DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN"

Átírás

1 PANNON EGYETEM GEORGIKON MEZŐGAZDASÁGTUDOMÁNYI KAR Állattudományi és Állattenyésztéstani Tanszék Tanszékvezető Dr. Husvéth Ferenc egyetemi tanár, az MTA doktora DOKTORI (PhD) ÉRTEKEZÉS Készült a Pannon Egyetem Állattenyésztési Tudományok Doktori Iskola, jogutód: Állat- és Agrárkörnyezet-tudományi Doktori Iskola állattenyésztés tudományok tudományág keretében Doktori Iskola volt vezetője Dr. Szabó Ferenc egyetemi tanár, az MTA doktora Doktori Iskola jelenlegi vezetője Dr. Anda Angéla egyetemi tanár, az MTA doktora Témavezető Dr. Husvéth Ferenc egyetemi tanár, az MTA doktora Társ-témavezető Dr. Fébel Hedvig tudományos tanácsadó Konzulens Bán Beáta vizsgáló mérnök DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN Készítette Józsa Csilla KESZTHELY 2008

2 2 DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN Értekezés doktori (PhD) fokozat elnyerése érdekében Írta: JÓZSA CSILLA Készült a Pannon Egyetem Állattenyésztési Tudományok Doktori Iskola, jogutód: Állat- és Agrárkörnyezet-tudományi Doktori Iskola állattenyésztés tudományok tudományág keretében Témavezető: Dr.Husvéth Ferenc, egyetemi tanár, az MTA doktora Elfogadásra javaslom (igen / nem)... A jelölt a doktori szigorlaton... % -ot ért el. Keszthely, Az értekezést bírálóként elfogadásra javaslom: Bíráló neve: igen /nem. Bíráló neve:... igen / nem. A jelölt az értekezés nyilvános vitáján...% - ot ért el. Keszthely, a Bíráló Bizottság elnöke A doktori (PhD) oklevél minősítése... Az EDT elnöke

3 3 TARTALOMJEGYZÉK oldal 1. BEVEZETÉS CÉLKITŰZÉSEK IRODALMI ÁTTEKINTÉS A molekuláris genetika alapjai Az örökítő anyag, a DNS molekula Mikroszatellit (STR) vizsgálatok PCR polimeráz láncreakció (polymerase chain reaction) A PCR sikertörténete A polimeráz láncreakció elve A PCR reakció menete A PCR reakcióelegy összetevői A kapilláris gélelektroforézis Molekuláris genetika az állattenyésztésben Genetikai markerek alkalmazása az állattenyésztésben Molekuláris genetika a génmegőrzésben Molekuláris genetika a származásellenőrzésben A DNS re alapozott származásellenőrzés módszerének főbb vonatkozásai Származásellenőrzés Magyarországon Származásellenőrzés a lótenyésztésben Származásellenőrzés a szarvasmarha tenyésztésben ANYAG ÉS MÓDSZER A kísérleti minták gyűjtése és előkészítése a molekuláris genetikai vizsgálatokhoz A vizsgálatokba vont fajták, populációk Ló faj Szarvasmarha faj A DNS kivonása és tisztítása A molekuláris genetikai elemzések során alkalmazott laboratóriumi vizsgálatok STR lókuszok vizsgálatának módszere ló faj esetén A vizsgálandó szakaszok amplifikálása Az STR fragmensek genotipizálása (elválasztás, detektálás, szelektálás) STR lókuszok vizsgálatának módszere szarvasmarha faj esetén A vizsgálandó szakaszok amplifikálása Az STR fragmensek genotipizálása (elválasztás, detektálás, szelektálás) Kísérleti eredmények értékelése, statisztikai analízisek EREDMÉNYEK A vizsgált fajták genetikai változatosságának leírása DNS mikroszatellit markerek segítségével A vizsgált ló fajták genetikai változatosságának jellemzése Allélfrekvencia értékek; allélszámok (megfigyelt, effektív); Shanonn-féle információs index; egyedi, fajtaspecifikus allélek; allélgazdagság (A r ) Várt és megfigyelt heterozigozitás (H e, H o ), Nei-féle várt heterozigozitás (H exp )... 55

4 Hardy-Weinberg egyensúlytól való eltérés (P H-W ), Wright-féle fixációs index (F IS ) Nei-féle genetikai távolság mérőszámai és a távolságok dendogrammon való ábrázolása Fajtapárok közötti fixációs index (F ST ) és génáramlás (N m ) Származásellenőrzés DNS mikroszatellitek segítségével A vizsgált húsmarha fajták genetikai változatosságának jellemzése Allélfrekvencia értékek; allélszámok (megfigyelt, effektív); Shanonn-féle információs index; egyedi, fajtaspecifikus allélek; allélgazdagság (A r ) Várt és megfigyelt heterozigozitás (H e, H o ), Nei-féle várt heterozigozitás (H exp ) Hardy-Weinberg egyensúlytól való eltérés (P H-W ), Wright-féle fixációs index (F IS ) Nei-féle genetikai távolság mérőszámai és a távolságok dendogrammon való ábrázolása Fajtapárok közötti fixációs index (F ST ) és génáramlás (N m ) Származásellenőrzés DNS mikroszatellitek segítségével Kiválasztott populációk genetikai jellemzése, összehasonlítása DNS markerek segítségével A dióspusztai és a kerteskői angol telivér populációk genetikai összehasonlítása A derecskei és a hajdúböszörményi magyar tarka populációk genetikai összehasonlítása EREDMÉNYEK ÉRTÉKELÉSE DNS lókuszok vizsgálata során kapott eredmények értékelése ló fajban DNS lókuszok vizsgálata során kapott eredmények értékelése szarvasmarha fajban KÖVETKEZTETÉSEK ÚJ EREDMÉNYEK ÖSSZEFOGLALÁS PUBLIKÁCIÓK JEGYZÉKE IRODALOMJEGYZÉK TÁBLÁZATOK JEGYZÉKE ÁBRÁK JEGYZÉKE KÖSZÖNETNYILVÁNÍTÁS MELLÉKLETEK

5 5 KIVONAT DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN A szerző a doktori munkája során néhány hazánkban is tenyésztett ló- (angol telivér, amerikai ügető, lipicai, magyar hidegvérű) és szarvasmarhafajta (magyar tarka, hereford, limousin, charolais, aberdeen angus) genetikai jellemzőit vizsgálta DNS mikroszatellitek segítségével, valamint ezen markerek alkalmazhatóságát becsülte a hazai állattenyésztés fejlesztése érdekében. Az vizsgálatok folyamán a ló fajban 17 (VHL20, HTG4, AHT4, HMS7, HTG6, AHT5, HMS6, ASB23, ASB2, HTG10, HTG7, HMS3, HMS2, ASB17, LEX3, HMS1, CA425), a szarvasmarha fajban 11 (BM1824, BM2113, ETH10, ETH225, INRA23, SPS115, TGLA122, TGLA126, TGLA227, ETH3, TGLA53) mikroszatellit detektálására került sor. Az eredmények alapján a több genetikai markerre alapozott analitikai eljárások alkalmasnak mutatkoztak az egyedek és a fajták közötti különbségek, a fajták genetikai változatosságának meghatározására. Az eredmények bizonyították, hogy a DNS mikroszatellit vizsgálatok szembetűnő különbségeket jeleztek a vizsgált ló- és szarvasmarha fajták között, s megállapítható, hogy a hazai állományok egésze genetikailag meglehetősen heterogén volt és jelentős genetikai erőforrásokkal rendelkezett. Mindezek mellett a disszertációban tanulmányozott fajták a beltenyésztettség jeleit mutatták, amit több genetikai mérőszámmal (várt és megfigyelt heterozigozitás egymáshoz viszonyítása; F IS értékek pozitivitása, illetve negativitása) is igazolt a szerző. Az egyedek származása az alkalmazott biotechnológiai módszer segítségével egyértelműen eldönthető volt (a vizsgált szarvasmarha fajták esetében 97,85 és 99,46%-os, a vizsgált lófajták esetében 99,80 és 99,98%-os biztonsággal), így megbízhatóan alkalmazható a hazai rutin származásellenőrzésben is. ABSTRACT DNA MICROSATELLITE ANALYSIS OF HORSE AND CATTLE BREEDS In this doctoral work the author investigated the genetic characteristics of several horse and cattle breeds in Hungary with DNA microsatellites. Moreover, the author estimated the applicability of these markers in order to improve animal husbandry in the country. Seventeen horse and eleven cattle microsatellites were detected in breeds throughout the study. According to the results, the applied analysis methods based on several genetic markers were suitable for identifying differences between individual animals and breeds and to determine the genetic variability of breeds. DNA microsatellite analyses revealed significant differences between the investigated horse and cattle breeds. These findings suggest that horse and cattle breeds in Hungary are genetically considerably heterogeneous and that they have significant genetic resources. Nevertheless, breeds studied in present

6 6 thesis showed signs of inbreeding, which was confirmed by various genetic parameters (comparison of the expected and observed heterozygosity, positivity and negativity of F IS values). The biotechnological method applied could unambiguously determine the origin of the individual animals ( % and % confidence for the examined cattle and horse breeds respectively). Thus, this method can be reliably used in routine parentage control in Hungary as well. AUSZUG UNTERSUCHUNG DER MIKROSATELITEN IN PFERDE- UND RINDSORTEN Der Verfasser untersuchte während seiner Doktorarbeit die genetische Charakteristika einiger in Ungarn auch gezüchteten Pferde- und Rindsorten mit Hilfe der DNS-Mikrosateliten, sowie geschätzte die Anwendbarkeit dieser Marker im Interesse der Entwicklung der ungarischen Viehzucht. In den untersuchungen wurden bei den Pferden 17, bei den Rinden 11 Mikrosateliten detektiert. Die auf mehreren genetischen Markern basierende analytische Verfahren erwiesen sich anhand unserer Ergebnisse geeignet für die Bestimmung der Unterschiede zwischen den einzelnen Tieren und zwischen den verschiedenen Sorten, sowie auch für die Bestimmung der genetischen Vielfalt der Sorten. Die DNS-Mikrosateliten-Untersuchungen zeigten hervorstechende Unterschiede zwischen den untersuchten Pferd- und Rindsorten, und es kann auch festgestellt werden, dass die ganze ungarische Population genetisch ziemlich heterogen war, und über bedeutende genetische Ressourcen verfügte. Daneben zeigten die in der Dissertation untersuchte Sorten die Anzeichen der Innzucht, die vom Verfasser auch mit mehreren genetischen Messzahlen (Vergleich der erwarteten und beobachteten Heterozigosität; Positivität bzw. Negativität der F IS Werte) bestätigt wurde. Die Herkunft der einzelnen Tiere konnte mit Hilfe der angewendeten biotechnologischen Methode eindeutig entschieden werden (bei den untersuchten Rindsorten mit einer Sicherheit von 97,85 und 99,46%, bei den Pferdesorten von 99,80 und 99,98%), so kann diese Methode in der routinemäßig erfolgenden Herkunftskontrolle verlässlich angewendet werden.

7 7 Lehet, hogy nem a biokémikus fogja kimondani az utolsó szót az élet leírásában. Az azonban biztos, hogy ezt az utolsó szót nélküle nem fogják kimondani Sir Frederick Gowland Hopkins 1. BEVEZETÉS A molekuláris genetikai kutatások számos új felfedezéssel gazdagodtak az elmúlt évtizedben. Napról napra újabb információkat publikáltak a kutatók, amelyek elősegítették a molekuláris biológia fejlődését. Ezek a kutatások nagymértékben befolyásolták az élelmiszertermelésben, ezen belül az állattenyésztés területén bekövetkezett változásokat. A több és jobb minőségű állati eredetű élelmiszer előállítását nem az állatlétszám növelésével, hanem elsősorban a termelés hatékonyságának fokozásával kell megoldani. Eközben természetesen az állatvédelemre, környezetvédelemre és a biodiverzitás megőrzésére irányuló törekvéseknek és az ezekre vonatkozó törvényeknek is eleget kell tennünk. Az állattenyésztés csak úgy tud megfelelni a fokozott mennyiségi és minőségi elvárásoknak, ha új és jobb módszereket alkalmaz a tenyésztés, a takarmányozás, a management, az állategészségügy, az állatvédelem, a génmegőrzés, a termék-feldolgozás, a termékértékesítés és élelmiszerbiztonság területén (Fésüs és mtsai, 2000). Ezért nagyon fontos, hogy a hazai kutatómunka a napjainkban zajló genetikai és biotechnológiai forradalom új felfedezéseiből született eljárásokat, módszereket alkalmazza és felhasználja az állattenyésztés, az állatnemesítés területén is. A szelekció segítségével az ember a háziasítás kezdete óta beleszólt az általa tenyésztett populáció genetikai szerkezetébe. Ezen munka eredményeként alakult ki a ma élő tenyésztett fajok ismert tulajdonságainak változatossága. A hagyományos szelekciós módszerek mellett azonban folyamatosan megjelennek a molekuláris genetika által teremtett új eljárások, lehetőségek, amelyek megbízhatóbb eredményeket nyújtanak mind a kutatók, mind a tenyésztők számára. Napjainkig még remény sem volt arra, hogy a QTL-eknél (Quantitative Trait Loci = mennyiségi jellegekért felelős lókuszok) egyszerűbb öröklésmenetet mutató termelési tulajdonságok molekuláris

8 8 genetikai hátterét fel lehessen tárni (Fésüs és mtsai, 2000). A genetika fejlődése mostanra elérte azt a szintet, hogy már néhány fenotípus genetikai meghatározottsága ismert, s ez a kör még bővülni fog. Ezáltal a genetikai vizsgálatokkal közvetlenül a DNS szekvencia alapján megállapítható az, hogy egy egyed hordoz-e egy adott tulajdonságot, vagy sem. A sok megoldásra váró feladat ellenére nem lehet kétségbe vonni azt, hogy a molekuláris biotechnológia, a DNS-technológia és az egyre tökéletesedő géntérképek döntő módon hozzájárulnak a genetikai és fiziológiai ismereteink bővítéséhez, és mindez az állattenyésztés előrehaladásának, fejlődésének alapját képezi. Emellett a rohamosan fejlődő komputertechnika, a közvetlen és az azonnali kapcsolatfelvétel a kutatók között egyre inkább lerövidíti a molekuláris genetika és immunológia eredményeinek átviteli idejét a tenyésztési gyakorlatba, az ott történő ellenőrzésüket, nemkülönben a genetikai markerek által segített szelekció elterjedését.

9 9 2. CÉLKITŰZÉSEK A Mezőgazdasági Szakigazgatási Hivatal (MgSzH), Állattenyésztési Igazgatóság, Központi Állattenyésztési Laboratóriuma (Budapest) több mint 15 éve végez vércsoport és biokémiai polimorfizmus vizsgálatokat származásellenőrzés céljából, de az elmúlt években fokozatosan áttértek a DNS mikroszatellitek alkalmazására azok megbízhatósága és nagyszámú polimorfizmusuk miatt. Az eddigi vizsgálatok azt mutatjáják, hogy a DNS mikroszatellitek rendkívül variabilis lókuszok, és ezért segítségükkel a populációk genetikai variabilitásának finom struktúrája pontosan feltárható, valamint egyedek származása is könnyen igazolható. Bár a módszer hazánkban még viszonylag újnak számít, a jelenleg ismert DNS-technikák közül a mikroszatellitek vizsgálata egyértelműen hasznosnak ígérkezik a populációszintű variabilitás tanulmányozására a hazánkban tenyésztett gazdasági állatfajok tekintetében is. A disszertáció tárgyát képező vizsgálatok főbb célkitűzései az alábbiakban foglalhatók össze: A Magyarországon tenyésztett ló (angol telivér, amerikai ügető, lipicai, magyar hidegvérű), illetve szarvasmarha (magyar tarka, limousin, hereford, charolais, aberdeen angus) fajták genetikai változatosságának feltérképezése DNS mikroszatellit markerek segítségével. A mikroszatellit lókuszokon az allélok számának és frekvenciájának meghatározása, egyedi allélek keresése az előzőekben leírt ló, illetve szarvasmarha fajtákban. A hazánkban tenyésztett egyes ló és szarvasmarha fajták közötti genetikai távolság felmérése DNS mikroszatellit vizsgálatok segítségével.

10 10 A beltenyésztettség mértékének felderítése DNS mikroszatellit vizsgálatok alapján a kísérletekbe vont populációkban, illetve fajtákban. A DNS mikroszatellit markerek alkalmazhatóságának becslése a hazai állattenyésztés fejlesztése érdekében.

11 11 3. IRODALMI ÁTTEKINTÉS 3.1. A molekuláris genetika alapjai Az örökítő anyag, a DNS molekula Friedrich Miescher (1869; 1871) izolált biológiai anyagból svájci laboratóriumában először nukleinsavat. Oswald Avery, Colin MacLeod és Maclyn McCarty (Rockefeller Intézet, New York) 1944-ben írták le először gondosan végzett, hosszadalmas baktériumkísérletek nyomán, hogy a DNS az öröklődés anyaga (Avery és mtsai, 1944). Felfedezésüket vagy közömbösség, vagy pedig hitetlenség fogadta, és a tudóscsoport vezetőjének, Averynek a visszahúzódó személyisége nem engedte meg a felfedezés propagálását. Ha kevesen is, de voltak azonban, akik felismerték a megállapítás forradalmi jellegét. Így Erwin Chargaff, a Columbia Egyetem akkor már híres biokémikusa a közlemény hatására egyik pillanatról a másikra abbahagyta addigi munkáit és további munkásságát a DNS biokémiájának szentelte. Hamarosan megállapította, hogy a DNS nem olyan monoton felépítésű, mint amilyennek feltételezték. Ellenkezőleg, összetétele a biológiai forrás függvénye: a különböző élőlényekben a DNS-ben található bázisok aránya az adott élőlényre specifikus, az (A: adenin + T: timin)/(g: guanin + C: citozin) arány széles határok között változhat (Hargittai, 2003). Chargaff másik fontos felfedezése az volt, hogy minden szervezet DNS-molekulájában guaninból és citozinból azonos mennyiség van jelen, és ugyanígy azonos mennyiségben van jelen adenin és timin, vagyis a G/C és az A/T arányok értékei egynek felelnek meg. Ez utóbbi megállapítás volt később az alapja a bázispárok feltételezésének a kettőscsavar-szerkezetben Watson és Crick szerint (Venetianer, 1998). Miután 1952-ben Chargaff igazolta a DNS molekulát alkotó négy szerves bázis párosodás szabályát, 1953-ban James Watson és Francis Crick közzé tette azt a korszakalkotó dolgozatot a Nature című tudományos folyóiratban, amelyben leírják a DNS szerkezetét, a double-helix (kettős spirál) szerkezetet (Watson és Crick, 1953a, 1953b). A vizsgálatok középpontjában tehát a DNS-molekula állt, amely az örökletes tulajdonságok hordozója. A DNS dezoxiribonukleotidokból lineárisan felépített polimer molekula, amely minden élő sejtben előfordul (Weaver és Hedrick, 2000).

12 12 1. ábra: A DNS molekula (forrás: A genetikai információt az eukariotákban a DNS molekula bázissorrendje hordozza. A DNS rendszerint két egymást kiegészítő (komplementer) láncból áll, amelyek egy jobbra csavarodó spirált alkotnak. A DNS molekula gerincét általában két párhuzamosan futó, egymás körül felcsavarodott cukorfoszfát lánc képezi (1. ábra). A DNS lánc cukor és foszfát egységeit aszimmetrikus 5'- 3' foszfodiészter kötések kapcsolják össze. Ennek megfelelően a DNS szál is polarizált: egyik végén a terminális nukleotid 5' szénatomján foszforil gyök, a másik végén a terminális nukleotid 3' szénatomján hidroxil gyök van. A két párhuzamos, de ellenkező irányban futó cukorfoszfát gerincen a cukorkomponensekhez négyféle bázis (A,T,G,C) kapcsolódik. A bázisok a kiegészítő lánc ellentett bázisai felé mutatnak, és az ellentett bázisokhoz hidrogénkötésekkel kapcsolódnak. A bázisok szerkezetéből adódóan az egyik láncon lévő A (adenin) a másik lánc T (timin)-jével két hidrogén kötéssel, a G

13 13 (guanin) a C (citozin)-nal három hidrogén kötéssel kapcsolódik (Weaver és Hedrick, 2000). Az egyedekre jellemző tulajdonságok a DNS-ben rögzültek, kódoltak. A DNS-nek vannak olyan szakaszai, melyek egy-egy tulajdonság kialakításáért felelősek (gének), más régiók pedig a gének működését szabályozzák (Khorana, 1968). Vannak azonban olyan DNS darabok, melyek az előbb említett genetikai információt nem hordoznak, hanem hosszabb-rövidebb ismétlődő szekvenciák (Fésüs és mtsai, 1997). Ezek a repetitív szakaszok az egész genom területén elszórtan megtalálhatók, néha akár a DNS több mint 30 %-át is kitehetik. Bizonyos kromoszóma-szegmentumokban mint például a centromér régiókban minden ismétlődő szekvencia, de különösen a tetranukleotidok ismétlődésének a gyakorisága magasabb. A repetitív DNS biológiai funkciójáról meglehetősen hiányosak az ismereteink, de a legtöbb eukariótánál azonos alapelvet felmutató szerveződése arra utal, hogy ez a frakció fontos strukturális és funkcionális szereppel bír. A repetitív DNS szerkezetében gyakran a közeli rokonságban álló genotípusok között is nagy mértékű változatosságot tapasztalhatunk, így a repetitív szekvenciákon alapuló markerek információs értéke magas. A repetitív DNS az ismétlődő egységek hossza alapján felosztható miniszatellitekre és mikroszatellitekre (Fésüs és mtsai, 1997) Mikroszatellit (STR) vizsgálatok A mikroszatellitek abba a repetitív szekvencia családba tartoznak, amelyben igen egyszerű, néhány bázis ill. szekvencia ismétlődik egy szakaszon, ugyanakkor a kópiaszám nagy mértékű variabilitást mutat. A tandem ismétlődő régiókat VNTR-nek (Variable Number Tandem Repeats = változó számú tandem ismétlődések, Nakamura és mtsai 1987), STR-nek (Short Tandem Repeat = rövid tandem ismétlődés, Edwards és mtsai, 1991) mikroszatellitnek (Litt és Luty, 1989) vagy SSR-nek (Simple Sequence Repeat = egyszerű szekvencia ismétlődés, Jacob és mtsai, 1991) nevezzük. A mikroszatellitek 2-5 bp (bázispár) hosszú, könnyen amplifikálható DNS szakaszok, amelyek egyenletesebben oszlanak el a genomban, mint a miniszatellitek (Buduram és mtsai, 2005; Litt és Luty, 1989; Weber és May,

14 ; Tautz és Renz, 1984; Jeffreys és mtsai, 1985). Az alapmotívumok száma alapján megkülönböztetünk di-, tri-, tetra- és pentanukleotidokat. A mikroszatellitek nagy polimorfizmust mutatnak, ami azt jelenti, hogy egy populációban, meghatározott génhelyen (lókusz) allélok egész sora azonosítható (De Woody és Avise, 2000). A különböző allélok a megismételt egységek eltérő számából jönnek létre (pl. (CA) 15, (CA) 17 ). A repetitív minta kedvez a mutációnak, ami az egyik oka a mikroszatellitek nagy polimorfizmusának. A mikroszatellitek mutációs rátáját 10-4 és 5x10-6 -ra becsülik (Edwards és mtsai, 1992; Dallas, 1992; Craighead és mtsai, 1995). A mutáció mechanizmusa régóta vitatott (Levinson és Gutman, 1987; Richards és Sutherland, 1994), csak a különböző hosszvarianciákat eredményező fő mechanizmus a biztos, amely a DNS replikáció során bekövetkező hiba eredménye. A mikroszatellitek kiváló eszközei a géntérképezésnek, valamint használatukkal egyedek könnyen és pontosan azonosíthatóak (Hidas, 2002). Tipizálásuk annak a néhány bázispár ismétlődésének számbeli változékonyságán alapul, amelyek két, csak egy-egy adott genomrészletre jellemző szekvenciarészlet között helyezkednek el (Weber és May, 1989). A mikroszatellitek ismert biológiai funkcióval nem rendelkező DNS szakaszok, amelyek szoros kapcsolatban állhatnak mennyiségi tulajdonságokat hordozó (létrehozó) poligénekkel (Komlósi és mtsai, 2005). Ezek a DNS szakaszok, mikroszatellitek jól felhasználhatók a mennyiségi tulajdonságokat meghatározó nagyhatású gének nyomon követésében, származásellenőrzésekben, a különböző populációszerkezeti vizsgálatokban (MacHugh és mtsai, 1994, 1997, 1998; Moazami-Goudarzi és mtsai, 1997; Schmid és mtsai, 1999; Martin-Burriel és mtsai, 1999; Arranz és mtsai, 1998; Saitbekova és mtsai, 1999; Canon és mtsai, 2000, Józsa és mtsai, 2006a). A DNS vizsgálatok különböző adataira támaszkodva olyan megoldások találhatók, amelyek lehetővé teszik a heterozigozitás, a genetikai variabilitás fenntartását kis létszámú állományokban. A decentralizált nukleusz tenyészetek közötti hasonlóságot vagy azonosságot is objektív módon tükrözik vissza (Mihók, 2002; Hansen és mtsai, 2002). A mikroszatellitek viszonylag egyenletesen oszlanak el a genomban (Schlötterer és Pemberton, 1998), ami igen jó lehetőséget nyújt a

15 15 géntérképezéshez, a nagy marker variabilitást pedig igen jól lehet hasznosítani egyed ill. fajtaazonosításban és genetikai összehasonlításokban is (Takahashi és mtsai, 1998; Zhou és mtsai, 1999; Romanov és Weigend, 2001; Zsolnai és mtsai, 2006). A molekuláris genetika lehetőségeinek hasznosítása integrált komponensévé kell váljék a hagyományos szelekció és keresztezéses nemesítési stratégiáknak. A hagyományosan alkalmazott cseppvérkeresztezés során egy fajta csak egy, vagy kevés számú monogénes tulajdonságban fejlesztendő. Markergének, mikroszatellitek felhasználásával kimutathatók azok az egyedek, amelyek a kívánatos gént nagy valószínűséggel hordozzák, így átadhatják a javítandó fajtának. Folyamatos visszakeresztezés és szelekció hatására, illetve után az ivadékokban becsülhető a reménykeltő gének jelenléte. Ugyanezen az elven működik a fajtafenntartás során az alappopulációra jellemző génkészlet megmaradásának kimutatása (Mihók, 2002). Az ismétlődések határoló szekvenciái specifikusak. Ezen határoló egyedi szekvenciákra tervezve primereket (szintetikusan előállított DNS szálak, a sokszorosítandó DNS szakasz végeinek komplementerei) lehetővé válik a mikroszatellitek ún. polimeráz láncreakcióval (PCR) történő vizsgálata (Fésüs és mtsai, 1997). A vizsgálatokhoz kis mennyiségű vérből, szövetből, szőrhagymából vagy nyálból izolált DNS minta szükséges (Bruford és Wayne, 1993). A mikroszatellit vizsgálatok előnye például a RAPD (Random Amplified Polymorphic DNA = véletlen amplifikált polimorf DNS) módszerrel szemben, hogy egy lókuszon a heterozigócia is detektálható (kodominancia) és több allél is előfordulhat. Viszonylagos hátránya, hogy többé-kevésbé fajspecifikusak, ill. csak részlegesen használhatók a közel rokon fajoknál is. Az egyes lókuszokra specifikus primerszekvenciákat kell tervezni, aminek előfeltétele természetesen, hogy szekvencia ismerettel rendelkezzünk a genom mikroszatelliteket hordozó fragmentjeiről. Ezért a mikroszatellit markerek kifejlesztése jelentős előmunkálatokat igényel. További hátrányai a módszernek, hogy nagy értékű szekvenáló elektroforézises készülékeken lehet csak hatékonyan vizsgálni őket, mivel a különböző allélek nem ritkán csak 1-4 bázispárban térnek el egymástól ill. az allélek pontos beazonosítása is ilyen felbontású futtatást igényel. Költségesebb ez a vizsgálat azért is, mert egy PCR

16 16 reakcióban csak egy lókuszra nyerünk információt. Lehetséges ugyan multiplex PCR alkalmazása is, több lókusz amplifikálása közös elegyben és protokollal, ez azonban újabb további optimalizálásokat igényel (Hidas, 2002) PCR polimeráz láncreakció (polymerase chain reaction) A PCR sikertörténete A tudománytörténet úgy tartja, hogy a polimeráz láncreakció (PCR: Polymerase Chain Reaction) elve 1983 áprilisában Kary Banks Mullis elméjében született meg. A módszer elvét, egy gyakorlati eredmény bemutatásán keresztül, 1985-ben közölték munkatársaival a Science magazinban (Saiki és mtsai, 1985). Ettől az időponttól a PCR által, egy egyszerű elven alapuló, de zseniális technikával bővült a molekuláris biológia eszköztára. Ez a ciklikus, in vitro, enzimkatalizált, DNS-szintetizáló eljárás lehetőséget teremtett arra, hogy kimutatható szintre növeljék a vizsgálni kívánt DNS-szakaszt, lényegében megszüntetve így a DNS vizsgálatok mennyiségi korlátait. Jelenleg az élettudományok szinte minden ágában alkalmazzák ezt a technikát. A PCR-rel kapcsolatos termékek, reagensek és készülékek hatalmas tárháza áll ma már rendelkezésünkre, s ma már egy PCR készülék megszokott alapfelszereltsége egy molekuláris biológiai laboratóriumnak A polimeráz láncreakció elve Ez a forradalmian új technika tehát egy olyan in vitro (egyes speciális alkalmazásokban in situ) módszer, amelynek során meghatározott DNS szakaszokat lehet enzimatikus módon megsokszorozni (amplifikálás) két, az amplifikálandó szakaszt közrefogó, specifikus szekvenciájú oligonukleotid (primer) segítségével (Mullis és Faloona, 1987). A PCR elve a DNS függő DNS polimerázok aktivitásán alapul. Ezek az enzimek egy indító oligonukleotid, a primer segítségével képesek lemásolni, és így megkettőzni az eredeti DNS szálat. Ismételt működésük során az eredeti DNS molekula, a templát hatványozottan felsokszorozódik (Innis és mtsai, 1990). Emiatt kapta ez a módszer a polimeráz láncreakció elnevezést. Akár bp (bázispárban határozzák meg a DNS hosszát) DNS-szakasz is felsokszorosítható ezzel a módszerrel. A PCR technika létrejöttét egy termostabil DNS-polimeráz, a Taq-

17 17 polimeráz felfedezése és az automatizált fűtőblokkok (PCR készülék, thermocycler) kialakítása tette lehetővé, mivel a reakció általában C-os hőmérsékleti tartományban zajló ciklikusan ismétlődő lépésekből áll (Brock és Freeze, 1969). Korábban a PCR-hez az E. coliból származó Klenow enzimet használták. Ekkor azonban forraláskor nemcsak a DNS, hanem az enzim is denaturálódik, ami azt jelenti, hogy a hőérzékeny polimeráz enzimeket minden ciklus után újra kell mérni a reakcióba. Az amerikai Yellowstone Nemzeti park forró vizű hőforrásában fedezték fel a Thermus acquaticus baktériumot (Brock és Freeze, 1969), amely 94 C-on él és a belőle kinyert DNS polimeráz, a Taq DNS polimeráz ezen a hőmérsékleten is megőrzi aktivitását. Az exponenciálisan felsokszorozott DNS agaróz vagy poliakrilamidgélen mutatható ki, interkalálódó DNS festék (etidium-bromid) segítségével (Righetti, 1989; Lindstedt és mtsai, 2000) A PCR reakció menete Az amplifikáció során a DNS-szintézis, majd a képződött termék denaturációjának ismétlődő ciklusai (25 40 ciklus) zajlanak. A PCR reakció rendkívül érzékeny, elméletileg alkalmas arra, hogy akár egyetlen DNS molekulát is felszaporítson, és ez által vizsgálhatóvá tegyen (Mullis és Faloona, 1987; Saiki és mtsai, 1985). A sokszorosítani kívánt DNS-szakasz bázissorrendjét, szekvenciáját nem feltétlenül szükséges teljes egészében ismernünk (egyes speciális esetektől eltekintve), általában a két végén elhelyezkedő nukleiotid sorrendjét kell tudnunk, ahová a primerek bekötődnek. A primerek jelölik ki az amplifikálni kívánt DNS-szakaszt. A kettősszálú DNS szétválása, denaturációja után történik a primerek hibridizációja (anneálás). A primerek a denaturált, egyszálú templát DNS lánchoz H-hidak által kapcsolódnak a bázispárosodás elve szerint, azaz kizárólag adenin-timin (A-T), citozin-guanin (C-G) kapcsolatok jönnek létre. A primer utolsó nukleotidjában szereplő dezoxiribóz 3 helyén egy szabad OH csoport található, amelyhez a DNS függő DNS-polimeráz kapcsolja a soron következő komplementer nukleotod 5 foszfát csoportját. A polimerizáció a primer 3 végén kezdődik és addig tart, amíg véget nem ér a templát, vagy míg a DNS polimeráz le nem válik a megszintetizált kettősszálú DNS darabról (Dieffenbach és mtsai, 1995). Adott hosszúságú DNS szakaszok

18 18 amplifikációjához legalább két primert használunk a PCR reakcióban, az egyik meghatározza a kierősítendő szekvencia elejét (forward primer), amely az úgynevezett sense DNS-szálhoz hibridizál, a másik pedig a végét (reverse primer), amely az antisense DNS-szálhoz kötődik a reakció során. Így a reakció végén csak a kívánt DNS-régió lesz jelen látható mennyiségben. Ha mindkét primer szelektíven tapad a megfelelő egyszálú templát komplementer részéhez és az elongációk során az újonnan szintetizált DNS szálak túlnyúlnak az ellenprimer tapadási helyén, akkor ezen szálak is célszekvenciaként (template) fognak szolgálni, növelve a rendelkezésre álló templát mennyiségét ciklusról ciklusra. A primerekkel kiválasztott DNS régió mennyiségi növekedése a következő formulával fejezhető ki: N=(2 n -2n)x, ahol n a ciklusok száma, x a kiindulási templát mennyiség kópiáinak száma, N az n ciklus után jelenlevő amplifikált DNS kópiáinak a száma (Rolfs és mtsai, 1992). A PCR reakció egy ciklusa az alábbi három lépésből áll: A PCR lépései: A reakció egy ciklusa 3 eltérő hőmérsékleten lejátszódó, 3 különböző lépésből tevődik össze (2. ábra; Zsolnai, 2000). A reakció statisztikai folyamatként fogható fel, ezért pl. az annealing hőmérsékleten is lejátszódik elongáció és viszont. - denaturáció: magas hőmérsékleten (92-96 C-on) a két DNS szál elválik egymástól, lehetővé téve, hogy a primerek majd kapcsolódhassanak rájuk. A folyamat ideje: 30 sec. - annealing (primerek kötődése): C-on a primerek kötődnek az egyszálúvá alakított DNS komplementer szakaszához. Az annealási hőmérséklet elsősorban a primerek olvadási hőmérsékletétől függ. A folyamat ideje: 30 sec. - elongáció (lánchosszabítás): ebben a szakaszban játszódik le az új lánc szintézise a már láncindító szekvenciaként viselkedő primer tökéletesen

19 19 feltapadó 3 végéről (72-73 C-on). A lépés időigénye egyrészt függ magától a DNS-polimeráztól, másrészt az amplifikálandó DNS-szakasz hosszától. 2. ábra: A PCR-ciklus sematikus ábrája. (1) Denaturálás C-on. (2) Kapcsolódás C-on. (3) Meghosszabbítás C-on (P=polimeráz). (4) Az első ciklus véget ért. Az eredményül kapott két DNS-szál a következő ciklus templátja lesz, azaz minden ciklusban megkétszereződik a DNS mennyisége. (forrás: A PCR reakcióelegy összetevői - Templát vagy target DNS: az a DNS, amelyről nagyszámú másolatot akarunk készíteni; biológiai mintából izolált DNS, amely lehet genomiális- vagy

20 20 mitokondriális DNS vagy RNS-ről reverz transzkripcióval átírt úgynevezett cdns - primerek: szintetikusan előállított DNS szálak (oligonukleotidok); a primer 1 (forward) az egyik DNS szálon komplementer és az amplifikálódó DNS kiindulását definiálja; a primer 2 (reverse) a másik DNS szálon komplementer és a termék végét határozza meg - dntp-k: az új komplementer lánc felépítéséhez szükséges alkotóelemek (d: deoxy, N: adenin citozin - guanin - timin, TP: tri-foszfát) - Hőstabil polimeráz (pl.:taq): a nukleotidok beépítését (lánchosszabítást) végző enzim - Puffer: a hőstabil polimeráz megfelelő működéséhez biztosítja az ideális pht, ionerősséget és sókoncentrációt - MgCl 2 : a Taq polimeráz működéséhez nélkülözhetetlen; az optimális Mg 2+ koncentráció általában 0,5-3 mm között mozog - desztillált víz A kapilláris gélelektroforézis A kapilláris elektroforézis egy olyan, napjainkban rendkívül gyorsan fejlődő analitikai elválasztási módszer, amely egyesíti a klasszikus elektroforézis technikáját a modern kromatográfiás detektálás és automatizálás műszeres lehetőségeivel (3. ábra; Issaq, 2000). Az elektroforetikus elválasztási módszerek azon alapulnak, hogy elektromos térben az oldott anyagok különböző sebességgel vándorolnak méretük és/vagy töltésük függvényékben (Tiselius, 1937). A kapilláris elektroforézisnél (capillary electrophoresis, CE) az elválasztás egy vékony, általában μm belső átmérőjű, puffer oldattal töltött cm hosszú kapillárisban történik. Az elektroforézist kis átmérőjű kapillárisban kivitelezve lehetővé válik nagy elektromos mező alkalmazása,

21 21 mert a kis kapilláris hatásosan adja le a keletkező hőt. Az elektromos mező növelésével hatékonyabb elválasztás érhető el rövidebb idő alatt. Az alkalmazott feszültség kv. A kapilláris elektroforézisnél a csatorna falát úgy képezik ki, hogy az valamilyen (általában negatív) elektromos töltésű csoportokat tartalmazzon, vagy a megfelelő ph-n negatív töltésűvé váljék, (de nemionos anyagok is kialakíthatnak EEO-t a felületükre adszorbeálódott anionoknak köszönhetően). Ebben az esetben az oldatban lévő kationok a negatív töltésű falhoz vándorolnak, ezzel a csatorna felületén elektromos kettősréteget alakítanak ki. A csatorna két végére elektromos feszültséget kapcsolva a felületen lévő szolvatált kationok elmozdulnak a negatív töltésű elektród irányába, és ezzel mozgásba hozzák a csatornában levő oldatot. Mivel az EEO jelentősen nagyobb az anionok effektív mobilitásánál, ezért nemcsak a kationok vándorolnak, hanem az anionok is. Így az anionok és kationok egyaránt egy futtatás alatt analizálhatók. A töltés nélküli részecskék nem választhatóak el egymástól. Az elválasztás során fontos, hogy az EEO-t megfelelően szabályozzuk (Engelhardt és mtsai, 1996). Az elektroforézist, mint elválasztási technikát Tiselius 1937-ben vezette be (Tiselius, 1937) amikor különböző fehérjéket tartalmazó oldatot helyezett egy, a végeinél puffer oldatokkal érintkező csőbe, és elektromos feszültséget kapcsolt a cső végeire, azt találta, hogy a minta komponensei töltésüktől és mozgékonyságuktól függően különböző sebességgel különböző irányokba vándoroltak. Munkájáért Tiseliusnak később Nobel-díjat adományoztak. A kapilláris gélelektroforézis (capillary gel electrophoresis CGE) a hagyományos lap-gél elektroforézis kapilláris elektroforézis megfelelője. Biológiai makromolekulák (oligonukleotidok, DNS fragmensek és fehérjék) méreten alapuló elválasztására használják (Smith, 1991; Swerdlow és Gesteland, 1990). Főbb előnyei a lap-gél elektroforézissel szemben, hogy sokféle gél-mátrix használható és széles tartományban változhat az összetétel. A kapillárist géllel töltve az megakadályozza az elektroozmotikus áramlást. Ekkor az elválasztás ugyanúgy történik, mint a hagyományos gélelektroforézisnél, de a kapilláris miatt jobb felbontás és nagyobb érzékenység érhető el, valamint lehetővé válik az on-line detektálás. Az elektroforézis szelektivitása nagy molekulatömegű anyagok elválasztásakor nő,

22 22 ha a kapillárist a kapilláris hosszában folytonosan változó pórusármérőjű géllel töltjük meg. Az elektromos erőtér hatására a töltéssel rendelkező molekulák a töltéssűrűség (töltés/ionsugár) alapján eltérő sebességgel vándorolnak, amelyet az ún. molekula szűrőhatás megváltoztat. Érdemes megemlíteni, hogy a töltéssűrűség, a forma és tömeg különbségek elválasztásra történő kihasználásánál a DNS szeparálás esetében szinte kizárólag a tömeg különbség kerül kihasználásra. A kapillárisba poliakrilamidot, agarózt vagy egyéb géleket tölthetünk. Elsősorban fehérjék és nukleinsavak elválasztására használjuk a poliakrilamid (PAGE) és Na-dodecil-szulfát (SDS) töltetet (SDS-PAGE). A kvarckapillárisban a gél polimerizációját kémiai módszerrel vagy gammasugárzással végzik. A gél lehet térhálós (3 dimenziós szerkezetű) vagy lineáris. Sok esetben megfelelő szelektivitás érhető el, ha a kapillárist polimer oldattal töltjük. A töltött csőben az elektroozmózis okozta anyagvándorlás megszűnik. Gélelektroforézissel csak töltéssel rendelkező molekulák elválasztását tudjuk megoldani (Swerdlow és Gesteland, 1990). 3. ábra: A kapilláris elektroforetikus készülék sematikus rajza (forrás: A kapilláris gélelektroforézis jól automatizálható, a gép automatikusan felveszi a DNS mintát, majd méret alapján elvégzi a szétválasztást. Fluoreszcens jelölés esetén az egyes mikroszatellitek azonosíthatók, és a műszer elvégzi a méret-meghatározást is.

23 Molekuláris genetika az állattenyésztésben A XX. század elején gazdasági állatok esetében intenzív kutatómunka kezdődött a vércsoportok, a biokémiai polimorf rendszerek területén. Az ötvenes évektől e vizsgálatok eredményeit felhasználták az állattenyésztési gyakorlatban, elsősorban a szülői származásellenőrzésben (Csontos és mtsai, 1993). A származásellenőrzéseknél az ún. kizárásos módszert alkalmazzák, melyet a humán igazságügyi gyakorlatból vettek át. A módszer lényege: meghatározott immuno-genetikai tulajdonságokra megvizsgálják a szülők (apa, anya), valamint az utód vérét. Az utód egyik szülőjét (ált. anya) biztosnak tekintik. Amennyiben az utód vérében olyan faktorokat találnak, ami a biztosnak mondott (hitt) szülő vérében nincs meg, azt csak a másik szülőjétől örökölhette. Ha az utód ezen tulajdonságai a másik szülőben nem mutathatóak ki, az utód származása attól a szülőtől kizárt (Flink és Csontos, 1988). A vizsgálatok megbízhatósága nagymértékben függ a vizsgált faktorok számától. A származásellenőrzés vizsgálatok mellett folyamatosan publikálták az első olyan kutatások eredményeit, amelyekben megkíséreltek összefüggést találni értékmérő tulajdonságok (termelési, szaporodási tulajdonságok) és az öröklődő vércsoport és a biokémiai polimorfizmus tulajdonságok, mint markerek között (Soós, 1986). Ezen a területen igazi előretörés napjainkban tapasztalható, amikor a molekuláris genetikai ismeretek alkalmazása révén olyan DNS szintű polimorfizmusokat ismerhetünk meg, amelyek számos területen felhasználhatók az állattenyésztési gyakorlatban (Fésüs és mtsai, 2000). Hazánkban a vércsoport és a vér biokémiai polimorfizmusok vizsgálatára kidolgozott módszereket alkalmazták a populációk közötti, illetve a populáción belüli távolság, diverzitás meghatározására az állattenyésztésben (Dohy, 1979; 1999; Cothran és Kovac, 1997; Nozawa és mtsai, 1998; Józsa és mtsai, 2006b). A fajtarokonsági viszonyok illetve a fajták közötti genetikai távolságok meghatározhatóak, ha összehasonlítjuk az egyes fajtákban kapott vércsoport-, szérumfehérje- és enzimgének gyakorisági értékeit. A kapott összefüggések a fajták fejlődéstörténetében való evolució eredményeit azonosíthatják. A fajták közötti genetikai távolságok ismerete különösen hasznos a fajtakeresztezések megtervezésekor és elősegítik a heterózishatásnak becslését (Fésüs, 1984). Megbízhatóbb eredményeket, szélesebb körben való alkalmazhatóságot

24 24 azonban csak a DNS szintű vizsgálatok jelentik. A populációgenetikai vizsgálatok során a DNS mikroszatellit vizsgálatok segítségével kifejezhető a genetikai variabilitás számszerűen is, becsülhető egy adott állomány beltenyésztettségének (homozigozitásának) mértéke is. Ennek elméleti alapja az, hogy a beltenyésztettség mértéke arányos a homozigóta egyedek adott állományon belüli viszonylagos gyakoriságával (Fésüs, 1984). Az utóbbi évtizedben a molekuláris genetika területén végbemenő fejlődés számos DNS marker felfedezését és kimutatásukra alkalmas módszerek kidolgozását jelentette (Achmann és mtsai, 2000; Woodruff, 1993) Genetikai markerek alkalmazása az állattenyésztésben A kódolt és nem kódolt genomi szakaszok variabilitásának a megismerésével létrejött a genetikai markerek fogalma (Jeffreys és mtsai, 1985; Weber és May, 1989). Az ideális genetikai marker nagymértékben polimorf, allélváltozatait egyértelműen, gyorsan és egyszerűen lehet kimutatni, továbbá előnyös, ha belőlük minél többet sikerül kimutatni a genom bármely területén (Dohy, 1999). A legrégebbi genetikai markerek látható genetikai jegyek voltak (pl: szőrszín, szarv megléte, hiánya), továbbá enzimpolimorfizmusok (pl: transzferrin, albumin), vércsoportok (pl: ló esetében D vércsoport, szarvasmarha esetében B vércsoport) stb. Ezek a hagyományos markerek sem polimorfizmusuk tekintetében, sem számukban nem voltak elégségesek átfogó genetikai térképezés végrehajtására. A rekombináns DNS technika megjelenésével fedezték fel a molekuláris genetikai markereket, amelyek döntő hányada génektől független, polimorfizmust mutató DNS szakaszok (Hardge, 1999). A biokémiai és immunológiai markerekkel szemben számos előnyük van. Elviekben minden szövetből, az egyed korától, nemétől függetlenül mód van DNS izolálásra. Genomon belüli eloszlásuknak, illetve a magasfokú polimorfizmusuknak köszönhetően (egy marker akkor számít polimorfnak, ha egy populáción belül minimum két allélja van, aminek a gyakorisága nincs 1 % alatt (Harge, 1999) egyre jobban előtérbe kerültek a populációgenetikai tanulmányokban (Hedrick és Miller, 1992, Russel és mtsai, 1993; Van Zeveren és mtsai, 1995; Magoulas, 1998). A molekuláris genetikai markereket O brien (1991) két csoportra, I. és

25 25 II. típusú markerekre osztotta. Az I. típusú markerek maguk a gének, amelyek kódolt funkcióval rendelkeznek. A fehérjéket kódoló területeknek azonban alacsony a mutációs rátájuk, mert az életfontosságú fehérjékműködésének a megőrzéséhez ez elengedhetetlen feltétel. A II. típusú markereknek nagyobb variabilitása van (Litt és Luty, 1989; Weber és May, 1989; Tautz, 1989). Ebbe a csoportba tartoznak a mikroszatellit markerek is. Az állattenyésztésben és a növénytermesztésben a termelési értékmérők alakulásában fontos szerepet játszó gének, génváltozatok markereinek keresése a fő cél, hogy ezek azonosításával megvalósulhasson a markereken alapuló szelekció. Ez a kutatómunka rengeteg DNS markert tárt fel különböző fajokban, amelyek kisebb-nagyobb mérvű polimorfizmust mutatnak és igen alkalmasak egyedek, állományok genotipizálására. Különösen jelentősek a nem aktív génekben előforduló polimorfizmusok, mivel ezek nincsenek szelekciós hatás alatt, mutációval történő változásai neutrálisak a fenotípusra ill. a túlélésre, ezért fennmaradnak a generációk során (Hidas, 2002). A molekuláris markerekkel számos kalkulációt végezhetünk és gyakoriságuk puszta megállapítása mellett további információkat nyerhetünk az állományokon belüli értékelésekben, pl: az állomány homogenitása, heterozigozitás, genetikai diverzitás, genetikai változatosság (Zhu és mtsai, 1996a; Machado és mtsai, 2003; Maudet és mtsai, 2002; Bjornstad és mtsai, 2000; Tozaki és mtsai, 2003, Achmann és mtsai, 2004; Cothran és mtsai, 1987; Korom és mtsai, 2003). Az állományok összehasonlítására a genetikai távolság (hasonlóság) becslése az alkalmas megközelítés (Nei, 1972). Ezek mellett nagy jelentősége van a molekuláris martkereknek az állományok, populációk beltenyésztettségi szintjének megállapításában is (Curik és mtsai, 2003; Zhu és mtsai, 1996b; Cunningham és mtsai, 2001; MacHugh és mtsai, 1998). Különösen a génmegőrzésben szerepet játszó állományoknál nagy jelentősége lenne az erre vonatkozó információknak Molekuláris genetika a génmegőrzésben A molekuláris genetikai analízisek révén nyert információk génmegőrzésben való közvetlen használata körül ma még nincs teljes konszenzus. Kezdetben a genetikai távolságok számításával értékelték a

26 26 fajtákat, ami azt jelentette, hogy génmegőrzési szempontból azok a legértékesebb fajták, amelyek a többitől legjobban eltérnek a markerek tekintetében. Újabb keletű szempont a megőrzendő állományok belső genetikai szerkezete is, azaz mekkora méretű variabilitást mutatnak a populációk. Ez a mutató természetesen jelentősen függ a fajta állományának történetétől, előfordult-e jelentős létszámcsökkenés a teljes állományt vagy csak a használt apaállatok számát illetően. Az aktuálisan mutatott genetikai variabilitás ezért jobban függ a fajta tenyésztésének múltjától, mint a jelenlegi állománymérettől. A fajták további értékelési szempontjai lehetnek a fajták ismert értékmérői, különleges, egyedi tulajdonságai (rezisztencia, húsminőség, stb.), amelyek természetesen magasabb értéket kölcsönöznek a fajtának (Hidas, 2002). A génmegőrzés célja, hogy a populációkat lehetőleg változatlan formában tartsuk fent. Ismeretes, hogy szelekció nélkül nem lehet tenyészteni, hiszen nem hagyunk meg minden állatot továbbtenyésztésre. Rendkívül fontos, hogy a ritka, kislétszámban előforduló értékeket megőrizzük. Ennek érdekében igyekszenek megőrizni azokat a genetikai markereket (vércsoport, polimorf allélek, mikroszatellit), amelyeknek csak néhány hordozója van. Ez akkor is érvényes, ha nem tudjuk, hogy milyen tulajdonságokkal vannak összefüggésben ezek a markerek (Takács és mtsai, 2006). Magyarországon több kutató is célul tűzte ki e nemes feladatot. Hazánkban számos munka jelent meg őshonos magyar fajták molekuláris genetikai felmérésére DNS mikroszatellit markerek segítségével (Takács és mtsai, 2006; Hidas és mtsai, 2006; Mihók és mtsai, 2006; Radnóczy és mtsai, 2006; Bán és mtsai, 2006; Kusza és mtsai, 2006). A géntartalékok védelmének célja a kihalástól veszélyeztetett háziállatfajták megmentése. A fajta viszont több mint csupán annak neve. A fajták védelmének értelme a jövő generációk ismeretlen igényeinek szolgálata, ezért a tulajdonságokat és az ezek alapját képező géneket kell megmenteni, nem csak a fajta nevét (Bodó, 2002). Sokszor azonban nem könnyű igazságot tenni a hosszú időre szóló idealista tervek és a tenyésztők azonnali álmai között (Alderson 1989). Ezt a célt csak úgy lehet megvalósítani, ha a fajták tulajdonságait értékeljük és kutatjuk termékeik felhasználásának lehetőségét. Leginkább az

27 27 teszi jogosulttá a fajták védelmét, hogy tulajdonságaiknak értéke a jövőben nőni fog. Következetes programra van szükség, hogy ezeket a tulajdonságokat megállapítsuk és hasznosítsuk (Alderson, 1989) Molekuláris genetika a származásellenőrzésben Egy állat származásának ismerete az állattenyésztésben alapvető fontosságú. A tenyészérték, ezáltal a forgalmi érték meghatározása nagyon lényeges. Abban az esetben, ha a származás nem ismeretes, nem állapítható meg az utódok öröklött tulajdonságaiban a szülők befolyása, s így a fajta genetikai előrehaladásának meghatározása is akadályba ütközik (Geldmann és mtsai, 1986; Israel és Weller, 2000). A származásellenőrzés területén a vércsoport és a vér biokémiai polimorfizmusainak vizsgálatára kidolgozott módszereket alkalmazták az állattenyésztésben (Bowling, 1996). A kizárásos módszer ténye, a vitás esetek tisztázatlansága, a nehézkes és hosszadalmas eljárás, valamint a minták szállításának, tárolásának problémái felvetettek egy megbízhatóbb és nagyobb hatékonyságú módszer kidolgozásának ill. adaptálásának szükségességét. Mindezek mellett a kérdés azért is aktuális volt számunkra, mert egyre erőteljesebb törekvések irányulnak az Európai Unió tagállamaiban egy egységes származásellenőrzési módszer bevezetésére. Ez a világban folyó kutatások alapján a molekuláris genetikai módszerek közül került ki (Fésüs és mtsai, 1997). A DNS vizsgálattal végzett származásellenőrzési módszerek magyarországi bevezetését indokolták és a következő hazai és nemzetközi történések tették szükségessé: Az európai és a magyar állategészségügyi szabályok megváltozása - immunsavók termelésének leállítása ISAG (Inernational Society for Animal Genetics) kongresszus ban meghatározta a vizsgálandó mikroszatelliteket ló és szarvasmarha fajban egyaránt 2000, az utolsó vércsoport és biokémiai polimorfizmus alapján végzett körtesztek éve

28 28 Megszűnik a vércsoport és biokémiai polimorfizmusok vizsgálatához használatos vizsgáló savók standardizálásának lehetősége 2000-től kizárólagos DNS alapú körteszt A szarvasmarha faj esetén még néhány egyéb ok is indokolttá tette a DNS alapú származásellenőrzés bevezetését. Hazánkban a húsmarhák tartása legelőre alapozott, gulya-tartásban történik. Az ágazatban csekély mértékű a mesterséges termékenyítés alkalmazása, így a legelőn tartott állatok szabadvagy háremszerű pároztatása a bevált módszer. Az utódok származásellenőrzése a borjak választása után történik: az anya általában ismert, de az apák esetében csak rendszerint azt tudjuk, hogy egy-egy időszakban mely bikák fedeztek a gulyában. Abban az esetben, ha a fajta genetikailag homogén, a fedezésre használt bikák genotípusa hasonló vagy azonos, a hagyományos vércsoport és biokémiai polimorfizmus vizsgálatok alapján a borjak nagy hányadának nem állapítható meg biztonsággal az apai származása. (A húsmarha egyedek kimutatható vércsoport faktorainak, és alléljeinek száma a tejelő-, és kettős hasznú fajtáénak kb %-át teszi ki.) Ez vonatkozik főleg a hereford és angus fajtákra, mely áttételesen rontja a tenyészérték becslés megbízhatóságát is, ha az utódok apákra egyértelműen nem különíthetőek el A DNS re alapozott származásellenőrzés módszerének főbb vonatkozásai A DNS alapú származásellenőrzés vizsgálatok lényege, hogy egy diploid szervezet két homológ kromoszóma garnitúrával rendelkezik, ezért egy lókuszon két mikroszatellit allélt hordoz. Az allél ebben az esetben a nukleotid szekvenciák ismétlődésének a számával lesz kapcsolatban. Egy utód a kérdéses (mikroszatellit) lókuszon olyan két alléllel (szekvencia ismétlődési számmal) rendelkezhet, melyek közül az egyiket az anyától, a másikat az apától örökölte. Ezért az utód minden egyes vizsgált mikroszatellit lókuszát össze kell hasonlítani a szülők megfelelő lókuszával (az adott mikroszatellit ismétlődési számával). Amennyiben minden vizsgált mikroszatellit esetében érvényes, hogy az utód mikroszatellit hossza az adott lókuszon a szülőként megjelölt

29 29 anyában és apában fellelhető, akkor ezzel a vizsgálattal a szülői származás nem zárható ki (Mihók, 2002). A mikroszatellit analízis során kapott eredményekből meghatározhatjuk az utód származását, azok ismerete hasznosan felhasználható a tenyésztésben. Azokra épülő számos kalkulációval pedig populációgenetikai összefüggésekre következtethetünk (Juras és Cothran, 2004; Luís és mtsai, 2002; Sun-joung Lee és Gil-jae Cho, 2006; Tozaki és mtsai, 2001; Van Haeringen és Van Haeringen, 1992) Származásellenőrzés Magyarországon Magyarországon jelenleg nem mindegyik fajtatenyésztő egyesület (ló és szarvasmarha egyaránt) kötelezi tagjait a DNS alapú származásellenőrzés elvégzésére. Minden egyesület maga hozhat határozatot, hogy kéri-e az említett vizsgálatot, vagy sem. Ez alól a nemzetközi fajták jelentenek kivételt (pl. angol telivér) Származásellenőrzés a lótenyésztésben A ló faj esetében az angol telivér, az arab telivér, a lipicai, a magyar sportló, az ügető és a quarter horse fajtákban kötelező a DNS alapú származásellenőrzés, csak a vizsgálat elvégzésével törzskönyvezik a csikókat. Ezenkívül a mesterséges termékenyítésből született csikókat kötelezően vizsgálni kell fajtától függetlenül. A kisbéri, gidrán, nóniusz, a póni, és kisló fajták esetében az adott évjárat véletlenszerűen kiválasztott 10 százaléka kerül vizsgálat alá. A furioso-north star és hidegvérű fajtákban nem kötelező a DNS alapú vizsgálat. Fajtától függetlenül azonban csak az az egyed válhat apaállattá, amelyik átesik az említett vizsgálaton, azaz minden ménjelölt DNS alapú származásellenőrzése kötelező. Magyarországon a Mezőgazdasági Szakigazgatási Hivatal, Állattenyésztési Igazgatóság, Központi Állattenyésztési Laboratóriuma (volt OMMI) szeptember 15.-től csak DNS alapú származásellenőrzést végez a lovak esetében, néhány kivételtől eltekintve (pl.: anya-, ill. apaállat elpusztult, külföldön tartózkodik az állat stb.) A származással, tenyésztéssel kapcsolatos információkat az OLIR (Országos Lótenyésztési Információs Rendszer) adatbázisában nyomon lehet követni.

30 30 A vizsgálat elvégzéséhez szükséges vérmintát (speciális esetekben szőr illetve sperma) jelenleg az állatorvos a lótenyésztési felügyelő jelenlétében veheti le a lovaktól Származásellenőrzés a szarvasmarha tenyésztésben A szarvasmarha faj esetén ugyancsak a tenyésztő egyesületek szabhatják meg tagjaiknak, hogy kérik-e a DNS alapú származásellenőrzés vizsgálatot, vagy sem. A tenyészállatok, illetve a tenyészbikák DNS vizsgálata azonban kötelező a 2. generációig (apa, anya is). Különleges esetekben (pl.: az egyed elpusztult, vagy nincs az országban) a Mezőgazdasági Szakigazgatási Hivatal, Állattenyésztési Igazgatóság, Központi Állattenyésztési Laboratóriuma (volt OMMI = Országos Mezőgazdasági Minősítő Intézet) vércsoport és biokémiai polimorf rendszerek vizsgálatát végzi el, DNS vizsgálat helyett. A magyar szürkemarha fajta esetében vércsoport vizsgálatot is végez a laboratórium, a génfenntartás, a biodiverzitás és a különleges allélok meghatározása céljából. A bikák esetében itt is kötelező a DNS vizsgálat. A húsmarha fajták (hereford, limousin, aberdeen angus) esetében számos egyesület a DNS alapú származásellenőrzést kérte, mivel jóval nagyobb pontossággal határozható meg a borjak származása, mint a vércsoport vizsgálatokkal (nagyon kevés a vércsoport allél) július 1.-től központi lajstromszámot csak az a bika kaphat, amelynek van DNS alapú vizsgálata. A törzskönyvezést több országos adatbázisban lehet nyomon követni (ENAR = Egységes Nyilvántartási és Azonosítási Rendszer, TER = Termékenyítés Ellenőrzési Rendszer adatbázisok). A vizsgálat elvégzéséhez szükséges vérmintát, illetve szőrmintát jelenleg az állatorvos veszi az állatoktól, de a tulajdonos, vagy a tenyésztési vezető is küldhet be a laboratóriumba mintákat.

31 31 4. ANYAG ÉS MÓDSZER 4.1. A kísérleti minták gyűjtése és előkészítése a molekuláris genetikai vizsgálatokhoz A vizsgálatokat az Mezőgazdasági Szakigazgatási Hivatal, Állattenyésztési Igazgatóság, Központi Állattenyésztési Laboratóriumában (Budapest) végeztem. A felhasznált minták a rutinlaborba származásellenőrzés céljából (DNS vizsgálat) kötelezően között beküldött vérminták voltak, amelyeket a randomizálás elvén választottam ki mindkét faj (ló, szarvasmarha) esetében. A vizsgált egyedek vegyesen nő, illetve hím ivarúak voltak (apa, anya, utód). A DNS-mikroszatellit vizsgálatokhoz vett vérmintákat a humán gyakorlatban is ismert EDTA tartalmú vérvételi csövekbe sterilen gyűjtöttem, a vizsgálatok elvégzéséig -20 C-on tároltam. A minták azonosságát a munkafolyamatok során szigorúan és pontosan biztosítanom kellett. A felhasznált vegyszerek analitikai tisztaságúak és DNS-áz mentesek voltak. Az ISAG (Inernational Society for Animal Genetics; ISAG Iroda: Laboratoire de Génétique Biochimique et Cytogénétique, INRA-CRJ, JOUY-EN-JOSAS, Franciaország; weblap: Társaság által, a lovak származásellenőrzésében kötelező 9 mikroszatellit mellett még 8 mikroszatellitet (Dimsoski, 2003) használtam vizsgálataimban, a szarvasmarha esetében pedig 11 mikroszatellitet (Glowatzki-Mullis és mtsai, 1995), amelyeket az 1. és a 2. táblázatok foglalnak össze.

32 32 Mikroszatellit Primer szekvencia (5 3 ) Mérettartomány (bázispár) Referencia VHL20 HTG4 AHT4 HMS7 AHT5 HMS6 HTG6 ASB23 ASB2 HTG10 HTG7 HMS3 HMS2 ASB17 LEX3 HMS1 CA425 (FAM)-CAAGTCCTCTTACTTGAAGACTAG AACTCAGGGAGAATCTTCCTCAG (FAM)-CTATCTCAGTCTTGATTGCAGGAC CTCCCTCCCTCCCTCTGTTCTC (FAM)-AACCGCCTGAGCAAGGAAGT GCTCCCAGAGAGTTTACCCT (FAM)-CAGGAAACTCATGTTGATACCATC TGTTGTTGAAACATACCTTGACTGT (VIC)-ACGGACACATCCCTGCCTGC GCAGGCTAAGGGGGCTCAGC (VIC)-GAAGCTGCCAGTATTCAACCATTG CTCCATCTTGTGAAGTGTAACTCA (VIC)-CCTGCTTGGAGGCTGTGATAAGAT GTTCACTGAATGTCAAATTCTGCT (VIC)-GCAAGGATGAAGAGGGCAGC CTGGTGGGTTAGATGAGAAGTC (VIC)-CCACTAAGTGTCGTTTCAGAAGG CACAACTGAGTTCTCTGATAGG (NED)-CAATTCCCGCCCCACCCCCGGCA TTTTTATTCTGATCTGTCACATTT (NED)-CCTGAAGCAGAACATCCCTCCTTG ATAAAGTGTCTGGGCAGAGCTGCT (NED)-CCAACTCTTTGTCACATAACAAGA CCATCCTCACTTTTTCACTTTGTT (NED)-CTTGCAGTCGAATGTGTATTAAAT ACGGTGGCAACTGCCAAGGAAG (PET)-GAGGGCGGTACCTTTGTACC ACCAGTCAGGATCTCCACCG (PET)-ACACTCTAACCAGTGCTGAGACT GAAGGAAAAAAAGGAGGAAGAC (PET)-CATCACTCTTCATGTCTGCTTGG TTGACATAAATGCTTATCCTATGGC (PET)-AGCTGCCTCGTTAATTCA CTCATGTCCGCTTGTCTC 1. táblázat: A ló fajban vizsgált 17 mikroszatellit listája (StockMarks for Horses Equine 17-plex Genotyping System, Applied Biosystems) van Haeringen és mtsai. (1994) Ellegren és mtsai. (1992) Binns és mtsai. (1995) Guérin és mtsai. (1994) Binns és mtsai. (1995) Guérin és mtsai. (1994) Ellegren és mtsai. (1992) Irvin és mtsai. (1998) Breen és mtsai. (1997) Marklund és mtsai. (1994) Marklund és mtsai. (1994) Guérin és mtsai. (1994) Guérin és mtsai. (1994) Breen és mtsai. (1997) Coogle és mtsai. (1996) Guérin és mtsai. (1994) Eggleston-Scott és mtsai. (1997)

33 33 Mikroszatellit Primer szekvencia (5 3 ) Mérettartomány (bázispár) Referencia BM1824 BM2113 ETH3 ETH10 ETH225 INRA23 TGLA53 TGLA122 TGLA126 TGLA227 SPS115 (NED)-GAGCAAGGTGTTTTTCCAATC CATTCTCCAACTGCTTCCTTG (FAM)-CGTGCCTTCTACCAAATACCC CTTCCTGACAGAAGCAACACC (NED)-GAACCTGCCTCTCCTGCATTGG ACTCTGCCTGTGGCCAAGTAGG (FAM)-GTTCAGGACTGGCCCTGCTAACA CCTCCAGCCCACTTTCTCTTCTC (NED)-GATCACCTTGCCACTATTTCCT ACATGACAGCCAGCTGCTACT (JOE)-GAGTAGAGCTACAAGATAAACTTC TAACTACAGGGTGTTAGATGAACTC (FAM)-GCTTTCAGAAATAGTTTGCATTCA ATCTTCACATGATATTACAGCAGA (JOE)-CCCTCCTCCAGGTAAATCAGC AATCACATGGCAAATAAGTACATAC (JOE)-CTAATTTAGAATGAGAGAGGCTTCT TTGGTCTCTATTCTCTGAATATTCC (FAM)-CGAATTCCAAATCTGTTAATTTGCT ACAGACAGAAACTCAATGAAAGCA (FAM)-AAAGTGACACAACAGCTTCTCCAG AACGAGTGTCCTAGTTTGGCTGTG Bishop és mtsai (1994) Bishop és mtsai (1994) Toldo és mtsai (1993) Toldo és mtsai (1993) Steffen és mtsai (1993) Vaiman és mtsai (1994) Barendse és mtsai (1994) Barendse és mtsai (1994) Barendse és mtsai (1994) Barendse és mtsai (1994) Barendse és mtsai (1994) 2. táblázat: A szarvasmarha fajban vizsgált 11 mikroszatellit listája (StockMarks for Cattle Bovine Genotyping Kit)

34 A vizsgálatokba vont fajták, populációk Ló faj A fajta vizsgálatok során a lipicai (n=630; 4. ábra), az angol telivér (n=200; 5. ábra), az amerikai ügető (n=198; 6. ábra), valamint a magyar hidegvérű (n=58; 7. ábra) fajta egyedeit vizsgáltam, amelyeket a véletlenszerűség elvén választottam ki. A populáció vizsgálatok esetében az angol telivér fajta két állományának 2005-ben beküldött egyedeit vizsgáltam, a Dióspusztai (n=72) és a Kerteskői (n=39) állományokat. 4. ábra: Lipicai fajta 5. ábra: Angol telivér fajta (forrás: (forrás: 6. ábra: Amerikai ügető fajta 7. ábra: Magyar hidegvérű fajta (forrás: (forrás: Szarvasmarha faj A fajtákra vonatkozó kísérletek során öt fajta egyedeit vizsgáltam, név szerint a következőket: magyar tarka (n=252; 10. ábra), limousin (n=127; 12. ábra), hereford (n=144; 9. ábra), charolais (n=254; 11. ábra), aberdeen angus (n=337; 8. ábra). A kísérletekbe vont egyedeket a véletlenszerűség elvén választottam ki. A magyar tarka fajtán belül elvégeztem még a Derecske Petőfi

35 35 Mezőgazdasági Kft. (Derecske, n=40) és a Béke Agrárszövetkezet (Hajdúböszörmény, n=55) populációinak ig beküldött egyedeinek a DNS mikroszatellit vizsgálatát. 8. ábra: Aberdeen Angus fajta (forrás: 9. ábra: Hereford fajta 10. ábra: Magyar tarka fajta (forrás: (forrás: 11. ábra: Charolais fajta 12. ábra: Limousin fajta (forrás: (forrás:

36 A DNS kivonása és tisztítása A vizsgálatok első szakaszában genomiális DNS-t izoláltam limfocitákból, amelyhez a QIAGEN DNS izoláló kitjét használtam (QIAamp DNA Bood Mini Kit, Cat. No ). A munkafolyamatok a gyártó által kiadott standard protokoll szerint történtek. 13. ábra: DNS izolálás QIAamp DNA Blood Mini Kit-tel (Qiagen) Anyagok és eszközök: szobahőmérsékletű minták 56 C-os vízfürdő QIAamp DNA Blood Mini Kit (Cat. No ; QIAGEN) centrifuga vortex Folyamat: 20 l QIAGEN Protease (vagy Protease K) t pipettáztam 1,5 ml-es mikrocentrifuga csövekbe majd hozzáadtam 50 l teljes vért 200 l Buffer AL-t adtam a mintákhoz és vortexeltem 15 másodpercig (homogén legyen) 56 C-os vízfürdőben inkubáltam a mintákat 30 percig majd lecentrifugáltam a csöveket, hogy a kupakban maradt cseppeket is eltávolítsam ezután 200 l etanolt (96-100%) adtam a mintákhoz, majd 15 másodpercig vortexeltem, aztán lecentrifugáltam a csöveket

37 37 Az így elkészített mintákat óvatosan átpipettáztam a QIAamp Spin Column csövekbe (+ 2 ml-es gyűjtőcsövekkel ellátott), anélkül hogy megnedvesíteném a csövek szélét, majd zárás után centrifugáltam 1 percig (6000x g, 8000 rpm). Az oszlopot tiszta gyűjtőcsőbe helyeztem (készletben megtalálható), és eldobtam a szűrletet tartalmazó csöveket. Óvatosan kinyitottam az oszlopokat és 500 l Buffer AW1-t adtam a mintákhoz. A csövek zárása után centrifugáltam 1 percig (6000x g, 8000 rpm). Az oszlopokat tiszta gyűjtőcsőbe helyeztem (készletben megtalálható), és eldobtam a szűrletet tartalmazó csöveket. Óvatosan kinyitottam az oszlopokat és 500 l Buffer AW2-t adtam a mintákhoz. A csövek zárása után centrifugáltam 3 percig (20000x g, rpm) a mintákat. Az oszlopokat új 2 ml-es gyűjtőcsövekbe (nincs a készletben) helyeztem, és eldobtam a szűrletet tartalmazó gyűjtőcsöveket. Egy percig centrifugáltam a mintákat (20000x g, 14000rpm). Az oszlopokat tiszta 1,5 ml-es eppendorf csövekbe (nincs a készletben) helyeztem, és eldobtam a szűrletet tartalmazó csöveket. Óvatosan kinyitottam az oszlopokat és 200 l Buffer AE-t adtam a mintákhoz. Szobahőmérsékleten tartottam 1 percig, majd lecentrifugáltam 1 percig (6000 x g, 8000 rpm) a mintákat. Az így kapott tiszta genomiális DNS -20 C-on felhasználásig tároltam! 4.2. A molekuláris genetikai elemzések során alkalmazott laboratóriumi vizsgálatok STR lókuszok vizsgálatának módszere ló faj esetén A vizsgálandó szakaszok amplifikálása A tiszta DNS kinyerése után felszaporítottam a templátot. Az amplifikálás elvégzéséhez az Applied Biosystems StockMarks for Horses Equine 17-plex Genotyping System (PN ) lovak számára kifejlesztett multiplex kitjét használtam. A PCR- reakcióelegyek össztérfogata mintánként 15 l volt. Ebből 1 l a tiszta genomiális DNS és 14 l volt a reakcióelegy.

38 38 történt: Az elegy összeállítása a gyári protokoll szerint a kit komponenseiből StockMarks PCR puffer 2,50 l dntp mix 4,00 l primer mix 4,00 l AmpliTaq Gold DNS polymerase 0,50 l desztillált víz 3,00 l Az amplifikálást a GeneAmp PCR System 9700 (Applied Biosystems, USA; 18. ábra) készüléken végeztem, a következő PCR program szerint: PCR program: 95 C 10 perc 95 C 30 mp 60 C 30 mp 30 ciklus 72 C 1 perc 72 C 60 perc felhasználásig 4 C-on tartottam Az STR fragmensek genotipizálása (elválasztás, detektálás, szelektálás) Az STR lókuszok PCR-fragmenseinek analíziséhez a felsokszorozott DNS-szakaszok méret szerinti elválasztására elektroforézis, az elválasztott PCR-termék detektálására festés, jelölés és az adott allél típusának meghatározására van szükség. A multiplex formában sokszorozott fragmensek kapilláris elektroforézissel történő elválasztását ABI PRISM TM 310 genetikai analizátor (Applied Biosystems, USA; 18. ábra) segítségével végeztem POP- 4 TM (310 Genetic Analyzer Performance Optimized Polymer-4, PN402838) gélen. A jelölt primerek lézergerjesztett detektálását GeneScan 3.7 szoftver (Applied Biosystems, USA) tette lehetővé. A minták genotipizálása a Genotyper 3.7 szoftverrel történt (14., 15. ábra).

39 ábra: Genotyper 3.7 szoftverrel (Applied Biosystems, USA) értékelt ló DNS profil 15. ábra: A minták genotipizálása (Genotyper 3.7 szoftver) során alkalmazott méret standard (LIZ-GS500) a ló faj esetén

DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN

DNS MIKROSZATELLITEK VIZSGÁLATA LÓ ÉS SZARVASMARHA FAJTÁKBAN DOKTORI (PhD) ÉRTEKEZÉS TÉZISEI PANNON EGYETEM GEORGIKON MEZŐGAZDASÁGTUDOMÁNYI KAR Állattudományi és Állattenyésztéstani Tanszék Tanszékvezető Dr. Husvéth Ferenc egyetemi tanár, az MTA doktora Készült

Részletesebben

DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!!

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!! Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció 1859 1865 1869 1952 Hershey & Chase 1953!!! 1879 1903 1951 1950 1944 1928 1911 1 1. DNS szerkezete Mi az örökítő anyag? Friedrich Miescher

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi

Részletesebben

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Szántó-Egész Réka 1, Mohr Anita 1, Sipos Rita 1, Dallmann Klára 1, Ujhelyi Gabriella 2, Koppányné Szabó Erika

Részletesebben

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA 1. Nukleinsavak keresztrejtvény (12+1 p) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 1. A nukleinsavak a.-ok összekapcsolódásával kialakuló polimerek. 2. Purinvázas szerves bázis, amely az

Részletesebben

Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 468 EGYEDAZONOSÍTÁS ÉS SZÁRMAZÁSELLENİRZÉS HIPERPOLIMORF MIKROSZATELLITA

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

A Hardy-Weinberg egyensúly. 2. gyakorlat

A Hardy-Weinberg egyensúly. 2. gyakorlat A Hardy-Weinberg egyensúly 2. gyakorlat A Hardy-Weinberg egyensúly feltételei: nincs szelekció nincs migráció nagy populációméret (nincs sodródás) nincs mutáció pánmixis van allélgyakoriság azonos hímekben

Részletesebben

TENYÉSZTÉSSZERVEZÉS. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

TENYÉSZTÉSSZERVEZÉS. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 TENYÉSZTÉSSZERVEZÉS Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 A gazdasági állatfajok elismert tenyésztőszervezeteinek ismertetése Tenyésztőszervezeti munka a lótenyésztésben

Részletesebben

DNS MARKEREK VIZSGÁLATA A BAROMFI ÁLLOMÁNYOK GÉNMEGŐRZÉSÉBEN. Hidas András Kisállattenyésztési és Takarmányozási Kutatóintézet, Gödöllő

DNS MARKEREK VIZSGÁLATA A BAROMFI ÁLLOMÁNYOK GÉNMEGŐRZÉSÉBEN. Hidas András Kisállattenyésztési és Takarmányozási Kutatóintézet, Gödöllő DNS MARKEREK VIZSGÁLATA A BAROMFI ÁLLOMÁNYOK GÉNMEGŐRZÉSÉBEN Hidas András Kisállattenyésztési és Takarmányozási Kutatóintézet, Gödöllő Bevezetés A genetikai kutatások forradalmi változásokon mentek át

Részletesebben

Genetika. Tartárgyi adatlap: tantárgy adatai

Genetika. Tartárgyi adatlap: tantárgy adatai Genetika Előadás a I. éves Génsebészet szakos hallgatók számára Tartárgyi adatlap: tantárgy adatai 2.1. Tantárgy címe Genetika 2.2. Előadás felelőse Dr. Mara Gyöngyvér, docens 2.3. Egyéb oktatási tevékenységek

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

Szent István Egyetem. Az ivarérés idejét maghatározó QTL-ek genetikai térképezése tyúkban. Szabó Gyula Doktori értekezés

Szent István Egyetem. Az ivarérés idejét maghatározó QTL-ek genetikai térképezése tyúkban. Szabó Gyula Doktori értekezés Szent István Egyetem Az ivarérés idejét maghatározó QTL-ek genetikai térképezése tyúkban Szabó Gyula Doktori értekezés Gödöllő 2004 A doktori iskola Neve: Állattenyésztés-tudományi Doktori Iskola Tudományága:

Részletesebben

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt

Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 projekt ÁLLATGENETIKA Debreceni Egyetem Nyugat-magyarországi Egyetem Pannon Egyetem A projekt az Európai Unió támogatásával, az

Részletesebben

Hazai méhészeti genomikai és genetikai vizsgálatok

Hazai méhészeti genomikai és genetikai vizsgálatok AKÁCKÖRÚTON Hazai méhészeti genomikai és genetikai vizsgálatok Előző cikkünkben arról írtunk, milyen új eszköztárral rendelkezünk a XXI. században a genetikai vizsgálatok területén, és mit adhat a molekuláris

Részletesebben

Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak.

Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak. Evolúció Az evolúció folyamatos változások olyan sorozata, melynek során bizonyos populációk öröklődő jellegei nemzedékről nemzedékre változnak. Latin eredetű szó, jelentése: kibontakozás Időben egymást

Részletesebben

Johann Gregor Mendel Az olmüci (Olomouc) és bécsi egyetem diákja Brünni ágostonrendi apát (nem szovjet tudós) Tudatos és nagyon alapos kutat

Johann Gregor Mendel Az olmüci (Olomouc) és bécsi egyetem diákja Brünni ágostonrendi apát (nem szovjet tudós) Tudatos és nagyon alapos kutat 10.2.2010 genmisk1 1 Áttekintés Mendel és a mendeli törvények Mendel előtt és körül A genetika törvényeinek újbóli felfedezése és a kromoszómák Watson és Crick a molekuláris biológoa központi dogmája 10.2.2010

Részletesebben

Poligénes v. kantitatív öröklődés

Poligénes v. kantitatív öröklődés 1. Öröklődés komplexebb sajátosságai 2. Öröklődés molekuláris alapja Poligénes v. kantitatív öröklődés Azok a tulajdonságokat amelyek mértékegységgel nem, vagy csak nehezen mérhetők, kialakulásuk kevéssé

Részletesebben

A kromoszómák kialakulása előtt a DNS állomány megkettőződik. A két azonos információ tartalmú DNS egymás mellé rendeződik és egy kromoszómát alkot.

A kromoszómák kialakulása előtt a DNS állomány megkettőződik. A két azonos információ tartalmú DNS egymás mellé rendeződik és egy kromoszómát alkot. Kromoszómák, Gének A kromoszóma egy hosszú DNS szakasz, amely a sejt életének bizonyos szakaszában (a sejtosztódás előkészítéseként) tömörödik, így fénymikroszkóppal láthatóvá válik. A kromoszómák két

Részletesebben

I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.

Részletesebben

MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN

MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN MIKROSZATELIT DNS- VIZSGÁLATOK A MOCSÁRI TEKNŐS NÉGY DUNÁNTÚLI ÁLLOMÁNYÁN Molnár Tamás 1, Lanszki József 1, Magyary István 1, Jeney Zsigmond 2, Lehoczky István 2 1 Kaposvári Egyetem Állattudományi Kar,

Részletesebben

Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben

Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben Duleba Mónika Környezettudományi Doktori Iskola I.

Részletesebben

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A NÖVÉNYGENETIKA Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 A citológia és a genetika társtudománya Citogenetika A kromoszómák eredetét, szerkezetét, genetikai funkcióját,

Részletesebben

Számítógépes döntéstámogatás. Genetikus algoritmusok

Számítógépes döntéstámogatás. Genetikus algoritmusok BLSZM-10 p. 1/18 Számítógépes döntéstámogatás Genetikus algoritmusok Werner Ágnes Villamosmérnöki és Információs Rendszerek Tanszék e-mail: werner.agnes@virt.uni-pannon.hu BLSZM-10 p. 2/18 Bevezetés 1950-60-as

Részletesebben

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal Intelligens Rendszerek Elmélete Dr. Kutor László Párhuzamos keresés genetikus algoritmusokkal http://mobil.nik.bmf.hu/tantargyak/ire.html login: ire jelszó: IRE0 IRE / A természet általános kereső algoritmusa:

Részletesebben

Evolúció. Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet

Evolúció. Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet Evolúció Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet Mi az evolúció? Egy folyamat: az élőlények tulajdonságainak változása a környezethez való alkalmazkodásra Egy

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

Magyar Hereford, Angus, Galloway Tenyésztk Egyesülete

Magyar Hereford, Angus, Galloway Tenyésztk Egyesülete SZAKMAI ÖNÉLETRAJZ Személyi adatok: - Név: Dr. Bene Szabolcs Albin - Lakcím: 8649 Balatonberény, Ady E. u. 45. - Telefonszám: +36306333278 - E-mail: bene-sz@georgikon.hu - Születési hely, id: Marcali,

Részletesebben

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika DNS munka a gyakorlatban 2012.10.12. Természetvédelmi genetika Munka fázisok DNS kivonás elektroforézis (fakultatív lépés) PCR Elektroforézis Szekvenálás Szekvencia elemzés faji azonosítás; variabilitás,

Részletesebben

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel Gyakorlat helye: BIOMI Kft. Gödöllő, Szent-Györgyi A. u. 4. (Nemzeti Agrárkutatási és Innovációs Központ épülete volt

Részletesebben

Természetes szelekció és adaptáció

Természetes szelekció és adaptáció Természetes szelekció és adaptáció Amiről szó lesz öröklődő és variábilis fenotípus természetes szelekció adaptáció evolúció 2. Természetes szelekció Miért fontos a természetes szelekció (TSZ)? 1. C.R.

Részletesebben

3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció

3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció 3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció A vírus genetikai anyagának vizsgálata (direkt víruskimutatási módszer) biztosítja a legrészletesebb és legspecifikusabb információkat a kimutatott

Részletesebben

Tudománytörténeti visszatekintés

Tudománytörténeti visszatekintés GENETIKA I. AZ ÖRÖKLŐDÉS TÖRVÉNYSZERŰSÉGEI Minek köszönhető a biológiai sokféleség? Hogyan történik a tulajdonságok átörökítése? Tudománytörténeti visszatekintés 1. Keveredés alapú öröklődés: (1761-1766,

Részletesebben

Evolúcióelmélet és az evolúció mechanizmusai

Evolúcióelmélet és az evolúció mechanizmusai Evolúcióelmélet és az evolúció mechanizmusai Az élet Darwini szemlélete Melyek az evolúció bizonyítékai a világban? EVOLÚCIÓ: VÁLTOZATOSSÁG Mutáció Horizontális géntranszfer Genetikai rekombináció Rekombináció

Részletesebben

2011. január április 10. IPK Gatersleben (Németország) május 17. Kruppa Klaudia

2011. január április 10. IPK Gatersleben (Németország) május 17. Kruppa Klaudia 2011. január 10. 2011. április 10. IPK Gatersleben (Németország) Gatersleben (G-life) Country State District Town Administration Germany Saxony-Anhalt Salzlandkreis Seeland Basic statistics Area 16.00

Részletesebben

B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK

B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK B aromfitudomány A PULYKA GENETIKAI VIZSGÁLATÁRA ALKALMAS TYÚK MIKROSZATELLITEK Korom Edit, Pinke Orsolya, Veress Gyula, Kovács Balázs, Szabó Gyula, Varga László Mezőgazdasági Biotechnológiai Kutatóközpont,

Részletesebben

Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes.

Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes. Múlt órán: Lehetséges tesztfeladatok: Kitől származik a variáció-szelekció paradigma, mely szerint az egyéni, javarészt öröklött különbségek között a társadalmi harc válogat? Fromm-Reichmann Mill Gallton

Részletesebben

DETERMINATION OF SHEAR STRENGTH OF SOLID WASTES BASED ON CPT TEST RESULTS

DETERMINATION OF SHEAR STRENGTH OF SOLID WASTES BASED ON CPT TEST RESULTS Műszaki Földtudományi Közlemények, 83. kötet, 1. szám (2012), pp. 271 276. HULLADÉKOK TEHERBÍRÁSÁNAK MEGHATÁROZÁSA CPT-EREDMÉNYEK ALAPJÁN DETERMINATION OF SHEAR STRENGTH OF SOLID WASTES BASED ON CPT TEST

Részletesebben

Azonosítási és nyilvántartási rendszerek

Azonosítási és nyilvántartási rendszerek Azonosítási és nyilvántartási rendszerek Dr. Antal Ákos hatósági főállatorvos, megyei ENAR koordinátor Hajdú Bihar Megyei Mezőgazdasági Szakigazgatási Hivatal Élelmiszerlánc biztonsági és Állategészségügyi

Részletesebben

A genetikai sodródás

A genetikai sodródás A genetikai sodródás irányított, nem véletlenszerű Mindig a jobb nyer! természetes szelekció POPULÁCIÓ evolúció POPULÁCIÓ A kulcsszó: változékonyság a populáción belül POPULÁCIÓ nem irányított, véletlenszerű

Részletesebben

KAPILLÁRIS ELEKTROFORÉZIS. dolgozat az Elválasztási műveletek a biotechnológiai iparokban c. tárgyhoz

KAPILLÁRIS ELEKTROFORÉZIS. dolgozat az Elválasztási műveletek a biotechnológiai iparokban c. tárgyhoz KAPILLÁRIS ELEKTROFORÉZIS dolgozat az Elválasztási műveletek a biotechnológiai iparokban c. tárgyhoz DIENES DÓRA I. ÉVF. PHD HALLGATÓ 1999 Bevezetés - Elektroforézis Az elektroforézis olyan elválasztási

Részletesebben

Nukleinsavak. Szerkezet, szintézis, funkció

Nukleinsavak. Szerkezet, szintézis, funkció Nukleinsavak Szerkezet, szintézis, funkció Nukleinsavak, nukleotidok, nukleozidok 1869-ben Miescher a sejtmagból egy savas természetű, lúgban oldódó foszfortartalmú anyagot izolált, amit később, eredetére

Részletesebben

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Rohonczy Kata, Zoller Linda, Fodor Andrea, Tabajdiné, dr. Pintér Vera FoodMicro Kft. Célkitűzés Élelmiszerekben és takarmányokban

Részletesebben

Domináns-recesszív öröklődésmenet

Domináns-recesszív öröklődésmenet Domináns-recesszív öröklődésmenet Domináns recesszív öröklődés esetén tehát a homozigóta domináns és a heterozigóta egyedek fenotípusa megegyezik, így a három lehetséges genotípushoz (példánkban AA, Aa,

Részletesebben

ADATBÁNYÁSZAT I. ÉS OMICS

ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT

Részletesebben

A gyakorlat elméleti háttere A DNS molekula a sejt információhordozója. A DNS nemzedékről nemzedékre megőrzi az élőlények genetikai örökségét.

A gyakorlat elméleti háttere A DNS molekula a sejt információhordozója. A DNS nemzedékről nemzedékre megőrzi az élőlények genetikai örökségét. A kísérlet megnevezése, célkitűzései: DNS molekula szerkezetének megismertetése Eszközszükséglet: Szükséges anyagok: színes gyurma, papírsablon Szükséges eszközök: olló, hurkapálcika, fogpiszkáló, cérna,

Részletesebben

62/2016. (IX. 16.) FM rendelet a magyar ebfajták körének megállapításáról és genetikai fenntartásuk rendjéről

62/2016. (IX. 16.) FM rendelet a magyar ebfajták körének megállapításáról és genetikai fenntartásuk rendjéről 62/2016. (IX. 16.) FM rendelet a magyar ebfajták körének megállapításáról és genetikai fenntartásuk rendjéről Az állattenyésztésről szóló 1993. évi CXIV. törvény 49. (1) bekezdés a) pont 3., 17. és 19.

Részletesebben

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G.

A DNS szerkezete. Genom kromoszóma gén DNS genotípus - allél. Pontos méretek Watson genomja. J. D. Watson F. H. C. Crick. 2 nm C G. 1955: 46 emberi kromoszóma van 1961: mrns 1975: DNS szekvenálás 1982: gén-bank adatbázisok 1983: R (polymerase chain reaction) Mérföldkövek 1 J. D. Watson F. H.. rick 2008 1953 2003 Watson genomja DNS

Részletesebben

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár

Részletesebben

A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish.

A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish. OTKA K67808 zárójelentés 2012. A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish. A fluoreszcens in situ hibridizáció (FISH) olyan technikai fejlettséget ért

Részletesebben

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013 Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz

Részletesebben

Növényi minták GMO-tartalmának kvalitatív meghatározása

Növényi minták GMO-tartalmának kvalitatív meghatározása Növényi minták GMO-tartalmának kvalitatív meghatározása Uri Csilla 1 Prokisch József 1 Sándor Erzsébet 2 Győri Zoltán 1 Debreceni Egyetem Agrártudományi Centrum, Mezőgazdaságtudományi Kar, 1 Élelmiszertudományi,

Részletesebben

CHO H H H OH H OH OH H CH2OH HC OH HC OH HC OH CH 2

CHO H H H OH H OH OH H CH2OH HC OH HC OH HC OH CH 2 4. Előadás ukleozidok, nukleotidok, nukleinsavak Történeti háttér Savas karakterű anyagok a sejtmagból 1869-71 DS a sejtmag fő komponense F. Miescher (Svájc) 1882 Flemming: Chromatin elnevezés Waldeyer:

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

DNS-számítógép. Balló Gábor

DNS-számítógép. Balló Gábor DNS-számítógép Balló Gábor Bevezetés A nukleinsavak az élő szervezetek egyik legfontosabb alkotórészei. Ezekben tárolódnak ugyanis az öröklődéshez, és a fehérjeszintézishez szükséges információk. Bár a

Részletesebben

A géntechnológiát megalapozó felfedezések

A géntechnológiát megalapozó felfedezések 2010. december BIOTECHNOLÓGIA Rova tvezető: Dr. Heszky László akadémikus A géntechnológia genetikai alapjai c. I. fejezet 1-5. részében azokat a tudományos eredményeket mutattuk be, melyek bizonyítják,

Részletesebben

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése Kereskedelmi forgalomban kapható készülékek 1 Fogalmak

Részletesebben

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Dr. Nagy Bálint az MTA doktora fokozat megszerzéséhez a fenti címen nyújtott be a

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

Biológiai biztonság: Veszély: - közvetlen - közvetett

Biológiai biztonság: Veszély: - közvetlen - közvetett Biológiai biztonság Biológiai biztonság: Minden biológiai anyag potenciálisan kórokozó és szennyező; a biológiai biztonság ezen biológiai anyagok hatásaira (toxikus hatások, fertőzések) koncentrál és célja

Részletesebben

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal. A genetikus algoritmus működése. Az élet információ tárolói

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal. A genetikus algoritmus működése. Az élet információ tárolói Intelligens Rendszerek Elmélete dr. Kutor László Párhuzamos keresés genetikus algoritmusokkal http://mobil.nik.bmf.hu/tantargyak/ire.html login: ire jelszó: IRE07 IRE 5/ Természetes és mesterséges genetikus

Részletesebben

A PCR TECHNIKA ÉS ALKALMAZÁSI TERÜLETEI

A PCR TECHNIKA ÉS ALKALMAZÁSI TERÜLETEI Polimeráz láncreakció A PCR TECHNIKA ÉS ALKALMAZÁSI TERÜLETEI Tetszõleges DNS-szakaszról (templát) rövid idõ alatt korlátlan számú másolatot készíthetünk két iniciáló oligonukleotid (primer) és a DNS-polimeráz

Részletesebben

Fenotípusos változékonyság: genetikai változékonyság A környezet hatása függ a jellegektől: a testi jellegekre rendszerint kevésbé hat mint a

Fenotípusos változékonyság: genetikai változékonyság A környezet hatása függ a jellegektől: a testi jellegekre rendszerint kevésbé hat mint a Fenotípusos változékonyság: genetikai változékonyság környezet A környezet hatása függ a jellegektől: a testi jellegekre rendszerint kevésbé hat mint a viselkedésre (1) Egy nukleotid polimorfizmus (SNP-ek)

Részletesebben

Zárójelentés. Állati rotavírusok összehasonlító genomvizsgálata. c. OTKA kutatási programról. Bányai Krisztián (MTA ATK ÁOTI)

Zárójelentés. Állati rotavírusok összehasonlító genomvizsgálata. c. OTKA kutatási programról. Bányai Krisztián (MTA ATK ÁOTI) Zárójelentés Állati rotavírusok összehasonlító genomvizsgálata c. OTKA kutatási programról Bányai Krisztián (MTA ATK ÁOTI) 2012 1 Az Állati rotavírusok összehasonlító genomvizsgálata c. programban azt

Részletesebben

Farmakológus szakasszisztens Farmakológus szakasszisztens 2/34

Farmakológus szakasszisztens Farmakológus szakasszisztens 2/34 -06 Farmakológus szakasszisztens feladatok A 0/007 (II. 7.) SzMM rendelettel módosított /006 (II. 7.) OM rendelet Országos Képzési Jegyzékről és az Országos Képzési Jegyzékbe történő felvétel és törlés

Részletesebben

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR)

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR) Genomika (A genom, génállomány vizsgálata) Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel DNS szekvenálási eljárások DNS ujjlenyomat (VNTR) DNS chipek statikus és dinamikus információk vizsgálata

Részletesebben

Nincs öntermékenyítés, de a véges méret miatt a párosodó egyedek bizonyos valószínűséggel rokonok, ezért kerül egy

Nincs öntermékenyítés, de a véges méret miatt a párosodó egyedek bizonyos valószínűséggel rokonok, ezért kerül egy Véges populációméret okozta beltenyésztettség incs öntermékenyítés, de a véges méret miatt a párosodó egyedek bizonyos valószínűséggel rokonok, ezért kerül egy utódba 2 IBD allél Előadásról: -F t (-/2)

Részletesebben

Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben

Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben Molekuláris biológiai módszerek alkalmazása a biológiai környezeti kármentesítésben Dr. Kovács Tamás, Kovács Árpád László Kármentesítés Aktuális Kérdései 2013 Budapest, 2013.03.21-22 Bioremediáció során

Részletesebben

Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze

Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze Polimeráz láncreakció a géntechnológia nélkülözhetetlen eszköze László Éva Babeş-Bolyai Tudományegyetem, Kolozsvár A polimeráz láncreakció (PCR) napjaink molekuláris biológiai (genetikai) kutatásának nélkülözhetetlen

Részletesebben

5. Molekuláris biológiai technikák

5. Molekuláris biológiai technikák 5. Molekuláris biológiai technikák DNS szaporítás kémcsőben és élőben. Klónozás, PCR, cdna, RT-PCR, realtime-rt-pcr, Northern-, Southernblotting, génexpresszió, FISH 5. Molekuláris szintű biológiai technikák

Részletesebben

TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL

TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL Az egyes biomolekulák izolálása kulcsfontosságú a biológiai szerepük tisztázásához. Az affinitás kromatográfia egyszerűsége, reprodukálhatósága

Részletesebben

Molekuláris ökológia Általános Ökológia 2012

Molekuláris ökológia Általános Ökológia 2012 Molekuláris ökológia Általános Ökológia 2012 Technikák Csak vázlatosan Technikák Allozim elektroforérizs Restrikciós fragmens méret polimorfizmus (RFLP) Miniszattelita DNS ujjlenyomat Random Amplification

Részletesebben

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor,

A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, 1 A gidrán fajta genetikai változatosságának jellemzése mitokondriális DNS polimorfizmusokkal Kusza Szilvia Sziszkosz Nikolett Mihók Sándor, (Debreceni Egyetem Állattenyésztéstani Tanszék) A bármilyen

Részletesebben

A GENOMIKUS TENYÉSZÉRTÉKEK ALKALMAZÁSA A HAZAI LIMOUSIN TENYÉSZTÉSBEN

A GENOMIKUS TENYÉSZÉRTÉKEK ALKALMAZÁSA A HAZAI LIMOUSIN TENYÉSZTÉSBEN A GENOMIKUS TENYÉSZÉRTÉKEK ALKALMAZÁSA A HAZAI LIMOUSIN TENYÉSZTÉSBEN Mottó: A GENOMIKA A LEGNAGYOBB HATÁSÚ FEJLESZTÉS A MÉLYHŰTÖTT SZAPORÍTÓANYAG BEVEZETÉSE ÓTA PIERRE LALIBERTÉ A SEMEX- ALLIANCE ALELNÖKE

Részletesebben

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai

Dr. Máthéné Dr. Szigeti Zsuzsanna és munkatársai Kar: TTK Tantárgy: CITOGENETIKA Kód: AOMBCGE3 ECTS Kredit: 3 A tantárgyat oktató intézet: TTK Mikrobiális Biotechnológiai és Sejtbiológiai Tanszék A tantárgy felvételére ajánlott félév: 3. Melyik félévben

Részletesebben

NÖVÉNYNEMESÍTÉS. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A

NÖVÉNYNEMESÍTÉS. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A NÖVÉNYNEMESÍTÉS Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Előadás áttekintése A növénynemesítés és molekuláris biológia története A biotechnológia jelentősége a növénynemesítésben

Részletesebben

Kontrol kártyák használata a laboratóriumi gyakorlatban

Kontrol kártyák használata a laboratóriumi gyakorlatban Kontrol kártyák használata a laboratóriumi gyakorlatban Rikker Tamás tudományos igazgató WESSLING Közhasznú Nonprofit Kft. 2013. január 17. Kis történelem 1920-as években, a Bell Laboratórium telefonjainak

Részletesebben

Mangalica tanácskozás Debrecen 2014. Augusztus 18. Dr. Radnóczi László

Mangalica tanácskozás Debrecen 2014. Augusztus 18. Dr. Radnóczi László A minisztérium feladatai a védett őshonos állatfajták megőrzésével és genetikai fenntartásával kapcsolatban Mangalica tanácskozás Debrecen 2014. Augusztus 18. Dr. Radnóczi László Jogi szabályozás -az

Részletesebben

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6 Agilent 2100 Bioanalyzer mikrokapilláris gélelektroforézis rendszer G2943CA 2100 Bioanalyzer system forgalmazó: Kromat Kft. 1112 Budapest Péterhegyi u. 98. t:36 (1) 248-2110 www.kromat.hu bio@kromat.hu

Részletesebben

SALMONELLA SSP. GYORS, MOLEKULÁRIS BIOLÓGIAI MÓDSZEREKKEL TÖRTÉNŐ DETEKTÁLÁSA

SALMONELLA SSP. GYORS, MOLEKULÁRIS BIOLÓGIAI MÓDSZEREKKEL TÖRTÉNŐ DETEKTÁLÁSA SALMONELLA SSP. GYORS, MOLEKULÁRIS BIOLÓGIAI MÓDSZEREKKEL TÖRTÉNŐ DETEKTÁLÁSA Nyirő-Fekete B., Tabajdi-Bajza N., Kovácsné Kis É., Pocklán E., Zoller L., Micsinai A., Gasparikné Reichardt J. Hungalimentaria

Részletesebben

Az elektromos kettősréteg. Az elektromos potenciálkülönbség eredete, értéke és az azt befolyásoló tényezők. Kolloidok stabilitása.

Az elektromos kettősréteg. Az elektromos potenciálkülönbség eredete, értéke és az azt befolyásoló tényezők. Kolloidok stabilitása. Az elektromos kettősréteg. Az elektromos potenciálkülönbség eredete, értéke és az azt befolyásoló tényezők. Kolloidok stabilitása. Adszorpció oldatból szilárd felületre Adszorpció oldatból Nem-elektrolitok

Részletesebben

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott

Részletesebben

ÁLLATTENYÉSZTÉSI TUDOMÁNYOK DOKTORI ISKOLA Doktori Iskola vezető: Dr. Bánszki Tamás, MTA doktora. Témavezetők: mezőgazdaság-tudomány kandidátusa

ÁLLATTENYÉSZTÉSI TUDOMÁNYOK DOKTORI ISKOLA Doktori Iskola vezető: Dr. Bánszki Tamás, MTA doktora. Témavezetők: mezőgazdaság-tudomány kandidátusa DEBRECENI EGYETEM AGRÁRTUDOMÁNYI CENTRUM MEZŐGAZDASÁGTUDOMÁNYI KAR ÁLLATTENYÉSZTÉS- ÉS TAKARMÁNYOZÁSTANI TANSZÉK ÁLLATTENYÉSZTÉSI TUDOMÁNYOK DOKTORI ISKOLA Doktori Iskola vezető: Dr. Bánszki Tamás, MTA

Részletesebben

POSZTTRANSZLÁCIÓS MÓDOSÍTÁSOK: GLIKOZILÁLÁSOK

POSZTTRANSZLÁCIÓS MÓDOSÍTÁSOK: GLIKOZILÁLÁSOK POSZTTRANSZLÁCIÓS MÓDOSÍTÁSOK: GLIKOZILÁLÁSOK Dr. Pécs Miklós Budapesti Műszaki és Gazdaságtudományi Egyetem, Alkalmazott Biotechnológia és Élelmiszertudomány Tanszék 1 Glikozilálás A rekombináns fehérjék

Részletesebben

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Szalma Katalin Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Témavezető: Dr. Turai István, OSSKI Budapest, 2010. október 4. Az ionizáló sugárzás sejt kölcsönhatása Antone

Részletesebben

A (human)genetika alapja

A (human)genetika alapja A (human)genetika alapja Genom diagnosztika - születés elött - tünetek megjelenése elött - hordozó diagnosztika Prenatalis genetikai diagnosztika indikációi emelkedett valószinüség egy gén betegségre egyik

Részletesebben

Transzgénikus állatok előállítása

Transzgénikus állatok előállítása Transzgénikus állatok előállítása A biotechnológia alapjai Pomázi Andrea Mezőgazdasági biotechnológia A gazdasági állatok és növények nemesítése új biotechnológiai eljárások felhasználásával. Cél: jobb

Részletesebben

Az anyagi rendszer fogalma, csoportosítása

Az anyagi rendszer fogalma, csoportosítása Az anyagi rendszer fogalma, csoportosítása A bemutatót összeállította: Fogarasi József, Petrik Lajos SZKI, 2011 1 1 A rendszer fogalma A körülöttünk levő anyagi világot atomok, ionok, molekulák építik

Részletesebben

A földművelésügyi miniszter 62/2016. (IX. 16.) FM rendelete a magyar ebfajták körének megállapításáról és genetikai fenntartásuk rendjéről

A földművelésügyi miniszter 62/2016. (IX. 16.) FM rendelete a magyar ebfajták körének megállapításáról és genetikai fenntartásuk rendjéről A földművelésügyi miniszter 62/2016. (IX. 16.) FM rendelete a magyar ebfajták körének megállapításáról és genetikai fenntartásuk rendjéről Az állattenyésztésről szóló 1993. évi CXIV. törvény 49. (1) bekezdés

Részletesebben

Dr. Nemes Nagy Zsuzsa Szakképzés Karl Landsteiner Karl Landsteiner:

Dr. Nemes Nagy Zsuzsa Szakképzés Karl Landsteiner Karl Landsteiner: Az AB0 vércsoport rendszer Dr. Nemes Nagy Zsuzsa Szakképzés 2011 Az AB0 rendszer felfedezése 1901. Karl Landsteiner Landsteiner szabály 1901 Karl Landsteiner: Munkatársai vérmintáit vizsgálva fedezte fel

Részletesebben

1. Magyar szürke szarvasmarha tenyésztési programhoz kapcsolódó meg nem felelések

1. Magyar szürke szarvasmarha tenyésztési programhoz kapcsolódó meg nem felelések 4B. számú melléklet: Az egyes fajták tenyésztési program előírásainak meg nem felelése a súlyosság és tartósság szempontjából az ellenőri megállapítások elvégzéséhez 1. Magyar szürke szarvasmarha tenyésztési

Részletesebben

Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL

Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL Szent István Egyetem ŐSHONOS MAGYAR TYÚKÁLLOMÁNYOK GENETIKAI DIVERZITÁSÁNAK VIZSGÁLATA KÜLÖNBÖZŐ MOLEKULÁRIS GENETIKAI MARKEREK SEGÍTSÉGÉVEL Doktori (Ph.D) értekezés tézisei Bodzsár Nóra Gödöllő 2012 A

Részletesebben

PrenaTest Újgenerációs szekvenálást és z-score

PrenaTest Újgenerációs szekvenálást és z-score PrenaTest Újgenerációs szekvenálást és z-score számítást alkalmazó, nem-invazív prenatális molekuláris genetikai teszt a magzati 21-es triszómia észlelésére, anyai vérből végzett DNS izolálást követően

Részletesebben

Biomatematika 13. Varianciaanaĺızis (ANOVA)

Biomatematika 13. Varianciaanaĺızis (ANOVA) Szent István Egyetem Állatorvos-tudományi Kar Biomatematikai és Számítástechnikai Tanszék Biomatematika 13. Varianciaanaĺızis (ANOVA) Fodor János Copyright c Fodor.Janos@aotk.szie.hu Last Revision Date:

Részletesebben

Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL

Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL KÖZÖS STRATÉGIA KIFEJLESZTÉSE MOLEKULÁRIS MÓDSZEREK ALKALMAZÁSÁVAL

Részletesebben

A polimeráz láncreakció (PCR) és gyógyszerkutatási alkalmazásai

A polimeráz láncreakció (PCR) és gyógyszerkutatási alkalmazásai 1. A PCR sikertörténete Magyar Kémiai Folyóirat - Összefoglaló közlemények 153 A polimeráz láncreakció (PCR) és gyógyszerkutatási alkalmazásai DEZSŐ Péter * és NAGY József Richter Gedeon Rt., Gyömrői út

Részletesebben

Biomassza anyagok vizsgálata termoanalitikai módszerekkel

Biomassza anyagok vizsgálata termoanalitikai módszerekkel Biomassza anyagok vizsgálata termoanalitikai módszerekkel Készítette: Patus Eszter Nagykanizsa, Batthyány Lajos Gimnázium Témavezető: Sebestyén Zoltán 2010. júl. 2. Mit is vizsgáltunk? Biomassza: A Földön

Részletesebben