Magyari E. K., Bálint M., Parducci L., Major Á., Nédli J., Rácz I

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Magyari E. K., Bálint M., Parducci L., Major Á., Nédli J., Rácz I. 2011.03.28. 1"

Átírás

1 İSI DNS ÉS POPULÁCIÓTÖRTÉNET: 11 ezer év demográfiai változásinak negatív hatása a lucfenyı (Picea abies) genetikai variabilitására egy kárpáti refúgium-területen Magyari E. K., Bálint M., Parducci L., Major Á., Nédli J., Rácz I

2 MOTIVÁCIÓ 2005: Molekuláris Taxonómiai Labor nyílik az MTM-ben Potenciális hasznosítás lehetıségei fosszilis témában? tavi üledékbe zárt fosszilis pollenek és makrofosszíliák

3 İSI DNS KUTATÁSOK rövid történeti áttekintés I. Özönvíz elıtti DNS Fosszilis, erısen fragmentálódott DNS szálak, melyek sokszor posztmortem bázis-transzformáción esnek át Higutchi et al. 1984: 150 éves múzeumi kvaggából sikeresen vontak ki és amplifikáltakısi DNS-t (Fokföldön 1800-as években kipusztult zebra alfaj) Hihetetlen korúısi DNS maradványok ( özönvíz elıtti DNS ): 100 millió évesnél is idısebb fosszíliák látszólagosan sikeres DNS analízise: pl. oligocén és kréta borostyánban talált rovarok, növényi maradványok ( ), miocén Magnolia fosszíliák ( ), 80 millió éves dinoszaurusz csont (1994), kréta korú dínó-tojás (1995) Egyiket sem sikerült reprodukálni, a 2000-es évek kutatásai szerint a DNS megtartás maximálisan néhány százezer éves idıtartományban lehetséges

4 İSI DNS KUTATÁSOK rövid történeti áttekintés II. Özönvíz utáni DNS a 2000-es évek Az ısi DNS vizsgálatok kettéágazó vizsgálati célja: 1. Populációgenetikai kérdések vizsgálata: pl. hogyan hat az elterjedési terület fluktuációja a genetikai diverzitásra, fajképzıdés, evolúció 2. Az egykoron élt fajspektrum kiderítése, diverzitás változás vizsgálata, ısi DNS használata fajmeghatározásra (metagenomika) Barlangi medve - mitokondriális genom hosszú szakaszai ismertek, barnamedvétıl 1.5 millió éve vált el, többszöri géndiverzitás csökkenés az utolsó glaciálisban Gyapjas mamut - teljes mitokondriális genom hajszálból, rövidebb mtdns szaksazok vizsgálata több faj együttes jelenlétét bizonyították az utolsó glaciálisban, 2011: japán kutatók Oroszországban tárolt mamut tetem sejtmagjait akarják elefánt petesejtbe ültetni: Jurasic Park helyett Pleistocene Park 4000 éves grönlandi ember - 3 billió bázispár hajból 2010-ben, mai szibériaiakkal rokonítható Neandervölgyi ember 4 billió bázispárt közöltek 2010-ben, 99,7%-os egyezés a modern emberrel, elválsái idı: ezr év, keveredhetett a modern emberrel Barlangi medve Gyapjas mamut Grönlandi emeber Neandervölgyi emeber

5 Taylor at al. (2010) Missing saiga on the taiga; Campos et al. (2010) Ancient DNA sequences point to a large loss of mitochondrial genetic diversity in the saiga antelope (Saiga tatarica) since the Pleistocene Szaiga antilop ısi DNS vizsgálat modern DNS vizsgálattal párhuzamosan - kihalás szélén álló fajról van szó, környezeti változásokra érzékenyen reagál, de kedvezı feltételek esetén gyorsan szaporodik és mobilis, kedvezıtlen környezetben viszont tömegesen pusztul - genetikia vizsgálat eredménye: hirtelen populációméret csökkenés 2000 és éve, elıbbit valószínőleg emberi hatásra utóbbit klimatikus hatásra bekövetkezı élıhely beszőkülés okozta. + dokumentált tömeges pusztulások betegség, téli nagy hóborítás hatására: 1971, 1987, az ısi DNS vizsgálat konzervációbiológiai jelentısége: ez a faj drámai populációméret csökkenéseket képes túlélni köszönhetıen a botlleneck utáni gyors szaporodásának, következésképpen védelmét leginkább az szolgálná ha a terjedését segítenék elı és nem a hirtelen elhalálozásokat próbálnák megakadályozni (élıhely összekötı folyosók létrehozása)

6 İSI NÖVÉNYI DNS VIZSGÁLATOK -KIS SZÁMÚ VIZSGÁLAT elsısorban metagenomika: milyen fajok voltak jelen? + Archeobotanika (pl. fıbb gabonák, szılı, kukorica)

7 VIZSGÁLT NÖVÉNYFAJ - LUCFENYİ (PICEA ABIES) Miért a lucfenyıt választottuk? 1) Európai populációnak genetikai mintázata részletesen tanulmányozott (kloroplaszt, mitokondriális és nukleáris régiók) 2) Az utolsó eljegesedés során fontos erdıalkotó a Kárpát-medencében, bizonyos helyeken feltételezhetı a folyamatos jelenléte (pl. hegyvidéken) 3) Fosszíliáinak elıkerülése várható glaciális és holocén tavi üledékekben 4) Pollenje nagy mérető ( mikron), relatíve könnyen izolálható az üledékbıl

8 Tollefsrud et al. (2008) A LUCFENYİ GENETIKAI CSOPORTJAI ÉS EZEK ALAPJÁN FELTÉTELEZETT POSZTGLACIÁLIS TERJEDÉSI ÚTVONALAK Mikor történt ez az elválás? Ezek a populációk nem terjedtek északra a holocén felmelegedés során, csak magassági övek közt mozogtak A PCA alapú lucfenyı genetikai csoportok földrajzi eloszlása, és a genetikai csoportok kapcsolata minimum-evolúciósfák alapján. 8 Retyezát-hegység Full glacial (LGM) distribution of Picea abies in the Carpathian Basin

9 Eemian interglacial (ca years BP) disribution of Picea abies in Central-Southern Europe. Taken from Ravazzi ( 2002) Maximum spruce expansion (Picea abies+picea omoricoides) during the early Weichselian ( kyr BP) Maximum expansion of Picea abies in southern Europe during middle pleniglacial interstadials (55 35 kyr cal BP) A LUCFENYİ ELTERJEDÉSI TERÜLETÉNEK VÁLTOZÁSAI AZ ELMÚLT 120,000 ÉVBEN EURÓPÁBAN Tentative range map of Picea abies in central and southern Europe during the LGM ( kyr cal BP). Ravazzi (2002) Lucfenyı (Picea abies) área

10 MOTIVÁCIÓ Ravazzi 2002 The time window used by most researchers (the postglacial) to evaluate the influence of historical events on genetic structure of European tree populations seems too short compared to the amount of genetic variability that was probably not eliminated by the restriction of populations during the LGM. This is especially important in the case of spruce, which was not reduced to a confined refugium but survived in large regions in southern Europe. Hope is now placed in fossil DNA extraction and identification, because this will allow a real integration of paleobotanical and molecular methods.

11 CÉLKITŐZÉSEK?? Az ısi és modern lucfenyı populáció DNS vizsgálata révén annak felderítése, hogy a késıglaciális és holocén idıszak (elmúlt ~ év) klímaváltozásai és az emberi tevékenység (erdıirtás) hogyan hatottak a fafaj genetikai összetételére a Déli-Kárpátokban, mely terület ma számos área-specifikus allélt hordoz közepes genetikai diverzitás mellett. A faj túlélése szempontjából kulcsfontosságú-e ezen área-specifikus allélek védelme? Hosszútávú cél: a paleobotanikai leletek alapján feltételezhetı DNY-ÉK irányú glaciális összeköttetés bizonyítása lucfenyı fosszíliák DNS vizsgálatával

12 KUTATÁSI TERÜLET - TAUL DINTRE BRAZI, RETYEZÁT-HG. T.sz.f.m. : 1740 m Terület : 0,5 ha Vízmélység: 80 cm ph: 5,7 Növényzet : Pinus mugo úszóláp, Rhododendron myrthillus, Sphagnum sp., Picea abies, Pinus cembra Fúrásmag: 5 m

13 A RETYEZÁT

14 MÓDSZER ÉS MUNKAFOLYAMAT Arche DNA lab Arche DNA lab A DNS laborban lucfenyıvel korábban nem dolgoztak A recens lucfenyı anyag elemzése a fosszilist követte (szennyezés elkerülése érdekében) A DNS ısiségének bizonyítása: minta kontroll, reagens kontroll, PCR reakciók és szekvenálás ismétlése külföldi laborban (Uppsala University) A pollen minták fagyasztást követıen közvetlen a PCR reakciók elıtt lettek összetörve (5 pollen egy PCR csıben)

15 Minták: 10 fosszilis lucfenyı mag 4 fosszilis tobozpikkely MÓDSZEREK PCR & SZEKVENÁLÁS 462 fosszilis lucfenyı pollen 58 modern lucfenyı tőlevél PCR mixes: 5 ul of the template solution), 1x reaction buffer, 1.5 mm MgCl2, 0.1 mm dntp (each), pmmole F and R primer, and 0.4 U of AmpliTaq Gold polymerase. PCR produktum tesztelése agaróz gélen ráamplifikálás szekvenálás Marker választás: pszeudo-gének, mikroszatelliták, intergénikus spacer-ek és intronok (rövid bázispáros szakaszok. ndhcp-ndhkp ndhk-for1 CACTTCAGTTCTTGTTGTTCC pseudogenes ndhc_ndhk-rev TCGCCACAGAACCAACGATG psbm-trnd psbm_trnd-f1 GTTCGAGTAACGGAATCTAAC intergene spacer psbm_trnd-rev1 CGAACGTCTTCTGGAGTAGC B: (ORF46b) B-for GCTTATGGCATTGTTGATGT B-rev TGGGCATTCTAGCTGTATTG D: Pt15169 D-for CTTGGATGGAATAGCAGCC D-rev GGAAGCGCATTAAGGTCATTA trnt-trnl trnt_trnl-sp-f1 CTGAGCTAAGCAGGCTCAATGG intergene spacer trnt_trnl-sp-brev GCATGTTATTATCCTCCCCTAG trnl-intron trnl-intron-f2 GAACGCTCTATTTACACC trnl-intron-rev ACACGTAGAATTGGACTCTATC trnl-trnf Aa_trnLF-for GGTTCAAGTCCCTCTATCCC intergene Aa_trnLF-rev ACTGATCAACTCAACTTGTCATAAG intron trnk2i-r1 CATGAGTCAGGAGAGCGATTGG 136 bp 200 bp bp PCR profile: 10 min at 94 ºC, 45 cycles of 20 sec at 94 ºC, 30 sec at 237 bp 55 ºC, 1 min at 72 ºC, final elongation 7 min at 72 ºC, with 10 spacer ATGG 186 bp ºC as end-temperature. matk-trnk trnk2i-f1 GCCCTCGTTCATGAGAATAACC bp 251 bp 197 bp

16 EREDMÉNYEK 58 modern szekvencia ~ 1550 bázispár össz-hossz + 2 Sweden 28 fosszilis pollen szekvencia bázispár hosszúak (összesen 462 próbálkozás) 22 fosszilis mag és tobozpikkely szekvencia, bázispár hosszúak

17 Recent haplotypes: 9 Region (position): Position (total): B(88) M CK B( ) D(77) 629 D( D(82) 634 TL(168) 834 TL(196) 872 TL(197) 873 TL(206) 882 Li(154) 1081 Li(157) 1084 LF(115) 1279 LF(133) 1297 K2i(134) 1464 Length (bp) MUTÁCIÓS POZÍCIÓK B11?? C 12A+5G A A C G T C G T C T T C 1551 Buk9?? C 11A+6G A A C G T C G T C A T C 1551 CP2?? C 11A+6G C A C G T C G T C A T C 1551 Gtk24?? C 10A+6G A A C G T C G T A A T T 1550 KR8-2?? C 13A+5G A A C G T C G T C A T C 1552 P9?? C 12A+5G C A C G T C G T C A T C 1551 St15?? C 10A+6G A A C G T C G T C A T C 1550 Z7?? C 12A+5G A A C G T C G T C A T C 1551 H12?? T 12A+4G+3A+G A C T G T A G C C A G C 1554 Arche cone: cone? C A C G T C G A T C 901 Arche seeds: seed3 A A C 124 seed4 T A 237 seed8? C A C G T C G 575 seed9? C 10A+7G G T C G A T C 990 seed10? A A C G T A G T C C 1016 Arche pollen grains: a-b-p1 C 10A+6G 212 a-d-p2 C A C 124 a-d-p3 C A C 124 a-tl-p4 G T C G 251 a-tl-p5 G T C G 251 a-tl-p6 G T C G 251 a-tl-p7 G T C G 251 a-tl-p8 G T C G 251 a-tl-p9 G T C G 251 a-tl-p10 G T C G 251 a-tl-p11 G T C G 251 a-tl-p12 G T A G 251 a-tl-p13 A G A A 251 a-ck-p14? 136 a-ck-p15? 136 a-m-p16? 200 a-m-p17? 200 Két fosszilis szekvencia kizárólag a fosszilis anyagban fordult elı A mai populáció gyakori és a ritka alléljei egyaránt elıkerültek a fosszilis mintákból, és érdekes jelenség, hogy a mai ritka allélek a fosszilis mintákban gyakoribbak voltak 13 pont mutációt észleltünk 5 in/del polimofizmust

18 A İSI DNS SZEKVENIÁK AUTENTIKUSSÁGÁT TÁMOGATÓ EREDMÉNYEK A reagens és minta kontrollok nem amplifikáltak DNS-t Az agaróz gélen tiszta és egyértelmő csíkok Olyan haplotipusok voltak jelen az ısi anyagban amik ma hiányoznak a területrıl A vizsgálatok replikálhatóak voltak egy független külföldi laborban

19 Alapstatisztikák: polimorfizmus, populációk differenciáltsága és génáramlás mérése az ısi és recens populációk közt No. haplotype s Haplotype diversity (Hd) Nucleotide diversity (π) Average no. differences (k) Fst Ks Kst B Ancient Recent ** D Ancient Recent ** TL Ancient Recent * Li Ancient Recent ** LF Ki Ancient Recent Ancient Recent A koraholocén populáció genetikai diverzitása magasabb volt mint a ma élı populációé ns ns ** - significant at p < 0.01 * - significant at p < 0.05 ns not significant

20 MAXIMUM PARSZIMÓNIA FÁK A KLOROPLASZT DNS SZEKVENCIÁK ALAPJÁN İsi DNS szekvenciák

21 A LUCFENYİ KÉSİGLACIÁLIS ÉS KORAHOLOCÉN POLLEN AKKUMULÁCIÓS RÁTÁJÁNAK (PAR) IDİBELI VÁLTOZÁSA A BRAZI-TÓ ÜLEDÉKSZELVÉNYÉBEN Picea abies PAR (grains cm-2 yr-1) Age (kyr cal yr BP) PAR zones positions Az ısi DNS of the minták adna pozíciója samples Populáció méret csökkenés A piros szaggatott vonal a PAR 3-tagú mozgó átlagát mutatja

22 A LUCFENYİ KÉSİGLACIÁLIS ÉS KORAHOLOCÉN POPULÁCIÓDINAMIKÁJA POLLEN, SZTÓMA ÉS MAKROFOSSZÍLIA ANALÍZIS ALAPJÁN Depth cm Picea abies (stomata) Timescale (cal yr BP) Picea abies (periderm) Picea abies (leaves) Picea abies (bud scale) Picea abies (pollen) Relative frequency (%) Concentration (number of remains per 10 cm 3 ) Sum Trees Sum Shrubs Concentration (number of remains on slide) First accurrance of Picea abies on lakeshore Sum Herbs TDB-1 (1770 m) Age cal yr BP Depth cm Picea abies Corylus Early Holocene warming 11,700-10, cal yr BP rapid increase in woody 400 cover, dense Larix forest around the lake Younger Dryas cooling 12,900-11, cal yr BP regional expanison of Artemisia and Chenopodiaceae; decreasing tree cover on the lakeshore, but Picea abies survives Bolling/Allerod warming 14,450-12,900 cal yr BP; establishment of Pinus mugo,larix decidua, Pinus cembra and Picea abies on the lakeshore Carpinus betulus Fagus Oldest Dryas cold phase > 14,450 cal yr BP lakeshore treless, 600 steppe tundra and alpine herbs (Soldanella, Primula) A lucefnyı 13,900 évvel ezelıtt telepedett meg a Brazi-tó partján, a késıglaciálisban majdnem folyamatos a jelenléte, a Fiatal Driász lehőlési fázis egy rövid szakaszán fosszíliái hiányoznak a térségben ekkor is jelen van, de a tó partjáról visszahúzódik Taul Zanogutii (1900 m) Picea 600 Holocén pollenszelvények a Brazitóból és a Zenóga-tóból. Arra utalnak, hogy a lucfenyı a Farcas hegységben et al az elmúlt évben gyakori volt, de kiterjedése jelentısen fluktuált

23 A RETYEZÁT-HEGYS HEGYSÉG ÉS A KÖRNYEZ RNYEZİ TERÜLETEK TÁJHASZN JHASZNÁLATI TÉRK RKÉPE A lucfenyvesek korlátozott kiterjedést érnek csak el a Retyezáthegységben, az északi oldalon nagyobb az állomány A hegyi rétek és legelık kiterjedés nagy a déli oldalon, erdıirtás? Forrás: Grodzinska et al. 2004

24 A Lolaia gleccser maximális kiterjedése 16 ezer éve A lucfenyı hipotetikus refúgiumai a gleccserek maximális kiterjedése idején Reuther et al Reuther et al Taul dinte Brazi (1740 m) A lucfenyı koraholocén expanziójának iránya A genetikai, pollen EREDMÉNYEK- akkumulációs fosszilis pollen, KONKLÚZIÓK ráták sztóma 3 és makrofosszília drasztikus Adataink arra populációméret utalnak, adatok együttesen hogy csökkenést a koraholocén, hogy még az elmúlt a terjedıben lucfenyı a lévı hegységben, évben lucfenyı arra utalnak, rögzítettek valószínőleg (bottleneck). populáció genetikai Ezek alacsonyabb nagy diverzitása tszf magasságokban nagyobb volt mint élte a túl hegységben az utolsó valószínőséggel hozzájárultak a ma élı eljegesedés populációé, maximumát, és a koraholocén a késıglaciális lucfenyı populáció több mára expanzió genetikai kihalt allélt ezekbıl variabilitásának is hordozott. a lokális populációkból csökkenéséhez, indult és elképzelhetı meg. hogy több ısi alléltípus is áldozatául esett a hirtelen állománycsökkenésnek, melyek közül a legerısebb a középkorra tehetı (antropogén erdıirtások sorozata).

25 KONZERVÁCIÓ-BIOLÓGIAI KÖVETKEZTETÉSEK A Kárpátokban a hegység szabdalt morfológiájának következtében, kis területen változatos génállományú fapopulációk élnek (a fenyıfajok esetében a populációk genetikai differenciáltsága is jóval nagyobb itt mint az Alpokban!!!) Ezt a különösen gazdag génállományt fokozottan védeni kell a jövı érdekében! İsi és modern DNS adataink a pollen alapú demográfiai rekonstrukcióval kiegészítve arra utaltak, hogy az erdıirtások MÁR CSÖKKENTETTÉK A LUCFENYİ GENETIKAI DIVERZITÁSÁT A RETYEZÁT- HEGYSÉGBEN, ami a faj alkalmazkodóképességének a csökkenését is maga után vonhatja. Fontos tehát a meglévı állományok fokozott védelme, a természetes terjedés elısegítése a déli oldalon a legeltetés korlátozásával. KORAHOLOCÉN (11000 ÉVE) MAI ÁLLAPOT

26 KÖSZÖNÖM M A FIGYELMET! Támogatóink: European Commission (MERG-CT Combining palaeoecology and palaeogenetics ), OTKA PD73234

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

KE SO NEGYEDKORI KVANTITATI V KO RNYEZETI E S KLI MAREKONSTRUKCIO K

KE SO NEGYEDKORI KVANTITATI V KO RNYEZETI E S KLI MAREKONSTRUKCIO K LATE QUATERNARY QUNATITATIVE ENVIRONMENTAL AND CLIMATE RECONSTRUCTIONS IN THE SOUTH CARPATHIANS KE SO NEGYEDKORI KVANTITATI V KO RNYEZETI E S KLI MAREKONSTRUKCIO K A DE LI KA RPA TOKBAN PROLONG PROJEKT

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai probléma vizsgálata genetikai módszerekkel

Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai probléma vizsgálata genetikai módszerekkel Földtan, őslénytan, flóra, fauna, természetvédelem www.mecsek.gportal.hu 2013.07.01. Szerkesztő: Fazekas Imre E-mail: fazekas.hu@gmail.com Magyar vakcsiga (Bythiospeum hungaricum (Soós, 1927)) egy szisztematikai

Részletesebben

A genetikai sodródás

A genetikai sodródás A genetikai sodródás irányított, nem véletlenszerű Mindig a jobb nyer! természetes szelekció POPULÁCIÓ evolúció POPULÁCIÓ A kulcsszó: változékonyság a populáción belül POPULÁCIÓ nem irányított, véletlenszerű

Részletesebben

A klímaváltozás hatása a tartószerkezetekre és az építési szabványokra

A klímaváltozás hatása a tartószerkezetekre és az építési szabványokra A klímaváltozás hatása a tartószerkezetekre és az építési szabványokra Rózsás Árpád, Kovács Nauzika Ph.D., Vigh László Gergely Ph.D. Problémafelvetés, motiváció Épületek, civil infrastruktúra ~ 80% nemzeti

Részletesebben

Filogenetikai analízis. Törzsfák szerkesztése

Filogenetikai analízis. Törzsfák szerkesztése Filogenetikai analízis Törzsfák szerkesztése Neighbor joining (szomszéd összevonó) módszer A fában egymás mellé kerülı objektumok kiválasztása a távolságmátrix értékei és az objektumoknak az összes többivel

Részletesebben

First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.

First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25. First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

képe. Kutatási területe: a Kárpát-medence skori H, Science in Archaeology m, m y ü-

képe. Kutatási területe: a Kárpát-medence skori H, Science in Archaeology m, m y ü- K K A mb y u b M M y v bb u m - y b Nyu ( u F b ) y m y b m v j yü, m j v um u m y - bó u m y, m u m y x- u b ü. S v m y, m v ó yv y u m y ü, v m y, v m m ü -. A u m y u j m 19. b m, m mó m v y ó. E v

Részletesebben

Igazságügyi genetika alapjai

Igazságügyi genetika alapjai Nyomok - Death Valley, CA 2007 / 10 / 11 Igazságügyi genetika alapjai Molekuláris orvostudomány - molekuláris bűnjelek genetikai analízise Pádár Zsolt Igazságügyi genetika vannak az ÉLET dolgai és vannak

Részletesebben

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2.

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2. BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február 1. Az IPK bemutatása 2. A TILLING módszer Hol található az IPK? Gatersleben Általános adatok az IPK-ról Leibniz

Részletesebben

Gyakorlati bioinformatika

Gyakorlati bioinformatika Gyakorlati bioinformatika Szekvenciaillesztés PhD kurzus 2. Szekvenciaillesztés Bagossi Péter Fajtái: - egyszer ill. többszörös illesztés - globális ill. lokális illesztés Alkalmazása: - adatbázisokban

Részletesebben

A Kárpát-medence avar és honfoglalás kori lóállományának archaeogenetikai elemzése

A Kárpát-medence avar és honfoglalás kori lóállományának archaeogenetikai elemzése A Kárpát-medence avar és honfoglalás kori lóállományának archaeogenetikai elemzése Priskin Katalin Ph.D értekezés tézisei Témavezetı: Prof. Dr. Raskó István Szegedi Tudományegyetem, Biológia Doktori Iskola

Részletesebben

Fotók a Lápi póc Fajvédelmi Mintaprogram megvalósításáról

Fotók a Lápi póc Fajvédelmi Mintaprogram megvalósításáról 2. sz. melléklet 2009. szeptember 17. Fotók a Lápi póc Fajvédelmi Mintaprogram megvalósításáról Réti csík (Misgurnus fossilis) telepítés az 1. sz. Illés-tó halmegtartó képességének tesztelésére (a jobb

Részletesebben

A Natura 2000 területekhez kapcsolódó eljárások kritikus mérlegelési kérdései

A Natura 2000 területekhez kapcsolódó eljárások kritikus mérlegelési kérdései A Natura 2000 területekhez kapcsolódó eljárások kritikus mérlegelési kérdései 2010. január 11. Ambrusné dr. Tóth Éva JNOB, Nemzetközi Fıosztály Bevezetés Nem kell félretenni a 275/2004. (X. 8.) Korm. rendeletet

Részletesebben

Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei

Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei A World Internet Project magyarországi kutatása országos reprezentatív minta segítségével készül.

Részletesebben

Directors and Officers Liability Insurance Questionnaire Adatlap vezetõ tisztségviselõk és felügyelõbizottsági tagok felelõsségbiztosításához

Directors and Officers Liability Insurance Questionnaire Adatlap vezetõ tisztségviselõk és felügyelõbizottsági tagok felelõsségbiztosításához Directors and Officers Liability Insurance Questionnaire Adatlap vezetõ tisztségviselõk és felügyelõbizottsági tagok felelõsségbiztosításához 1. Name, legal form and address of company Társaság neve, címe,

Részletesebben

FÖLDRAJZ ANGOL NYELVEN

FÖLDRAJZ ANGOL NYELVEN Földrajz angol nyelven középszint 1411 ÉRETTSÉGI VIZSGA 2015. május 14. FÖLDRAJZ ANGOL NYELVEN KÖZÉPSZINTŰ ÍRÁSBELI ÉRETTSÉGI VIZSGA JAVÍTÁSI-ÉRTÉKELÉSI ÚTMUTATÓ EMBERI ERŐFORRÁSOK MINISZTÉRIUMA Paper

Részletesebben

9. Táppénz Sick-pay TÁPPÉNZ SICK-PAY 159

9. Táppénz Sick-pay TÁPPÉNZ SICK-PAY 159 9. Táppénz Sick-pay 9.1. Kifizetőhelyi betegszabadsági adatok... 160 Sick-leave data on payment offices 9.2. Összefoglaló táppénzes adatok... 160 Aggregate sick-pay data 9.3. Táppénzes adatok a foglalkoztatás

Részletesebben

ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY

ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY A feladatsor három részből áll 1. A vizsgáztató társalgást kezdeményez a vizsgázóval. 2. A vizsgázó egy szituációs feladatban vesz részt a

Részletesebben

Az ökológia alapjai. Dinamikus állatföldrajz. Az egyedek tér-időbeli eloszlása, szétterjedés ökológiája

Az ökológia alapjai. Dinamikus állatföldrajz. Az egyedek tér-időbeli eloszlása, szétterjedés ökológiája Az ökológia alapjai Dinamikus állatföldrajz. Az egyedek tér-időbeli eloszlása, szétterjedés ökológiája Állatföldrajz Tárgya: a fajok elterjedése, ennek folyamatai ill. okai Néhány alapfogalom Fauna: valamely

Részletesebben

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós Összefoglalás A humángenetika korunk egyik legdinamikusabban fejlődő tudományága. Ennek a fejlődésnek legfőbb mozgatórugója az, hogy a humángenetika,

Részletesebben

Tájékoztató az M0 autóút északi szektor 11. és 10. sz. fıutak közötti szakaszáról

Tájékoztató az M0 autóút északi szektor 11. és 10. sz. fıutak közötti szakaszáról Tájékoztató az M0 autóút északi szektor 11. és 10. sz. fıutak közötti szakaszáról Miért van szükség az M0-ra? Budapestnek az országon belül elfoglalt helye és szerepe, továbbá a fıváros és agglomerációs

Részletesebben

ARCHEOGENETIKA (RÉGÉSZETI GENETIKA) Raskó István

ARCHEOGENETIKA (RÉGÉSZETI GENETIKA) Raskó István ARCHEOGENETIKA (RÉGÉSZETI GENETIKA) Raskó István Összefoglalás Sokan azt gondolják, hogy a DNS tanulmányozásával a jövőnk számára fontos kérdésekre kaphatunk választ. Az archeogenetika, vagy génrégészet

Részletesebben

Tájékozódási futás és természetvédelem. Vajda Zoltán Kiskunsági Nemzeti Park Igazgatóság biológus osztályvezető

Tájékozódási futás és természetvédelem. Vajda Zoltán Kiskunsági Nemzeti Park Igazgatóság biológus osztályvezető Tájékozódási futás és természetvédelem Vajda Zoltán Kiskunsági Nemzeti Park Igazgatóság biológus osztályvezető Miért van szükség védett területekre? Élőhelyek pusztulása Klímaváltozás Lecsapolás Beruházások

Részletesebben

B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK

B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK Korom Edit, Pinke Orsolya, Veress Gyula, Kovács Balázs, Szabó Gyula, Varga László Mezőgazdasági Biotechnológiai Kutatóközpont,

Részletesebben

31. Hét 2009. július.31. Péntek

31. Hét 2009. július.31. Péntek Napii Ellemzéss 31. Hét 2009. július.31. Péntek Összegzés Kedvezı makrogazdasági adatok által támogatott optimista hangulatban telt a tegnapi amerikai kereskedés. Már a nyitásban jelentıs pluszok mutatkoztak

Részletesebben

Az akácgazdálkodás biológiai alapjai. Borovics Attila Cseke Klára Csiha Imre Keserű Zsolt Koltay András Rédei Károly

Az akácgazdálkodás biológiai alapjai. Borovics Attila Cseke Klára Csiha Imre Keserű Zsolt Koltay András Rédei Károly Az akácgazdálkodás biológiai alapjai Borovics Attila Cseke Klára Csiha Imre Keserű Zsolt Koltay András Rédei Károly Az akác ellentmondásos megítélése akác nagyhatalom vagyunk nincs még egy olyan fafajunk,

Részletesebben

Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben

Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben * BUDAPESTI EÖTVÖS LORÁND * TUDOMÁNYEGYETEM Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben DOKTORI ÉRTEKEZÉS Készítette: Egyed Balázs

Részletesebben

Fenntartható fejlődés vs. nemnövekedés. Tóth Gergely

Fenntartható fejlődés vs. nemnövekedés. Tóth Gergely Fenntartható fejlődés vs. nemnövekedés Tóth Gergely Témák 1. Nemnövekedés? 2. Történelmi ökolábnyom 3. Paradigmaváltók Forduljatok vissza fiúk. Ez csapda! Nemnöveked és Témák 1. Nemnövekedés? 2. Történelmi

Részletesebben

Bemutatkozás Dr. Lehoczky István. 2013. december 4..

Bemutatkozás Dr. Lehoczky István. 2013. december 4.. Bemutatkozás Dr. Lehoczky István 2013. december 4.. A baromfihoz eddig ilyen viszony fűzött Képzettség: 1991 1995. Szinyei Merse Pál Gimnázium, Budapest, Érettségi. 1995 2001. Kaposvári Egyetem, Állattudományi

Részletesebben

BUDAPESTI KÖZELKÉP PAJZSTETVEK VÁROSI KÖRNYEZETBEN FETYKÓ KINGA DR. SZITA ÉVA KONCZNÉ BENEDICTY ZSUZSANNA MTA ATK NÖVÉNYVÉDELMI INTÉZET

BUDAPESTI KÖZELKÉP PAJZSTETVEK VÁROSI KÖRNYEZETBEN FETYKÓ KINGA DR. SZITA ÉVA KONCZNÉ BENEDICTY ZSUZSANNA MTA ATK NÖVÉNYVÉDELMI INTÉZET BUDAPESTI KÖZELKÉP PAJZSTETVEK VÁROSI KÖRNYEZETBEN FETYKÓ KINGA DR. SZITA ÉVA KONCZNÉ BENEDICTY ZSUZSANNA MTA ATK NÖVÉNYVÉDELMI INTÉZET ISMERKEDJÜNK A PAJZSETVEKKEL [HEMIPTERA - COCCOIDEA] MEGHÖKKENTŐEN

Részletesebben

A biomassza, mint energiaforrás. Mit remélhetünk, és mit nem?

A biomassza, mint energiaforrás. Mit remélhetünk, és mit nem? MTA Kémiai Kutatóközpont Anyag- és Környezetkémiai Intézet Budapest II. Pusztaszeri út 59-67 A biomassza, mint energiaforrás. Mit remélhetünk, és mit nem? Várhegyi Gábor Biomassza: Biológiai definíció:

Részletesebben

Az északi pocok mtdns kontroll régiójának elemzése

Az északi pocok mtdns kontroll régiójának elemzése Az északi pocok mtdns kontroll régiójának elemzése DIPLOMADOLGOZAT készítette: ANTAL FERENC biológus hallgató témavezető: Dr. PUTNOKY PÉTER PTE TTK Biológiai Intézet Genetikai és Molekuláris Biológiai

Részletesebben

Fulbright Bizottság Budapest

Fulbright Bizottság Budapest Fulbright Bizottság Budapest Budapest Tel.: 462-8040 Fax: 252-0266 Baross u. 62. info@fulbright.hu H-1082 www.fulbright.hu Híd emberek és kultúrák között: A Fulbright Program Magyarországon Dr. Brückner

Részletesebben

Kérdések. M5M0001 Mikor jöttek létre Magyarországon az elsı egyetemek? Jelölje meg a helyes választ!

Kérdések. M5M0001 Mikor jöttek létre Magyarországon az elsı egyetemek? Jelölje meg a helyes választ! Kérdések M5M0001 Mikor jöttek létre Magyarországon az elsı egyetemek? Jelölje meg a helyes választ! A 12. és 13. század fordulóján A 13. és 14. század fordulóján A 14. és 15. század fordulóján M5M0002

Részletesebben

DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN

DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN DOKTORI (PhD) ÉRTEKEZÉS TÉZISEI PANNON EGYETEM GEORGIKON MEZŐGAZDASÁGTUDOMÁNYI KAR Állattudományi és Állattenyésztéstani Tanszék Tanszékvezető Dr. Husvéth Ferenc egyetemi tanár, az MTA doktora Készült

Részletesebben

Magyar tıke külföldön. Budapest 2008. nov. 6.

Magyar tıke külföldön. Budapest 2008. nov. 6. Magyar tıke külföldön Budapest 2008. nov. 6. A globalizáció eredménye a növekvı tıkemozgás a világgazdaságban A magyar közgondolkodás középpontjában eddig a beáramló mőködı tıke állt Ha komolyan vesszük

Részletesebben

ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY

ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY ANGOL NYELV KÖZÉPSZINT SZÓBELI VIZSGA I. VIZSGÁZTATÓI PÉLDÁNY A feladatsor három részbol áll 1. A vizsgáztató társalgást kezdeményez a vizsgázóval. 2. A vizsgázó egy szituációs feladatban vesz részt a

Részletesebben

A biodiverzitás és természetvédelem finanszírozási kérdései (EU finanszírozás 2014-2020)

A biodiverzitás és természetvédelem finanszírozási kérdései (EU finanszírozás 2014-2020) A biodiverzitás és természetvédelem finanszírozási kérdései (EU finanszírozás 2014-2020). Marczin Örs természetvédelmi fejlesztési referens Vidékfejlesztési Minisztérium, Természetmegırzési Fıosztály A

Részletesebben

A Hardy-Weinberg egyensúly. 2. gyakorlat

A Hardy-Weinberg egyensúly. 2. gyakorlat A Hardy-Weinberg egyensúly 2. gyakorlat A Hardy-Weinberg egyensúly feltételei: nincs szelekció nincs migráció nagy populációméret (nincs sodródás) nincs mutáció pánmixis van allélgyakoriság azonos hímekben

Részletesebben

Éghajlati tendenciák és idıjárási

Éghajlati tendenciák és idıjárási Éghajlati tendenciák és idıjárási szélsıségek a Kárpát-medencében Bozó László, Szalai Sándor, Bihari Zita Országos Meteorológiai Szolgálat Európai Meteorológiai Infrastruktúra (EMI) Nemzeti (Hidro-)Meteorológiai

Részletesebben

Találkozz a Tudóssal! A geológus egy napja. A hard rock-tól a környezetgeokémiáig

Találkozz a Tudóssal! A geológus egy napja. A hard rock-tól a környezetgeokémiáig Találkozz a Tudóssal! A geológus egy napja. A hard rock-tól a környezetgeokémiáig www.meetthescientist.hu 1 26 ? ÚTKERESÉS?? Merre menjek? bankár fröccsöntő?? politikus? bogarász?? jogász? tudományos kutató

Részletesebben

PATAKLAKÓ KÜLLŐFÉLÉK (CYPRINIDAE, GENUS: GOBIO) GENETIKAI VIZSGÁLATA REJTETT (KRIPTIKUS) FAJOK A KÁRPÁT-MEDENCÉBEN?

PATAKLAKÓ KÜLLŐFÉLÉK (CYPRINIDAE, GENUS: GOBIO) GENETIKAI VIZSGÁLATA REJTETT (KRIPTIKUS) FAJOK A KÁRPÁT-MEDENCÉBEN? Takács et al. Pataklakó küllőfélék PATAKLAKÓ KÜLLŐFÉLÉK (CYPRINIDAE, GENUS: GOBIO) GENETIKAI VIZSGÁLATA REJTETT (KRIPTIKUS) FAJOK A KÁRPÁT-MEDENCÉBEN? Takács Péter PhD, tudományos munkatárs, MTA Ökológiai

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

33. Hét 2009. augusztus. 11. Kedd

33. Hét 2009. augusztus. 11. Kedd Napii Ellemzéss 33. Hét 2009. augusztus. 11. Kedd Összegzés Enyhén negatív nyitás, majd lassú egész napos csorgás jellemezte a tegnapi amerikai kereskedést, mely jelentısebb makrogazdasági és vállalati

Részletesebben

A természetvédelem finanszírozási lehetıségei magánszemélyek

A természetvédelem finanszírozási lehetıségei magánszemélyek A madárbarát Magyarországért! www.mme.hu A természetvédelem finanszírozási lehetıségei magánszemélyek Halmos Gergı Magyar Madártani és Természetvédelmi Egyesület Országos konferencia a biológiai sokféleség

Részletesebben

Nincs öntermékenyítés, de a véges méret miatt a párosodó egyedek bizonyos valószínűséggel rokonok, ezért kerül egy

Nincs öntermékenyítés, de a véges méret miatt a párosodó egyedek bizonyos valószínűséggel rokonok, ezért kerül egy Véges populációméret okozta beltenyésztettség incs öntermékenyítés, de a véges méret miatt a párosodó egyedek bizonyos valószínűséggel rokonok, ezért kerül egy utódba 2 IBD allél Előadásról: -F t (-/2)

Részletesebben

PALEOBOTANIKAI KUTATÁSOK VÉRTES LÁSZLÓ ÁSATÁSAIN

PALEOBOTANIKAI KUTATÁSOK VÉRTES LÁSZLÓ ÁSATÁSAIN 11 PALEOBOTANIKAI KUTATÁSOK VÉRTES LÁSZLÓ ÁSATÁSAIN Abstract MEDZIHRADSZKY ZSÓFIA MTM Növénytár Email: medzi@bot.nhmus.hu In the present paper the results of the palaeobotanical investigations carried

Részletesebben

Felhasználói tulajdonú főtési rendszerek korszerősítésének tapasztalatai az Öko Plusz Programban

Felhasználói tulajdonú főtési rendszerek korszerősítésének tapasztalatai az Öko Plusz Programban Felhasználói tulajdonú főtési rendszerek korszerősítésének tapasztalatai az Öko Plusz Programban Várt és elért megtakarítások Némethi Balázs Fıtáv Zrt. 2009. szeptember 15. 1 Elızmények A Fıtáv az Öko

Részletesebben

5. Molekuláris biológiai technikák

5. Molekuláris biológiai technikák 5. Molekuláris biológiai technikák DNS szaporítás kémcsőben és élőben. Klónozás, PCR, cdna, RT-PCR, realtime-rt-pcr, Northern-, Southernblotting, génexpresszió, FISH 5. Molekuláris szintű biológiai technikák

Részletesebben

Felhők teljesítményelemzése felhő alapokon

Felhők teljesítményelemzése felhő alapokon Felhők teljesítményelemzése felhő alapokon Kocsis Imre ikocsis@mit.bme.hu HTE Infokom 2014 Budapest University of Technology and Economics Department of Measurement and Information Systems 1 IT Szolgáltatásmenedzsment

Részletesebben

SUBIECTELE Limba maghiar

SUBIECTELE Limba maghiar ROMÂNIA JUDEUL TIMI MUNICIPIUL TIMIOARA DIRECIA DE MEDIU SERVICIUL PROTECIA MEDIULUI SUBIECTELE Limba maghiar pentru competiia intercolar în vederea seleciei unitilor colare (elevi i cadre didactice) care

Részletesebben

Elemzés. A gyalogosátkelıhelyek elé felfestett Nézz körül járdagrafikák észlelése és hatása. Készítette: Gold Communications Kft. 2009.

Elemzés. A gyalogosátkelıhelyek elé felfestett Nézz körül járdagrafikák észlelése és hatása. Készítette: Gold Communications Kft. 2009. Elemzés A gyalogosátkelıhelyek elé felfestett Nézz körül járdagrafikák észlelése és hatása Készítette: Gold Communications Kft. 2009. február Felmérés a GRSP Magyarország Egyesület által felfestett járdagrafikák

Részletesebben

Mi történik a genetikai laboratóriumban?

Mi történik a genetikai laboratóriumban? 12 Mi történik a genetikai laboratóriumban? A brossúra elkészítéséhez segítséget nyújtottak: Dr Ian M Frayling, Orvosi Genetikai Intézet (Institute of Medical Genetics), Walesi Egyetemi Klinika (University

Részletesebben

Klíma és társadalom kapcsolata a Kárpát-medencében az elmúlt 5000 évben Demény Attila 1, Bondár Mária 2, Sümegi Pál 3

Klíma és társadalom kapcsolata a Kárpát-medencében az elmúlt 5000 évben Demény Attila 1, Bondár Mária 2, Sümegi Pál 3 Klíma és társadalom kapcsolata a Kárpát-medencében az elmúlt 5000 évben Demény Attila 1, Bondár Mária 2, Sümegi Pál 3 valamint Cserny Tibor 4, Fábián Szilvia 2, Fórizs István 1, Schöll- Barna Gabriella

Részletesebben

Szakszolgálati engedély formátumok A gyakornok légiforgalmi irányító szakszolgálati engedély formátuma

Szakszolgálati engedély formátumok A gyakornok légiforgalmi irányító szakszolgálati engedély formátuma 2. sz. melléklet a./2006. (.) HM rendelethez Szakszolgálati engedély formátumok A gyakornok légiforgalmi irányító szakszolgálati engedély formátuma Előlap 2. oldal Honvédelmi Minisztérium Katonai Légügyi

Részletesebben

Lehetıségek a thrombosis prophylaxis és kezelés hatékonyságának monitorozásában

Lehetıségek a thrombosis prophylaxis és kezelés hatékonyságának monitorozásában Lehetıségek a thrombosis prophylaxis és kezelés hatékonyságának monitorozásában Tıkés-Füzesi Margit PTE ÁOK Laboratóriumi Medicina Intézete, Pécs Aspirin(ASA) non responder betegek 30-40%a További kezelési

Részletesebben

- Tápoldat Kalkulátor program használata

- Tápoldat Kalkulátor program használata Euphoros Workshop Szentes (HU), 28 June 2011 A tápoldatok t kémik miája - Tápoldat Kalkulátor program használata Luca Incrocci (incrocci@agr.unipi.it) University of Pisa, Pisa, Italy A tápoldat fıbb jellemzıi

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

Discovering cleantech incubation possibilities Conference and stakeholder meeting MEGHÍVÓ/ INVITATION

Discovering cleantech incubation possibilities Conference and stakeholder meeting MEGHÍVÓ/ INVITATION Discovering cleantech incubation possibilities Conference and stakeholder meeting 02-03-04. November 2014 MEGHÍVÓ/ INVITATION 1 2014 November 3 (Hétfő) Gödöllő Helyszín: Szent István Egyetem: 2100 Gödöllő,

Részletesebben

Golden oak - 08. Water oak - 06. Nut - 05. Mahagony - 09. Dark oak - 04

Golden oak - 08. Water oak - 06. Nut - 05. Mahagony - 09. Dark oak - 04 Golden oak - 08 Water oak - 06 Nut - 05 Mahagony - 09 Dark oak - 04 Creme white - 030 Quartz Grey - 031 Coal Grey - 032 Dark green - 033 Brown - 034 Teak terra - 050 Noce Sorrento natur - 051 Noce Sorrento

Részletesebben

A FÉNY ÉS Hİ HATÁSA A PAPRIKA BOGYÓJÁRA THE EFFECT OF LIGHT AND HEAT ON THE PEPPER BERRY

A FÉNY ÉS Hİ HATÁSA A PAPRIKA BOGYÓJÁRA THE EFFECT OF LIGHT AND HEAT ON THE PEPPER BERRY A FÉNY ÉS Hİ HATÁSA A PAPRIKA BOGYÓJÁRA THE EFFECT OF LIGHT AND HEAT ON THE PEPPER BERRY KOVÁCS ANDRÁS -TÓTHNÉ TASKOVICS ZSUZSANNA fıiskolai docens - fıiskolai adjunktus Kecskeméti Fıiskola Kertészeti

Részletesebben

Bérczi László tű. dandártábornok Országos Tűzoltósági Főfelügyelő

Bérczi László tű. dandártábornok Országos Tűzoltósági Főfelügyelő The role of volunteer firefighter organizations, municipality and facility firefighter departments in the unified disaster management system of Hungary Bérczi László tű. dandártábornok Országos Tűzoltósági

Részletesebben

bab.la Cümle Kalıpları: İş Sipariş İngilizce-Macarca

bab.la Cümle Kalıpları: İş Sipariş İngilizce-Macarca bab.la Cümle Kalıpları: İş Sipariş İngilizce-Macarca Sipariş : Verme We are considering the purchase of Gondolkozunk a... vásárlásán. Resmi, çekingen We are pleased to place an order with your company

Részletesebben

bab.la Cümle Kalıpları: İş Sipariş Macarca-İngilizce

bab.la Cümle Kalıpları: İş Sipariş Macarca-İngilizce bab.la Cümle Kalıpları: İş Sipariş Macarca-İngilizce Sipariş : Verme Gondolkozunk a... vásárlásán. We are considering the purchase of Resmi, çekingen Örömmel tudatjuk, hogy szeretnénk Önöktől rendelni...

Részletesebben

OTKA zárójelentés 2004-2007

OTKA zárójelentés 2004-2007 OTKA zárójelentés 2004-2007 Humán vizsgálatok 2004. Korábban összefüggést találtunk a monocyte chemoattractant protein-1 (MCP-1) távoli szabályozó régiójában található polimorfizmusa és az asztma fokozott

Részletesebben

A Páratlanklub 2010 Áprilisi Kérdıíves Felmérésének Kiértékelése

A Páratlanklub 2010 Áprilisi Kérdıíves Felmérésének Kiértékelése A Páratlanklub 2010 Áprilisi Kérdıíves Felmérésének Kiértékelése Készítették: Galli Tamás Nater Ulrike Dátum: 2011. 04. 01. 1 Tartalomjegyzék TARTALOMJEGYZÉK 2 BEVEZETİ 3 PÁRATLANKLUB KÉRDİÍV 4 Elıadás

Részletesebben

és gyakorlat a Dr. Kujáni Katalin Mezőgazdasági Főosztály Földművelésügyi Minisztérium 2015. Május 5.

és gyakorlat a Dr. Kujáni Katalin Mezőgazdasági Főosztály Földművelésügyi Minisztérium 2015. Május 5. EU-s s környezetvk rnyezetvédelmi törekvt rekvések és néhány ny nemzetközi zi jój gyakorlat a sertéságazatban Dr. Kujáni Katalin Mezőgazdasági Főosztály Földművelésügyi Minisztérium 2015. Május 5. Jogszabályi

Részletesebben

Készítette: Dr. Ács Éva Kutatóhelyi témavezető

Készítette: Dr. Ács Éva Kutatóhelyi témavezető Dunakutató Intézet részjelentése a A veszélyeztetett biodiverzitás megőrzése a Pannon ökorégióban: az ökológiai, morfológiai és genetikai diverzitás értékelése szentély jellegű és emberi tájhasználatnak

Részletesebben

RENDEZVÉNYTERMEK / EVENT VENUE

RENDEZVÉNYTERMEK / EVENT VENUE RENDEZVÉNYTERMEK / EVENT VENUE A tökéletes választás rendezvények, csapatépítő tréningek, konferenciák és üzleti találkozók számára. Az épület a város szívében helyezkedik el kiváló tömegközlekedési csatlakozással,

Részletesebben

Bird species status and trends reporting format for the period 2008-2012 (Annex 2)

Bird species status and trends reporting format for the period 2008-2012 (Annex 2) 1. Species Information 1.1 Member State Hungary 1.2.2 Natura 2000 code A129 1.3 Species name Otis tarda 1.3.1 Sub-specific population 1.4 Alternative species name 1.5 Common name túzok 1.6 Season Breeding

Részletesebben

Kedves Tanárok! 1. rész: Prológus

Kedves Tanárok! 1. rész: Prológus Kedves Tanárok! Az alábbi kisfilmek a természettel, környezetvédelemmel foglalkozó emberek, szervezetek munkáját mutatják be. Az egyes fejezetek után kérdéseket teszünk fel a filmekben elhangzott kérdésekkel

Részletesebben

Az özönnövények visszaszorításának helye a természetvédelmi területkezelés rendszerében

Az özönnövények visszaszorításának helye a természetvédelmi területkezelés rendszerében Az özönnövények visszaszorításának helye a természetvédelmi területkezelés rendszerében Fenntartható tájhasznosítás a Peszér-adacsi réteken Dr. Vadász Csaba Kiskunsági Nemzeti Park Igazgatóság Miről lesz

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Élő szolgáltatás; minden egyben ERP+CRM+projektek+folyamatok (workflow is)+csoportmunka. Minden fő, modern böngészőn fut.

Élő szolgáltatás; minden egyben ERP+CRM+projektek+folyamatok (workflow is)+csoportmunka. Minden fő, modern böngészőn fut. Az informatikus jelene és jövője a felhőből nézve, 500 céglátogatás tapasztalata alapján Avagy: mit hoz és mit visz a felhő és a SaaS az informatikusoknak? 10xONE Magyarország 10xONE kik vagyunk? Élő szolgáltatás;

Részletesebben

HAZAI BIOTECHNOLÓGIAI KKV-K A NEMZETKÖZIESEDİ TUDÁSHÁROMSZÖGBEN

HAZAI BIOTECHNOLÓGIAI KKV-K A NEMZETKÖZIESEDİ TUDÁSHÁROMSZÖGBEN NKTH Innotárs program KKVENT_8 HAZAI BIOTECHNOLÓGIAI KKV-K A NEMZETKÖZIESEDİ TUDÁSHÁROMSZÖGBEN Dr. Antalóczy Katalin Halász György Imre Tatabánya, 2010. november 24. IKU Innovációs Kutató Központ (Pénzügykutató

Részletesebben

Az újszülöttkori galactosaemia szűrés eredményei és differenciáldiagnosztikai lehetőségei

Az újszülöttkori galactosaemia szűrés eredményei és differenciáldiagnosztikai lehetőségei Az újszülöttkori galactosaemia szűrés eredményei és differenciáldiagnosztikai lehetőségei Balázs Imre SZTE ÁOK Gyermekgyógyászati Klinika és Gyermekegészségügyi Centrum Anyagcsere-Szűrő Laboratórium Magyar

Részletesebben

Megújuló energiák hasznosítása: a napenergia. Készítette: Pribelszky Csenge Környezettan BSc.

Megújuló energiák hasznosítása: a napenergia. Készítette: Pribelszky Csenge Környezettan BSc. Megújuló energiák hasznosítása: a napenergia Készítette: Pribelszky Csenge Környezettan BSc. A minket körülvevı energiaforrások (energiahordozók) - Azokat az anyagokat, amelyek energiát közvetítenek energiahordozóknak

Részletesebben

A Lynch szindróma molekuláris genetikai háttere Magyarországon

A Lynch szindróma molekuláris genetikai háttere Magyarországon A Lynch szindróma molekuláris genetikai háttere Magyarországon A doktori értekezés tézisei Kovács Marietta Éva Eötvös Loránd Tudományegyetem Természettudományi Kar Biológiai Doktori Iskola Klasszikus és

Részletesebben

Can/be able to. Using Can in Present, Past, and Future. A Can jelen, múlt és jövő idejű használata

Can/be able to. Using Can in Present, Past, and Future. A Can jelen, múlt és jövő idejű használata Can/ Can is one of the most commonly used modal verbs in English. It be used to express ability or opportunity, to request or offer permission, and to show possibility or impossibility. A az egyik leggyakrabban

Részletesebben

ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan

ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan 02/15/39/2008 ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan ÁLLATEGÉSZSÉGÜGYI BIZONYÍTVÁNY rágcsálók Magyar Köztársaságból Japánba történő exportjához Number

Részletesebben

A GMO-k szép új világa (?)

A GMO-k szép új világa (?) A GMO-k szép új világa (?) Sági László E-mail: lacisagi@gmail.com Tematika A géntechnológia alapjai A GM növények előállítási módszerei A GM növények néhány alkalmazása GM növények a piacon Kérdések Géntechnológia

Részletesebben

Újállatidő vagy földtörténeti újkor 67-65 millió évtől máig

Újállatidő vagy földtörténeti újkor 67-65 millió évtől máig Kainozóikum Újállatidő vagy földtörténeti újkor 67-65 millió évtől máig Időszakai: Harmadidőszak (tercier) Kor: Paleocén 67-55 millió év Eocén 55-37 millió év Oligocén 37-25 millió év Miocén 25-5 millió

Részletesebben

Nagyfelbontású magassági szélklimatológiai információk dinamikai elıállítása

Nagyfelbontású magassági szélklimatológiai információk dinamikai elıállítása Nagyfelbontású magassági szélklimatológiai információk dinamikai elıállítása Szépszó Gabriella Országos Meteorológiai Szolgálat Éghajlati Osztály, Klímamodellezı Csoport Együttmőködési lehetıségek a hidrodinamikai

Részletesebben

Készítették/Made by: Bencsik Blanka Joy Chatterjee Pánczél József. Supervisors: Gubán Dorottya Mentorok Dr. Szabó Ervin

Készítették/Made by: Bencsik Blanka Joy Chatterjee Pánczél József. Supervisors: Gubán Dorottya Mentorok Dr. Szabó Ervin Készítették/Made by: Bencsik Blanka Joy Chatterjee Pánczél József Supervisors: Gubán Dorottya Mentorok Dr. Szabó Ervin A fosszilis energiahordozók mennyisége rohamosan csökken The amount fossil fuels is

Részletesebben

Fogalmi meghatározás

Fogalmi meghatározás A terhelés összetevıi Készítette: Gondi Noémi Szegedi Tudományegyetem Juhász Gyula Pedagógusk gusképzı Kar 2007.10.04. Fogalmi meghatározás A terhelés az az alkalmazkodás érdekében szervezetre gyakorolt

Részletesebben

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A TM vizsgálatok alapkérdései A vizsgálatok célja, információértéke? Az alkalmazás területei? Hogyan válasszuk ki az alkalmazott

Részletesebben

Vízi szeizmikus kutatások a Balaton nyugati medencéiben

Vízi szeizmikus kutatások a Balaton nyugati medencéiben Doktoranduszi Beszámoló Vízi szeizmikus kutatások a Balaton nyugati medencéiben Visnovitz Ferenc Környezettudományi Doktori Iskola II. évf. Témavezető: Dr. Horváth Ferenc egyetemi tanár Budapest, 2012.06.04

Részletesebben

Mészáros Anita Dr. Béres Judit Hazai etnikumok/populációk genetikai struktúrája

Mészáros Anita Dr. Béres Judit Hazai etnikumok/populációk genetikai struktúrája Mészáros Anita Dr. Béres Judit Hazai etnikumok/populációk genetikai struktúrája Az emberi genetikai variációk olyan objektív adatok, melyek a történelem során lezajlott vándorlások és rokonsági viszonyok

Részletesebben

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B) 0.1 Member State HU 0.2.1 Species code 1358 0.2.2 Species name Mustela putorius 0.2.3 Alternative species scientific name 0.2.4 Common name házigörény 1. National Level 1.1 Maps 1.1.1 Distribution Map

Részletesebben

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1.

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1. Biobankok a Semmelweis Egyetemen Szalai Csaba 2009. július 1. Molnár Mária Judit MD, PhD A Semmelweis Egyetem Molekuláris Neurológiai Klinikai és Kutatási Központ igazgatója SE Molekuláris Neurológiai

Részletesebben

A parlagfű Magyarországon

A parlagfű Magyarországon Előadás a Környezetvédelmi Világnap alkalmából Csongrád, 2012. június 5. A parlagfű Magyarországon Szerzők: Dr. Juhászné Halász Judit Exner Tamás Parlagfűmentes Magyarországért Egyesület A parlagfű bemutatása

Részletesebben

A fűrészlábú szöcskék (Saga spp.) biológiája, különös tekintettel a Saga

A fűrészlábú szöcskék (Saga spp.) biológiája, különös tekintettel a Saga A fűrészlábú szöcskék (Saga spp.) biológiája, különös tekintettel a Saga pedo (PALLAS, 1771) fajra Doktori (PhD) értekezés tézisei Készítette: Kolics Balázs Témavezetők: Dr. Kondorosy Előd, Pannon és Egyetem

Részletesebben

There is/are/were/was/will be

There is/are/were/was/will be There is/are/were/was/will be Forms - Képzése: [There + to be] [There + létige ragozott alakja] USE - HASZNÁLAT If you simply want to say that something exists or somebody is doing something then you start

Részletesebben