Az RkpM fehérje funkciójának elemzése

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Az RkpM fehérje funkciójának elemzése"

Átírás

1 Az RkpM fehérje funkciójának elemzése DIPLOMAMUNKA Készítette: PÁLVÖLGYI ADRIENN Biológus hallgató Témavezető: DR. PUTNOKY PÉTER Pécsi Tudományegyetem, Természettudományi Kar Genetikai és Molekuláris Biológiai Tanszék PÉCS, 2004

2 2 TARTALOMJEGYZÉK 1. IRODALMI ÁTTEKINTÉS Bevezetés Nitrogénkötő szervezetek A szimbiózis kialakulása A Nod faktor A nitrogénkötésért felelős gének Sejtfelszíni poliszacharidok Az exopoliszacharidok A lipopoliszacharidok A kapszuláris poliszacharidok 7 2. A MUNKA ELŐZMÉNYEI Spontán mutáns baktériumtörzsek izolálása CÉLKITŰZÉSEK ANYAGOK ÉS MÓDSZEREK Baktériumok, bakteriofágok, plazmidok A baktériumok növesztése Fágok szaporítása A baktériumok keresztezése Fágérzékenységi teszt Összes DNS izolálás Plazmid DNS izolálás Polimeráz láncreakció (PCR) Fragmentizolálás DNS szekvenálás Restrikciós emésztés Gélelekroforézis Kompetens sejt készítés Ligálási reakció Transzformálás In vitro transzpozíciós mutagenezis Bioinformatikai módszerek EREDMÉNYEK ÉS MEGVITATÁSUK Az rkp-4046 mutáció helyének meghatározása A 16-3 bakteriofág receptor kialakításában részt vesz az RkpM fehérje Az rkpm 4046 allélban egy missense mutáció található Újabb mutánsok vizsgálata Komplementációs kísérlet a receptorfunkció bizonyítására Az rkpm klónozása egy erős promoter után Az rkpm expresszió hatása különböző mutáns törzsekben Az rkpm gén bioinformatikai analízise PLP kötés a DegT/EryC/DnrJ/StrS aminotranszferáz családnál Az RkpM fehérje DNS-kötő domént tartalmaz? A bioinformatikai elemzések eredményeinek értékelése ÖSSZEFOGLALÁS IRODALMI HIVATKOZÁSOK RÖVIDÍTÉSEK 45 KÖSZÖNETNYÍLVÁNÍTÁS 46

3 3 1. IRODALMI ÁTTEKINTÉS 1.1. Bevezetés A biológiai nirtogénkötés igen fontos szerepet tölt be az ökoszisztémában, része a folyamatos nitrogénkörforgásnak. A folyamatban számos baktérium vesz részt. A lebontó szervezetek által a szerves nitrogén vegyületek ammóniává alakulnak (ammonifikáció), illetve a légkörből nitrogénfixálás során a nitrogéngáz szintén ammóniává redukálódik. A redukált ammónia bizonyos arányát nitrifikáló baktériumok nitráttá oxidálják, mely denitrifikáció segítségével nitrogéngáz formájában újra a légkörbe juthat. A Föld légkörének 78%-át nitrogéngáz alkotja, ennek nagy részét a diazotróf szervezetek biológiai úton redukálják (Burns and Hardy, 1975). A növények egyik alapvető tápanyagforrása a talajból, kötött formában felvett nitrogén (nitrát, nitrit, ammónia). A növényekkel szimbiózist kialakító diazotróf baktériumok a légköri nitrogéngázt redukálják ammóniává, így az együttélés lehetőséget biztosít arra, hogy kimeríthetetlen nitrogén utánpótlásként szolgáljon a gazdanövények számára Nitrogénkötő szervezetek Nitrogénkötésre a cianobaktériumok mellett még néhány, szintén prokarióta szervezet képes. Leghatékonyabban a szimbiózisban élő baktériumok alkalmasak a nitrogénkötésre, de léteznek szabadonélő szervezetek is, mint a Klebsiella, Rhodospirillum, Azotobacter és Clostridium fajok. A szimbiotikus baktériumok a növénytől kapják meg a nitrogénkötéshez szükséges energiát. A cianobaktériumok mindenütt előforduló fotoautotróf prokarióták (Rippka et al., 1979). Ismerünk mind szabadon (Noctoc spp., Chlorogleosis spp.), mind szimbiózisban élő fajokat (Nostoc spp., Chalotrix spp.) (West and Adams, 1997). Ezen szervezeteknél a nitrogénfixálás és fotoszintézis együtt zajlik, de külön differenciálódott sejtekben. A nitrogén fixálása heterociszta sejtekben, a fotoszintézis vegetatív sejtekben történik (Wolk et al., 1994). A Nostoc fajok számos élőlénnyel képesek a szimbiózis kialakítására, úgymint az Azolla moha, a nyitvatermő cikász és a zárvatermő Gunnera növényekkel (Schenk, 1992). A rhizobiumok, a Rhizobiaceae családba tartozó, Gram-negatív, diazotróf talajbaktériumok (Rhizobium, Azorhizobium, Bradyrhizobium, Sinorhizobium, Mezorhizobium), szimbiózist tudnak kialakítani a pillangósvirágú (Fabaceae) növényekkel (Dénairé et al., 1992), illetve a nem pillangósvirágú Parasponia fajokkal (Becking, 1992). A szimbiózis legfejlettebb formája az endoszimbiózis, melyet a rhizobiumok is alkalmaznak, partnerspecifikus módon jön létre. Ebben az esetben egy kölcsönösen hasznos együttélésről van szó (Allen and Allen, 1981). A baktérium megfelelő, redukált

4 4 nitrogénforrással látja el a növényt, míg a gazdanövény tápanyagot biztosít a baktérium számára. A vizsgálatunk tárgyát képező Sinorhizobium meliloti (régebbi nevén Rhizobium meliloti), szimbiotikus kapcsolatot képes kialakítani a lucerna (Medicago), lepkeszeg (Trigonella) és a somkóró (Melilotus) fajokkal. E különleges baktérium-növény kapcsolat régóta kutatott téma a világon, mind a Sinorhizobium meliloti, mind más rhizobium fajok esetében (pl. Sinorhizobium fredii) A szimbiózis kialakulása A rhizobium és pillangósvirágúak közötti szimbiózis létrejöttének mechanizmusa hasonló a patogén baktériumok és az eukarióta sejtek kapcsolódásához (Hentschel et al., 2000). A szimbiózis kialakulása, igen összetett folyamat, mely komplex molekuláris jelcserén alapszik. Első lépésként a gazdanövény különféle, flavonoid típusú vegyületeket bocsájt ki a talajba (Redmond et al., 1986), ami pozitív kemotaxist vált ki (Currier and Strobel, 1974). Ennek hatására a baktériumok feldúsulnak a növény rhizoszférájában. A flavonoidok, melyek molekula szerkezete fajspecifikus (Bladergroen and Spaink, 1998), aktiválják a baktériumsejtekben található un. nodulációs (nod) gének expresszióját, aminek következtében a baktérium a növény felé kiválaszt egy szignált, a Nod faktort (Schultze et al., 1994), mely többek között a szimbiótikus gümő kialakulását indukálja. A fertőzés során a baktériumok a gyökérszőrőkhöz tapadnak (Mills and Bauer, 1985), a tapadást a növény által kiválasztott lectinek biztosítják (Diaz et al., 1989). Ezután történik a gyökérszőrök meggörbülése. A fertőzési helyen a sejtfal leépül és egy sejtfalösszetevőkből álló, újonnan lerakódó, belső csőszerű képlet, az infekciós fonal jön létre, mely folyamatosan növekszik, elágazik (Robertson and Lyttleton, 1982). Ezáltal jutnak el a baktériumok a gyökérszőrsejtektől a gümősejtekig, ahol a növényi sejt citoplazmájába endocitózissal lépnek be. A gümősejt belsejébe került baktériumok peribakteroid membránnal határoltak (Mellor and Werner, 1987). Mialatt a növény gyökerén kialakul a külön növényi szervként funkcionáló gümő (Dudley et al., 1987), a baktériumok fiziológiai és morfológiai változásokon mennek keresztül, egy időleges sejtorganellummá, un. bakteroiddá alakulnak. Miután megtörtént a baktériumok differenciálódása, megindul a nitrogenáz enzimkomplexet kódoló gének expressziója, így a szimbiotikus gümő alkalmassá válik a légköri nitrogén redukálására. A bakteroidok és a növény közötti anyagcseretermékek transzportja a szállítónyalábokon keresztül történik (Newcomb, 1981). A gümőfejlődésnek két típusát ismerjük. Az elkülönítés az állandó merisztéma meglétén, illetve hiányán alapszik (Luyten and Vanderleyden, 2000). Determinált gümő esetében a külső

5 5 kéregsejtekből indul a fejlődés, a merisztematikus aktivitás megszűnik a gümő kifejlődésével. Determinált gümőt a szója (Glycine max), bab (Phaseolus vulgaris) fajokon kívül más, főleg trópusi pillangósvirágú (Fabaceae) növény tud létrehozni. Indeterminált gümő esetében pedig a belső kéregsejtek állandó merisztematikus aktivitása jellemző, folyamatos növekedést biztosítva ezzel. Az indeterminált gümő, példaként említve a borsó (Pisum sativum), bükköny (Vicia sp.), lucerna (Medicago sp.) növényeknél fordul elő (Hirsch, 1992). A Sinorhizobium meliloti indeterminált, a Sinorhizobium fredii determinált gümőképződést indukál A Nod faktor A Nod faktornak fontos szerepe van a szimbiotikus gümő kialakításában, különféle növényi választ vált ki: a gyökér belső kéregsejtjei között dedifferenciáció és mitózis inicializálása, mely során egy új osztódószövet alakul ki, a gümőmerisztéma (Dudley et al., 1987), a növényi gének indukciója, a kálcium oszcilláció (Ehrhardt et al., 1996; Geurts and Bisseling, 2002), a gyökérszőrök görbülése (Catoira et al., 2000), infekciós fonal növekedése (Gage and Margolin, 2000). A nod génekben mutáns baktériumok nem képesek a gümőképződés elindítására (Nod - fenotípus). A nod géneket (psyma megaplazmidon találhatóak) két csoportra oszthatjuk, az egyik csoportba (közös nod gének, noda, nodb, nodc) azok a gének tartoznak, melyek a Nod faktor alapszerkezetének kialakítását végzik, a többi gén (nodfeg, nodh, nodpq) a gazdaspecificitás szempontjából fontos. A növényi szignált (flavonoidok) a NodD fehérje képes felfogni, ez a fehérje aktiválja a többi nod gént, kapcsolódik a nod box-ként ismert konzerválódott szekvenciához. Ezzel ellentétes a represszor hatású, kromoszómán található nolr gén. A két regulátor fehérje (NodD, NolR) biztosítja a nod gének megfelelő szabályozását. A Nod faktor szerkezete egységesen lipo-kitooligoszacharid molekulákból állnak, erre a gazdaspecifitásért felelős gének különböző oldalláncokat helyeznek (Denarie and Debelle, 1996; Mergaert et al., 1997), így a különböző szerkezetű molekulák meghatározzák, hogy a baktérium mely növényt képes megfertőzni. A Nod faktor szekréciójáért a nodij gének felelősek A nitrogénkötésért felelős gének A nitrogénkötés megfelelő létrejöttéhez alacsony oxigén tenziójú (mikroaerofil) környezetre van szükség, ezt a növényi citoszolban lokalizálódó leghemoglobin molekula biztosítja. A késői bakteriális gének közé tartoznak a nif és bizonyos fix gének. A nitrogénfixáláshoz szükséges nitrogenáz enzimkomplex egyes részeit a nifhdk gének kódolják (Fischer, 1994). A nifh gén a homodimer Fe protein (dinitrogenáz reduktáz)

6 6 szintéziséért, a nifd a " 2 $ 2 szerkezetű dinitrogenáz " alegység, míg a nifk a $ alegység kialakításáért felelős (Postgate, 1972). Továbbá a nife, nifn, nifb gének a FeMo kofaktor szintézisét végzik (Dean et al., 1993), valamint a nifa génnek, mely egy transzkripciós aktivátor fehérjét kódol, a nitrogénfixálás szabályozásában van szerepe a fixlj, fixk génekkel együtt. Az enzimkomlpex felé történő elektrontranszport biztosítását a fixabcx gének végzik (Earl et al., 1987). A nagy oxigén affinitású, memránba ágyazott, bakteriod specifikus citokróm oxidáz komplexet a fixnoqp gének kódolják (Preisig et al., 1993). Alacsony oxigén koncentráció esetén a szabályozó és szenzor funkciójú fixlj gének aktiválják a fixk és nifa regulátor gént, ezáltal megindul a nif operon és több fix gén expressziója (David et al., 1988). A nif és fix gének regulációját alapvetően a nitrogéngáz és az oxigén koncentrációja határozza meg Sejtfelszíni poliszacharidok A rhizobiumok sejtfelszíni poliszacharidjai kulcsszerepet játszanak a szimbiózis kialakulásának lépéseiben: az infekciós fonal növekedésében, a gümő inváziójában, és a gazdaspecificitásban (Reuhs et al., 1998), valamint megvédik a baktériumot a környezeti ártalmakkal szemben. Hasonló szerkezetű sejtfelszíni struktúrákat a patogén baktériumoknál is találunk, ahol a patogenitást határozzák meg (Reuhs et al., 1993). A S. meliloti sejtfelszíni poliszacharidjai sok más Gram-negatív baktériumhoz hasonlóan az exopoliszacharid (EPS), lipopoliszacharid (LPS) és a kapszuláris poliszacharid (KPS) (Kannenberg and Brewin, 1994). A poliszacharidok szimbiózisban betöltött szerepére különböző baktérium mutánsok vizsgálatával derítettek fényt, ilyenek a gümő inváziójára képtelen, infekcióban hibás (Inf - ) baktérium mutánsok, melyek el tudják indítani a gümőfejlődést, de nem képesek bejutni a belsejébe, üres gümők keletkeznek Az exopoliszacharidok A Rhizobium spp. által termelt exopoliszacharidoknak (EPS) két féle típusát ismerjük. Az egyik típus EPSII néven ismert, glükózt és galaktózt tartalmazó, diszacharid egységekből felépülő galaktoglükán. A másik típus a S. meliloti által is termelt EPSI (másnéven savas EPS) (Fraysse et al., 2003), amely egy szukcinoglükán egységekből álló heteropolimer, mely a sejt felszínén akkumulálódik, és a sejt környezetébe szekretálódik. A szukcinoglükán hét glükóz és egy galaktóz molekulát tartalmazó, ismétlődő alegységekből épül fel (Reuber and Walker, 1993). Az alegységeken szukcinil, acetil és piruvil módosításokat tartalmaz. Savas jellegét az uronsav, szukcinát, piruvát elemek jelenlétének köszönheti. A szukcinoglükán poliszacharid

7 7 szintézise négy lépésből áll, melyért a psymb megaplazmidon elhelyezkedő exo gének felelősek. Első lépésként, az UDP-glükóz és UDP-galaktóz szintézise történik (pl. exob,c,n), majd egy sejtmembránba ágyazott lipid hordozó felszínén zajlik az ismétlődő oktoszacharid alegység szintézise nukleotid-cukorból (exof,j,a,l,m,n,o,u). Következő lépésben az alegységek módosítása (szukcinil exoh, acetil exoz, piruvil exov), majd legvégül az oktoszacharid alegységek polimerizációja, és a sejtfelszínre való transzfere történik (exop,t,q) (Leigh and Walker, 1994). Az exopoliszacharidnak alapvetően a nitrogénfixáló gümő létrehozásában, az infekciós fonal kialakulásában van meghatározó szerepe (Cheng and Walker, 1998; Gonzáles et al., 1998). Sok exopoliszacharid termelésében hibás S. meliloti törzs nem képes a növény inváziójára (Exo -, Inf - fenotípus), mert az infekciós fonalak abortálódnak a fejlődő gümő sejtjeinél (Müller et al., 1988) A lipopoliszacharidok A lipopoliszacharidok (LPS) a Gram-negatív baktériumok sejtfelszínének fontos alkotóelemei, a külső membránhoz kapcsolódva helyezkednek el. A Rhizobium fajok konzerválodott szerkezetű LPS-el jellemezhetőek (Reuhs et al., 1998). Szerkezetileg három egységre bonthatók. A külső foszfolipid membránba egy un. horgonyzó molekulával, a lipida egység segítségével rögzülnek. A horgonyzó egység különböző szerkezetű lehet a Rhizobium fajokban (Reuhs et al., 1995). Ehhez kapcsolódik egy úgynevezett core oligoszacharid, melyhez a törzsspecifikus O-antigén kötődik (Kannenberg and Brewin, 1994). A lipida és a core oligoszacharid egységeket közösen az LPS rough (R-LPS) formájának nevezzük, míg az O-antigén egységet tartalmazó formát smooth LPS-nek (S-LPS) hívjuk. A S. meliloti LPS mutánsok szimbiózisra képesek a gazdanövénnyel, de a szimbiótikus kapcsolat lassabban alakul ki, mint a vad típusú baktériumok esetében (Lagares et al., 1992). Léteznek olyan baktérium törzsek is, mint például a S. meliloti 41 törzs, melyeknél az LPS nem játszik fontos szerepet a fertőzésben, vagy más struktúra veszi át a szerepét, itt az R-LPS forma hiányozhat. Más rhizobium fajoknál azonban sok esetben előfordul, hogy csak az LPS bizonyul lényeges tényezőnek, míg a többi (KPS, EPS) nem (Kannenberg and Brewin, 1994) A kapszuláris poliszacharidok Léteznek olyan rhizobiumok, melyek nem termelik egyik formájú exopoliszacharidot sem, mégis szimbiózist tudnak kialakítani bármely gazdanövénnyel. Ennek oka az, hogy ezek a baktériumok olyan rhizobiális kapszuláris poliszacharidot (KPS vagy K-antigén) termelnek, mely átveszi az exopoliszacharid szerepét a szimbiózis kialakításában, ilyen baktérium a S.

8 8 meliloti 41 törzs exob mutánsa (más néven AK631 - Petrovics et al., 1993; Putnoky et al., 1990). A KPS, mint egy kapszula veszi körül a baktérium sejtet, hidrát mátrixot alkot, amely rezisztenciát biztosít egyes bakteriofágokkal szemben, és védi a különféle abiotikus tényezőktől, mint a kiszáradás. Fontos a szimbiótikus felismerés korai szakaszában (Becquartde Kozak et al., 1997) A lipopoliszacharid egy konzerválódott szerkezetű poliszacharid, ezzel ellentétben a KPS törzsspecifikus, sok variánsa fordul elő (Forsberg and Reuhs, 1997; Reuhs, 1997). A KPS nem rendelkezik horgonyzó molekulával, hanem szorosan kapcsolódik a baktérium felszínéhez. A K-antigén széleskörben elterjedt a talajbaktériumokban, rhizobiumokban először a Sinorhizobium fredii USDA205 törzsben izolálták (1.ábra) és kiderült, hogy strukturálisan analóg az E. coli II-es csoportba tartozó K-antigénjével, ahol a patogenitásban van szerepe (Reuhs et al., 1993; Rosenow et al., 1995). 1. ábra: A S. fredii USDA205 törzs K R 1 antigén ismétlődő egységének (Kdops) elsődleges szerkezete (Reuhs et al., 1993). A rhizobiumok KPS molekulái (1. táblázat) tartalmaznak megegyező és eltérő egységeket, közös elemek a hexóz és 1-karboxy-2-keto-3-deoxy cukrokból álló ismétlődő egységek, mint a sziálsav vagy a 3-deoxy-D-manno-2-oktulozonsav (Kdo), különböznek a glikozil alegységek elrendezésében, a térszerkezetükben, a kapcsolódó oldalláncok mintázatában, molekula méretben (Forsberg and Reuhs, 1997). A S. meliloti és S. fredii baktériumok K-antigénjei, Reuhs és munkatársai által igen jól jellemzett poliszacharidok. A S. meliloti AK631 törzse K R 5 antigén néven ismert kapszuláris poliszacharidot termel. A K R 5 antigén diszacharid alegységekből épül fel. Az alegység egy glükuronsavból és egy 5,7- diamino-3,5,7,9-tetradeoxi nonulozonsavból áll, melyen 7-N-acetil és 5-N-β-hidroxibutiril módosítások is találhatók (Reuhs et al., 1998; Reuhs és Glushka, nem közölt eredmények). Az elmúlt évek kutatásai során három régiót azonosítottak az S. meliloti 41 törzsben, melyek a KPS bioszintéziséért felelősek (rkp-1, rkp-2, rkp-3 régiók).

9 9 1. táblázat: A K-antigén szerkezete néhány Rhizobium fajnál (Reuhs et al., 1998). Pse: pseudaminsav, Ac: acetil csoport, $-OH-But: $-OH-Butiril csoport. K-antigén Törzs Molekuláris szerkezet Hivatkozás K R 1 S. fredii USDA205 [ 3-"-D-Galp-(1 5)-$-D-Kdop-(2 ] n Reuhs et al., 1993 K R 3 S. fredii USDA257 [ 3)-$-D-Manp-(1 5)-$-D-Kdop-(2 ] n Forsberg and Reush 1997 K R 5 S. meliloti AK631 [ $-GlcA Pse5N($-OH-But)7NAc ] n Reuhs nem közölt eredm. K R 6 S. meliloti NGR247 [ "-Glc "-NeuNAc ] n Reuhs et al., 1998 K R 7 S. meliloti NGR185 [ $-GlcNAc $-Kdo ] n Reuhs et al., 1998 Az rkp-1 régióban 10 gén található (rkpa-j). A gének nagy része olyan fehérjéket kódol, melyek hasonlóak a különböző zsírsavszintézisben részt vevő enzimekkel, ezek a fehérjék a lipofil molekulák módosításában és szállításában játszanak szerepet (Kiss and Kondorosi, 1997; Petrovics et al., 1993). Az említett gének feladata a feltételezések szerint, hogy a K- antigén bioszintéziséhez szükséges lipid hordozót létrehozzák. Az RkpJ fehérjének a kapszuláris poliszacharid transzportjában lehet szerepe, mert az E. coli KpsS fehérjéjével homológ. Ha mutáció történik az említett génekben, akkor a KPS nem jelenik meg a baktérium felszínén. Az rkp-1 régióban nincsenek olyan gének, melyeknek a cukoralegységek bioszintézisében vagy a KPS polimerizációjában lenne szerepe. Az rkp-2 régióban két olyan gén található, melyek a vad típusú LPS kialakításához szükségesek. Az lpsl gén által kódolt fehérje egy UDP-glükuronsav epimeráz, mely a lipopoliszacharid bioszintézisében fontos. A másik fehérje, az RkpK egy UDP-glükóz dehidrogenáz, amely az UDP-glükóz UDP-glükuronsavvá oxidálását katalizálja. Az RkpK fehérje az LPS és a KPS bioszintézisében is fontos (Kereszt et al., 1998). A psymb megaplazmidon található rkp-3 régióban 10 gént (rkpl-z) azonosítottak (Kiss et al., 2001), melyek pontos funkciója homológiák alapján feltételezett, még kísérletesen nem bizonyított (2. táblázat). Az rkp-1 és rkp-2 régió általánosan előfordul a Sinorhizobium genusban, ezzel szemben az rkp-3 régió csak a S. meliloti 41 törzsben található meg. A KPS bioszintézisért, és a sejtfelszínre való exportálásáért, valamint a növény infekciójáért felelősek. Az egy policisztronos operont alkotó rkpl-q gének között vannak olyan gének, melyek homológiát mutatnak különféle transzferáz enzimet kódoló génekkel (például: rkpm, rkpo, rkpp). Feltételezett funkciójuk a cukor prekurzorok bioszintézise a KPS polimer számára. Transzkripciójuk független a fordított orientációval rendelkező rkpr, rkpt, rkps génektől. E három gén feladata valószínű az, hogy a KPS polimert transzportálják a citoplazmából a sejtfelszínre. Az rkpt és rkps olyan szekvencia motívummal rendelkeznek, mely specifikus az

10 10 ABC transzporter családban. A régió utolsó génje a polymerizáció szabályozását biztosító rkpz, melyet korábban lpsz génként azonosítottak (Brzoska and Signer, 1991). Az RkpZ fehérje homológ az E. coli KpsC fehérjéjével, melyről tudjuk, hogy befolyása van a termelt KPS méretére és exportjára (Reuhs et al., 1995). 2. táblázat: Az rkp-3 régióban található gének feltételezett szerepe. A táblázatban feltüntettük a homológ fehérjék bizonyított vagy feltételezett funkcióját, valamint azokat a szervezeteket, melyekben az adott homológ fehérje található. rkp-3 gén Feltételezett szerep Homológ fehérje Homológ szervezet Homológ fehérje szerepe rkpl dntp-hexóz-dehidratáz / epimeráz Jhp0778 Cap5E FlmA Helicobacter pylori Staphylococcus aureus Aeromonas caviea Cukor-nukleotid szintézis UDP-glükóz epimeráz O-antigén bioszintézis rkpm DegT/DnrJ/EryC/StrS aminotranszferáz FlmB SpsC WlbF Aeromonas caviae Methanococcus janaschii Bordatella bronchiseptica O-antigén bioszintézis Poliszacharid szintézis Amino-cukor szintézis rkpn Pse aktiválás NeuA NeuA KpsU Aeromonas caviae E. coli E. coli O-antigén bioszintézis CMP-NeuNAC szintáz CMP-KDO szintáz rkpo transzferáz FlmD FlaR SpsG/H Aeromonas caviae Caulobacter crescentus Methanococcus janaschii O-antigén bioszintézis Flagelláris protein Poliszacharid szintézis rkpp acetiltranszferázok FlaG SpeG Caulobacter crescentus E.coli Flagelláris protein Acil transzferáz rkpq Pse szintézis NeuB NeuB NeuB Aeromonas caviae Helicobacter pylori E.coli O-antigén bioszintézis Sziálsav szintáz NeuNAC kondenzáció rkpr KPS export a periplazmatikus téren keresztül KpsE BexC CtrB E.coli Haemophilus influenzae Neisseria meningitidis KPS export protein rkps ABC transzporter KPS export a sejtmembránon át KpsT BexA CtrB E.coli Haemophilus influenzae Neisseria meningitidis KPS export protein rkpt ABC-2 típ.transzporter KPS export a sejtmembránon át KpsM BexB CtrC E.coli Haemophilus influenzae Neisseria meningitidis KPS export protein rkpz Lánchosszúság meghatározása LpsZ KpsC LipA R. meliloti E. coli Neisseria meningitidis LPS modifikáció KPS export protein KPS modifikáció rkpy Poliszacharid szintézis - Nincs homológja

11 11 Az előzőekben ismertetett poliszacharidok fontos feladatot töltenek be a baktériumnövény szimbiózis kialakulásában, a baktérium külső környezeti tényezők elleni védelmében. Az EPS és KPS szerkezete nagymértékben különbözik, mégis azonos szerepet töltenek be a szimbiózisban, a S. meliloti AK631 törzsnél az EPS feladatát a kapszuláris poliszacharid veszi át. Ismeretes, hogy a baktérium és a gazdanövény közötti kapcsolat igen specifikus a poliszacharidok tekintetében is. Az, hogy alapvetően eltérő szerkezetű poliszacharidok helyettesíteni képesek egymást az invázió folyamatában arra utal, hogy a növény több független mechanizmussal is felismerheti a baktériumot.

12 12 2. ELŐZMÉNYEK A szimbiózis kialakulásában különböző növényi, illetve bakteriális gének játszanak szerepet. Ezen gének egy részet már számos kutatócsoport jellemezte. A növény inváziójához szükséges bakteriális gének funkciójáról viszonylag még keveset tudunk, ezért az említett folyamat pontosabb megismerése érdekében, jónéhány infekcióban hibás (Inf - ) S. meliloti mutánst izoláltak, jellemeztek már, melyek nem képesek bejutni a növény belsejébe, így a szimbiózis kialakulása elakad a gümőfejlődés korai fázisában. Az Inf - fenotípusú mutánsokkal történő fertőzés során üres gümők jönnek létre, segítségükkel sikerült kimutatni, hogy a szimbiózis kialakulásának ebben a szakaszában a baktérium különböző poliszacharidjainak fontos szerep jut. Ezen kívül kimutatták, hogy a funkcionális gümő képződéséhez nélkülözhetetlen az EPS, illetve KPS valamelyikének jelenléte (Walker, 1992). A S. meliloti AK631 törzs például EPS-t nem termel, mégis képes szimbiózist kialakítani a gazdanövényeivel, mivel a törzs által termelt KPS helyettesíteni tudja az exopoliszacharidokat a gümőfejlődés során (Putnoky et al., 1990; Petrovics et al., 1993). Bizonyos vizsgálatok, melyeket több S. meliloti törzsön végeztek arra utalnak, hogy a KPS-nek akár elsődleges szerepe is lehet az infekciós folyamatban (B. Reuhs személyes közlés). Munkánkban szerettük volna jobban megismerni a KPS endoszimbiózisban betöltött szerepét. Konkrétan arra voltunk kíváncsiak, hogy létezik-e olyan funkcionális molekularészlet, bioszintézisben bekövetkező utólagos módosítás a KPS-t illetően, melynek hiányában a szimbiózis az infekciós lépésben elakad. Az EPS esetében már végeztek kísérletet ennek bizonyítására (Leigh et al., 1985). A kapszuláris poliszacharid szerkezetének gazdaspecifikus vonatkozásainak megismeréséhez olyan mutáns baktériumtörzsek izolálására volt szükség, melyek felszínén a KPS kismértékben módosult. Ezen fenotípust okozó genetikai mutáció(k) helyének pontos behatárolásával a feltételezett gazdaspecifitásért felelős gén(ek) meghatározhatók Spontán mutáns baktériumtörzsek izolálása Előzetes információk alapján tudtuk, hogy több Inf - S. meliloti mutáns, mely nem termelt exopoliszacharidot, rezisztenciát mutatott a 16-3 fággal szemben (Putnoky et al., 1988). Gyanítani lehetett, hogy az Inf - fenotípusú törzsek (mint az AK631 törzs is), az invázióra képtelen tulajdonságuk mellett, a fággal szemben mutatott rezisztenciájukat is a KPS hiányának vagy hibájának köszönhetik. Következésképpen, a poliszacharid bioszintézise és a

13 13 fágreceptor jelenléte, nagy valószínűséggel összefügg. Ezen információkból kiindulva feltételezték azt, hogy a KPS-molekula egyúttal receptorként szolgálhat a 16-3 fág számára (Petrovics et al., 1993; Putnoky et al., 1990). Munkánkban olyan baktérium-mutánsokra volt szükség, melyek felszínén a KPS módosult formában van jelen. Ennek érdekében csoportunkban olyan mutánsizolálási eljárást alkalmaztak (Hoffman Gyula munkája), melynek során a S. meliloti 41 törzsre specifikus 16-3 bakteriofágot alkalmazták szelekciós eszközként. Az RM41 törzsből izolált mutációk azonosítása az un. host-range jelenség segítségével történt. A fág baktériumfelszínt felismerő fehérjéjét kódoló gén mutációja révén alakul ki a host-range (gazdaspecifitási) mutáció. Ha egy fágra rezisztenssé vált baktérium-mutánson lehetséges host-range fágmutánst izolálni, akkor a baktérium mutáns felszínén a fágreceptor jelen van, de feltehetően módosult formában. Mivel a jelenség lehetővé teszi host-range fágmutánsok adszorbcióját, ezért valószínű, hogy finom szerkezetbeli változás történhetett. Ezen kísérlet elvégzésével sikerült olyan baktérium mutánst izolálni (GH4046 törzs), mely rezisztens volt a 16-3 fággal szemben, tehát feltételezhetően a KPS megváltozott formában van jelen a sejtfelszínen. Ezzel párhozamosan, sikerült izolálni egy feltehetően módosult farkirosttal rendelkező host-range fágot (16-3 h 5 ), mely fertőzni képes az izolált baktériumot.

14 14 3. CÉLKITŰZÉSEK A munkánk célja az volt, hogy komplementációs kísérletekkel azonosítsuk az izolált mutáció(k) helyét, valamint megállapítsuk a mutáció(k) jellegét bázissorrend meghatározással, mely megmutatja milyen változás történt DNS, illetve fehérje szekvencia szinten. Kíváncsiak voltunk, hogy a KPS valóban fágreceptor szerepet is betölthet, vagy valamilyen más struktúra látja el a feladatot, mely kapcsolatban van a KPS génjeivel. Ez utóbbi esetben tudni szerettük volna, hogy a fágreceptor milyen módon épül fel és mely fehérjék alkotják. A fágreceptor szerkezetét meghatározó gén(ek) azonosítható(k) a mutáció(k) helyének pontos behatárolásával. Amennyiben a fágreceptor valóban a KPS, úgy ezzel a módszerrel még ismeretlen bioszintézis-gének azonosítására is lehetőség nyílhat. Ezen kívül, minél többet szerettünk volna megtudni az érintett gén(ek) funkciójáról, természetéről bioinformatikai analízis segítségével. A GH4046 törzsön izolált host-range fág (16-3 h 5 ) oldalán is elindult a jelenség vizsgálata a csoportunkban (Békási Krisztina, illetve Maász Anita diplomadolgozata, 2004.).

15 15 4. ANYAGOK ÉS MÓDSZEREK 4.1. Baktériumok, bakteriofágok, plazmidok Munkánk során használt baktérium és bakteriofág törzsek, valamint plazmidok jellemzőit a 3. táblázat tartalmazza. 3. táblázat: Baktériumok, bakteriofágok, plazmidok. ELNEVEZÉS JELLEMZŐK REFERENCIA Sinorhizobium meliloti RM41 S. meliloti vad típusú (Exo +, Nod +, Fix + ) Szende K. AK631 RM41 exob631 (Nod + Fix + ) Kondorosi Á. GH4046 RM fágra rezisztens, spontán mutáns Hoffmann Gy. GH4178 RM fágra rezisztens, spontán mutáns Hoffmann Gy. GH4180 RM fágra rezisztens, spontán mutáns Hoffman Gy AT212 AK631 rkpm::tn5 (212) Km R Sm R Kiss et al., 2001 Escherichia coli JF1754 met leu his hsr - hsm + Friesen, J PP219 JF1754 (prk2013) Putnoky P. AV4189 AV4190 XL1 Blue pbs::rkpm Kpn-Sal Amp R Ez a munka AV4191 AV4223 XL1 Blue psem91::rkpm EcoRV Km R Ez a munka AV4258 XL1 Blue (pav4223 Km::Cm(F-778)) Km S Cm R Ez a munka XL1 Blue RecA1,endA1,gyrA96,thi-1, hsdr17,supe44,rela1 Bullock et al., 1987 lacz M15 Tc R JM109 F trad36 proa + B + laci q (lacz)m15 / e14 - Yanisch-P et al., 1985 (McrA - ) (lac-proab) enda1 gyra96 (Nal r ) thi-1 hsdr17(r - k m + k ) glnv44 rela1 reca1 Bakteriofágok 16-3 S.meliloti 41 törzs fágja Orosz and Sik, h 5 S.meliloti GH4046 törzsre specifikus host-range mutáns Hoffmann Gy. Plazmidok pbluescript SK II (+/ ) Amp R Stratagen, USA pbbr1 MCS-3 Széles gazdaspecifitású konjugatív plazmid Tc R Kovach et al., 1994 psem91 Expressziós vektor Km R Semsey et al., 1999 prk2013 Helper plazmid keresztezéshez Km R Ditta et al., 1980

16 A baktériumok növesztése A S. meliloti törzseket TA (Orosz et al., 1973) vagy GTS (minimál) (Kiss et al., 1979) táptalajokon 32 o C -on, az E. coli törzseket pedig LB (Sambrook et al., 1989) tápközegben 37 o C-on növesztettük. A táptalajok a megfelelő antibiotikumot a 4. táblázatban feltüntetett végkoncentrációban tartalmazták. 4. táblázat: Az antibiotikumok végkoncentrációja (:g/ml) Antibiotikum E. coli S. meliloti Tetraciklin Kanamicin Kloramfenikol 5 5 Ampicillin Fágok szaporítása A felszaporítani kívánt fág egy tarfoltját 10 ml TA folyadékba tettük, és 0,2 ml éjszakán át felnövesztett baktériumtörzs hozzáadása után a lombikot 32 C-on, órán át rázattuk. A fáglizátumhoz néhány csepp kloroformot adtunk, majd meghatároztuk a fágszámot úgy, hogy 0,1 ml megfelelően hígított fágot, 0,2 ml éjszakán át felnövesztett baktériumot és 4ml TA fedőagart összekeverve TA lemez tetejére rétegeztünk. A lemezeket órán át 32 Con történő inkubálás után értékeltük ki. A fáglizátumok általában 10 9 részecskét tartalmaztak milliliterenként A baktériumok keresztezése A keresztezni kívánt baktériumokat és a helper (PP211) törzset felnövesztettük a megfelelő antibiotikumokat tartalmazó komplett táptalajon. A keresztezést 0.9%-os NaCloldatban felszuszpendált baktériumokkal végeztük, TA lemezen összecseppentve őket órás 32 o C -on történő inkubálás után a felnőtt baktériumokat felszuszpendáltuk, és a megfelelő antibiotikumot tartalmazó szelektív lemezre kentük különböző hígításban Fágérzékenységi teszt A baktériumok fágérzékenységét 16-3 vad típusú, 16-3h 5 host-range mutáns bakteriofágokkal szemben vizsgáltuk. A vizsgálni kívánt baktériumot tartalmazó TA fedőagar felszínére 1 µl, körülbelül 10 6 darab fágot tartalmazó lizátumot cseppentettünk, és 24 órás inkubációs idő után vizsgáltuk, hogy bekövetkezett-e a lízis vagy sem.

17 Összes DNS izolálás 1.5 ml, éjszakán át növesztett, baktériumkultúrából a sejteket centrifugálással ülepítettük és 300 µl TE oldatban (50 mm TrisHCL, 20 mm EDTA, ph 8,0) szuszpendáltuk. 100 µl 5% SDS-t tartalmazó TE oldatot és 100 µl pronáz oldatot (2,5 mg/ml pronáz TE oldatban) adtunk hozzá. 1-3 órás 37 o C-os inkubálás után 500 µl fenollal ráztuk össze, majd centrifugálás után a felülúszót újabb Eppendorf-csőbe pipettáztuk át. 500 µl fenol:kloroform oldattal (25 térfogat fenol:24 térfogat kloroform:1 térfogat izoamil-alkohol) ráztuk össze. Centrifugálás után a felülúszóhoz 500 µl kloroform oldatot (24 térfogat kloroform:1 térfogat izoamil-alkohol) adtunk, összeráztuk és centrifugáltuk. A vizes fázist 1000 µl etanollal kicsaptuk. A kocsonyás csapadékot új, 500 µl 70%-os etanol tartalmú, eppendorf csőbe tettük át pipettahegy segítségével. Centrifugálás után a felülúszót leöntve, szárítást követően, a DNS csapadékot 100 µl steril desztillált vízben oldottuk fel (Meade et al., 1982 ). A psem91 plazmid vektorba történő rkpm inszert beépülésének tesztelésére gyors DNS izolálási technikát használtunk. A vizsgálni kívánt baktériumot felszuszpendáltuk 100µl steril desztillált vízben, 5 percig 100 C-on forraltuk, majd 5 percig 0 C-on inkubáltuk. Ezután a mintát 5 percig centrifugáltuk, majd a felülúszót új csőbe pipettáztuk és higítottuk (10x) Plazmid DNS izolálás A plazmid vagy kozmid DNS-t E. coli esetén 3-3 ml LB tápfolyadékban, S. meliloti esetén pedig TA tápfolyadékban, a megfelelő antibiotikum jelenlétében éjszakán át növesztett sejtekből Ish-Horowicz és Burke (Ish-Horovicz and Burke, 1981) szerint alkalikus lízissel preparáltuk. 1.5 ml kultúrát Eppendorf-csőbe tettünk és a sejteket centrifugálással ülepítettük. A sejteket 100 µl TEG oldatban (25 mm TrisHCL, 10 mm EDTA, 50 mm glükóz ph 8.0) szuszpendáltuk fel. A feltárást óvatos keverés mellett 200 µl NS oldat (0.2N NaOH, 1% SDS) hozzáadásával végeztük. A mintákat 5 percig 0 C-on inkubáltuk, majd erős rázással 160 µl jéghideg Na-acetát oldatot (3M, ph 4.8) adtunk hozzájuk. 5 perces 0 C-os inkubáció után 5 percig centrifugáltuk, és a felülúszóból 400 µl izopropanollal kicsaptuk a plazmid DNS-t. 10 perc -20 C-os inkubáció után a csapadékot lecentrifugáltuk és szárítottuk. A csapadékot 100 µl Tris-pufferben (50 mm TrisHCL, 100 mm Na-acetát, ph 8.0) oldottuk fel, majd 200 µl etanollal ismét kicsaptuk. 10 perc 0 C-os inkubáció után a csapadékot centrifugáltuk, szárítottuk, majd 30 µl RNáz-os trideszt vízben (100 µl/ml RNázA) oldottuk fel.

18 A szekvenáláshoz és a transzpozíciós in vitro reakcióhoz készített preparátumoknál további tisztítási lépést iktattunk be. A plazmid DNS izolálálás végén 50 µl RNáz-os desztillált vízben vettük fel a csapadékot, majd 0.1 térfogat 10% SDS és 1 térfogat 7,5 M NH 4 -acetát után 15 percig inkubáltuk jégen. Ezután centrifugáltuk 5 percig és a felülúszót új csőbe pipettáztuk, ehhez 0,6 térfogat izopropanolt adtunk és -20 C -ra tettük 20 percig. Az inkubálás után etanolos mosás, és szárítás következett. A csapadékot 40 µl steril desztillált vízbe vettük fel Polimeráz láncreakció (PCR) Az rkpm gént magába foglaló, illetve ennek egy részét tartalmazó DNS-szakaszt sokszoroztuk meg polimeráz láncreakció segítségével. A felhasznált oligonukleotidokat az 5. táblázat tartalmazza. DNS szekvencia meghatározáshoz az rkpm 4046, illetve rkpm 4178 allélt magába foglaló DNS szakaszt az RM-15 és RM-13 primerekkel, valamint az alábbiakban részletezett RKP-M program alkalmazásával amplifikáltuk (1625 bp). A klónozáshoz használt rkpm allél felsokszorozásához ugyanezen primereket, és a valószínűsíthetően jobb hatásfokkal tompa végeket létrehozó Pfu DNS-polimerázt alkalmaztuk (RKP-M1 program). A psem91 plazmid vektorba történő rkpm inszert beépülésének tesztelésére két belső primert (RM-23, RM-25) használtunk fel, melyekkel 1% agaróz gélen is könnyen detektálható (558 bp) fragmentet kaptunk (RKP-M2 program). Az alábbi PCR-programokat alkalmaztuk: RKP-M RKP-M1 RKP-M min. 94 C 1. 1 min 95 C 1. 1 min. 94 C sec. 94 o C 2. 1 min 95 C sec. 94 o C sec. 62 o C sec. 62 o C sec. 59 o C 4. 1 min. 72 o C 4. 3 min 72 o C 4. 1 min. 72 o C 5.34 a második lépésre a második lépésre 5.34 a második lépésre sec. 20 o C 6. 5 min 72 o C sec. 20 o C 7. End 7. 1 min 20 o C 7. End 8. End 4.9. Fragmentizolálás A PCR terméket agaróz gélelektroforézis segítségével tisztítottuk. Az izolálni kívánt fragment elé a gélbe Whatman DE 81 papírt tettünk és 20 perces 60V feszültség melletti elektroforézis után az izolálandó fragment a papírra került. A papírt eppendorf csőbe tettük, és a DNS-t 100 µl 1M NaCl oldattal mostuk le, kétszer egymás után. A DNS kicsapása 20 µl 3M Na-acetát oldattal (ph 7,0) és 120 µl izo-propanollal történt. 20 perces -20 o C-os inkubálás után lecentrifugáltuk, szárítottuk és 20 µl steril desztillált vízben oldottuk fel a csapadékot. 18

19 DNS-szekvenálás Az izolált PCR fragmenteket, DNS szekvencia meghatározás céljából a MTA Szegedi Biológiai Központ DNS Szekvenáló Laboratóriumába küldtük el. A szekvenálási reakcióhoz felhasznált oligonukleotidok fő jellemzőit az 5. táblázat foglalja össze. 5. táblázat: A szekvenálási reakcióhoz felhasznált oligonukleotidok Oligonukletid neve Nukleotidszekvencia Számított Tm ( o C) RM-15 primer 5 - GCATTAGGCCCGGGGAGAAGC -3 62,4 RM-13 primer 5 - CAGGCCGAAGGAACGGAACCTC -3 62,0 RM-25 primer 5 - CGAGCCAAGGTGGACTTCGTT -3 59,4 RM-23 primer 5 - CAGGCCGGAATAGCTGTCAGG -3 59,5 RM-35 primer 5 - CTGGCTCGGCGATATGATAAG -3 54,9 RM-33 primer 5 - AGCGAAATGCACGAGCACAAC -3 59, Restrikciós emésztés, kettős emésztés A DNS minták restrikciós emésztését Sambrook és mtsai szerint végeztük. (Sambrook et al., 1989). A kettős emésztés esetén, az első enzimreakció után a minta DNS tartalmát kicsaptuk 0,1 térfogat 3M Na-acetát (ph=7) és 2 térfogat et-oh (96%) hozzáadásával, és min. 20 percig inkubáltuk -20 C-on, majd 5 perc centrifugálás és 70% et-oh mosás, szárítás után 30µl steril desztillált vízbe vettük fel. Ez után végeztük el a második enzimreakciót Gélelekroforézis A fragmentek elválasztására 1%-os agaróz gélt használtunk. Az elválasztásra szánt DNS mintához, az alábbiakban leírt összetételű STOP-oldatot adtunk (5xSTOP-ból a végtérfogat 1/5-ét). A gélelektroforézist minigél esetében 60V-on, fragmentizolálásnál 40V-on végeztük. Kontrollként, PstI enzimmel emésztett, λ DNS-t alkalmaztunk. 1%-os agaróz gél: 1 g agaróz, 100 ml 1xTBE puffer, 100 µl etidium-bromid (100 µg/ml). 5xSTOP 20 ml-hez: 2 g ficoll, 10 ml 0,5 M EDTA (ph 8,0), 40 mg brómfenolkék (BFB). 5xTBE törzsoldat: 54 g TRIS, 27,5g bórsav, 20 ml 0,5 M EDTA (ph 8,0) / 1000 ml.

20 Kompetens sejt készítés Kompetens sejtek készítéséhez XL1-Blue, valamint JM109 E. coli törzset használtunk. 200 ml SOB táptalajban (2% Bacto trypton, 0.5% Yeast extract, 10 mm NaCl, 2.5 mm KCl, ph 7.0) éjszakán át 22 C-on növesztett baktériumkultúrát 10 percre jégre tettünk. A 10 perces centrifugálással (4000 rpm) összegyűjtött sejteket 80 ml hideg TB pufferben (10 mm PIPES, 15 mm CaCl 2, 250 mm KCl, ph 6.7) szuszpendáltuk. 10 percig jégen inkubáltuk, majd centrifugálással összegyűjtöttük a sejteket, és 20 ml jéghideg TB pufferben szuszpendáltuk. A szuszpenzióhoz 1.5 ml DMSO-t adtunk, a sejteket Eppendorf-csövekbe szétosztva -80 C-os hűtőben fagyasztottuk és tároltuk transzformációig (Inoue et al., 1990) Ligálás A ligálási elegyet vektor DNS oldat, fragment DNS oldat, ligáz puffer (5 koncentráció: 200 mm TrisHCL, 50 mm MgCl 2, 50 mm dithiotreitol (DTT) 2,5 mm ATP, ph 7.8) és steril desztillált víz felhasználásával készítettük. A fragment mennyisége tízszeres volt a vektor mennyiségéhez képest. A reakcióhoz T4 DNS ligázt használtunk, és az elegyet legalább 2 óráig szobahőmérsékleten inkubáltuk Transzformálás Egy transzformáláshoz 100 µl kompetens sejtet használtunk fel. A sejteket -20 C-ról jégre tettük, és 15 perc elteltével hozzáadtuk a transzformációhoz használt DNS-t. 30 percig jégen inkubáltuk, majd 3 perces 37 C-os hősokkot alkalmaztunk. A hősokk után 400 µl SOC oldatot (2% Bacto trypton, 0.5% Yeast extract, 10 mm NaCl, 2.5 mm KCl, 20 mm glükóz, ph 7.0) adtunk a sejtekhez. Egy óra 37 C-os inkubáció után a sejteket szelektív táptalajra tettük. pbluescript használata esetén a táptalajba 40 µl IPTG (100 mm) és 40 µl Xgal oldatot (2%,dimetil-formamidban) tettünk, és a transzformánsokat kék-fehér screen segítségével detektáltuk. (Inoue et al., 1990). A transzpozíciós mutagenezisnél antibiotikumot használtunk szelekciós eszközként (Km, Cam) In vitro transzpozíciós mutagenezis A psem91 plazmid vektor transzpozonos mutagenezisét a TGS II Kit (Template Generation System TM II, TGS TM II, F-702; Haapa et al., 1999) alapján végeztük el. A cél a vektoron lévő rezisztencia marker megváltoztatása volt. Kloramfenikol rezisztencia gént juttattunk be a kanamicin génbe. Plazmid DNS tisztítás után megmértük a minta DNSkoncentrációját. A reakcióhoz szükséges DNS mennyiséget a target DNS hossza (8,4 kb)

A 16-3 bakteriofág host-range mutációi

A 16-3 bakteriofág host-range mutációi DIPLOMAMUNKA A 16-3 bakteriofág host-range mutációi Maász Anita biológus hallgató témavezető: Dr. Putnoky Péter Pécsi Tudományegyetem Természettudományi Kar Genetikai és Molekuláris Biológiai Tanszék 2004.

Részletesebben

A növény inváziójában szerepet játszó bakteriális gének

A növény inváziójában szerepet játszó bakteriális gének A növény inváziójában szerepet játszó bakteriális gének merisztéma korai szimbiotikus zóna késői szimbiotikus zóna öregedési zóna gyökér keresztmetszet NODULÁCIÓ növényi jel Rhizobium meliloti rhizobium

Részletesebben

PÉCSI TUDOMÁNYEGYETEM. A kapszuláris poliszacharid bioszintézis és a 16-3 bakteriofág receptor Sinorhizobium meliloti 41 baktériumban

PÉCSI TUDOMÁNYEGYETEM. A kapszuláris poliszacharid bioszintézis és a 16-3 bakteriofág receptor Sinorhizobium meliloti 41 baktériumban PÉCSI TUDOMÁNYEGYETEM Biológia Doktori Iskola A kapszuláris poliszacharid bioszintézis és a 16-3 bakteriofág receptor Sinorhizobium meliloti 41 baktériumban Ph.D. értekezés tézisei Pálvölgyi Adrienn Témavezető:

Részletesebben

Szimbiotikus nitrogénkötés

Szimbiotikus nitrogénkötés Szimbiotikus nitrogénkötés Nitrogén körforgalom, kémiai és biológiai nitrogénkötés - szabadonélő, asszociatív és szimbiotikus nitrogénkötés. Növény-baktérium kapcsolatok: az agrobaktériumok és a rhizobiumok

Részletesebben

Ph.D. értekezés tézisei. A c-típusú citokrómok biogenezisében résztvevő fehérjék. szerepe és génjeik szabályozása Sinorhizobium meliloti-ban

Ph.D. értekezés tézisei. A c-típusú citokrómok biogenezisében résztvevő fehérjék. szerepe és génjeik szabályozása Sinorhizobium meliloti-ban Ph.D. értekezés tézisei A c-típusú citokrómok biogenezisében résztvevő fehérjék szerepe és génjeik szabályozása Sinorhizobium meliloti-ban Készítette: Cinege Gyöngyi Témavezető: Dr. Dusha Ilona MTA Szegedi

Részletesebben

A 16-3 bakteriofág h génje

A 16-3 bakteriofág h génje A 16-3 bakteriofág h génje Diplomamunka Békási Krisztina biológus hallgató témavezető: Dr. Putnoky Péter PTE TTK Genetikai és Molekuláris Biológiai Tanszék Pécs, 2004. A 16-3 fág h génje - 2 TARTALOM OLDAL

Részletesebben

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia Fehérje expressziós rendszerek Gyógyszerészi Biotechnológia Expressziós rendszerek Cél: rekombináns fehérjék előállítása nagy tisztaságban és nagy mennyiségben kísérleti ill. gyakorlati (therapia) felhasználásokra

Részletesebben

A 16-3 bakteriofág receptorának elemzése

A 16-3 bakteriofág receptorának elemzése 1 DIPLOMAMUNKA A 16-3 bakteriofág receptorának elemzése DEÁK VERONIKA biológus hallgató Témavezető: DR. PUTNOKY PÉTER Pécsi Tudományegyetem Biológiai Intézet Genetikai és Molekuláris Biológiai Tanszék

Részletesebben

NITROGÉNKÖTŐ ENDOSZIMBIÓZISOK 1

NITROGÉNKÖTŐ ENDOSZIMBIÓZISOK 1 NITROGÉNKÖTŐ ENDOSZIMBIÓZISOK 1 Frankia baktériumfajok (Actinomycetales) filamentumok v. fonalak, (Streptomyces rokonok) növények: Alnus (Alnus glutinosa lásd a képet) Casuarina mediterrán fajok Eleagnus

Részletesebben

DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer

Részletesebben

Mutáció létrehozása a Sinorhizobium meliloti baktérium phaa2 génjében

Mutáció létrehozása a Sinorhizobium meliloti baktérium phaa2 génjében Mutáció létrehozása a Sinorhizobium meliloti baktérium phaa2 génjében Készítette: ACKERMANN ANDREA Biológia-kémia szakos hallgató Témavezetı: Pálvölgyi Adrienn, Dr. Putnoky Péter Pécsi Tudományegyetem,

Részletesebben

A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése. Kiss Erzsébet Kovács László

A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése. Kiss Erzsébet Kovács László A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése Kiss Erzsébet Kovács László Bevezetés Nagy gazdasági gi jelentıségük k miatt a gyümölcs lcsök, termések fejlıdésének mechanizmusát

Részletesebben

Agrobacterium vitis rezisztencia kialakítása az iaam szekvencia segítségével DIPLOMAMUNKA

Agrobacterium vitis rezisztencia kialakítása az iaam szekvencia segítségével DIPLOMAMUNKA Agrobacterium vitis rezisztencia kialakítása az iaam szekvencia segítségével DIPLOMAMUNKA készítette: GALAMBOS ANIKÓ biológus hallgató témavezető: Dr. PUTNOKY PÉTER PTE TTK Biológiai Intézet Genetikai

Részletesebben

7. A b-galaktozidáz indukciója Escherichia coliban

7. A b-galaktozidáz indukciója Escherichia coliban 7. A b-galaktozidáz INDUKCIÓJA ESCHERICHIA COLIBAN 7. A b-galaktozidáz indukciója Escherichia coliban dr. Bauer Pál 7.1. Az enzimindukció jelensége Az élõlények valamennyi génjének állandó és folyamatos

Részletesebben

Agrobacterium rezisztens növények létrehozása géncsendesítéssel

Agrobacterium rezisztens növények létrehozása géncsendesítéssel Agrobacterium rezisztens növények létrehozása géncsendesítéssel DIPLOMAMUNKA Készítette: CSEH ATTILA Biológus MSc szakos hallgató Témavezetők: GALAMBOS ANIKÓ, DR. PUTNOKY PÉTER PTE TTK Biológiai Intézet

Részletesebben

A c-típusú citokrómok biogenezisében résztvevő fehérjék. szerepe és génjeik szabályozása Sinorhizobium. meliloti-ban.

A c-típusú citokrómok biogenezisében résztvevő fehérjék. szerepe és génjeik szabályozása Sinorhizobium. meliloti-ban. A c-típusú citokrómok biogenezisében résztvevő fehérjék szerepe és génjeik szabályozása Sinorhizobium meliloti-ban Ph.D. értekezés Cinege Gyöngyi Témavezető: Dr. Dusha Ilona MTA Szegedi Biológiai Központ

Részletesebben

Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása.

Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása. Növények klónozása Klónozás Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása. Görög szó: klon, jelentése: gally, hajtás, vessző. Ami

Részletesebben

MOLEKULÁRIS BIOLÓGIAI GYAKORLATOK

MOLEKULÁRIS BIOLÓGIAI GYAKORLATOK Molekuláris biológiai gyakorlatok - 1 MOLEKULÁRIS BIOLÓGIAI GYAKORLATOK Putnoky Péter PTE, TTK Genetikai és Molekuláris Biológiai Tanszék Tartalom Balesetvédelem 2. 3. DNS koncentráció meghatározás 10.

Részletesebben

A glükóz reszintézise.

A glükóz reszintézise. A glükóz reszintézise. A glükóz reszintézise. A reszintézis nem egyszerű megfordítása a glikolízisnek. A glikolízis 3 irrevezibilis lépése más úton játszódik le. Ennek oka egyrészt energetikai, másrészt

Részletesebben

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel

DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel DNS molekulák elválasztása agaróz gélelektroforézissel és kapilláris elektroforézissel Gyakorlat helye: BIOMI Kft. Gödöllő, Szent-Györgyi A. u. 4. (Nemzeti Agrárkutatási és Innovációs Központ épülete volt

Részletesebben

Egy új, a szimbiotikus gümőfejlődésben szerepet játszó ubiquitin ligáz funkcionális jellemzése

Egy új, a szimbiotikus gümőfejlődésben szerepet játszó ubiquitin ligáz funkcionális jellemzése Zárójelentés 76843 sz. pályázat 2009 2012 Egy új, a szimbiotikus gümőfejlődésben szerepet játszó ubiquitin ligáz funkcionális jellemzése A tervezett munka a kutatócsoportunkban korábban genetikai térképezésen

Részletesebben

A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish.

A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish. OTKA K67808 zárójelentés 2012. A termesztett búza diploid őseinek molekuláris citogenetikai elemzése: pachytén- és fiber-fish. A fluoreszcens in situ hibridizáció (FISH) olyan technikai fejlettséget ért

Részletesebben

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan fehérjét (FC-1 killer toxint) választ ki a tápközegbe, amely elpusztítja az opportunista patogén Cryptococcus neoformans-t.

Részletesebben

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!!

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!! Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció 1859 1865 1869 1952 Hershey & Chase 1953!!! 1879 1903 1951 1950 1944 1928 1911 1 1. DNS szerkezete Mi az örökítő anyag? Friedrich Miescher

Részletesebben

TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL

TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL Az egyes biomolekulák izolálása kulcsfontosságú a biológiai szerepük tisztázásához. Az affinitás kromatográfia egyszerűsége, reprodukálhatósága

Részletesebben

A DNS replikációban kulcsszerepet játszó PCNA fehérje variánsok előállítása és rekombináns DNS technológia segítségével való kifejezése

A DNS replikációban kulcsszerepet játszó PCNA fehérje variánsok előállítása és rekombináns DNS technológia segítségével való kifejezése A DNS replikációban kulcsszerepet játszó PCNA fehérje variánsok előállítása és rekombináns DNS technológia segítségével való kifejezése PCNA (Proliferating Cell Nuclear Antigen) Csiszár Mónika, Kós Tamás,

Részletesebben

A tananyag felépítése: A BIOLÓGIA ALAPJAI. I. Prokarióták és eukarióták. Az eukarióta sejt. Pécs Miklós: A biológia alapjai

A tananyag felépítése: A BIOLÓGIA ALAPJAI. I. Prokarióták és eukarióták. Az eukarióta sejt. Pécs Miklós: A biológia alapjai A BIOLÓGIA ALAPJAI A tananyag felépítése: Környezetmérnök és műszaki menedzser hallgatók számára Előadó: 2 + 0 + 0 óra, félévközi számonkérés 3 ZH: október 3, november 5, december 5 dr. Pécs Miklós egyetemi

Részletesebben

avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest

avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest Iparilag alkalmazható szekvenciák, avagy az ipari alkalmazhatóság kérdése biotechnológiai tárgyú szabadalmi bejelentéseknél Dr. Győrffy Béla, Egis Nyrt., Budapest Neutrokin α - jelentős kereskedelmi érdekek

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

Escherichia coli aminosav-transzporterek vizsgálata

Escherichia coli aminosav-transzporterek vizsgálata Doktori (Ph.D) értekezés tézisei Escherichia coli aminosav-transzporterek vizsgálata Készítette: Szvetnik Attila Témavezetı: Dr. Kálmán Miklós egyetemi docens Biológia Doktori Iskola Szegedi Tudományegyetem

Részletesebben

Génszerkezet és génfunkció

Génszerkezet és génfunkció Általános és Orvosi Genetika jegyzet 4. fejezetének bővítése a bakteriális genetikával 4. fejezet Génszerkezet és génfunkció 1/ Bakteriális genetika Nem szükséges külön hangsúlyoznunk a baktériumok és

Részletesebben

Energiatermelés a sejtekben, katabolizmus. Az energiaközvetítő molekula: ATP

Energiatermelés a sejtekben, katabolizmus. Az energiaközvetítő molekula: ATP Energiatermelés a sejtekben, katabolizmus Az energiaközvetítő molekula: ATP Elektrontranszfer, a fontosabb elektronszállító molekulák NAD: nikotinamid adenin-dinukleotid FAD: flavin adenin-dinukleotid

Részletesebben

ZSÍRSAVAK OXIDÁCIÓJA. FRANZ KNOOP német biokémikus írta le először a mechanizmusát. R C ~S KoA. a, R-COOH + ATP + KoA R C ~S KoA + AMP + PP i

ZSÍRSAVAK OXIDÁCIÓJA. FRANZ KNOOP német biokémikus írta le először a mechanizmusát. R C ~S KoA. a, R-COOH + ATP + KoA R C ~S KoA + AMP + PP i máj, vese, szív, vázizom ZSÍRSAVAK XIDÁCIÓJA FRANZ KNP német biokémikus írta le először a mechanizmusát 1 lépés: a zsírsavak aktivációja ( a sejt citoplazmájában, rövid zsírsavak < C12 nem aktiválódnak)

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

A bioenergetika a biokémiai folyamatok során lezajló energiaváltozásokkal foglalkozik.

A bioenergetika a biokémiai folyamatok során lezajló energiaváltozásokkal foglalkozik. Modul cím: MEDICINÁLIS ALAPISMERETEK BIOKÉMIA BIOENERGETIKA I. 1. kulcsszó cím: Energia A termodinamika első főtétele kimondja, hogy a különböző energiafajták átalakulhatnak egymásba ez az energia megmaradásának

Részletesebben

A baktériumok szaporodása

A baktériumok szaporodása A baktériumok szaporodása Baktériumsejt növekszik, majd osztódik a populáció szaporodik - Optimális körülmények esetén a sejttömeg (sejtszám) exponenciálisan nõ az idõvel - Generációs idõ: az az idõ, ami

Részletesebben

6. változat. 3. Jelöld meg a nem molekuláris szerkezetű anyagot! A SO 2 ; Б C 6 H 12 O 6 ; В NaBr; Г CO 2.

6. változat. 3. Jelöld meg a nem molekuláris szerkezetű anyagot! A SO 2 ; Б C 6 H 12 O 6 ; В NaBr; Г CO 2. 6. változat Az 1-től 16-ig terjedő feladatokban négy válaszlehetőség van, amelyek közül csak egy helyes. Válaszd ki a helyes választ és jelöld be a válaszlapon! 1. Jelöld meg azt a sort, amely helyesen

Részletesebben

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika

DNS munka a gyakorlatban. 2012.10.12. Természetvédelmi genetika DNS munka a gyakorlatban 2012.10.12. Természetvédelmi genetika Munka fázisok DNS kivonás elektroforézis (fakultatív lépés) PCR Elektroforézis Szekvenálás Szekvencia elemzés faji azonosítás; variabilitás,

Részletesebben

NANOTECHNOLOGIA 6. előadás

NANOTECHNOLOGIA 6. előadás NANOTECHNOLOGIA 6. előadás A plazmid: Ha meg akarjuk ismerni egy fehérje működését, akkor sokat kell belőle előállítanunk. Ezt akár úgy is megtehetjük, hogy a kívánt géndarabot egy baktérumba ültetjük

Részletesebben

Natív antigének felismerése. B sejt receptorok, immunglobulinok

Natív antigének felismerése. B sejt receptorok, immunglobulinok Natív antigének felismerése B sejt receptorok, immunglobulinok B és T sejt receptorok A B és T sejt receptorok is az immunglobulin fehérje család tagjai A TCR nem ismeri fel az antigéneket, kizárólag az

Részletesebben

KUTATÁSI JELENTÉS. DrJuice termékek Ezüstkolloid Hydrogél és Kolloid oldat hatásvizsgálata

KUTATÁSI JELENTÉS. DrJuice termékek Ezüstkolloid Hydrogél és Kolloid oldat hatásvizsgálata KUTATÁSI JELENTÉS A Bay Zoltán Alkalmazott Kutatási Közalapítvány Nanotechnológiai Kutatóintézet e részére DrJuice termékek Ezüstkolloid Hydrogél és Kolloid oldat hatásvizsgálata. E z ü s t k o l l o

Részletesebben

5. Molekuláris biológiai technikák

5. Molekuláris biológiai technikák 5. Molekuláris biológiai technikák DNS szaporítás kémcsőben és élőben. Klónozás, PCR, cdna, RT-PCR, realtime-rt-pcr, Northern-, Southernblotting, génexpresszió, FISH 5. Molekuláris szintű biológiai technikák

Részletesebben

Szimbiotikus eredetű, antimikrobiális típusú peptidek hatása Sinorhizobium meliloti baktériumra

Szimbiotikus eredetű, antimikrobiális típusú peptidek hatása Sinorhizobium meliloti baktériumra Szimbiotikus eredetű, antimikrobiális típusú peptidek hatása Sinorhizobium meliloti baktériumra Doktori/Ph.D. értekezés Tiricz Hilda Anikó Témavezető: Dr. Kereszt Attila SZTE TTIK Biológia Doktori Iskola

Részletesebben

A 9,9 -biantril különleges fluoreszcenciája

A 9,9 -biantril különleges fluoreszcenciája A 9,9 -biantril különleges fluoreszcenciája Témavezetők: Demeter Attila és Harangozó József Az oldatok színe attól függ, hogy az oldott molekula a látható színkép mely hullámhossz tartományában nyeli el

Részletesebben

RNS-ek. 1. Az ősi RNS Világ: - az élet hajnalán. 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek

RNS-ek. 1. Az ősi RNS Világ: - az élet hajnalán. 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek RNS-ek RNS-ek 1. Az ősi RNS Világ: - az élet hajnalán 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek 3. Egy újonnan felfedezett RNS Világ: - szabályozó RNS-ek 4. Transzkripció Ősi

Részletesebben

Poligénes v. kantitatív öröklődés

Poligénes v. kantitatív öröklődés 1. Öröklődés komplexebb sajátosságai 2. Öröklődés molekuláris alapja Poligénes v. kantitatív öröklődés Azok a tulajdonságokat amelyek mértékegységgel nem, vagy csak nehezen mérhetők, kialakulásuk kevéssé

Részletesebben

1. előadás Membránok felépítése, mebrán raftok, caveolák jellemzője, funkciói

1. előadás Membránok felépítése, mebrán raftok, caveolák jellemzője, funkciói 1. előadás Membránok felépítése, mebrán raftok, caveolák jellemzője, funkciói Plazmamembrán Membrán funkciói: sejt integritásának fenntartása állandó hő, energia, és információcsere biztosítása homeosztázis

Részletesebben

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A NÖVÉNYGENETIKA Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 A NÖVÉNYI TÁPANYAG TRANSZPORTEREK az előadás áttekintése A tápionok útja a növényben Növényi tápionok passzív és

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi

Részletesebben

Kevéssé fejlett, sejthártya betüremkedésekből. Citoplazmában, cirkuláris DNS, hisztonok nincsenek

Kevéssé fejlett, sejthártya betüremkedésekből. Citoplazmában, cirkuláris DNS, hisztonok nincsenek 1 A sejtek felépítése Szerkesztette: Vizkievicz András A sejt az élővilág legkisebb, önálló életre képes, minden életjelenséget mutató szerveződési egysége. Minden élőlény sejtes szerveződésű, amelyek

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

A GENOM MEGISMERÉSÉNEK MÓDSZEREI

A GENOM MEGISMERÉSÉNEK MÓDSZEREI A GENOM MEGISMERÉSÉNEK MÓDSZEREI 20 GENETIKA ALAPOK 3-1 Jóslatok és a valóság a molekuláris biológiában. Mennyire látható előre a tudomány fejlődése? 1968 Simone de Beauvoir "Minden ember halandó" 1-2

Részletesebben

folsav, (a pteroil-glutaminsav vagy B 10 vitamin) dihidrofolsav tetrahidrofolsav N CH 2 N H H 2 N COOH

folsav, (a pteroil-glutaminsav vagy B 10 vitamin) dihidrofolsav tetrahidrofolsav N CH 2 N H H 2 N COOH folsav, (a pteroil-glutaminsav vagy B 10 vitamin) 2 2 2 2 pirimidin rész pirazin rész aminobenzoesav rész glutaminsav rész pteridin rész dihidrofolsav 2 2 2 2 tetrahidrofolsav 2 2 2 2 A dihidrofolát-reduktáz

Részletesebben

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 NÖVÉNYÉLETTAN Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Sejtfal szintézis és megnyúlás Környezeti tényezők hatása a növények növekedésére és fejlődésére Előadás áttekintése

Részletesebben

MINTAJEGYZŐKÖNYV A VÉRALVADÁS VIZSGÁLATA BIOKÉMIA GYAKORLATHOZ

MINTAJEGYZŐKÖNYV A VÉRALVADÁS VIZSGÁLATA BIOKÉMIA GYAKORLATHOZ MINTAJEGYZŐKÖNYV A VÉRALVADÁS VIZSGÁLATA BIOKÉMIA GYAKORLATHOZ Feladatok 1. Teljes vér megalvasztása rekalcifikálással 1.1 Gyakorlat kivitelezése 1.2 Minta jegyzőkönyv 2. Referenciasor készítése fehérjeméréshez

Részletesebben

AZ EMBERI MIKROBIOM: AZ EGYÉN, MINT SAJÁTOS ÉLETKÖZÖSSÉG Duda Ernő

AZ EMBERI MIKROBIOM: AZ EGYÉN, MINT SAJÁTOS ÉLETKÖZÖSSÉG Duda Ernő AZ EMBERI MIKROBIOM: AZ EGYÉN, MINT SAJÁTOS ÉLETKÖZÖSSÉG Duda Ernő Az NIH, az Egyesült Államok Nemzeti Egészségügyi Hivatala (az orvosi- és biológiai kutatásokat koordináló egyik intézmény) 2007 végén

Részletesebben

Flagellin alapú filamentáris nanoszerkezetek létrehozása

Flagellin alapú filamentáris nanoszerkezetek létrehozása Flagellin alapú filamentáris nanoszerkezetek létrehozása Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium MTA Enzimológiai Intézete MTA MFA Bakteriális flagellumok Flagelláris filamentum: ~10

Részletesebben

3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció

3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció 3. gyakorlat: nukleinsav-tisztítás, polimeráz láncreakció A vírus genetikai anyagának vizsgálata (direkt víruskimutatási módszer) biztosítja a legrészletesebb és legspecifikusabb információkat a kimutatott

Részletesebben

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár

Részletesebben

Budapesti Műszaki és Gazdaságtudományi Egyetem Vegyészmérnöki és Biomérnöki Kar. Hajdú Fanni. BSc. IV. évfolyam Biomérnök szakos hallgató

Budapesti Műszaki és Gazdaságtudományi Egyetem Vegyészmérnöki és Biomérnöki Kar. Hajdú Fanni. BSc. IV. évfolyam Biomérnök szakos hallgató Budapesti Műszaki és Gazdaságtudományi Egyetem Vegyészmérnöki és Biomérnöki Kar Hajdú Fanni BSc. IV. évfolyam Biomérnök szakos hallgató A maláriaellenes célpont Plasmodium falciparum CTP: foszfokolin citidililtranszferáz

Részletesebben

ENZIMEK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA

ENZIMEK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ENZIMEK BIOTECHNOLÓGIAI

Részletesebben

Evolúcióelmélet és az evolúció mechanizmusai

Evolúcióelmélet és az evolúció mechanizmusai Evolúcióelmélet és az evolúció mechanizmusai Az élet Darwini szemlélete Melyek az evolúció bizonyítékai a világban? EVOLÚCIÓ: VÁLTOZATOSSÁG Mutáció Horizontális géntranszfer Genetikai rekombináció Rekombináció

Részletesebben

Fotoszintézis. fotoszintetikus pigmentek Fényszakasz - gránum/sztrómalamella. Sötétszakasz - sztróma

Fotoszintézis. fotoszintetikus pigmentek Fényszakasz - gránum/sztrómalamella. Sötétszakasz - sztróma Fotoszintézis fotoszintetikus pigmentek Fényszakasz - gránum/sztrómalamella Sötétszakasz - sztróma A növényeket érı hatások a pigmentösszetétel változását okozhatják I. Mintavétel (inhomogén minta) II.

Részletesebben

Ph.D. értekezés tézisei. Dürgő Hajnalka. Témavezető: Dr. Medzihradszky-Fölkl Katalin. Biológia Doktori Iskola. MTA SZBK Biokémiai Intézet SZTE TTIK

Ph.D. értekezés tézisei. Dürgő Hajnalka. Témavezető: Dr. Medzihradszky-Fölkl Katalin. Biológia Doktori Iskola. MTA SZBK Biokémiai Intézet SZTE TTIK Gümő-specifikus NCR peptidek azonosítása, vad és mutáns Medicago truncatula gyökérgümők összehasonlító fehérjeanalízise, és az NCR247 lehetséges bakteriális interakciós partnereinek felderítése Ph.D. értekezés

Részletesebben

Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben

Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben Algaközösségek ökológiai, morfológiai és genetikai diverzitásának összehasonlítása szentély jellegű és emberi használatnak kitett élőhelykomplexekben Duleba Mónika Környezettudományi Doktori Iskola I.

Részletesebben

SZÉRUM KOLESZTERIN ÉS TRIGLICERID MEGHATÁROZÁS

SZÉRUM KOLESZTERIN ÉS TRIGLICERID MEGHATÁROZÁS SZÉRUM KOLESZTERIN ÉS TRIGLICERID MEGHATÁROZÁS A koleszterin, a koleszterin észterek, triacilglicerolok vízben oldhatatlan vegyületek. E lipidek a májból történő szintézist, és/vagy táplálék abszorpciót

Részletesebben

Az Ames teszt (Salmonella/S9) a nemzetközi hatóságok által a kémiai anyagok minősítéséhez előírt vizsgálat, amellyel az esetleges genotoxikus hatás

Az Ames teszt (Salmonella/S9) a nemzetközi hatóságok által a kémiai anyagok minősítéséhez előírt vizsgálat, amellyel az esetleges genotoxikus hatás Az Ames teszt (Salmonella/S9) a nemzetközi hatóságok által a kémiai anyagok minősítéséhez előírt vizsgálat, amellyel az esetleges genotoxikus hatás kockázatát mérik fel. Annak érdekében, hogy az anyavegyületével

Részletesebben

Az északi pocok mtdns kontroll régiójának elemzése

Az északi pocok mtdns kontroll régiójának elemzése Az északi pocok mtdns kontroll régiójának elemzése DIPLOMADOLGOZAT készítette: ANTAL FERENC biológus hallgató témavezető: Dr. PUTNOKY PÉTER PTE TTK Biológiai Intézet Genetikai és Molekuláris Biológiai

Részletesebben

Dr. Nemes Nagy Zsuzsa Szakképzés Karl Landsteiner Karl Landsteiner:

Dr. Nemes Nagy Zsuzsa Szakképzés Karl Landsteiner Karl Landsteiner: Az AB0 vércsoport rendszer Dr. Nemes Nagy Zsuzsa Szakképzés 2011 Az AB0 rendszer felfedezése 1901. Karl Landsteiner Landsteiner szabály 1901 Karl Landsteiner: Munkatársai vérmintáit vizsgálva fedezte fel

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

A Globális regulátor mutációknak mint az attenuálás lehetőségének vizsgálata Escherichia coli-ban

A Globális regulátor mutációknak mint az attenuálás lehetőségének vizsgálata Escherichia coli-ban A Globális regulátor mutációknak mint az attenuálás lehetőségének vizsgálata Escherichia coli-ban című támogatott kutatás fő célja az volt, hogy olyan regulációs mechanizmusoknak a virulenciára kifejtett

Részletesebben

BIOLÓGIAI PRODUKCIÓ. Az ökológiai rendszerekben végbemenő szervesanyag-termelés. A növények >fotoszintézissel történő szervesanyagelőállítása

BIOLÓGIAI PRODUKCIÓ. Az ökológiai rendszerekben végbemenő szervesanyag-termelés. A növények >fotoszintézissel történő szervesanyagelőállítása BIOLÓGIAI PRODUKCIÓ Az ökológiai rendszerekben végbemenő szervesanyag-termelés. A növények >fotoszintézissel történő szervesanyagelőállítása az elsődleges v. primer produkció; A fogyasztók és a lebontók

Részletesebben

Több oxigéntartalmú funkciós csoportot tartalmazó vegyületek

Több oxigéntartalmú funkciós csoportot tartalmazó vegyületek Több oxigéntartalmú funkciós csoportot tartalmazó vegyületek Hidroxikarbonsavak α-hidroxi karbonsavak -Glikolsav (kézkrémek) - Tejsav (tejtermékek, izomláz, fogszuvasodás) - Citromsav (citrusfélékben,

Részletesebben

Egy Polycomb Response Element (PRE) in situ vizsgálata Drosophila melanogaster-ben génkonverzió segítségével. Kozma Gabriella

Egy Polycomb Response Element (PRE) in situ vizsgálata Drosophila melanogaster-ben génkonverzió segítségével. Kozma Gabriella Egy Polycomb Response Element (PRE) in situ vizsgálata Drosophila melanogaster-ben génkonverzió segítségével Kozma Gabriella Ph.D. tézisek Témavezető: Dr. Sipos László Genetikai Intézet MTA Szegedi Biológiai

Részletesebben

Pórusos polimer gélek szintézise és vizsgálata és mi a közük a sörgyártáshoz

Pórusos polimer gélek szintézise és vizsgálata és mi a közük a sörgyártáshoz Pórusos polimer gélek szintézise és vizsgálata és mi a közük a sörgyártáshoz Póta Kristóf Eger, Dobó István Gimnázium Témavezető: Fodor Csaba és Szabó Sándor "AKI KÍVÁNCSI KÉMIKUS" NYÁRI KUTATÓTÁBOR MTA

Részletesebben

PÉCSI TUDOMÁNYEGYETEM. Természetes és mesterséges agrobaktérium rezisztencia vizsgálata szőlőben. Galambos Anikó

PÉCSI TUDOMÁNYEGYETEM. Természetes és mesterséges agrobaktérium rezisztencia vizsgálata szőlőben. Galambos Anikó PÉCSI TUDOMÁNYEGYETEM Biológiai Doktori Iskola Genetika program Természetes és mesterséges agrobaktérium rezisztencia vizsgálata szőlőben PhD értekezés tézisei Galambos Anikó Témavezető: Dr. Putnoky Péter

Részletesebben

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll.

Mivel korábban már végeztünk mikroszatellit elemzést (Liker et al 2009), a kiértékeléshez szükséges szoftverek és tapasztalat rendelkezésre áll. Genetikai változatosság (állat csoportok) Pénzes Zsolt, Bihari Péter és Raskó István SZBK Genetika Intézet A pályázati munkatervnek megfelelően első évben elsősorban a részletes elemzésre kiválasztott

Részletesebben

A mutáns fenotípushoz szorosan kapcsolt markerek (1N1R és U212D) segítségével BAC (Bacterial Artifical Chromosome) klónokat azonosítottunk egy másik

A mutáns fenotípushoz szorosan kapcsolt markerek (1N1R és U212D) segítségével BAC (Bacterial Artifical Chromosome) klónokat azonosítottunk egy másik A szimbiotikus gümő kialakulásában résztvevő két gén azonosítása Medicago truncatulaból térképezésen alapuló génizolálással c. OTKA pályázat (T046645) zárójelentése A pályázat célja a Sinorhizobium meliloti

Részletesebben

Baktériumok tenyésztése

Baktériumok tenyésztése Baktériumok tenyésztése Koch posztulátumok A betegből a kórokozó izolálása Izolálás, tenyésztés, tápközegben fenntartás Kísérleti állatba oltva a betegségre jellemző tünetek kialakulása Ezen állatokból

Részletesebben

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Szalma Katalin Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Témavezető: Dr. Turai István, OSSKI Budapest, 2010. október 4. Az ionizáló sugárzás sejt kölcsönhatása Antone

Részletesebben

Készült: Módosítva: július

Készült: Módosítva: július Tananyag címe: Transzaminázok vizsgálata Szerző: Dr. Mótyán János András egyetemi tanársegéd Biokémiai és Molekuláris Biológiai Intézet Általános Orvostudományi Kar Debreceni Egyetem Készült: 2014.12.01-2015.01.31.

Részletesebben

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Rohonczy Kata, Zoller Linda, Fodor Andrea, Tabajdiné, dr. Pintér Vera FoodMicro Kft. Célkitűzés Élelmiszerekben és takarmányokban

Részletesebben

Bakteriofág és bakteriális represszor vizsgálata in vivo és in vitro módszerekkel

Bakteriofág és bakteriális represszor vizsgálata in vivo és in vitro módszerekkel SZENT ISTVÁN EGYETEM Bakteriofág és bakteriális represszor vizsgálata in vivo és in vitro módszerekkel Doktori értekezés tézisei Ferenczi Szilamér Imre Gödöllő 2008 A doktori iskola megnevezése: Biológia

Részletesebben

Transzgénikus növények előállítása

Transzgénikus növények előállítása Transzgénikus növények előállítása Növényi biotechnológia Területei: A növények szaporításának új módszerei Növényi sejt és szövettenyészetek alkalmazása Mikroszaporítás Vírusmentes szaporítóanyag előállítása

Részletesebben

3. Sejtalkotó molekulák III.

3. Sejtalkotó molekulák III. 3. Sejtalkotó molekulák III. Fehérjék, fehérjeszintézis (transzkripció, transzláció, posztszintetikus módosítások). Enzimműködés 3.1 Fehérjék A genetikai információ egyik fő manifesztálódása Számos funkció

Részletesebben

Az IPD3 gén genetikai térképezése és szerepének vizsgálata a szimbiotikus kapcsolatok kialakításában Medicago truncatula-ban.

Az IPD3 gén genetikai térképezése és szerepének vizsgálata a szimbiotikus kapcsolatok kialakításában Medicago truncatula-ban. Az IPD3 gén genetikai térképezése és szerepének vizsgálata a szimbiotikus kapcsolatok kialakításában Medicago truncatula-ban Doktori értekezés Horváth Beatrix Eötvös Loránd Tudományegyetem, Természettudományi

Részletesebben

A szénhidrátok az élet szempontjából rendkívül fontos, nélkülözhetetlen vegyületek. A bioszféra szerves anyagainak fő tömegét adó vegyületek.

A szénhidrátok az élet szempontjából rendkívül fontos, nélkülözhetetlen vegyületek. A bioszféra szerves anyagainak fő tömegét adó vegyületek. Szénhidrátok Szerkesztette: Vizkievicz András A szénhidrátok az élet szempontjából rendkívül fontos, nélkülözhetetlen vegyületek. A bioszféra szerves anyagainak fő tömegét adó vegyületek. A szénhidrátok

Részletesebben

ALLOSZTÉRIKUSAN SZABÁLYOZÓ METABOLITOK HATÁSA A PIRUVÁT-KINÁZ L és M IZOENZIMRE

ALLOSZTÉRIKUSAN SZABÁLYOZÓ METABOLITOK HATÁSA A PIRUVÁT-KINÁZ L és M IZOENZIMRE ALLOSZTÉRIKUSAN SZABÁLYOZÓ METABOLITOK HATÁSA A PIRUVÁT-KINÁZ L és M IZOENZIMRE A glukóz piruváttá (illetve laktáttá) történő átalakulása során (glikolízis), illetve a glukóz reszintézisben (glukoneogenezis)

Részletesebben

A kromoszómák kialakulása előtt a DNS állomány megkettőződik. A két azonos információ tartalmú DNS egymás mellé rendeződik és egy kromoszómát alkot.

A kromoszómák kialakulása előtt a DNS állomány megkettőződik. A két azonos információ tartalmú DNS egymás mellé rendeződik és egy kromoszómát alkot. Kromoszómák, Gének A kromoszóma egy hosszú DNS szakasz, amely a sejt életének bizonyos szakaszában (a sejtosztódás előkészítéseként) tömörödik, így fénymikroszkóppal láthatóvá válik. A kromoszómák két

Részletesebben

DNS replikáció. DNS RNS Polipeptid Amino terminus. Karboxi terminus. Templát szál

DNS replikáció. DNS RNS Polipeptid Amino terminus. Karboxi terminus. Templát szál DNS replikáció DNS RNS Polipeptid Amino terminus Templát szál Karboxi terminus Szuper-csavarodott prokarióta cirkuláris DNS Hisztonok komplexe DNS hisztonokra történő felcsvarodása Hiszton-kötött negatív

Részletesebben

Szőlőmag extraktum hatása makrofág immunsejtek által indukált gyulladásos folyamatokra Radnai Balázs, Antus Csenge, Sümegi Balázs

Szőlőmag extraktum hatása makrofág immunsejtek által indukált gyulladásos folyamatokra Radnai Balázs, Antus Csenge, Sümegi Balázs Szőlőmag extraktum hatása makrofág immunsejtek által indukált gyulladásos folyamatokra Radnai Balázs, Antus Csenge, Sümegi Balázs Pécsi Tudományegytem Általános Orvostudományi Kar Biokémiai és Orvosi Kémiai

Részletesebben

Az élelmiszerek mikrobiális ökológiája. Mohácsiné dr. Farkas Csilla

Az élelmiszerek mikrobiális ökológiája. Mohácsiné dr. Farkas Csilla Az élelmiszerek mikrobiális ökológiája Mohácsiné dr. Farkas Csilla Az élelmiszerek mikroökológiai tényezői Szennyeződés forrásai és közvetítői A mikroorganizmusok belső tulajdosnágai Belső tényezők (az

Részletesebben

POSZTTRANSZLÁCIÓS MÓDOSÍTÁSOK: GLIKOZILÁLÁSOK

POSZTTRANSZLÁCIÓS MÓDOSÍTÁSOK: GLIKOZILÁLÁSOK POSZTTRANSZLÁCIÓS MÓDOSÍTÁSOK: GLIKOZILÁLÁSOK Dr. Pécs Miklós Budapesti Műszaki és Gazdaságtudományi Egyetem, Alkalmazott Biotechnológia és Élelmiszertudomány Tanszék 1 Glikozilálás A rekombináns fehérjék

Részletesebben

Zsírsav szintézis. Az acetil-coa aktivációja: Acetil-CoA + CO + ATP = Malonil-CoA + ADP + P. 2 i

Zsírsav szintézis. Az acetil-coa aktivációja: Acetil-CoA + CO + ATP = Malonil-CoA + ADP + P. 2 i Zsírsav szintézis Az acetil-coa aktivációja: Acetil-CoA + CO + ATP = Malonil-CoA + ADP + P 2 i A zsírsav szintáz reakciói Acetil-CoA + 7 Malonil-CoA + 14 NADPH + 14 H = Palmitát + 8 CoA-SH + 7 CO 2 + 7

Részletesebben

Az örökítőanyag. Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase

Az örökítőanyag. Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase SZTE, Orv. Biol. Int., Mol- és Sejtbiol. Gyak., VIII. Az örökítőanyag Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase Ez az

Részletesebben

Bevezetés a növénytanba Növényélettani fejezetek 2.

Bevezetés a növénytanba Növényélettani fejezetek 2. Bevezetés a növénytanba Növényélettani fejezetek 2. Dr. Parádi István Növényélettani és Molekuláris Növénybiológiai Tanszék (istvan.paradi@ttk.elte.hu) www.novenyelettan.elte.hu A gyökér élettani folyamatai

Részletesebben

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA 1. Nukleinsavak keresztrejtvény (12+1 p) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 1. A nukleinsavak a.-ok összekapcsolódásával kialakuló polimerek. 2. Purinvázas szerves bázis, amely az

Részletesebben

A pha1 és pha2 géncsoport szerepe Agrobacterium tumefaciensben

A pha1 és pha2 géncsoport szerepe Agrobacterium tumefaciensben A pha1 és pha2 géncsoport szerepe Agrobacterium tumefaciensben Diplomamunka Készítette: Csoknya Julianna biológus hallgató Témavezetı: Dr. Putnoky Péter PTE TTK Biológiai Intézet Genetikai és Molekuláris

Részletesebben

Növényélettani Gyakorlatok A légzés vizsgálata

Növényélettani Gyakorlatok A légzés vizsgálata Növényélettani Gyakorlatok A légzés vizsgálata /Bevezető/ Fotoszintézis Fény-szakasz: O 2, NADPH, ATP Sötétszakasz: Cellulóz keményítő C 5 2 C 3 (-COOH) 2 C 3 (-CHO) CO 2 Nukleotid/nukleinsav anyagcsere

Részletesebben

SZÉNHIDRÁTOK. Biológiai szempontból legjelentősebb a hat szénatomos szőlőcukor (glükóz) és gyümölcscukor(fruktóz),

SZÉNHIDRÁTOK. Biológiai szempontból legjelentősebb a hat szénatomos szőlőcukor (glükóz) és gyümölcscukor(fruktóz), SZÉNHIDRÁTOK A szénhidrátok döntő többségének felépítésében három elem, a C, a H és az O atomjai vesznek részt. Az egyszerű szénhidrátok (monoszacharidok) részecskéi egyetlen cukormolekulából állnak. Az

Részletesebben