A magyarok genetikai vizsgálata. Dr. Pamzsav Horolma (ISZKI)

Save this PDF as:
 WORD  PNG  TXT  JPG

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "A magyarok genetikai vizsgálata. Dr. Pamzsav Horolma (ISZKI)"

Átírás

1 A magyarok genetikai vizsgálata Dr. Pamzsav Horolma (ISZKI)

2 BEVEZETÉS

3 Kérdés?

4 DNS szerkezet

5 Genetikai örökség

6 Sejt és szervecskéi

7 KROMOSZÓMA KÉSZLET Kariotípus: 23 pár kromoszóma 50 Mb

8 GENOM GENOM = DNS = 6x10 9 bp 3% - kódoló DNS (kb GÉN): 97% - nem kódoló DNS 99,7% - azonos minden emberben 0,3 % - eltér és egyedi: Személyazonosítás és filogenetika

9 Rekombináció: a genetikusok átka X Y X X 1 1

10 50 Mb PAR1 Y KROMOSZÓMA PAR2 Apáról fiúra öröklődik Nincs rekombináció Az információ tehát változatlanul öröklődik át a következő generációra, kivéve a mutációs eseményeket (nem káros mutáció)

11 Az Y kromoszóma vizsgálata Népcsoportok eredetének kutatása és vándorlási útvonalának meghatározása Evolúciós kutatások (kromoszóma evolúció) Ádámkutatás

12 Y-STR (Short Tandem Repeat) és Y-SNP (Single Nucleotide Polymorphism) ősi leszármazott TACGTAGCTAGCTAGCTAGCTAATGCAC TTCGTAGCTAGCTAGCTAATGCACGCTA HAPLOTÍPUS STR vizsgálatokkal definiálható, rövid távú rokonsági vizsgálatra alkalmas HAPLOCSOPORT SNP vizsgálatokkal definiálható, hosszú távú rokonsági vizsgálatra (UME, 1:50 Millióhoz)

13 HOGYAN LEHET MODELLEZNI A HAPLOCSOPORTOK KIALAKULÁSÁNAK IDEJÉT? Biallélikus SNP markerek esetében: Emberszabásúak (csimpánz) szekvencia analíziséből lehet az ősi SNP (UME) státuszokra következtetni, az egymás után megjelenő mutációk T időpontokban következnek. STR markerek esetében: A különböző SNP státuszú Y kromoszómák (A,B,C,D) kialakulása közötti időszakban STR mutációk következtében sokféle Y kromoszóma alakul ki. Viszont T időpontokban az új SNP státuszú Y kromoszómák közül csak egyből lehetséges a többi STR státuszú kromoszóma kialakulása (bottleneck). Peter de Knijff, Am. J. Hum. Genet. 67: , 2000.

14 Y-kromoszómális Ádám és mitokondriális Éva öröksége

15 HAPLOCSOPORT=İSAPA Európai ısapák születése és terjeszkedése: Genographic Project

16 A Homo sapiens sapiens kirajzása Afrikából: éve

17 Eurázsiai Ádám: éve M168(C/T): C-R, ma élő összes nem afrikai férfi őse M343: R1b M173: R1 M207: R M89: F (F-R), nem afrikaiak 90-95%-a Közel-Kelettől Ausztráliáig M9: K(K-R): Irán v. Közép-Ázsia, leszármazottai: eurázsiai klán M45: P (P-R): A mutáció Közép-Ázsiában egy férfiben keletkezett, aki a legtöbb európai és amerikai indián őse volt.

18 Haplocsoport R*: M év R*: hordozó, aki Közép-Ázsiában hosszú időt töltött és utódai két csoportra váltak: R1 és R2

19 Korai ázsiai bevándorlók Európában: R* utódai R1a1 R1b1 Az R1a1-M198 mutáció egy férfiben keletkezett, aki évvel ezelőtt élt a mai Irán vagy Kaukázus területén. Az indoeurópai nyelv elterjedése valószínűleg az ő utódainak köszönhető. Kurgán kultúra: halomsír (Szkíták) Az R1b1-P25 mutációt hordozók az egyik elmélet szerint lehettek a cromagnoni emberek, akik Európát benépesítették. A cro-magnoni emberek nevéhez fűződik az un. aurignaci kultúra (párhuzamos élű, pengeszerű kőeszközök és finoman megmunkált csonteszközök).

20 Európai őslakosok: vadászok és gyűjtögetők I I-M170 kromoszómát hordozó férfiak éve a Közel-Keletről a Balkánon keresztül jöttek Európába. Az utódaik valószínűleg alapították és terjesztették az un. Gravetti kultúrát (apró "mikrogravett" nyílhegyekről). I1 Az I1-M253 kromoszóma kb éve alakult ki, valószínűleg az Ibériai félszigeten, többek között itt kerestek menedéket az emberek az utolsó jégkorszak idején. Napjainkban inkább Észak- és Nyugat-Európában élnek (pl. Skandinávia).

21 Európai őslakosok: vadászok, gyűjtögetők I2a A I2a-P37.2 mutáció kb ezer évvel ezelőtt keletkezett egy férfiban, aki a Balkánon élt, ez a terület menedéket jelentett a jégkorszak zordsága elől. Napjainkban az I2a kromoszómát hordozó férfiak leszármazottai főleg Közép- és Kelet- Európában élnek nagy létszámban. I2b Az I2b az M223 pontmutációval definiálható, kb ezer évvel ezelőtt keletkezett egy férfiban, aki Dél- Franciaország területén élt. Az I2b kromoszómát hordozó férfiak Németországban és Horvátországban elég gyakoriak (11%).

22 Földművelők, állattenyésztők utódai (kb. 20% Európában) G J2 E1 A J2, G és E (Kelet Afrika? )haplocsoportok a Közel-Keleten alakultak ki és onnan terjedtek el. A neolitikum (kb éve) idején jutottak el Európába, amit régészeti leletek is alátámasztanak pl. un. lineáris fazekasság és lenyomatos kerámia (kézművesség). Ők terjesztették el Európában a földművelést és az állattenyésztést.

23 Az N haplocsoport elterjedése

24 A Q ısapa születését (M242 mutáció keletkezését) év közé datálják, inkább Észak Eurázsiában

25 EREDMÉNYEK

26 Recens magyar populáció haplocsoport megoszlása: 230 férfi R1a1 nagyon gyakori Kelet- Európában és Indiában. R1b1 Nyugat-Európában H1: Jelenleg Indiában gyakori, helyi törzsekben és alacsony kasztbeliekben 25-30%. I1 Skandináviában, I2a Közép- és Kelet-Európában, I2b Németországban és Horvátországban gyakori. Uráli nyelvet beszélők: N1c 1% J2 haplocsoport A mediterrán területeken és a Kaukázus vidékén, Dél- és Kelet-Indiában is gyakori. E1 Balkánon, G haplocsoport Kaukázusban.

27 Székely populáció (Csíkszereda)

28 Csángó populáció (Gyímes) R1a1: 24,4% P (Q): 3,8 %

29 HOL KELETKEZTEK az N1c, R1a1 és Q HAPLOCSOPORTOK?

30 Az N haplocsoport (M231) vándorlási útvonala Yunnan: Ausztroázsiai nyelvek és a protoindokínai típus északi változatának őshazája N1c-Tat: Észak- Kína: év Dél-Szibéria Urálon keresztül Északkelet-Európába év Proto-ugor:8000 év

31 N ısapa leszármazási vonala év év N-M231 ősapa N1-LLY22g ősapa év N1a-M128 ősapa N1b-P43 ősapa N1c-Tat ősapa év év N1c-L708ősapa N1c-L1034ősapa

32 N1c-L1034 (2400+/-1200 év)

33 Az R1a1 feltételezett keletkezési helyei Ukrajna Közép-Ázsia Észak-India Közel-Kelet

34 Az R1a1 alcsoportjai R1a1-M198 R1a1-M458 szláv TMRCA év R1a1-Z280 közép-európai év R1a1-Z93 ázsiai európai: év indiai: év

35 Az M458, Z280 és a Z93 eloszlásai

36 A Q-M242 haplocsoport elıfordulása a világtérképen. Látható, hogy Észak-Szibériában nagyon gyakori, nagy valószínőséggel az Q ısapja ott született (ott keletkezett a haplocsoport) és leszármazottai onnan terjeszkedtek tovább. A ma élı amerikai indiánok is a Q haplocsoportnak az egyik alcsoportját (Q3) hordozzák.

37

38

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus

Részletesebben

A magyar populáció genetikai elemzése nemi kromoszómális markerek alapján

A magyar populáció genetikai elemzése nemi kromoszómális markerek alapján A magyar populáció genetikai elemzése nemi kromoszómális markerek alapján DOKTORI ÉRTEKEZÉS Készítette: Vágó-Zalán Andrea ELTE TTK Biológia Doktori Iskola Iskolavezető: Prof. Dr. Erdei Anna Klasszikus

Részletesebben

A magyarok genetikai gyökerei a szlovák genetikusok előadásában.

A magyarok genetikai gyökerei a szlovák genetikusok előadásában. A magyarok genetikai gyökerei a szlovák genetikusok előadásában. A The Genographic Project 2005-2012 próbálja összehangolni a genetikusok munkáját. A közölt eredmények sok helyen meglepték a tudósokat,

Részletesebben

A genetikai lelet értelmezése monogénes betegségekben

A genetikai lelet értelmezése monogénes betegségekben A genetikai lelet értelmezése monogénes betegségekben Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika A ~20 ezer fehérje-kódoló gén a 23 pár kromoszómán A kromoszómán található bázisok száma: 250M

Részletesebben

Kárpát-medencei magyar ősiség. Cser Ferenc Magyarságtudományi füzetek Kisenciklopédia 12. A kötet társszerzője: Darai Lajos

Kárpát-medencei magyar ősiség. Cser Ferenc Magyarságtudományi füzetek Kisenciklopédia 12. A kötet társszerzője: Darai Lajos Kárpát-medencei magyar ősiség Cser Ferenc Magyarságtudományi füzetek Kisenciklopédia 12. A kötet társszerzője: Darai Lajos Bevezetés Egy nép, nemzet, műveltség eredetének felderítéséhez nem elegendő az

Részletesebben

PAMJAV HOROLMA FEHÉR TIBOR NÉMETH ENDRE CSÁJI LÁSZLÓ KOPPÁNY 74 & 74 &

PAMJAV HOROLMA FEHÉR TIBOR NÉMETH ENDRE CSÁJI LÁSZLÓ KOPPÁNY 74 & 74 & PAMJAV HOROLMA FEHÉR TIBOR NÉMETH ENDRE CSÁJI LÁSZLÓ KOPPÁNY A populáció- és filogenetikai adatok őstörténeti értelmezésének lehetőségei és korlátai A történeti kutatásokat régóta segítik a természettudományos

Részletesebben

A magyar populáció genetikai elemzése nemi kromoszómális markerek alapján

A magyar populáció genetikai elemzése nemi kromoszómális markerek alapján A magyar populáció genetikai elemzése nemi kromoszómális markerek alapján DOKTORI ÉRTEKEZÉS TÉZISEI Készítette: Vágó-Zalán Andrea ELTE TTK Biológia Doktori Iskola Iskolavezető: Prof. Dr. Erdei Anna Klasszikus

Részletesebben

Volt egyszer egy finnugor

Volt egyszer egy finnugor Volt egyszer egy finnugor Néhány hónapja szenzációs bejelentés járta be a világot a legjelentősebb tudományos folyóirat, a Science november 10-ei számában. A génvizsgálatok bebizonyították, hogy a magyar

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

Honfoglalás kori, valamint magyar és székely populációk apai ági genetikai kapcsolatrendszerének vizsgálata

Honfoglalás kori, valamint magyar és székely populációk apai ági genetikai kapcsolatrendszerének vizsgálata Honfoglalás kori, valamint magyar és székely populációk apai ági genetikai kapcsolatrendszerének vizsgálata Ph. D. értekezés Kovácsné Csányi Bernadett Témavezetı: Prof. Dr. Raskó István Biológia Doktori

Részletesebben

Igazságügyi genetika alapjai

Igazságügyi genetika alapjai Nyomok - Death Valley, CA 2007 / 10 / 11 Igazságügyi genetika alapjai Molekuláris orvostudomány - molekuláris bűnjelek genetikai analízise Pádár Zsolt Igazságügyi genetika vannak az ÉLET dolgai és vannak

Részletesebben

A genetikai sodródás

A genetikai sodródás A genetikai sodródás irányított, nem véletlenszerű Mindig a jobb nyer! természetes szelekció POPULÁCIÓ evolúció POPULÁCIÓ A kulcsszó: változékonyság a populáción belül POPULÁCIÓ nem irányított, véletlenszerű

Részletesebben

A világnépesség térbeli eloszlása, a népsûrûség

A világnépesség térbeli eloszlása, a népsûrûség A világn gnépesség g térbeli t eloszlása, sa, a népsûrûség 60 30 0 Fõ/km 2 < 1 30 1-10 11-25 26-50 51-100 101-200 > 200 A világn gnépesség g rasszok, nyelvek és s vallások szerinti megoszlása sa Rassz

Részletesebben

Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak.

Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak. Evolúció Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak. Latin eredetű szó, jelentése: kibontakozás Időben egymást

Részletesebben

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor,

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, 1 A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, (Debreceni Egyetem Állattenyésztéstani Tanszék) A bármilyen

Részletesebben

Genetikai idôutazás az emberi populációk eredetének nyomában

Genetikai idôutazás az emberi populációk eredetének nyomában RASKÓ ISTVÁN Genetikai idôutazás az emberi populációk eredetének nyomában Raskó István genetikus az MTA doktora És mondta Isten: Teremtsünk embert a mi képünkre Teremté tehát Isten az embert az ô képére,

Részletesebben

Humán genom variációk single nucleotide polymorphism (SNP)

Humán genom variációk single nucleotide polymorphism (SNP) Humán genom variációk single nucleotide polymorphism (SNP) A genom ~ 97 %-a két különböző egyedben teljesen azonos ~ 1% különbség: SNP miatt ~2% különbség: kópiaszámbeli eltérés, deléciók miatt 11-12 millió

Részletesebben

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik.

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. MUTÁCIÓK A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. Pontmutáció: A kromoszóma egy génjében pár nukleotidnál következik be változás.

Részletesebben

Szegedi Tudományegyetem

Szegedi Tudományegyetem Szegedi Tudományegyetem Populációgenetikai és diagnosztikai célú mitokondriális DNS és autoszómális marker vizsgálatok Magyarországon feltárt régészeti csontleletekből és modern mintákból Ph.D. értekezés

Részletesebben

SZOMATIKUS ÉS Y KROMOSZÓMÁN LOKALIZÁLÓDÓ STR MARKEREK POPULÁCIÓGENETIKAI VIZSGÁLATA

SZOMATIKUS ÉS Y KROMOSZÓMÁN LOKALIZÁLÓDÓ STR MARKEREK POPULÁCIÓGENETIKAI VIZSGÁLATA SZEGEDI TUDOMÁNYEGYETEM TERMÉSZETTUDOMÁNYI KAR SZOMATIKUS ÉS Y KROMOSZÓMÁN LOKALIZÁLÓDÓ STR MARKEREK POPULÁCIÓGENETIKAI VIZSGÁLATA PhD dolgozat Készítette: Beer Zsuzsanna Szakvezető: Prof. Dr. Varga Tibor

Részletesebben

Vándorló milliók 1. Kontinensek közötti (interkontinentális) vándorlások: - népvándorlás Ázsiából Európa felé (4-9. század); - kivándorlás Európából Amerikába (15-16. 16. századtól napjainkig, a legintenzívebb

Részletesebben

Az anyagcseretípusok fejlődése 2.

Az anyagcseretípusok fejlődése 2. Kedves Olvasó! A Természetes EgyenSúly című online magazin 6. számát tartod a kezedben. Az anyagcseretípusok fejlődése 2. Dél-India csak az egyik példa, amelyen keresztül egy anyagcseretípus keletkezése

Részletesebben

Őslénytan, régészet ŐSLÉNYEK A BARLANGOKBAN

Őslénytan, régészet ŐSLÉNYEK A BARLANGOKBAN Őslénytan, régészet ŐSLÉNYEK A BARLANGOKBAN Az őslénytan (paleontológia) a földtörténeti múlt növény; és állatvilágát kutatja. A barlangok és karsztos üregek kitöltése kedvező körülményeket biztosít az

Részletesebben

Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes.

Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes. Múlt órán: Lehetséges tesztfeladatok: Kitől származik a variáció-szelekció paradigma, mely szerint az egyéni, javarészt öröklött különbségek között a társadalmi harc válogat? Fromm-Reichmann Mill Gallton

Részletesebben

A kromoszómák kialakulása előtt a DNS állomány megkettőződik. A két azonos információ tartalmú DNS egymás mellé rendeződik és egy kromoszómát alkot.

A kromoszómák kialakulása előtt a DNS állomány megkettőződik. A két azonos információ tartalmú DNS egymás mellé rendeződik és egy kromoszómát alkot. Kromoszómák, Gének A kromoszóma egy hosszú DNS szakasz, amely a sejt életének bizonyos szakaszában (a sejtosztódás előkészítéseként) tömörödik, így fénymikroszkóppal láthatóvá válik. A kromoszómák két

Részletesebben

Őskor- Történelem előtti kor

Őskor- Történelem előtti kor AZ ŐSKOR KULTÚRÁJA Őskor- Történelem előtti kor Az emberiség fejlődéstörténetének az a korszaka, melyből írott emlékek nem maradtak ránk. Felosztása: 1. Paleolitikum: i.e. 600 000-10 000 alsó szakasz:

Részletesebben

ö ö ü ü ű ö Í ö ö ö ű Í ü ű ö ö ö ü ű ö ö ö ö ö Í ű ű ü ü Ó ű ö ö É ü ö ö ö ü ü É ö ü ö Á ü Á ű ü ű ű ű ű Í ÍÁ ü ö ö ö ü ü ü É ü ü Á ö ü ü ö ö ű ü ö ü ü ü ö ü ü ü ö ü ü ü ö ö ü ű ö ű ü ö ü ü ö ű ü Í ü

Részletesebben

Í ű Á Á ű ü ü ü ű Í ü ü ü ü Í ű ű ü ü ű ü ü ű ü Í Í É Á Á Á É Á Ö Á Á Á ü É Ó Á Á Á Á É É Á ű É É Á ű ű Á Í Á Í É Á Á Á Á Á Á Ó Á ű ű ü ű ű ű ű ű ü ű Ó ü ű ü ü ű ü ű Í Í ü ű ü ü ü ü ü ű ü ű ü ü ü ü ü ű

Részletesebben

ó ö ó Í Í Ó Í Á Í Í Í Ó Ú ó Í Ó ó Ó ó Í Ó Ó Ó Ó Ó Ó Ó ó Á Ó Ó ó ö ó Ú Í Í Ó Ó Ó Í Ó Ú É Í Í Í Ú Ó ő Í Í Ó Ó Ú Ó Ó ó Í ó Á Ó Ó Ó ó ó Í Ó Ó Ó Ó Ó Í Ú Í Í É ö Ó Ó Í Ó Ú Ó Ú Ó Ö Í Í Ú Ó Ó ó Ű Ó Ó Ó Ó Ó Ó Ó

Részletesebben

1. MAGYAR ÁLLAMPOLGÁRSÁGOT KAPOTT SZEMÉLYEK ELŐZŐ ÁLLAMPOLGÁRSÁG ORSZÁGA SZERINT

1. MAGYAR ÁLLAMPOLGÁRSÁGOT KAPOTT SZEMÉLYEK ELŐZŐ ÁLLAMPOLGÁRSÁG ORSZÁGA SZERINT Tartalom 1. MAGYAR ÁLLAMPOLGÁRSÁGOT KAPOTT SZEMÉLYEK ELŐZŐ ÁLLAMPOLGÁRSÁG ORSZÁGA SZERINT 2. MAGYAR ÁLLAMPOLGÁRSÁGOT KAPOTT SZEMÉLYEK MEGOSZLÁSA ELŐZŐ ÁLLAMPOLGÁRSÁG ORSZÁGA SZERINT 3. MAGYAR ÁLLAMPOLGÁRSÁGOT

Részletesebben

Mészáros Anita Dr. Béres Judit Hazai etnikumok/populációk genetikai struktúrája

Mészáros Anita Dr. Béres Judit Hazai etnikumok/populációk genetikai struktúrája Mészáros Anita Dr. Béres Judit Hazai etnikumok/populációk genetikai struktúrája Az emberi genetikai variációk olyan objektív adatok, melyek a történelem során lezajlott vándorlások és rokonsági viszonyok

Részletesebben

Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what?

Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what? 2000 június 26 Új út kezdete, vagy egy út vége? Human Genome Project, 1990-2005 5 évvel a tervezett befezés előtt The race is over, victory for Craig Venter. The genome is mapped* - now what? 2000 június

Részletesebben

TOVÁBBHALADÁS FELTÉTELEI minimum követelmény 11. osztály - 2015

TOVÁBBHALADÁS FELTÉTELEI minimum követelmény 11. osztály - 2015 TOVÁBBHALADÁS FELTÉTELEI minimum követelmény 11. osztály - 2015 1.1. Európa általános természetföldrajzi képe Ismertesse a nagytájak felszínformáit, földtörténeti múltjukat Támassza alá példákkal a geológiai

Részletesebben

Molekuláris ökológia Általános Ökológia 2012

Molekuláris ökológia Általános Ökológia 2012 Molekuláris ökológia Általános Ökológia 2012 Technikák Csak vázlatosan Technikák Allozim elektroforérizs Restrikciós fragmens méret polimorfizmus (RFLP) Miniszattelita DNS ujjlenyomat Random Amplification

Részletesebben

A PKU azért nem hal ki, mert gyógyítják, és ezzel növelik a mutáns allél gyakoriságát a Huntington kór pedig azért marad fenn, mert csak későn derül

A PKU azért nem hal ki, mert gyógyítják, és ezzel növelik a mutáns allél gyakoriságát a Huntington kór pedig azért marad fenn, mert csak későn derül 1 Múlt órán: Genetikai alapelvek, monogénes öröklődés Elgondolkodtató feladat Vajon miért nem halnak ki az olyan mendeli öröklődésű rendellenességek, mint a Phenylketonuria, vagy a Huntington kór? A PKU

Részletesebben

Honalapító őseink genetikai öröksége

Honalapító őseink genetikai öröksége 1 Kristóf Zoltán Honalapító őseink genetikai öröksége A magyarság őseinek a szkítákat és a hunokat tartják középkori krónikáink, a magyar irodalom nagy alakjai (Zrínyi Miklós, Arany János, Jókai Mór, Ady

Részletesebben

Domináns-recesszív öröklődésmenet

Domináns-recesszív öröklődésmenet Domináns-recesszív öröklődésmenet Domináns recesszív öröklődés esetén tehát a homozigóta domináns és a heterozigóta egyedek fenotípusa megegyezik, így a három lehetséges genotípushoz (példánkban AA, Aa,

Részletesebben

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

Recesszív öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 Recesszív öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság

Részletesebben

BIOLÓGIA TANMENET. XII. évfolyam 2013/2014

BIOLÓGIA TANMENET. XII. évfolyam 2013/2014 MISKOLCI MAGISTER GIMNÁZIUM BIOLÓGIA TANMENET XII. évfolyam 2013/2014 A 110/2012. (VI. 4.) Korm. rendelet és az 51/2012. (XII. 21.) EMMI rendelet alapján készítette Zárdai-Csintalan Anita 1. óra Év eleji

Részletesebben

Evolúció. Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet

Evolúció. Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet Evolúció Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet Mi az evolúció? Egy folyamat: az élőlények tulajdonságainak változása a környezethez való alkalmazkodásra Egy

Részletesebben

Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben

Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben * BUDAPESTI EÖTVÖS LORÁND * TUDOMÁNYEGYETEM Mitokondriális DNS és mikroszatellita polimorfizmusok igazságügyi genetikai aspektusú vizsgálata a magyar népességben DOKTORI ÉRTEKEZÉS TÉZISEI Készítette: Egyed

Részletesebben

Az etológia módszere és fogalmai. A Humánetológia

Az etológia módszere és fogalmai. A Humánetológia Humánetológia Darwin evolúcióelmélete A fajok eredete (1859) az egyedek különböznek, és ezek a különbségek öröklődnek az egyedek versengenek A természetes kiválasztódás az a folyamat melynek során bizonyos

Részletesebben

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós Összefoglalás A humángenetika korunk egyik legdinamikusabban fejlődő tudományága. Ennek a fejlődésnek legfőbb mozgatórugója az, hogy a humángenetika,

Részletesebben

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal Intelligens Rendszerek Elmélete Dr. Kutor László Párhuzamos keresés genetikus algoritmusokkal http://mobil.nik.bmf.hu/tantargyak/ire.html login: ire jelszó: IRE0 IRE / A természet általános kereső algoritmusa:

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

A HÓNAP KÜLDŐORSZÁGA UKRAJNA. Kiss Kornélia Magyar Turizmus Zrt. Budapest, június 20.

A HÓNAP KÜLDŐORSZÁGA UKRAJNA. Kiss Kornélia Magyar Turizmus Zrt. Budapest, június 20. A HÓNAP KÜLDŐORSZÁGA UKRAJNA Kiss Kornélia Magyar Turizmus Zrt. Budapest, 2007. június 20. Adatforrásaink UN WORLD TOURISM ORGANIZATION IMF, CIA World FACTBOOK INTERNET WORLD STATS EUROPEAN TRAVEL COMMISSON

Részletesebben

ARCHEOGENETIKA (RÉGÉSZETI GENETIKA) Raskó István

ARCHEOGENETIKA (RÉGÉSZETI GENETIKA) Raskó István ARCHEOGENETIKA (RÉGÉSZETI GENETIKA) Raskó István Összefoglalás Sokan azt gondolják, hogy a DNS tanulmányozásával a jövőnk számára fontos kérdésekre kaphatunk választ. Az archeogenetika, vagy génrégészet

Részletesebben

JAVÍTÓ- ÉS OSZTÁLYOZÓ VIZSGA KÖVETELMÉNYEI FÖLDRAJZBÓL HATOSZTÁLYOS GIMNÁZIUM. 7. évfolyam

JAVÍTÓ- ÉS OSZTÁLYOZÓ VIZSGA KÖVETELMÉNYEI FÖLDRAJZBÓL HATOSZTÁLYOS GIMNÁZIUM. 7. évfolyam JAVÍTÓ- ÉS OSZTÁLYOZÓ VIZSGA KÖVETELMÉNYEI FÖLDRAJZBÓL HATOSZTÁLYOS GIMNÁZIUM 7. évfolyam A szilárd Föld anyagai és Földrajzi övezetesség alapjai Gazdasági alapismeretek Afrika és Amerika földrajza Környezetünk

Részletesebben

7. SOKFÉLESÉG. Sokféleség

7. SOKFÉLESÉG. Sokféleség Sokféleség DIA 1 Egy populáció egyedei fenotípusos jegyeikben különböznek egymástól. Az egypetéjű ikreket leszámítva, nincs két egyforma egyed. A fenotípusos változékonyságot a genetikai változékonyság

Részletesebben

MUTÁCIÓ ÉS HIBAJAVÍTÁS

MUTÁCIÓ ÉS HIBAJAVÍTÁS 1 5. A DNS Mutáció Hibajavítás MUTÁCIÓ ÉS HIBAJAVÍTÁS DIA 29 DIA 30 DIA 31 DIA 32 MUTÁCIÓK Definíció: a mutáció a DNS nukleotid sorrendjének megváltozása. Csoportosítás A mutációkat többféleképpen csoportosíthatjuk.

Részletesebben

Az ember összes kromoszómája 23 párt alkot. A 23. pár határozza meg a nemünket. Ha 2 db X kromoszómánk van ezen a helyen, akkor nők, ha 1db X és 1db

Az ember összes kromoszómája 23 párt alkot. A 23. pár határozza meg a nemünket. Ha 2 db X kromoszómánk van ezen a helyen, akkor nők, ha 1db X és 1db Testünk minden sejtjében megtalálhatók a kromoszómák, melyek a tulajdonságok átörökítését végzik. A testi sejtekben 2 x 23 = 46 db kromoszóma van. Az egyik sorozat apánktól, a másik anyánktól származik.

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

Természetes szelekció és adaptáció

Természetes szelekció és adaptáció Természetes szelekció és adaptáció Amiről szó lesz öröklődő és variábilis fenotípus természetes szelekció adaptáció evolúció 2. Természetes szelekció Miért fontos a természetes szelekció (TSZ)? 1. C.R.

Részletesebben

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G.

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G. 1955: 46 emberi kromoszóma van 1961: mrns 1975: DNS szekvenálás 1982: gén-bank adatbázisok 1983: R (polymerase chain reaction) Mérföldkövek 1 J. D. Watson F. H.. rick 2008 1953 2003 Watson genomja DNS

Részletesebben

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai Kar: TTK Tantárgy: CITOGENETIKA Kód: AOMBCGE3 ECTS Kredit: 3 A tantárgyat oktató intézet: TTK Mikrobiális Biotechnológiai és Sejtbiológiai Tanszék A tantárgy felvételére ajánlott félév: 3. Melyik félévben

Részletesebben

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal. A genetikus algoritmus működése. Az élet információ tárolói

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal. A genetikus algoritmus működése. Az élet információ tárolói Intelligens Rendszerek Elmélete dr. Kutor László Párhuzamos keresés genetikus algoritmusokkal http://mobil.nik.bmf.hu/tantargyak/ire.html login: ire jelszó: IRE07 IRE 5/ Természetes és mesterséges genetikus

Részletesebben

Altruizmus. Altruizmus: a viselkedés az adott egyed fitneszét csökkenti, de másik egyed(ek)ét növeli. Lehet-e önző egyedek között?

Altruizmus. Altruizmus: a viselkedés az adott egyed fitneszét csökkenti, de másik egyed(ek)ét növeli. Lehet-e önző egyedek között? Altruizmus Altruizmus: a viselkedés az adott egyed fitneszét csökkenti, de másik egyed(ek)ét növeli. Lehet-e önző egyedek között? Altruizmus rokonok között A legtöbb másolat az adott génről vagy az egyed

Részletesebben

Populációgenetika és evolúció

Populációgenetika és evolúció Populációgenetika és evolúció 1 Koncepció 2 Populációgenetika 3 A változatosság eredete 4 A változatosság fenntartása 5 Adaptív evolúció 6 Fenotípus evolúció Populációgenetika és evolúció 1/42 Jellegek

Részletesebben

SZÁRMAZÁS, HATALOM, TÖRTÉNELEM. Szerkesztette: Szalay Gábor

SZÁRMAZÁS, HATALOM, TÖRTÉNELEM. Szerkesztette: Szalay Gábor SZÁRMAZÁS, HATALOM, TÖRTÉNELEM Szerkesztette: Szalay Gábor Ádám és utódainak neve a sumer mondákban: Ádám= Eridui Alulim Széth=Alalgas Enos=Enmenluanna Káin= Emmengalama Mahalael=Dumuzid, a Pásztor Járed=

Részletesebben

Altruizmus. Altruizmus: a viselkedés az adott egyed fitneszét csökkenti, de másik egyed(ek)ét növeli. Lehet-e önző egyedek között?

Altruizmus. Altruizmus: a viselkedés az adott egyed fitneszét csökkenti, de másik egyed(ek)ét növeli. Lehet-e önző egyedek között? Altruizmus Altruizmus: a viselkedés az adott egyed fitneszét csökkenti, de másik egyed(ek)ét növeli. Lehet-e önző egyedek között? Altruizmus rokonok között A legtöbb másolat az adott génről vagy az egyed

Részletesebben

A Hardy-Weinberg egyensúly. 2. gyakorlat

A Hardy-Weinberg egyensúly. 2. gyakorlat A Hardy-Weinberg egyensúly 2. gyakorlat A Hardy-Weinberg egyensúly feltételei: nincs szelekció nincs migráció nagy populációméret (nincs sodródás) nincs mutáció pánmixis van allélgyakoriság azonos hímekben

Részletesebben

Transzgénikus. nikus állatok. Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk bejuttatott DNS-t t tartalmaz.

Transzgénikus. nikus állatok. Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk bejuttatott DNS-t t tartalmaz. Transzgénikus nikus állatok Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk zremüködéssel bejuttatott DNS-t t tartalmaz. I. A KONKRÉT T GÉNSEBG NSEBÉSZETI SZETI TECHNIKA A beavatkozást

Részletesebben

Amerikai Egyesült Államok összlakossága és magyar származású népessége az American Community Service 1 2004 adatai alapján

Amerikai Egyesült Államok összlakossága és magyar származású népessége az American Community Service 1 2004 adatai alapján Amerikai Egyesült Államok összlakossága és magyar származású népessége az American Community Service 1 2004 adatai alapján 1. ábra. Összpopuláció* Összlakosság 285 691 501 (99%) Összlakosság 1 527 156

Részletesebben

A domináns öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

A domináns öröklődés. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 A domináns öröklődés Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság

Részletesebben

Számítógépes döntéstámogatás. Genetikus algoritmusok

Számítógépes döntéstámogatás. Genetikus algoritmusok BLSZM-10 p. 1/18 Számítógépes döntéstámogatás Genetikus algoritmusok Werner Ágnes Villamosmérnöki és Információs Rendszerek Tanszék e-mail: werner.agnes@virt.uni-pannon.hu BLSZM-10 p. 2/18 Bevezetés 1950-60-as

Részletesebben

A földtörténet évmilliárdjai nyomában 2010.11.22. FÖLDRAJZ 1 I. Ősidő (Archaikum): 4600-2600 millió évvel ezelőtt A földfelszín alakulása: Földkéreg Ősóceán Őslégkör kialakulása. A hőmérséklet csökkenésével

Részletesebben

Szerk.: Vizkievicz András

Szerk.: Vizkievicz András A főemlősök evolúciója Szerk.: Vizkievicz András A legidősebb ma ismert főemlős lelet egy felső krétakori 60-70 millió éves fog, amely az Egyesült Államokban került elő. Ez alapján ősi rovarevők tekinthetők

Részletesebben

A nyelv genetikai háttere

A nyelv genetikai háttere A nyelv genetikai háttere Szalontai Ádám ELTE Elméleti Nyelvészeti Doktori Program MTA Nyelvtudományi Intézet 2014. április 29. 1 / 41 Az előadás menete Genetikai bevezető Gének és nyelv elmélet KE család

Részletesebben

Milyen tudományokra támaszkodik?

Milyen tudományokra támaszkodik? 3. Újabb eredmények Glosszogenetika Milyen tudományokra támaszkodik? Biológia (szociobiológia), etológia, anatómia Pszichológia Pszicholingvisztika Szemiotika Neurológia (agy evolúciójának kutatása) Nyelvészet

Részletesebben

Migráció, települési hálózatok a Kárpát-medencében. Nagyvárad, szeptember 15.

Migráció, települési hálózatok a Kárpát-medencében. Nagyvárad, szeptember 15. Migráció, települési hálózatok a Kárpát-medencében Nagyvárad, 2016. szeptember 15. Adat és cél Felhasznált adatok: A 2001-es és 2011-es népszámlások adatbázisai ( If everything seems under control, you're

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

A népesség kulturális helyzete, állampolgársága, nyelvi, etnikai és vallási összetétele

A népesség kulturális helyzete, állampolgársága, nyelvi, etnikai és vallási összetétele A népesség kulturális helyzete, állampolgársága, nyelvi, etnikai és vallási összetétele A népesség kulturális helyzete Hogyan vizsgálják? írni-olvasni tudás (6, 7 éves v. 10, 15 éves kortól nézik) írni-olvasni

Részletesebben

I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.

Részletesebben

4. A humorális immunválasz október 12.

4. A humorális immunválasz október 12. 4. A humorális immunválasz 2016. október 12. A klónszelekciós elmélet sarokpontjai: Monospecifictás: 1 sejt 1-féle specificitású receptor Az antigén receptorhoz kötődése aktiválja a limfocitát A keletkező

Részletesebben

Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon

Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon Conserved ortholog set (COS) markerek térképezése Aegilops kromoszómákon Rövid tanulmányút 2011. 01.03-03. 30., John Inn Centre, Dept. of Crop Genetics, Norwich Research Park, Norwich NR4 7UH, UK Supervisor:

Részletesebben

Genetika. Tartárgyi adatlap: tantárgy adatai

Genetika. Tartárgyi adatlap: tantárgy adatai Genetika Előadás a I. éves Génsebészet szakos hallgatók számára Tartárgyi adatlap: tantárgy adatai 2.1. Tantárgy címe Genetika 2.2. Előadás felelőse Dr. Mara Gyöngyvér, docens 2.3. Egyéb oktatási tevékenységek

Részletesebben

Az uráli nyelvcsalád népességének genetikája a mitokondriális DNS vizsgálatok alapján

Az uráli nyelvcsalád népességének genetikája a mitokondriális DNS vizsgálatok alapján Az uráli nyelvcsalád népességének genetikája a mitokondriális DNS vizsgálatok alapján Gáspár Róbert 1, Mészáros Anita 2 1 Zürichi Magyar Történelmi Egyesület, 2 PTE ÁOK Orvosi Népegészségtani Intézet Bevezetés

Részletesebben

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi

Részletesebben

A magyar honfoglalás

A magyar honfoglalás A magyar honfoglalás A magyar név A magyar név legkorábbi előfordulásai a 9. századi arab krónikákban találhatóak ( madzsar ). A finnugristák elmélete szerint a magyar szó embert jelentett, és ennek egy

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

Evolúcióelmélet és az evolúció mechanizmusai

Evolúcióelmélet és az evolúció mechanizmusai Evolúcióelmélet és az evolúció mechanizmusai Az élet Darwini szemlélete Melyek az evolúció bizonyítékai a világban? EVOLÚCIÓ: VÁLTOZATOSSÁG Mutáció Horizontális géntranszfer Genetikai rekombináció Rekombináció

Részletesebben

SZKÍTA KIFESTŐ Bérczi Szaniszló, Budapest, 1996

SZKÍTA KIFESTŐ Bérczi Szaniszló, Budapest, 1996 SZKÍTA KIFESTŐ Bérczi Szaniszló, Budapest, 1996 A Kárpátoktól az Altáj hegységig terjedt egykor a sztyeppevidéken élő szkíta műveltségű népek köre. Európában szkítáknak, Közép-Ázsiában szakáknak nevezték

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

Najat, Shamil Ali Közel-Kelet: térképek, adatok az észak-afrikai helyzet gazdasági hátterének értelmezéséhez

Najat, Shamil Ali Közel-Kelet: térképek, adatok az észak-afrikai helyzet gazdasági hátterének értelmezéséhez Najat, Shamil Ali Közel-Kelet: térképek, adatok az észak-afrikai helyzet gazdasági hátterének értelmezéséhez A mai közel-keleti változások elemzéséhez elengedhetetlen az eseményeket jelentős mértékben

Részletesebben

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk.

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A genetikai betegségek mellett, génterápia alkalmazható szerzett betegségek, mint

Részletesebben

Genetikai szótár. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem

Genetikai szótár. Tájékoztató a betegek és családtagjaik számára. Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 12 Genetikai szótár Fordította: Dr. Komlósi Katalin Orvosi Genetikai Intézet, Pécsi Tudományegyetem 2009. május 15. A London IDEAS Genetikai Tudáspark, Egyesült Királyság szótárából módosítva. A munkát

Részletesebben

Európai kapcsolat? Az aranysakál genetikai struktúrája és terjeszkedése Európában és a Kaukázusban

Európai kapcsolat? Az aranysakál genetikai struktúrája és terjeszkedése Európában és a Kaukázusban Európai kapcsolat? Az aranysakál genetikai struktúrája és terjeszkedése Európában és a Kaukázusban Heltai Miklós és Szabó László Szent István Egyetem, Vadvilág Megőrzési Intézet Bevezetés Az aranysakál

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Tudománytörténet. 1. Előadás Őskor

Tudománytörténet. 1. Előadás Őskor Tudománytörténet 1. Előadás Őskor Tudománytörténet előadás Óraszám/hét: 2 Kreditszám: 2 Tantárgyteljesítési követelmény: kollokvium Évközi feladatok: zh + beadandó dolgozat + kiselőadás (Határidő: 2012.

Részletesebben

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA 1. Nukleinsavak keresztrejtvény (12+1 p) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 1. A nukleinsavak a.-ok összekapcsolódásával kialakuló polimerek. 2. Purinvázas szerves bázis, amely az

Részletesebben

A NÉPESSÉG VÁNDORMOZGALMA

A NÉPESSÉG VÁNDORMOZGALMA A NÉPESSÉG VÁNDORMOZGALMA A népesség mobilitása (példa: egyetlen személy pozícióváltása ) térbeli vagy földrajzi mobilitás társadalmi mobilitás (vándorlás vagy migráció) lakóhelyváltoztatással lakóhelyváltoztatás

Részletesebben

ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS

ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS Mi az öregedés? Egyrészről az idő múlásával definiálható, a születéstől eltelt idővel mérhető, kronológiai sajátosságú, Másrészről az idő múlásához köthető biológiai,

Részletesebben

Azon ügyfelek számára vonatkozó adatok, akik részére a Hivatal hatósági bizonyítványt állított ki

Azon ügyfelek számára vonatkozó adatok, akik részére a Hivatal hatósági bizonyítványt állított ki Amerikai Egyesült Államok Ausztrália Ausztria Belgium Brunei Ciprus Dánia Egyesült Arab Emírségek Egyesült Királyság Finnország Franciaország Görögország Hollandia Horvátország Irán Írország Izland Izrael

Részletesebben

Nagykövetségek March 13.

Nagykövetségek March 13. Nagykövetségek 2007. March 13. Albánia Albán Köztársaság Magyarországi Nagykövetsége Cím: 1026 Budapest, Gábor Áron u. 55. Telefon: +31 1 326 8905 Algéria Algériai Demokratikus Népi Köztársaság Magyarországi

Részletesebben

Kromoszóma transzlokációk

Kromoszóma transzlokációk 16 Kromoszóma transzlokációk A londoni Guy s and St Thomas kórház, a Királyi Nőgyógyászati és Szülészeti Társaság és a London IDEAS Genetikai Tudáspark kiadványainak módosítása alapján készült a minőségbiztosítási

Részletesebben

Világtendenciák. A 70-es évek végéig a világ szőlőterülete folyamatosan nőtt 10 millió hektár fölé

Világtendenciák. A 70-es évek végéig a világ szőlőterülete folyamatosan nőtt 10 millió hektár fölé Világtendenciák A 70-es évek végéig a világ szőlőterülete folyamatosan nőtt 10 millió hektár fölé 80-as évek elejétől: túltermelési válság 25 % visszaesés (34% az EU-ban) Asztali bort adó szőlőterületek

Részletesebben

értékel függvény: rátermettségi függvény (tness function)

értékel függvény: rátermettségi függvény (tness function) Genetikus algoritmusok globális optimalizálás sok lehetséges megoldás közül keressük a legjobbat értékel függvény: rátermettségi függvény (tness function) populáció kiválasztjuk a legrátermettebb egyedeket

Részletesebben

Kutyafélék viselkedésgenetikája. Miklósi Ádám 2015

Kutyafélék viselkedésgenetikája. Miklósi Ádám 2015 Kutyafélék viselkedésgenetikája Miklósi Ádám 2015 Kutyagenom 2N = 78 kromoszóma (minden Canis-nak!) (hány faj?) C. lupus, C. latrans, C. aureus hibridek) Autoszómák acrocentrikusak (egy karúak) Nemi kromoszómák

Részletesebben

Felmérés eredményei: Expat országmenedzserek

Felmérés eredményei: Expat országmenedzserek Felmérés eredményei: Expat országmenedzserek 1. Honnan érkeztek expat vezérigazgatóik és országmenedzsereik? Az expat országmenedzserek 42%-a Nyugat-Európából vagy az Egyesült Államokból érkezik, 58%-uk

Részletesebben