJOR ÁGNES 2 1 MTA Balatoni Limnológiai Kutatóintézet,

Részletesebben

Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon

Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon Rövid tanulmányút 2011. 01.03-03. 30., John Inn Centre, Dept. of Crop Genetics, Norwich Research Park, Norwich NR4 7UH, UK Supervisor:

Részletesebben

MAGYARORSZÁG VÍZGYŐJTİ- GAZDÁLKODÁSI TERVE

MAGYARORSZÁG VÍZGYŐJTİ- GAZDÁLKODÁSI TERVE A víz élet, gondozzuk közösen! MAGYARORSZÁG VÍZGYŐJTİ- GAZDÁLKODÁSI TERVE A 2009. december 22-én közétett A Duna-vízgyőjtı magyarországi része VÍZGYŐJTİ-GAZDÁLKODÁSI TERV dokumentumának összefoglaló, rövidített

Részletesebben

Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 468 EGYEDAZONOSÍTÁS ÉS SZÁRMAZÁSELLENİRZÉS HIPERPOLIMORF MIKROSZATELLITA

Részletesebben

Harvested production of cereals increases about one third in 2013 (Preliminary production data of main crops, 2013)

Harvested production of cereals increases about one third in 2013 (Preliminary production data of main crops, 2013) Release date: 22 January 2014 Next release: 24 January 2014. Vital events, January November 2013 Number 13 Harvested of cereals increases about one third in 2013 (Preliminary data of main crops, 2013)

Részletesebben

Lillafüredi Pisztrángtelep. A képernyõ jobb alsó sarkában a nagyítás gombra kattintva, az újságcikkek jól olvashatók.

Lillafüredi Pisztrángtelep. A képernyõ jobb alsó sarkában a nagyítás gombra kattintva, az újságcikkek jól olvashatók. Rólunk írták A képernyõ jobb alsó sarkában a nagyítás gombra kattintva, az újságcikkek jól olvashatók. Lehet, hogy a receptek részhez is tehettem volna, ami Gyepes Gabojsza tollából jelent meg. A legutóbbi

Részletesebben

Európai kapcsolat? Az aranysakál genetikai struktúrája és terjeszkedése Európában és a Kaukázusban

Európai kapcsolat? Az aranysakál genetikai struktúrája és terjeszkedése Európában és a Kaukázusban Európai kapcsolat? Az aranysakál genetikai struktúrája és terjeszkedése Európában és a Kaukázusban Heltai Miklós és Szabó László Szent István Egyetem, Vadvilág Megőrzési Intézet Bevezetés Az aranysakál

Részletesebben

AZ ÉGHAJLATVÁLTOZÁS KEDVEZ KÖRÜLMÉNYEKET HOZHAT ALMATERMESZTÉSÜNKNEK? ERDÉLYI É.

AZ ÉGHAJLATVÁLTOZÁS KEDVEZ KÖRÜLMÉNYEKET HOZHAT ALMATERMESZTÉSÜNKNEK? ERDÉLYI É. AZ ÉGHAJLATVÁLTOZÁS KEDVEZ KÖRÜLMÉNYEKET HOZHAT ALMATERMESZTÉSÜNKNEK? ERDÉLYI É. Összefoglalás Budapesti Corvinus Egyetem, Kertészettudományi Kar, 1118 Budapest, Villányi út 29-43. A termesztett növények

Részletesebben

Egy egyedülálló dél-alföldi löszszelvény malakológiai vizsgálata és a terület felső-würm paleoklimatológiai rekonstrukciója

Egy egyedülálló dél-alföldi löszszelvény malakológiai vizsgálata és a terület felső-würm paleoklimatológiai rekonstrukciója SZEGEDI TUDOMÁNYEGYETEM FÖLDTUDOMÁNYOK DOKTORI ISKOLA DOKTORI ÉRTEKEZÉS TÉZISEI Egy egyedülálló dél-alföldi löszszelvény malakológiai vizsgálata és a terület felső-würm paleoklimatológiai rekonstrukciója

Részletesebben

IZOTÓPHIDROKÉMIAI KOMPLEX MÓDSZER ALKALMAZÁSA TALAJVIZEK UTÁNPÓTLÓDÁSÁNAK VIZSGÁLATÁNÁL

IZOTÓPHIDROKÉMIAI KOMPLEX MÓDSZER ALKALMAZÁSA TALAJVIZEK UTÁNPÓTLÓDÁSÁNAK VIZSGÁLATÁNÁL IZOTÓPHIDROKÉMIAI KOMPLEX MÓDSZER ALKALMAZÁSA TALAJVIZEK UTÁNPÓTLÓDÁSÁNAK VIZSGÁLATÁNÁL Kompár László 1, Szűcs Péter 2, Palcsu László 3, Braun Mihály 4 tudományos segédmunkatárs 1 DSc, tanszékvezető, egyetemi

Részletesebben

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott

Részletesebben

Expansion of Red Deer and afforestation in Hungary

Expansion of Red Deer and afforestation in Hungary Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi www.vmi.szie.hu Background and importance large herbivores are overpopulated

Részletesebben

MAGYARORSZÁG PLEISZTOCÉNVÉGI VEGETÁCIÓTÜRTÉNETE AZ UTOLSÓ INTERGLACIÁLIS ÓTA. x Jár a iné Kornlódi Magda

MAGYARORSZÁG PLEISZTOCÉNVÉGI VEGETÁCIÓTÜRTÉNETE AZ UTOLSÓ INTERGLACIÁLIS ÓTA. x Jár a iné Kornlódi Magda ŐSLÉNY TANI VITÁK /Oiscussiones Palaeontologicae/, 36-37, Budapest, 1991 pp. 201-215. MAGYARORSZÁG PLEISZTOCÉNVÉGI VEGETÁCIÓTÜRTÉNETE AZ UTOLSÓ INTERGLACIÁLIS ÓTA x Jár a iné Kornlódi Magda Bevezetés A

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi

Részletesebben

6 x 2,8 mm AGYAS LÁNCKEREKEK 04B - 1 DIN 8187 - ISO/R 606. Osztás 6,0 Bels szélesség 2,8 Görg átmér 4,0

6 x 2,8 mm AGYAS LÁNCKEREKEK 04B - 1 DIN 8187 - ISO/R 606. Osztás 6,0 Bels szélesség 2,8 Görg átmér 4,0 6 x 2,8 04B 1 6,0 2,8 4,0 6,0 0,7 2,6 h 2 h 3 Anyaga: St 50 192 Kód d D 8 18,0 15,67 PS 02008 9,8 5 10 9 19,9 17,54 PS 02009 11,5 5 10 10 21,7 19,42 PS 02010 13 6 10 11 23,6 21,30 PS 02011 14 6 10 12 25,4

Részletesebben

Az erdötalajban lakó állati véglények (protozoák) szerepének és kutatásának problémái (Befejezés.) írta: Dr. Varga Lajos, egyetemi magántanár.

Az erdötalajban lakó állati véglények (protozoák) szerepének és kutatásának problémái (Befejezés.) írta: Dr. Varga Lajos, egyetemi magántanár. Az erdötalajban lakó állati véglények (protozoák) szerepének és kutatásának problémái (Befejezés.) írta: Dr. Varga Lajos, egyetemi magántanár. 2. A vizsgálatok nehézségei. Ismeretes, hogy a baktériumokhoz

Részletesebben

Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL

Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL Doktori (Ph.D) értekezés tézisei Bodzsár Nóra Gödöllő 2012 A

Részletesebben

3. Magyarország növényzetének fejlődése a harmadkortól. Reliktum növények és reliktum endemizmusok. Az Ősmátra elmélet.

3. Magyarország növényzetének fejlődése a harmadkortól. Reliktum növények és reliktum endemizmusok. Az Ősmátra elmélet. 3. Magyarország növényzetének fejlődése a harmadkortól. Reliktum növények és reliktum endemizmusok. Az Ősmátra elmélet. Vegetációtörténet Az evolóció nagy lépései a növényvilág fejlődése során 1. 3,5

Részletesebben

IKR Agrár Kft. biztonsági elemzése Füzesabony Területi Központ

IKR Agrár Kft. biztonsági elemzése Füzesabony Területi Központ 2016. IKR Agrár Kft. biztonsági elemzése Füzesabony Területi Központ 5. számú melléklet Kockázat csökkentő intézkedés tervezete AGEL-CBI Kft. Verzió: 1.0 2016.04.30. IKR Agrár Kft. biztonsági elemzése

Részletesebben

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel Gyakorlat helye: BIOMI Kft. Gödöllő, Szent-Györgyi A. u. 4. (Nemzeti Agrárkutatási és Innovációs Központ épülete volt

Részletesebben

A TÓGAZDASÁGI HALTERMELÉS SZERKEZETÉNEK ELEMZÉSE. SZATHMÁRI LÁSZLÓ d r.- TENK ANTAL dr. ÖSSZEFOGLALÁS

A TÓGAZDASÁGI HALTERMELÉS SZERKEZETÉNEK ELEMZÉSE. SZATHMÁRI LÁSZLÓ d r.- TENK ANTAL dr. ÖSSZEFOGLALÁS A TÓGAZDASÁGI HALTERMELÉS SZERKEZETÉNEK ELEMZÉSE SZATHMÁRI LÁSZLÓ d r.- TENK ANTAL dr. ÖSSZEFOGLALÁS A hazai tógazdasági haltermelés a 90-es évek közepén tapasztalt mélypontról elmozdult és az utóbbi három

Részletesebben

Szürke marhától a szürke marháig Fenékpusztán *

Szürke marhától a szürke marháig Fenékpusztán * Készítette: Palkó Csaba Szürke marhától a szürke marháig Fenékpusztán * * 1. kép Bevezetés Egyedülálló nemzeti kincsünk a Balaton. (2. kép) A tó környezetében már ritka a természetes partszakasz. Az egyik

Részletesebben

kopint-tarki.hu Az Agrárrendtartási és a Kereskedelmi Törvény egyes beszállító-védelmi szabályai érvényesülésének tapasztalata

kopint-tarki.hu Az Agrárrendtartási és a Kereskedelmi Törvény egyes beszállító-védelmi szabályai érvényesülésének tapasztalata kopint-tarki.hu Az Agrárrendtartási és a Kereskedelmi Törvény egyes beszállító-védelmi szabályai érvényesülésének tapasztalata Készült a Gazdasági Versenyhivatal VKK megbízásából A tanulmányt készítették

Részletesebben

DOKTORI (PhD) ÉRTEKEZÉS TÉZISEI

DOKTORI (PhD) ÉRTEKEZÉS TÉZISEI DOKTORI (PhD) ÉRTEKEZÉS TÉZISEI KAPOSVÁRI EGYETEM ÁLLATTUDOMÁNYI KAR Baromfi-és Társállattenyésztési Tanszék Doktori Iskola vezetıje: DR. HORN PÉTER akadémikus, az MTA rendes tagja Témavezetı: DR. BOGENFÜRST

Részletesebben

Molekuláris biológiai diagnosztika alkalmazása

Molekuláris biológiai diagnosztika alkalmazása Molekuláris biológiai diagnosztika alkalmazása (HIV, HCV, HBV szabad vírus mennyiség meghatározás) a napi rutin diagnosztikában Reichenberger Anna Mária, Dr. Sárvári Csilla Dr. Ujhelyi Eszter Fıvárosi

Részletesebben

képe. Kutatási területe: a Kárpát-medence skori H, Science in Archaeology m, m y ü-

képe. Kutatási területe: a Kárpát-medence skori H, Science in Archaeology m, m y ü- K K A mb y u b M M y v bb u m - y b Nyu ( u F b ) y m y b m v j yü, m j v um u m y - bó u m y, m u m y x- u b ü. S v m y, m v ó yv y u m y ü, v m y, v m m ü -. A u m y u j m 19. b m, m mó m v y ó. E v

Részletesebben

Bogácsi-Szabó Erika. Ph.D. értekezés tézisei. Témavezető: Prof. Dr. Raskó István. Szegedi Tudományegyetem, Molekuláris és sejtbiológiai Ph.D.

Bogácsi-Szabó Erika. Ph.D. értekezés tézisei. Témavezető: Prof. Dr. Raskó István. Szegedi Tudományegyetem, Molekuláris és sejtbiológiai Ph.D. Populációgenetikai és diagnosztikai célú mitokondriális DNS és autoszómális marker vizsgálatok Magyarországon feltárt régészeti csontleletekből és modern mintákból Bogácsi-Szabó Erika Ph.D. értekezés tézisei

Részletesebben

Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI

Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance

Részletesebben

Csupor Károly. Vízben oldható faanyagvédıszer kioldódási tulajdonságai. Doktori (Ph.D.) értekezés. Nyugat-Magyarországi Egyetem

Csupor Károly. Vízben oldható faanyagvédıszer kioldódási tulajdonságai. Doktori (Ph.D.) értekezés. Nyugat-Magyarországi Egyetem Csupor Károly Vízben oldható faanyagvédıszer kioldódási tulajdonságai Doktori (Ph.D.) értekezés Témavezetı: Dr.habil Varga Ferenc intézetigazgató egyetemi tanár Nyugat-Magyarországi Egyetem 21 VÍZBEN OLDHATÓ

Részletesebben

Kiadó: Baranya Természeti Értékeiért Alapítvány. Szöveg: Bank László. Lektor: Dr. Szép Tibor. Nyomda: Borgisz-Print Kft.

Kiadó: Baranya Természeti Értékeiért Alapítvány. Szöveg: Bank László. Lektor: Dr. Szép Tibor. Nyomda: Borgisz-Print Kft. Baranya Természeti Értékeiért Alapítvány FECSKEVÉDELMI PROGRAM www.baranyamadar.hu A TERMÉSZET SZOLGÁLATÁBAN İszi fecskegyülekezés (Fotó: Losonczi Lajos) Kiadó: Baranya Természeti Értékeiért Alapítvány

Részletesebben

Igazságügyi genetika alapjai

Igazságügyi genetika alapjai Nyomok - Death Valley, CA 2007 / 10 / 11 Igazságügyi genetika alapjai Molekuláris orvostudomány - molekuláris bűnjelek genetikai analízise Pádár Zsolt Igazságügyi genetika vannak az ÉLET dolgai és vannak

Részletesebben

Tömöry Gyöngyvér. Ph.D. értekezés tézisei. Szegedi Tudományegyetem, Molekuláris és sejtbiológiai Ph.D. program

Tömöry Gyöngyvér. Ph.D. értekezés tézisei. Szegedi Tudományegyetem, Molekuláris és sejtbiológiai Ph.D. program A Kárpát-medence honfoglalás kori (10-11. századi) lakosságának valamint mai magyar nyelvő népcsoportoknak összehasonlító mitokondriális alapú filogeográfiai analízise Tömöry Gyöngyvér Ph.D. értekezés

Részletesebben

TUDÁSBŐVÍTÉS VERSUS TUDATMÓDOSÍTÁS. VISSZAÉLÉSEK A STATISZTIKA JÓHISZEMŰSÉGÉVEL VERESS JÓZSEF DSC egyetemi tanár BME GTK 2012

TUDÁSBŐVÍTÉS VERSUS TUDATMÓDOSÍTÁS. VISSZAÉLÉSEK A STATISZTIKA JÓHISZEMŰSÉGÉVEL VERESS JÓZSEF DSC egyetemi tanár BME GTK 2012 TUDÁSBŐVÍTÉS VERSUS TUDATMÓDOSÍTÁS VISSZAÉLÉSEK A STATISZTIKA JÓHISZEMŰSÉGÉVEL VERESS JÓZSEF DSC egyetemi tanár BME GTK 2012 Veress József Kor 2 6 2 0 Sport labdarúgás (ballábas), asztalitenisz (jobbkezes),

Részletesebben

Gyepgazdálkodás. Sáringer-Kenyeres Tamás

Gyepgazdálkodás. Sáringer-Kenyeres Tamás Gyepgazdálkodás Sáringer-Kenyeres Tamás Bevezetés A telepítés (felújítás) elıkészítése táblásítás. A táblák méreteit a természetes határok, a hasznosítási, továbbá az üzemelési igények figyelembevételével

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

EGY MAGYARORSZÁGI ERİMŐ VÍZELİKÉSZÍTİ ÜZEMÉNEK MIKROBIOLÓGIAI VIZSGÁLATA

EGY MAGYARORSZÁGI ERİMŐ VÍZELİKÉSZÍTİ ÜZEMÉNEK MIKROBIOLÓGIAI VIZSGÁLATA EGY MAGYARORSZÁGI ERİMŐ VÍZELİKÉSZÍTİ ÜZEMÉNEK MIKROBIOLÓGIAI VIZSGÁLATA Kéki Zsuzsa Környezettudományi Doktori Iskola Környezetbiológia Program Témavezetı: Majorosné Dr. Tóth Erika ELTE Mikrobiológiai

Részletesebben

Természetvédelmi biológia

Természetvédelmi biológia Természetvédelmi biológia 8. Populáció- és fajszintő védelem: a kis populációk problémái. A populációvédelem elméleti és gyakorlati alapjai. A kis populációk problémái A populáció definíciója: azonos élıhelyen

Részletesebben

FIATAL MŰSZAKIAK TUDOMÁNYOS ÜLÉSSZAKA

FIATAL MŰSZAKIAK TUDOMÁNYOS ÜLÉSSZAKA FIATAL ŰSZAKIAK TUDOÁNYOS ÜLÉSSZAKA Kolozsvár, 1999. március 19-20. Zsákolt áruk palettázását végző rendszer szimulációs kapacitásvizsgálata Kádár Tamás Abstract This essay is based on a research work

Részletesebben

Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei

Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei A World Internet Project magyarországi kutatása országos reprezentatív minta segítségével készül.

Részletesebben

Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék

Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék PATOGÉN MIKROORGANIZMUSOK KIMUTATÁSÁRA SZOLGÁLÓ GYORS MÓDSZEREK ÖSSZEHASONLÍTÓ VIZSGÁLATA Rohonczy Kata Doktori

Részletesebben

A BOMBINA BOMBINA ÉS BOMBINA VARIEGATA MORFOLÓGIAI ÉS TÉZISEK VÖRÖS JUDIT

A BOMBINA BOMBINA ÉS BOMBINA VARIEGATA MORFOLÓGIAI ÉS TÉZISEK VÖRÖS JUDIT A BOMBINA BOMBINA ÉS BOMBINA VARIEGATA MORFOLÓGIAI ÉS GENETIKAI VIZSGÁLATA MAGYARORSZÁGON, KÜLÖNÖS TEKINTETTEL FILOGEOGRÁFIÁJUKRA ÉS A KÉT FAJ ÁLTAL ALKOTOTT HIBRIDZÓNÁKRA TÉZISEK VÖRÖS JUDIT EÖTVÖS LORÁND

Részletesebben

Gyakorlati bioinformatika

Gyakorlati bioinformatika Gyakorlati bioinformatika Szekvenciaillesztés PhD kurzus 2. Szekvenciaillesztés Bagossi Péter Fajtái: - egyszer ill. többszörös illesztés - globális ill. lokális illesztés Alkalmazása: - adatbázisokban

Részletesebben

Egykori nagylétszámú denevér szülőkolóniák nyomai a Bakony barlangjaiban

Egykori nagylétszámú denevér szülőkolóniák nyomai a Bakony barlangjaiban Egykori nagylétszámú denevér szülőkolóniák nyomai a Bakony barlangjaiban Paulovics Péter Marks referring to presence of former large bat nursery colonies in the caves of Bakony Mts., Hungary In Central

Részletesebben

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika DNS munka a gyakorlatban 2012.10.12. Természetvédelmi genetika Munka fázisok DNS kivonás elektroforézis (fakultatív lépés) PCR Elektroforézis Szekvenálás Szekvencia elemzés faji azonosítás; variabilitás,

Részletesebben

Budapest 03.10.2008 A J Á N L A T Sorsz.: 25756

Budapest 03.10.2008 A J Á N L A T Sorsz.: 25756 Budapest 03.10.2008 A J Á N L A T Sorsz.: 25756 Tisztelt Hegyi Richárd! Köszönettel vettük érdeklödésüket, hogy az új ablakaik összeállításánál fontosnak tartják a variációs lehetöségeket, az esztétikus

Részletesebben

Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 1 Issue 3 Gödöllı 2005 208 ÁLLATJÓLLÉT A MŐSZAKI GYAKORLATBAN Pazsiczki Imre FVM Mezıgazdasági Gépesítési

Részletesebben

A Puszta 1999. 1/16, pp. 25-31. MADÁRÁLLOMÁNYÁNAK VISZONYIRÓL A SZENNYEZÉSI HULLÁMOK KAPCSÁN 2000.

A Puszta 1999. 1/16, pp. 25-31. MADÁRÁLLOMÁNYÁNAK VISZONYIRÓL A SZENNYEZÉSI HULLÁMOK KAPCSÁN 2000. A Puszta. 1/16, pp. 25-31. A TISZA-TÓ MADÁRÁLLOMÁNYÁNAK VISZONYIRÓL A SZENNYEZÉSI HULLÁMOK KAPCSÁN ZALAI TAMÁS, HEVES HORTOBÁGY TERMÉSZETVÉDELMI EGYESÜLET. * A tanulmány eredeti, teljes címe: Összefoglaló

Részletesebben

A 2013/3. SZÁM TARTALMA. Pálfi V., Juhászné Kaszanyitzky É.,Jánosi Sz., Malik P.: Streptococcus

A 2013/3. SZÁM TARTALMA. Pálfi V., Juhászné Kaszanyitzky É.,Jánosi Sz., Malik P.: Streptococcus A 2013/3. SZÁM TARTALMA LÓ Pálfi V., Juhászné Kaszanyitzky É.,Jánosi Sz., Malik P.: Streptococcus equi subsp. zooepidemicus okozta tömeges légzőszervi megbetegedések lóállományokban KISÁLLAT Bende B.,

Részletesebben

Csonkafülű denevér (Myotis emarginatus) előfordulása Gemencen The occurrence of Geoffroy s bat (Myotis emarginatus) in the Gemenc forest

Csonkafülű denevér (Myotis emarginatus) előfordulása Gemencen The occurrence of Geoffroy s bat (Myotis emarginatus) in the Gemenc forest DENEVÉRKUTATÁS Hungarian Bat Research News 4: 7-11. (2008) Csonkafülű denevér (Myotis emarginatus) előfordulása Gemencen The occurrence of Geoffroy s bat (Myotis emarginatus) in the Gemenc forest GÖRFÖL

Részletesebben

Átlagtermés és rekordtermés 8 növénykultúrában

Átlagtermés és rekordtermés 8 növénykultúrában Átlagtermés és rekordtermés 8 növénykultúrában Növény Rekord termés * Átlag termés * Veszteség típusa Biotikus Abiotikus Abiotikus stressz okozta kiesés (% a rekord terméshez képest) Kukorica 19300 4600

Részletesebben

AZ ÚJSZÜLÖTT NYULAK TESTTÖMEGE A LÉTSZÁMOKTÓL ÉS A MÉHEN BELÜLI ELHELYEZKEDÉSÜKTŐL FÜGGŐEN UNILATERÁLISAN OVARIEKTOMIZÁLT ANYANYULAKBAN

AZ ÚJSZÜLÖTT NYULAK TESTTÖMEGE A LÉTSZÁMOKTÓL ÉS A MÉHEN BELÜLI ELHELYEZKEDÉSÜKTŐL FÜGGŐEN UNILATERÁLISAN OVARIEKTOMIZÁLT ANYANYULAKBAN AZ ÚJSZÜLÖTT NYULAK TESTTÖMEGE A LÉTSZÁMOKTÓL ÉS A MÉHEN BELÜLI ELHELYEZKEDÉSÜKTŐL FÜGGŐEN UNILATERÁLISAN OVARIEKTOMIZÁLT ANYANYULAKBAN POIGNER J., SZENDRŐ ZS., LÉVAI A., BIRÓNÉ NÉMETH E., RADNAI I., SCHÁN

Részletesebben

ÜLEDÉKESEDÉSI FOLYAMATOK A DUNA-DELTAI TÓ-RENDSZERBEN

ÜLEDÉKESEDÉSI FOLYAMATOK A DUNA-DELTAI TÓ-RENDSZERBEN Őszi Radiokémiai Napok 2014 Balatonszárszó, 2014. október 13 15. ÜLEDÉKESEDÉSI FOLYAMATOK A DUNA-DELTAI TÓ-RENDSZERBEN Begy R-Cs., Simon H., Kelemen Sz., Reizer E., Steopoaie I. Környezettudomány és Környezetmernöki

Részletesebben

Technikai elemzés. c.člá. Fio o.c.p., a.s. Fio o.c.p., a.s. Forrás: Bloomberg 6/2011

Technikai elemzés. c.člá. Fio o.c.p., a.s. Fio o.c.p., a.s. Forrás: Bloomberg 6/2011 Technikai elemzés c.člá Fio o.c.p., a.s. A S&P 500 index áttörte az elızı maximumokat, amelyek 1350 alatt voltak. Ez általában bika jelzés. A maximumok áttörése viszont hamis volt, és az index visszatért

Részletesebben

KELER KSZF Zrt. bankgarancia-befogadási kondíciói. Hatályos: 2014. július 8.

KELER KSZF Zrt. bankgarancia-befogadási kondíciói. Hatályos: 2014. július 8. KELER KSZF Zrt. bankgarancia-befogadási kondíciói Hatályos: 2014. július 8. A KELER KSZF a nem-pénzügyi klíringtagjaitól, és az energiapiaci alklíringtagjaitól a KELER KSZF Általános Üzletszabályzata szerinti

Részletesebben

A termıföld mint erıforrás

A termıföld mint erıforrás A termıföld mint erıforrás Birtokviszonyok Birtokpolitika A termıföld fogalma termıföld: az a földrészlet, amelyet a település külterületén az ingatlan-nyilvántartásban szántó, szılı, gyümölcsös, kert,

Részletesebben

ÉS ÁGAZATI EREDMÉNY DIFFERENCIÁLTSÁGA UDOVECZ GÁBOR dr. KERTÉSZ RÓBERT BÉLÁDI KATALIN dr.

ÉS ÁGAZATI EREDMÉNY DIFFERENCIÁLTSÁGA UDOVECZ GÁBOR dr. KERTÉSZ RÓBERT BÉLÁDI KATALIN dr. DIFFERENTIATION OF COSTS AND RETURNS IN AGRICULTURAL BRANCHES UDOVECZ, GÁBOR KERTÉSZ, RÓBERT BÉLÁDI, KATALIN Keywords: median costs and scatter, market dominating farms, investment return ratio, differentiation

Részletesebben

Készítette: Dr. Cserei Pál környezetvédelmi tervezı, szakértı. Selemoncsák Ferenc környezetgazdálkodási mérnök

Készítette: Dr. Cserei Pál környezetvédelmi tervezı, szakértı. Selemoncsák Ferenc környezetgazdálkodási mérnök Készítette: Dr. Cserei Pál környezetvédelmi tervezı, szakértı Selemoncsák Ferenc környezetgazdálkodási mérnök A program felülvizsgálata az alábbi szervezetek és személyek által biztosított adatok és információk

Részletesebben