Semmelweis Egyetem Doktori Iskola. Dr Bélteki Gusztáv. Új módszerek a transzgénes egér technológiában

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Semmelweis Egyetem Doktori Iskola. Dr Bélteki Gusztáv. Új módszerek a transzgénes egér technológiában"

Átírás

1 Semmelweis Egyetem Doktori Iskola Dr Bélteki Gusztáv Új módszerek a transzgénes egér technológiában Témavezető: Opponensek: Szigorlati Bizottság: Prof. Dr. Falus András Dr Prohászka Zoltán Dr Polgár Beáta Prof. Dr. Schaff Zsuzsa Prof. Dr. Dinnyés András Dr. Tóth Sára Budapest és Cambridge (UK), 2005

2 Tartalomjegyzék 1 Bevezetés A transzgénes egér technológia jelentősége a posztgenomikus korban Az embrionális őssejtek (ES sejtek) szerepe a transzgénes 8 technológiában Az embrionális őssejtek eredete és jellemzői Az ES sejteken alapuló transzgenezis előnyei az egyéb technikákkal 10 szemben 1.3 Az ES sejtek genetikai módosításának lehetőségei Klasszikus transzgenezis ES sejtek segítségével Gén targeting Null mutáció létrehozása egérben: knock-out Specifikus genetikai változások létrehozása: knock-in Nagyléptékű mutagenezis egérben Kémiai mutagenezis egérben Géncsapdázás ( gene trapping ) RNS interferencia Feltételes (kondicionális) genetikai módosítások egérben A klasszikus knock-out technológia korlátai A helyspecifikus rekombinázok jellemzői A kondicionális módosítás példái Kondicionális gén targeting Transzgének kondicionális overexpressziója A kondicionális rendszerek korlátai Nemkívánatos rekombináz expresszió Liganddal indukálható Cre rekombinázok Tetraciklinekkel indukálható transzgénes rendszerek Egyéb inducibilis rendszerek Genomiális integrációra építő stratégiák A pop-in integráció 26 2

3 A rekombináz-mediált kazetta csere (RMCE) A φc31 integráz rendszer A φc31 integráz jellemzői A φc31 integráz felismerési helyei A φc31 integráz működése heterológ környezetben 30 2 Célkitűzések 32 3 Módszerek Transzgénes vektorok létrehozása φc31 integráz kísérlet Felismerési helyek Dokkoló vektorok Inszerciós plazmidok Reverz tetraciklin transzaktivátor kísérlet Target vektor készítése Sejtkultúra protokoll ES sejtek tenyésztése, passzálása, tárolása ES sejtek tenyésztése ES sejtek passzálása ES sejtek tárolása ES sejtek genetikai módosítása DNS bejuttatása ES sejtekbe ES sejtek drogszelekciója és a kolóniák expanziója Genomiális DNS izolálása ES sejtekből ES sejtek előkészítése az embrió aggregációra ES sejtek transzfekciója lipofekcióval Southern blotting Polimeráz láncreakció Embriológiai módszerek ES sejt diploid morula aggregáció 45 3

4 3.5.2 Pronukleáris mikroinjekció Egérembriók X-gal festése Fluoreszcens detektálás 47 4 Eredmények φc31 integráz kísérlet Dokkoló helyet tartalmazó ES sejtvonalak létrehozása és molekuláris 48 jellemzése A φc31 integráz működőképes egér ES sejtekben Helyspecifikus integráció a φc31 integrázt expresszáló ES sejtekben A rekombináz-mediált kazetta csere (RMCE) echanizmusának elemzése A helyspecifikus integráció lehetőségei Az integrációs termékek elemzése A rekombinációs helyek molekuláris vizsgálata A φc31 integráz expressziója nem befolyásolja az ES sejtek fejlődési 59 potenciálját A φc31 integráz használata szelekciót igényel Genomiális integráció vizsgálata a zigótában Genomiális integráció ES sejtekben nem szelektív körülmények között Reverz tetraciklin transzaktivátor kísérlet Rosa26-rtTA knock-in ES sejtvonal létrehozása A tetraciklinnel indukálhatóság vizsgálata ES sejtekben Rosa26-rtTA knock-in egér létrehozása A Cre-kondicionalis Rosa26-rtTA egértörzs tesztelése in vivo A Rosa26-rtTA egértörzs használatának elvi sémája A VEGF-A embrionális konstitutív overexpressziója embrionális 69 letalitást okoz Peliosis hepatis és thymus atrophia a VEGF-A posztnatális 72 overexpressziója esetén A VEGF-A központi idegrendszeri overexpressziója az embrionális életben idegrendszeri vérzések kialakulásához vezet 72 4

5 A VEGF-A overexpressziója a vese podocytáiban nephrosis szindrómát okoz 73 5 Megbeszélés φc31 integráz projekt A φc31 integráz működése és annak korlátai ES sejtekben A helyspecifikus rekombináció lehetséges iránya A genomiális integráció mechanizmusáról A φc31 integráz mediálta genomiális integráció hatékonysága A φc31 integráz lehetséges káros hatásai az ES sejtekre A φc31 integráz rendszer lehetséges alkalmazásai az ES sejt 79 technológiában Géncsapda inszerciók másodlagos módosítása Transzgének kiszámítható expressziója jól jellemzett genomiális 81 dokkoló helyeken A φc31 integráz egyéb alkalmazási területei Reverz tetraciklin transzaktivátor projekt Az indukálható génexpressziós rendszerek sajátságai A Rosa26-rtTA stratégia alkamazhatóságának elemzése A genom manipuláció és az induktor hatása Alacsony háttéraktivitás és gyorsan indukálható génexpresszió A szövetspecificitás biztosítása A VEGF-A overexpressziójának következményei egérben A Rosa26-rtTA stratégia korlátai és továbbfejlesztési lehetőségei 88 6 Következtetések φc31 integráz projekt 6.2 Reverz tetraciklin transzaktivátor projekt 91 7 Köszönetnyilvánítás 92 8 Irodalomjegyzék 93 5

6 9 Saját közlemények jegyzéke Összefoglaló Summary Ábrák és táblázatok jegyzéke A dolgozatban használt rövidítések 106 6

7 1. Bevezetés 1.1 A transzgénes egér technológia jelentősége a posztgenomikus korban A XX. század utolsó és a XXI. század első évtizedének legjelentősebb biológiai felfedezése a genom projektek kidolgozása és megvalósítása. A genom projekt elnevezés élőlények genetikai programjának DNS szekvencia-szintű meghatározását jelenti. Legismertebb a saját fajunk genetikai információját felderítő Humán Genom Projekt (1,2,3), ezzel egy időben folyik azonban kísérleti modellként szolgáló élőlények (pl. Drosophila melanogaster, Caenorhabditis elegans, Mus musculus) és fontos kórokozó organizmusok (pl. Mycobacterium tuberculosis) genom projektje is (4,5,6,7). E munkák eredményeképpen nagy számú új gén válik ismertté becslések szerint az emberi és az egér genomban egyaránt kb a fehérjét kódoló gének száma. E gének jelentős részének funkciója ismeretlen (8). A szekvencia-adatbázisok segítségével a DNS-szekvenciából megjósolható a kódolt fehérje aminosav-sorrendje, abból azonban csak általában csak durva becslés tehető a működésre nézve. A korábbiakban két módon lehetett kísérleti betekintést nyerni egy emberi gén működésébe: a kódolt fehérje tulajdonságainak vizsgálatával és a gén mutációja által eredményezett kóros állapot vizsgálatával. Sok fehérje azonban igen nehezen izolálható, és az in vitro funkcionális vizsgálatokkal csak korlátozott információ nyerhető. Az örökletes emberi betegségek csak génjeink kis részét jellemzik működési szempontból. Számos gén nélkülözhetetlen az egyedfejlődés igen korai szakaszában, és működésének kiesése az embrió pusztulását okozza, vagyis beteg egyed nem születik meg. Az is gyakori, hogy a kieső funkciót más gének képesek teljességgel átvenni, és ezért nem jelentkezik kóros fenotípus. A fenti meggondolások teszik szükségessé a transzgénes egerek létrehozását és vizsgálatát a gének funkcionális jellemzése céljából. A gének szerkezete és szerveződése valamint a legtöbb biológiai folyamat (pl. biokémiai reakcióutak, fejlődési mintázatképzés) nagyfokú hasonlóságot mutat emberben és egérben, így az egérmodellen nyert adatok - megfelelő kritikával - emberre is átvihetők. Az egér génjei célzottan vagy random módon megváltoztathatók, s a mutációk következményei kísérletesen vizsgálhatók. Embriológiai vizsgálatok végezhetők az embrionális letalitással járó mutációk funkcionális jellemzésére. Az utóbbi két évtized technológiai haladásának 7

8 (l. lentebb) eredményeképpen ma már gyakorlatilag bármilyen kívánt genetikai változtatás előidézhető az egér genomjában. Nincs pontos adat arról, hány gén mutációját idézték már elő egérben, de a szám bizonyosan meghaladja a 3000-et (9). 1.2 Az embrionális őssejtek (ES sejtek) szerepe a transzgénes technológiában Az embrionális őssejtek eredete és jellemzői Az embrionális őssejtek (ES sejtek) pluripotens őssejtek, melyek az embrionális fejlődés korai szakaszában izolálhatók. A blasztula stádiumú embrióban két sejttípus található: a külső sejtréteget képező trophoectoderm és a belül elhelyezkedő embriócsomó (más néven belső sejttömeg). Utóbbi sejteket megfelelő körülmények között in vitro tenyésztve ES sejtvonal hozható létre (10, 11). E sejtek táptalajon sok generáción át fenntarthatók és szaporíthatók, közben genetikai állományuk célzottan megváltoztatható és a megfelelő mutációt hordozó klónok izolálhatók (1A. ábra). Az in vitro manipuláció közben az ES sejtek megőrzik eredeti fejlődési potenciáljukat, és képesek az embrió valamennyi szervévé illetve szövetévé differenciálódni (de nem képesek részt venni a trophoectoderm és a visceralis endoderm képzésében). Amennyiben injekció vagy aggregáció segítségével az ES sejteket egy blasztula stádiumú embrióval hozzuk össze, a születendő egyed kiméra lesz, vagyis szervezete tartalmazni fog az eredeti zigótából és az ES sejtekből származó sejteket egyaránt (1B. ábra). Amennyiben az egyed ivarsejtjei között is található ES sejt eredetűek, akkor azok révén az ES sejt genetikai állománya az utódra átörökíthető; ezt nevezik germinális transzmissziónak. Ily módon a genetikailag megváltoztatott sejtből genetikailag megváltoztatott (transzgénes) élőlény hozható létre (12). 8

9 1. ábra: ES-sejtek és alkalmazásuk A. ES-sejtek izolálása, módosítása, transzgénes egér létrehozása Blasztula ES-sejt izolálás DNS Transzgénes egér Germinális transzmisszió Drogszelekció Kiméra egér Szubklónok izolálása, expanziója és genetikai jellemzése Kiméra embrió ES-sejt embrió aggregáció B. ES-sejtek és diploid egérembrió aggregációjából származó kiméra 9

10 1.2.2 Az ES sejteken alapuló transzgenezis előnyei az egyéb technikákkal szemben Transzgénes élőlények létrehozásának alternativ módja az egyed sejtjeinek in vivo genetikai módosítása. Ennek két fő lehetősége a sejtek transzdukciója rekombináns vírusokkal illetve a DNS közvetlen bejuttatása fizikai módszerekkel (pl. mikroinjekcióval). Amennyiben örökölhető genetikai változtatást tervezünk, akkor annak germinális transzmissziója szükséges. Ez csak az ivarsejtek vagy az igen korai stádiumú embriók (optimálisan a zigóta) genetikai állományának megváltoztatásával érhető el. A gyakorlatban leggyakrabban a bejuttatandó DNS szakasz (transzgén) pronukleáris injekcióját végzik a megtermékenyített petesejt pronucleusába. A pronukleáris injekció (és az egyéb technikák) alkalmazhatóságát két tényező korlátozza, melyek az ES sejt technológiával áthidalhatók: 1. A bejuttatott DNS szakasz előre nem megjósolható helyen és példányszámban épül be a sejt saját DNS-ébe. Ez az esetek kb %-ában fenotípusosan megjelenő mutációt okoz. Ennél jelentősebb azonban, hogy a random módon beépült DNS-szakasz a szomszédos endogén génszabályozó elemek pozícióhatása alá kerül, és ilyen módon expressziója nem a kívánt módon alakul. Ahhoz, hogy megbízható transzgén expressziót érjünk, nagyszámú egértörzset kell létrehozni és expressziós szempontból jellemezni. 2. A fenti technikákkal csak a kívülről bevitt DNS-szekvenciák vizsgálatára van mód, a sejt saját génjeit nem lehet célzottan megváltoztatni. 1.3 Az ES sejtek genetikai módosításának lehetőségei Az ES sejtekben (és a belőlük létrehozott transzgénes egerekben) előidézhető genetikai változások fogalmilag két csoportba oszthatók. Az egyik lehetőség külső, idegen DNS-szakaszok beépítése a sejt genomjába. Ezzel az adott DNS-szakasz által előidézett fenotípusbeli változások vizsgálhatók in vitro és in vivo. Szűkebb értelemben e DNS-szakaszokat nevezik transzgéneknek. Tágabb értelemben azonban transzgénes egérnek neveznek minden, mesterségesen megváltoztatott genetikai állományú egértörzset. Közéjük sorolják tehát a másik fő lehetőséget, a saját DNS-állomány célzott megváltoztatását is. 10

11 1.3.1 Klasszikus transzgenezis ES sejtek segítségével Az ES sejteken alapuló transzgenezis több előnnyel rendelkezik a klasszikus módszerrel, a pronukleáris microinjekcióval szemben. Pozitív drogszelekcióval kiválaszthatók azok a sejtek, melyek felvették és stabilan expresszálják a transzgént. Genetikai módszerekkel (pl. Southern hibridizáció) megállapítható, hány példányban épült be a transzgén a sejt DNS-ébe, kiválaszthatók az egyetlen kópiát tartalmazó sejtvonalak. Amennyiben a transzgénben található egy vizualizálható riportergén (pl. lacz vagy egfp), akkor képet kaphatunk a transzgén expressziójáról differenciálatlan ES sejtekben vagy in vitro valamely szöveti sejttípussá differenciált sejtekben (13, 14). Összességében tehát lehetőségünk van, hogy a különböző random inszerciókat tartalmazó sejtvonalakat előzetesen in vitro jellemezzük, s csupán az igéreteseket vizsgáljuk tovább in vivo transzgénes egér formájában Gén targeting Gén targeting -nek nevezzük valamely endogén DNS-szakasz megváltoztatását egy külsőleg bejutatott DNS-molekula segítségével. A módszer alapja a homológ rekombináció jelensége: amennyiben a bejuttatott DNS-szakasz és valamely saját DNSszakasz között megfelelő hosszúságú átfedés van, akkor rekombináció (crossing over) következhet be a két szakasz között. Ennek eredményeként a külső DNS-szakasz a vele homológiát mutató lókuszra beépül, annak mutációját okozva (15). A homológ rekombináció ES sejtekben igen ritka esemény. A sejtek többségének genomjába egyáltalán nem épül be a bejuttatott DNS, és a beépülés a legtöbb esetben random és nem homológ módon történik. Ezért mindenképpen szükséges, hogy pozitív drogszelekcióval ki tudjuk választani a külső DNS-t a genomba beépítő sejtvonalakat, és hogy ezek közül genetikai analízissel azonosítsuk azokat, amelyekben homológ rekombináció zajlott le Null mutáció létrehozása egérben: knock-out 11

12 Knock-out -nak nevezik valamely gén megváltoztatását ES sejtekben homológ rekombináció segítségével olyan módon, hogy a gén ne legyen képes működőképes fehérje termelésére. A klasszikussá vált technikát a 2. ábra mutatja be. A rekombináció helyéül a gén olyan szakaszát választják, mely a szekvenciából feltételezett funkció alapján létfontosságúnak tűnik a géntermék működőképessége szempontjából (pl. egy enzim esetében a katalitikus helyet kódoló exon). A két megfelelő hosszúságú (> 1 kb) homológ szakasz ( homológ karok ) egy pozitív szelekciós markert fognak közre; a karokon kívül negatív szelekciós marker helyezkedik el. Pozitív szelekciós markerként használatos a neomycin foszfotranszferáz (neo) és a puromycin aciltranszferáz (puro) génje, a megfelelő antibiotikumok (G418 illetve puromycin) alkalmazásával. Negatív szelekciós marker a herpes vírus timidin kináz génje (tk) és a diphteria toxin A alegysége (DT-A); az előbbi gén expresszáló sejtek gancyclovir hatására elpusztulnak, a DT-A gént kifejező sejtek elpusztulásához nincs szükség drogra (16). Kettős (pozitív-negatív) szelekció alkalmazásával izolálhatók azok a sejtvonalak, amelyeknél mindkét homológ karban 1-1 rekombinációs esemény történt, és ezért a gén karok közötti szakasza a pozitív szelekciós markerre cserélődött. Az előidézett genetikai változás rendszerint a gén működésének kieséséhez vezet (pl. csak jelentősen rövidebb és/vagy instabil mrns termelődik vagy a fehérje létfontosságú doménjei hiányoznak), ez azonban nem minden esetben jósolható meg biztonsággal. Fontos megjegyezni, hogy a beépülő szelekciós marker és annak promotere távoli DNS-szakaszok, így szomszédos gének kifejeződését is befolyásolhatja (17). Megszokott eljárás ezért a szelekciós marker in vitro deléciója a knock-out egér létrehozása előtt. Ez valamely helyspecifikus rekombináz-rendszer alkalmazásával érhető el (l. lentebb) Specifikus genetikai változások létrehozása: knock-in A spontán mutációk csupán kis része okozza a gén működésének teljes kiesését. Hasonlóképpen, egy gén funkciójának tanulmányozásához a null mutáció okozta 12

13 2. Ábra: Knock-out allél létrehozása homológ rekombinációval Genom DNS Target vektor * neo tk Megváltoztatott gén neo mrns Fehérje 13

14 fenotípuson kívül egyéb genetikai változások következményét is meg kell vizsgálni. A fenti szakaszban részletezett technika módosításával erre lehetőség van: az így létrehozott alléleket nevezik knock-in -nek. Lehetőség van pl. hypomorph vagy hypermorph allélek létrehozására; adott esetben egy bizonyos pontmutáció is illeszthető a génbe. Olyan genetikai változások is létrehozhatók, melyek spontán nem fordulhatnak elő: a gén kódoló szekvenciája kicsélhető egy másik génével, amelynek expressziója így az eredeti gén szabályozó régióinak irányítása alá kerül. Ha a beépített DNS szakasz egy hisztokémiailag (pl. lacz) vagy fluoreszcenciával (egfp) vizualizálható fehérjét kódol, akkor az eredeti gén expressziója in vivo követhető (18). 1.4 Nagyléptékű mutagenezis egérben A homológ rekombináció segítségével elméletileg bármely gén tetszőlegesen megváltoztatható. A technika azonban általában igen munka- és eszközigényes. Egyrészt általában nagyszámú (több száz) drog-rezisztens sejtvonal közül kell kiválasztani a megfelelő genetikai eltérést hordozókat, másrészt a germinális transzmisszió elérése majd pedig a homozigóta egerek előállítása nagy számú egér keresztezését és genotípusvizsgálatát igényli. Ezért a hagyományos módszerekkel a knock-out technológia nem alkalmazható nagyszámú gén funkcionális szűrővizsgálatára, ami pedig a genom projektek során felszínre kerülő új kódoló szekvenciák elemzéséhez kívánatos lenne. Ennek áthidalása három, egymástól alapvetően eltérő módon lehetséges Kémiai mutagenezis egérben Ha hím egerek ivóvízébe erősen mutagén hatású etil-nitrozureát (ENU) teszünk, akkor ivarsejtjeik jelentős része indukált pontmutációkat fog hordozni. Ezen egerek utódaiban a domináns mutációk fenotípusos következményeit már közvetlenül vizsgálhatjuk. További előny, hogy az így létrehozott pontmutációak túlnyomóan nem null mutációk, hasonlóan a spontán fellépő genetikai változásokhoz. A módszer fő hátulütője, hogy a fenotípus alapján nem tudjuk, melyik génben történt a mutáció. Ennek meghatározásához a gén pozicionális klónozására van szükség, mely ugyan a ma rendelkezésre álló nagyfelbontású genetikai és fizikai térképek birtokában jelentősen 14

15 leegyszerűsödött, de még mindig igen erőforrás-igényes. A másik probléma, hogy közvetlenül csak a domináns mutációk okozta fenotípusok vizsgálhatók; a recesszív mutációk analíziséhez keresztezési sémák végrehajtása szükséges. Jelenleg több nagyléptékű ENU mutagenezis program van folyamatban világszerte (19, 20, 21). Az ENU mutagenezis ES sejtekben is alkalmazható (22) Géncsapdázás ( gene trapping ) A géncsapdázás inszerciós mutagenezis ES sejtekben, amelynek során a sejtekbe elektroporációval vagy retrovírus fertőzéssel bejuttatott DNS molekula (vektor) random módon épül be a sejt genomjába, mutációt idézve elő abban (23). A beépülő DNS szakasz tartalmaz egy vizualizálható fehérjeterméket kódoló riportergént és pozitív szelekciós markert (l. 3. ábra). A promoterrel nem rendelkező riportergént egy splice akceptor (SA) szekvencia előzi meg. Ha a vektor egy gén intronjába épül be, akkor a génnek az inszerciós helytől 5 irányba eső részéből és a riporterből álló fúziós mrns illetve fúziós fehérje jön létre, melyben a riporter fehérje általában megőrzi aktivitását. A szelekciós marker rendelkezhet saját promoterrel, vagy szintén alá lehet rendelve az endogén gén szabályozó elemeinek; utóbbi esetben csak azok a gének érhetők el mutagenezis céljából, amelyek expressziót mutatnak differenciálatlan ES sejtekben. A géncsapda-vektor beépülésének három lényeges következménye van (24): 1. A szóban forgó gén transzkripciója az inszerciónál általában megszakad, ami az esetek többségében a gén null mutációját eredményezi. 2. A létrejövő fúziós mrns információt hordoz az endogén génről és a riporterről egyaránt, így izolálható, és megfelelő módszerrel a szóban forgó gén egyszerűen azonosítható. 3. A riporter gén expressziója híven tükrözi az endogén gén expresszióját, és az vizualizálható in vitro és in vivo egyaránt. Több nagyléptékű gene trap projekt van folyamatban jelenleg is (25, 26, 27). Ezek során nagyszámú (több ezer) mutáns sejtvonalat állítanak elő. A mutáns egerek létrehozása előtt az inszerciókat jellemzik, és érdekesség szerint rangsorolják. Ez 15

16 3. Ábra: Géncsapda mutagenezis ES sejtekben Az ábrán látható vektorok random beépülése valamely gén intronjába a gén null mutációját eredményezi. A poliadenilációs jel az mrns szintézisének befejezéséhez vezet, így a további exonok nem íródnak át. A lacz gén termékének hisztokémiai vizsgálatával lehetséges a gén expressziójának követése. A β-geo gént a lacz és neo fúziójával hozták létre. Az A ábrán látható vektorral potenciálisan valamennyi gént vizsgálhatjuk, a B ábrán szereplő vektor csak a differenciálatlan ES sejtekben aktív gének elemzésére alkalmas. (Pr: promoter, SA: splice akceptor, a többi rövidítést l. a szövegben.) A Genom DNS Pr Géncsapda vektor Pr SA-lacZ-pA PGK-neo-pA mrns lacz pa B Genom DNS Pr Géncsapda vektor Pr SA-βgeo-pA mrns βgeo pa 16

17 történhet az endogén gén szekvenciája alapján, és történhet a sejtvonalak funkcionális jellemzésével (pl. markergén-expresszió változása külső ágensek vagy in vitro differenciálódás hatására). A gene trap vektor módosításaival lehetőség nyílik speciális géncsoportok célzott keresésére is (28, 29) RNS interferencia (RNAi) Az utóbbi években vált ismertté, hogy a sejtekbe bejuttatott vagy ott termelődő rövid, nukleotid hosszúságú kétszálú RNS (rövid interferáló RNS, sirna) specifikusan képes gátolni a vele azonos szekvenciát tartalmazó gén expresszióját. A módszert először C. elegans-ban alkalmazták a génműködés külső befolyásolására (30). A technológia továbbfejlesztése mára lehetővé tette RNS interferencia könyvtárak létrehozását, melyek a vizsgált élőlény összes génjére (vagy azok jelentős hányadára) tartalmaznak sirna-t. E könyvtár felhasználásával C. elegans-ban teljes genom screeneket végeztek, vagyis a genom összes génjét megvizsgálták, hogy a gén inaktiválása képes-e egy bizonyos fenotípusbeli eltéréshez vezetni (31). Tenyésztett emlős sejtekben is végezhetők hasonló screen-ek, amennyiben a keresett fenotípus sejtszinten azonosítható (pl. apoptosis) (32, 33). RNS interferencia alkalmazásával specifikus null mutáció idézhető elő ES sejtekben ( knock-down ) is, mely a rövid RNS-ek stabil expressziója esetén a transzgénes egérben is megfigyelhető (34, 35). Nincs szükség nagy számú ES sejtvonal előzetes genetikai vizsgálatára, és recesszív mutációk esetén is azonnal (keresztezés nélkül) null fenotípust kapunk. E módszer még technológiai fejlesztésre szorul, de potenciálisan lehetővé teheti igen nagy számú gén funkcionális analízisét viszonylag kevés ráfordítással. 1.5 Feltételes (kondicionális) genetikai módosítások egérben A klasszikus knock-out technológia korlátai Génjeink jelentős hányadára jellemző a pleiotrópia, vagyis a gén terméke a különböző szervekben és szövetekben vagy az egyedfejlődés különböző szakaszaiban egyaránt jelentős feladatot lát el. E gének működése nehezen vizsgálható olyan egyedben, 17

18 amelynek minden sejtje a gén null mutációját tartalmazza. Ha például egy gén működése elengedhetetlen valamely létfontosságú szerv kifejlődéséhez az embrionális fejlődés során, akkor annak kiesése az egyed méhen belüli elhalásához vezet. A gén működése más szervekben és/vagy az egyedfejlődés későbbi szakaszaiban nem vizsgálható. E gének analíziséhez szomatikus mozaik élőlények előállítása szükséges, amelyekben a gén funkciója izoláltan vizsgálható valamely szövetben. További lehetőségeket nyit meg, ha a gén be- és kikapcsolása időben is szabályozható. E technikákat gyűjtőnéven kondicionális (feltételes) génmódosítási stratégiáknak nevezzük. (36). Alkamazásukat a helyspecifikus rekombinázok használata tette lehetővé A helyspecifikus rekombinázok jellemzői A helyspecifikus rekombinázok genetikai átrendeződések katalízisére képes enzimek. Jelenleg két rekombináz használata terjedt el széleskörben ES sejtekben: az E. coli P1 fágjából származó Cre rekombináz (37, 38), és az élesztő (Saccharomyces cerevisae) Flp rekombináza (39, 40). Gazdaszervezetében mindkét rekombináz a genom megkettőződése során játszik fontos szerepet. A genetikai átrendeződés minden esetben a rekombináz két felismerési helye között történik. A Cre rekombináz felismerési helyét loxp helynek, Flp rekombinázét FRT helynek nevezzük. Mindkét felismerési hely 34 bp hosszúságú DNS szakasz, mely palindrom karokból és a közöttük elhelyezkedő magból áll (4A. ábra). A mag aszimmetrikus szekvenciájának iránya határozza meg a felismerési hely orientációját. A rekombináció eredménye a két felismerési hely relatív helyzetétől függően deléció, inszerció, inverzió és transzlokáció egyaránt lehet (4B. ábra és l. 40. hivatkozás). A lehetséges különböző reakcióutak azonban termodinamikai és reakció-kinetikai kontroll alatt állnak. Az intramolekuláris átrendeződések (pl. deléció) általában előnyt élveznek az intermolekulárisokkal (pl. inszerció vagy transzlokáció) szemben, és minél nagyobb a két felismerési hely távolsága, annál kevésbé valószínű az intramolekuláris reakció lezajlása is. Megfelelő szelekciós stratégiák alkalmazásával azonban lehetséges kedvezőtlen reakcióirányok megvalósítása is. (41, 42, 43) 18

19 4. ábra: A helyspecifikus rekombinázok jellemzői A. loxp és FRT felismerési helyek A nyilak a palindrom karokat jelzik, az aszimmetrikus központi szekvenciát aláhúzással jelöltük. A felismerési hely irányultságáért az utóbbi a felelős. Az FRT felismerési hely nagyobb betűmérettel jelölt timidinje szintén megtöri a szimmetriát. loxp: FRT: ATAACTTCGTATAATGTATGCTATACGAAGTTAT GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC B. Helyspecifikus rekombinázokkal létrehozható genetikai átrendeződések Deléció Transzlokáció szelek ció szelek ció Inverzió = loxp or FRT 19

20 1.5.3 A kondicionális módosítás példái Kondicionális gén targeting A kondicionális gén targeting során az adott gént nem inaktiváljuk az ES sejtekben, hanem az csak a sejtekből létrehozott egér bizonyos szöveteiben történik meg egy helyspecifikus rekombináz segítségével (44). Az ES sejtekben homológ rekombináció segítségével elhelyezzük a gén két intronjában a helyspecifikus rekombináz két felismerési helyét. Ez általában nem befolyásolja a gén működését. Utóbbi épségéhez rendszerint szükséges a homológ rekombináció során beépült szelekciós marker kazetta deléciója, ez ES sejtekben in vitro történik ugyanazon vagy másik helyspecifikus rekombináz segítségével (l. 5A. ábra). Az ilyen módon megváltoztatott ES sejtekből származó egerek általában nem mutatnak fenotípusbeli eltérést. Ha azonban keresztezzük őket egy olyan transzgénes egértörzzsel, melyben a Cre rekombináz expresszióját egy szövetspecifikus promoter irányítja, a mindkét genetikai változást hordozó utódok megfelelő szöveteiben a felismerési helyek között elhelyezkedő létfontosságú szakaszok kivágódnak. Ezzel a gént csupán az adott szövetféleségben inaktiváltuk, és ennek következményei a gén más hatásaitól izoláltan vizsgálhatók (5A. ábra). Az utóbbi években lehetővé vált a génexpresszió időbeli szabályozása is külső ágensekkel (pl. doxiciklin, tamoxifen) indukálható Cre rekombinázok segítségével (45, 46) Transzgének kondicionális expressziója A helyspecifikus rekombinázok segítségével lehetséges a klasszikus transzgének expressziójának térben vagy időben szabályozott bekapcsolása. Ehhez a transzgén és annak ubiquitaer promotere közé egy felismerési helyekkel közrefogott poliadenilációs (pa) jelet kell elhelyezni (5B. ábra). Alapállapotban a transzgénről nem termelődik fehérje, mert az mrns szintézisét a pa szignál megszakítja. Ha azonban az utóbbit a rekombináz szövetspecifikus expressziója eltávolítja, a szóban forgó szövet(ek)ben lehetővé válik a transzgén kifejeződése. Hasonló módon lehetséges molekuláris 20

21 5. ábra: Kondicionális genetikai változások létrehozása egérben A. Kondicionális knock-out Az ábra részletes magyarázatát l. a szövegben. A szelekciós marker exciziójára in vitro kerül sor Cre-expressziós vektor transzfekciójával, amiben Cre gén kifejeződését az erős CMV promoter irányítja. A csillaggal jelölt, a gén működéséhez nélkülözhetetlen exon deléciója szövetspecifikusan történik in vivo. A nestin promoter az idegszövet progenitor sejtjeiben fejeződik ki, ezért ebben az esetben a gén az idegszövetben inaktiválódik. Más szövetspecifikus promotereket tartalmazó Cre egértörzsekkel a legkülönfélébb szövetekben érhető el a gén működésének kiesése. A háromszög loxp (vagy FRT) felismerési helyet jelöl. Az egyéb rövidítések értelmezését l. a 2. ábrán. Genom DNS * Target vektor * neo tk Megváltoztatott gén * neo Kondicionális allél CMV Cre * Null allél Nestin Cre 21

22 B. Transzgén szövetspecifikus overexpressziója Az erős és konstitutív CMV promoter jelenléte ellenére alapállapotban a gén által kódolt fehérje nem termelődik, mivel a három példányban jelenlevő poliadenilációs jel (3xpA) leállítja az mrns szintézisét. A nestin gént expresszáló sejtekben Cre rekombináz termelődik, ez eltávolítja a loxp helyekkel közrefogott poliadenilációs jeleket. A géntermék képződése e sejtekben és utódsejtjeikben (a nestin esetében az idegszövetben) megindul. CMV 3xpA Gén pa Szövetspecifikus excizió Nestin Cre CMV Gén pa kapcsoló beépítése is az egér genomjába, mely a rekombináz hatására egyik gén kifejeződésről a másikéra kapcsol át (47). A jelenleg használt kondicionális rendszerek két fő problémáját a nemkívánatos rekombináz-expresszió és a genomiális integrációval kapcsolatos nehézségek jelentik. Ezeket elemezzük az alábbiakban A kondicionális transzgénes rendszerek korlátai 22

Ph.D. Tézis. Új módszerek a transzgénes egér technológiában. Dr Bélteki Gusztáv

Ph.D. Tézis. Új módszerek a transzgénes egér technológiában. Dr Bélteki Gusztáv Ph.D. Tézis Új módszerek a transzgénes egér technológiában Dr Bélteki Gusztáv Semmelweis Egyetem Doktori Iskola Tudományági Doktori Iskola: 7. Molekuláris Orvostudományok Program: 7/4. Témavezető: Prof.

Részletesebben

Transzgénikus állatok előállítása

Transzgénikus állatok előállítása Transzgénikus állatok előállítása A biotechnológia alapjai Pomázi Andrea Mezőgazdasági biotechnológia A gazdasági állatok és növények nemesítése új biotechnológiai eljárások felhasználásával. Cél: jobb

Részletesebben

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia

Fehérje expressziós rendszerek. Gyógyszerészi Biotechnológia Fehérje expressziós rendszerek Gyógyszerészi Biotechnológia Expressziós rendszerek Cél: rekombináns fehérjék előállítása nagy tisztaságban és nagy mennyiségben kísérleti ill. gyakorlati (therapia) felhasználásokra

Részletesebben

Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása.

Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása. Növények klónozása Klónozás Klónozás: tökéletesen egyforma szervezetek csoportjának előállítása, vagyis több genetikailag azonos egyed létrehozása. Görög szó: klon, jelentése: gally, hajtás, vessző. Ami

Részletesebben

A kromoszómák kialakulása előtt a DNS állomány megkettőződik. A két azonos információ tartalmú DNS egymás mellé rendeződik és egy kromoszómát alkot.

A kromoszómák kialakulása előtt a DNS állomány megkettőződik. A két azonos információ tartalmú DNS egymás mellé rendeződik és egy kromoszómát alkot. Kromoszómák, Gének A kromoszóma egy hosszú DNS szakasz, amely a sejt életének bizonyos szakaszában (a sejtosztódás előkészítéseként) tömörödik, így fénymikroszkóppal láthatóvá válik. A kromoszómák két

Részletesebben

A preventív vakcináció lényege :

A preventív vakcináció lényege : Vakcináció Célja: antigénspecifkus immunválasz kiváltása a szervezetben A vakcina egy olyan készítmény, amely fokozza az immunitást egy adott betegséggel szemben (aktiválja az immunrendszert). A preventív

Részletesebben

Mit tud a genetika. Génterápiás lehetőségek MPS-ben. Dr. Varga Norbert

Mit tud a genetika. Génterápiás lehetőségek MPS-ben. Dr. Varga Norbert Mit tud a genetika Génterápiás lehetőségek MPS-ben Dr. Varga Norbert Oki terápia Terápiás lehetőségek MPS-ben A kiváltó okot gyógyítja meg ERT Enzimpótló kezelés Őssejt transzplantáció Genetikai beavatkozások

Részletesebben

Transzgenikus technikák a neurobiológiában. általános fogalmak

Transzgenikus technikák a neurobiológiában. általános fogalmak Transzgenikus technikák a neurobiológiában általános fogalmak Némi történeti áttekintés 1865. Mendel genetikai törvényei fajta-nemesítés már korábban is! 1940 s- kémiai (ethyl methanesulfonate, methyl

Részletesebben

Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL

Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL KÖZÖS STRATÉGIA KIFEJLESZTÉSE MOLEKULÁRIS MÓDSZEREK ALKALMAZÁSÁVAL

Részletesebben

I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.

Részletesebben

A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése. Kiss Erzsébet Kovács László

A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése. Kiss Erzsébet Kovács László A szamóca érése során izolált Spiral és Spermidin-szintáz gén jellemzése Kiss Erzsébet Kovács László Bevezetés Nagy gazdasági gi jelentıségük k miatt a gyümölcs lcsök, termések fejlıdésének mechanizmusát

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

A replikáció mechanizmusa

A replikáció mechanizmusa Az öröklődés molekuláris alapjai A DNS megkettőződése, a replikáció Szerk.: Vizkievicz András A DNS-molekula az élőlények örökítő anyaga, kódolt formában tartalmazza mindazon információkat, amelyek a sejt,

Részletesebben

Rekombináns Géntechnológia

Rekombináns Géntechnológia Rekombináns Géntechnológia Tartalom: 1 1. Biotechnológia, géntechnológia, társadalom 2. Genetikai rekombináció 3. Génbevitel tenyésztett sejtekbe 4. Genetikailag módosított szervezetek (GMO-k) 4a. Transzgénikus

Részletesebben

Epigenetikai Szabályozás

Epigenetikai Szabályozás Epigenetikai Szabályozás Kromatin alapegysége a nukleoszóma 1. DNS Linker DNS Nukleoszóma mag H1 DNS 10 nm 30 nm Nukleoszóma gyöngy (4x2 hiszton molekula + 146 nukleotid pár) 10 nm-es szál 30 nm-es szál

Részletesebben

Molekuláris terápiák

Molekuláris terápiák Molekuláris terápiák Aradi, János Balajthy, Zoltán Csősz, Éva Scholtz, Beáta Szatmári, István Tőzsér, József Varga, Tamás Szerkesztette Balajthy, Zoltán és Tőzsér, József, Debreceni Egyetem Molekuláris

Részletesebben

A növény inváziójában szerepet játszó bakteriális gének

A növény inváziójában szerepet játszó bakteriális gének A növény inváziójában szerepet játszó bakteriális gének merisztéma korai szimbiotikus zóna késői szimbiotikus zóna öregedési zóna gyökér keresztmetszet NODULÁCIÓ növényi jel Rhizobium meliloti rhizobium

Részletesebben

A géntechnológia genetikai alapjai (I./3.)

A géntechnológia genetikai alapjai (I./3.) Az I./2. rész (Gének és funkciójuk) rövid összefoglalója A gének a DNS információt hordozó szakaszai, melyekben a 4 betű (ATCG) néhány ezerszer, vagy százezerszer ismétlődik. A gének önálló programcsomagként

Részletesebben

Sejtek - őssejtek dióhéjban. 2014. február. Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest

Sejtek - őssejtek dióhéjban. 2014. február. Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest Sejtek - őssejtek dióhéjban 2014. február Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest A legtöbb sejtünk osztódik, differenciálódik, elpusztul... vérsejtek Vannak

Részletesebben

Transzgénikus. nikus állatok. Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk bejuttatott DNS-t t tartalmaz.

Transzgénikus. nikus állatok. Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk bejuttatott DNS-t t tartalmaz. Transzgénikus nikus állatok Transzgénikus nikus minden olyan állat, melynek genomja emberi közremk zremüködéssel bejuttatott DNS-t t tartalmaz. I. A KONKRÉT T GÉNSEBG NSEBÉSZETI SZETI TECHNIKA A beavatkozást

Részletesebben

Génszerkezet és génfunkció

Génszerkezet és génfunkció Általános és Orvosi Genetika jegyzet 4. fejezetének bővítése a bakteriális genetikával 4. fejezet Génszerkezet és génfunkció 1/ Bakteriális genetika Nem szükséges külön hangsúlyoznunk a baktériumok és

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

5. Molekuláris biológiai technikák

5. Molekuláris biológiai technikák 5. Molekuláris biológiai technikák DNS szaporítás kémcsőben és élőben. Klónozás, PCR, cdna, RT-PCR, realtime-rt-pcr, Northern-, Southernblotting, génexpresszió, FISH 5. Molekuláris szintű biológiai technikák

Részletesebben

A BIOTECHNOLÓGIA ALKALMAZÁSI LEHETŐSÉGEI A GYÓGYSZERKUTATÁSBAN

A BIOTECHNOLÓGIA ALKALMAZÁSI LEHETŐSÉGEI A GYÓGYSZERKUTATÁSBAN Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 A BIOTECHNOLÓGIA

Részletesebben

A C. elegans TRA-1/GLI/Ci szex-determinációs faktor célgénjeinek meghatározása és analízise. Doktori értekezés tézisei.

A C. elegans TRA-1/GLI/Ci szex-determinációs faktor célgénjeinek meghatározása és analízise. Doktori értekezés tézisei. A C. elegans TRA-1/GLI/Ci szex-determinációs faktor célgénjeinek meghatározása és analízise Doktori értekezés tézisei Hargitai Balázs Eötvös Loránd Tudományegyetem Természettudományi Kar Biológia Doktori

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik.

MUTÁCIÓK. A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. MUTÁCIÓK A mutáció az örökítő anyag spontán, maradandó megváltozása, amelynek során új genetikai tulajdonság keletkezik. Pontmutáció: A kromoszóma egy génjében pár nukleotidnál következik be változás.

Részletesebben

TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL

TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL TRIPSZIN TISZTÍTÁSA AFFINITÁS KROMATOGRÁFIA SEGÍTSÉGÉVEL Az egyes biomolekulák izolálása kulcsfontosságú a biológiai szerepük tisztázásához. Az affinitás kromatográfia egyszerűsége, reprodukálhatósága

Részletesebben

A TATA-kötő fehérje asszociált faktor 3 (TAF3) p53-mal való kölcsönhatásának funkcionális vizsgálata

A TATA-kötő fehérje asszociált faktor 3 (TAF3) p53-mal való kölcsönhatásának funkcionális vizsgálata Ph.D. ÉRTEKEZÉS TÉZISEI A TATA-kötő fehérje asszociált faktor 3 (TAF3) p53-mal való kölcsönhatásának funkcionális vizsgálata Buzás-Bereczki Orsolya Témavezetők: Dr. Bálint Éva Dr. Boros Imre Miklós Biológia

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

Poligénes v. kantitatív öröklődés

Poligénes v. kantitatív öröklődés 1. Öröklődés komplexebb sajátosságai 2. Öröklődés molekuláris alapja Poligénes v. kantitatív öröklődés Azok a tulajdonságokat amelyek mértékegységgel nem, vagy csak nehezen mérhetők, kialakulásuk kevéssé

Részletesebben

Az adenovírusok morfológiája I.

Az adenovírusok morfológiája I. Adenovírusok A vírusok Elnevezésük a latin virus szóból ered, amelynek jelentése méreg. A vírusok a legkisebb ismert entitások. Csak elektronmikroszkóppal tanulmányozhatóak, mert méretük 20-400 nanométerig

Részletesebben

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk.

A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A génterápia genetikai anyag bejuttatatása diszfunkcionálisan működő sejtekbe abból a célból, hogy a hibát kijavítsuk. A genetikai betegségek mellett, génterápia alkalmazható szerzett betegségek, mint

Részletesebben

Az Ig génátrendeződés

Az Ig génátrendeződés Az Ig génátrendeződés Háromféle változás játszódik le a molekula szerkezetét tekintve: B sejtek fejlődése alatt: VDJ átrendeződés (rekombináció) IgH izotípusváltás rekombináció (CSR) Szomatikus hipermutáció

Részletesebben

7. A b-galaktozidáz indukciója Escherichia coliban

7. A b-galaktozidáz indukciója Escherichia coliban 7. A b-galaktozidáz INDUKCIÓJA ESCHERICHIA COLIBAN 7. A b-galaktozidáz indukciója Escherichia coliban dr. Bauer Pál 7.1. Az enzimindukció jelensége Az élõlények valamennyi génjének állandó és folyamatos

Részletesebben

A biotechnológia alapjai A biotechnológia régen és ma. Pomázi Andrea

A biotechnológia alapjai A biotechnológia régen és ma. Pomázi Andrea A biotechnológia alapjai A biotechnológia régen és ma Pomázi Andrea A biotechnológia fogalma Alkalmazott biológia A fogalom állandó változásban van A biológia és a biotechnológia közötti különbség a méretekben

Részletesebben

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!!

12/4/2014. Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció. 1952 Hershey & Chase 1953!!! Genetika 7-8 ea. DNS szerkezete, replikáció és a rekombináció 1859 1865 1869 1952 Hershey & Chase 1953!!! 1879 1903 1951 1950 1944 1928 1911 1 1. DNS szerkezete Mi az örökítő anyag? Friedrich Miescher

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

MODELLORGANIZMUSOK GENETIKÁJA. Drosophila melanogaster, muslica (borlégy)

MODELLORGANIZMUSOK GENETIKÁJA. Drosophila melanogaster, muslica (borlégy) MODELLORGANIZMUSOK GENETIKÁJA Drosophila melanogaster, muslica (borlégy) Thomas Hunt Morgan, légyszoba, X kromoszómához kapcsolt szemszín öröklődés, Alfred Sturtevant genetikai térképezés Calvin Bridges,

Részletesebben

Génátvitel magasabb rendű állatokba elméleti megfontolások, gyakorlati eredmények és génterápiás lehetőségek

Génátvitel magasabb rendű állatokba elméleti megfontolások, gyakorlati eredmények és génterápiás lehetőségek MEZÕGAZDASÁGI BIOTECHNOLÓGIÁK Génátvitel magasabb rendű állatokba elméleti megfontolások, gyakorlati eredmények és génterápiás lehetőségek Tárgyszavak: génátvitel; transzfekció; transzgenézis; génterápia;

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

A Hardy-Weinberg egyensúly. 2. gyakorlat

A Hardy-Weinberg egyensúly. 2. gyakorlat A Hardy-Weinberg egyensúly 2. gyakorlat A Hardy-Weinberg egyensúly feltételei: nincs szelekció nincs migráció nagy populációméret (nincs sodródás) nincs mutáció pánmixis van allélgyakoriság azonos hímekben

Részletesebben

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Szalma Katalin Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Témavezető: Dr. Turai István, OSSKI Budapest, 2010. október 4. Az ionizáló sugárzás sejt kölcsönhatása Antone

Részletesebben

Az ember összes kromoszómája 23 párt alkot. A 23. pár határozza meg a nemünket. Ha 2 db X kromoszómánk van ezen a helyen, akkor nők, ha 1db X és 1db

Az ember összes kromoszómája 23 párt alkot. A 23. pár határozza meg a nemünket. Ha 2 db X kromoszómánk van ezen a helyen, akkor nők, ha 1db X és 1db Testünk minden sejtjében megtalálhatók a kromoszómák, melyek a tulajdonságok átörökítését végzik. A testi sejtekben 2 x 23 = 46 db kromoszóma van. Az egyik sorozat apánktól, a másik anyánktól származik.

Részletesebben

Tudománytörténeti visszatekintés

Tudománytörténeti visszatekintés GENETIKA I. AZ ÖRÖKLŐDÉS TÖRVÉNYSZERŰSÉGEI Minek köszönhető a biológiai sokféleség? Hogyan történik a tulajdonságok átörökítése? Tudománytörténeti visszatekintés 1. Keveredés alapú öröklődés: (1761-1766,

Részletesebben

Az ABCG2 multidrog transzporter fehérje szerkezetének és működésének vizsgálata

Az ABCG2 multidrog transzporter fehérje szerkezetének és működésének vizsgálata Az ABCG2 multidrog transzporter fehérje szerkezetének és működésének Kutatási előzmények Az ABC transzporter membránfehérjék az ATP elhasítása (ATPáz aktivitás) révén nyerik az energiát az általuk végzett

Részletesebben

5.2.5. ÁLLATGYÓGYÁSZATI IMMUNOLÓGIAI GYÓGYSZEREK ELŐÁLLÍTÁSÁRA SZÁNT ÁLLATI EREDETŰ ANYAGOK

5.2.5. ÁLLATGYÓGYÁSZATI IMMUNOLÓGIAI GYÓGYSZEREK ELŐÁLLÍTÁSÁRA SZÁNT ÁLLATI EREDETŰ ANYAGOK 1 5.2.5. ÁLLATGYÓGYÁSZATI IMMUNOLÓGIAI GYÓGYSZEREK ELŐÁLLÍTÁSÁRA SZÁNT ÁLLATI EREDETŰ ANYAGOK 07/2009:50205 javított 6.5 1. ALKALMAZÁSI TERÜLET Az állatgyógyászati célra szánt immunológiai gyógyszerek

Részletesebben

Biológiai biztonság: Veszély: - közvetlen - közvetett

Biológiai biztonság: Veszély: - közvetlen - közvetett Biológiai biztonság Biológiai biztonság: Minden biológiai anyag potenciálisan kórokozó és szennyező; a biológiai biztonság ezen biológiai anyagok hatásaira (toxikus hatások, fertőzések) koncentrál és célja

Részletesebben

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA

BIOLÓGIA HÁZIVERSENY 1. FORDULÓ BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA BIOKÉMIA, GENETIKA 1. Nukleinsavak keresztrejtvény (12+1 p) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 1. A nukleinsavak a.-ok összekapcsolódásával kialakuló polimerek. 2. Purinvázas szerves bázis, amely az

Részletesebben

DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer

Részletesebben

Mint emlős, az ember genetikai modelljeként is szolgál. Genomja, génjeinek elrendeződése, szabályozása sok hasonlóságot mutat az emberével.

Mint emlős, az ember genetikai modelljeként is szolgál. Genomja, génjeinek elrendeződése, szabályozása sok hasonlóságot mutat az emberével. A HÁZIEGÉR (Mus musculus) Mendel és újra felfedezői (Correns, Tschermak, de Vries) mind növényeken kísérleteztek. Sokan megkérdőjelezték, hogy az állatoknál és az embernél is hasonló öröklődési szabályok

Részletesebben

Az omnipotens kutatónak, Dr. Apáti Ágotának ajánlva, egy hálás ex-őssejtje

Az omnipotens kutatónak, Dr. Apáti Ágotának ajánlva, egy hálás ex-őssejtje 1 Az omnipotens kutatónak, Dr. Apáti Ágotának ajánlva, egy hálás ex-őssejtje Írta és rajzolta: Hargitai Zsófia Ágota Munkában részt vett: Dr. Sarkadi Balázs, Dr. Apáti Ágota A szerkesztésben való segítségért

Részletesebben

Egy Polycomb Response Element (PRE) in situ vizsgálata Drosophila melanogaster-ben génkonverzió segítségével. Kozma Gabriella

Egy Polycomb Response Element (PRE) in situ vizsgálata Drosophila melanogaster-ben génkonverzió segítségével. Kozma Gabriella Egy Polycomb Response Element (PRE) in situ vizsgálata Drosophila melanogaster-ben génkonverzió segítségével Kozma Gabriella Ph.D. tézisek Témavezető: Dr. Sipos László Genetikai Intézet MTA Szegedi Biológiai

Részletesebben

Immunológia I. 2. előadás. Kacskovics Imre (imre.kacskovics@ttk.elte.hu)

Immunológia I. 2. előadás. Kacskovics Imre (imre.kacskovics@ttk.elte.hu) Immunológia I. 2. előadás Kacskovics Imre (imre.kacskovics@ttk.elte.hu) Az immunválasz kialakulása A veleszületett és az adaptív immunválasz összefonódása A veleszületett immunválasz mechanizmusai A veleszületett

Részletesebben

Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes.

Hátterükben egyetlen gén áll, melynek általában számottevő a viselkedésre gyakorolt hatása, öröklési mintázata jellegzetes. Múlt órán: Lehetséges tesztfeladatok: Kitől származik a variáció-szelekció paradigma, mely szerint az egyéni, javarészt öröklött különbségek között a társadalmi harc válogat? Fromm-Reichmann Mill Gallton

Részletesebben

Kutatási beszámoló ( )

Kutatási beszámoló ( ) Kutatási beszámoló (2008-2012) A thrombocyták aktivációja alapvető jelentőségű a thrombotikus betegségek kialakulása szempontjából. A pályázat során ezen aktivációs folyamatok mechanizmusait vizsgáltuk.

Részletesebben

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013

Szelekció. Szelekció. A szelekció típusai. Az allélgyakoriságok változása 3/4/2013 Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz Szelekció Ok: több egyed születik, mint amennyi túlél és szaporodni képes a sikeresség mérése: fitnesz

Részletesebben

Kereskedelmi forgalomban lévő rekombináns gyógyszerkészítmények

Kereskedelmi forgalomban lévő rekombináns gyógyszerkészítmények Kereskedelmi forgalomban lévő rekombináns gyógyszerkészítmények Írta: Barta Zsolt Biomérnök hallgató 2007 Tartalomjegyzék 1 Rekombináns inzulin [1]... 3 2 A humán növekedési hormon rekombináns módon történő

Részletesebben

4. A humorális immunválasz október 12.

4. A humorális immunválasz október 12. 4. A humorális immunválasz 2016. október 12. A klónszelekciós elmélet sarokpontjai: Monospecifictás: 1 sejt 1-féle specificitású receptor Az antigén receptorhoz kötődése aktiválja a limfocitát A keletkező

Részletesebben

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.)

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.) Genomika Új korszak, paradigmaváltás, forradalom: a teljes genomok ismeretében a biológia adatokban gazdag tudománnyá válik. Új kutatási módszerek, új szemlélet. Hajtóerõk: Genomszekvenálási projektek

Részletesebben

Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata

Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata Dr. Nemes Karolina, Márk Ágnes, Dr. Hajdu Melinda, Csorba Gézáné, Dr. Kopper László, Dr. Csóka Monika, Dr.

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

Példák a független öröklődésre

Példák a független öröklődésre GENETIKAI PROBLÉMÁK Példák a független öröklődésre Az amelogenesis imperfecta egy, a fogzománc gyengeségével és elszíneződésével járó öröklődő betegség, a 4-es kromoszómán lévő enam gén recesszív mutációja

Részletesebben

Evolúcióelmélet és az evolúció mechanizmusai

Evolúcióelmélet és az evolúció mechanizmusai Evolúcióelmélet és az evolúció mechanizmusai Az élet Darwini szemlélete Melyek az evolúció bizonyítékai a világban? EVOLÚCIÓ: VÁLTOZATOSSÁG Mutáció Horizontális géntranszfer Genetikai rekombináció Rekombináció

Részletesebben

NANOTECHNOLOGIA 6. előadás

NANOTECHNOLOGIA 6. előadás NANOTECHNOLOGIA 6. előadás A plazmid: Ha meg akarjuk ismerni egy fehérje működését, akkor sokat kell belőle előállítanunk. Ezt akár úgy is megtehetjük, hogy a kívánt géndarabot egy baktérumba ültetjük

Részletesebben

DNS replikáció. DNS RNS Polipeptid Amino terminus. Karboxi terminus. Templát szál

DNS replikáció. DNS RNS Polipeptid Amino terminus. Karboxi terminus. Templát szál DNS replikáció DNS RNS Polipeptid Amino terminus Templát szál Karboxi terminus Szuper-csavarodott prokarióta cirkuláris DNS Hisztonok komplexe DNS hisztonokra történő felcsvarodása Hiszton-kötött negatív

Részletesebben

Domináns-recesszív öröklődésmenet

Domináns-recesszív öröklődésmenet Domináns-recesszív öröklődésmenet Domináns recesszív öröklődés esetén tehát a homozigóta domináns és a heterozigóta egyedek fenotípusa megegyezik, így a három lehetséges genotípushoz (példánkban AA, Aa,

Részletesebben

Téma 2: Genetikai alapelvek, a monogénes öröklődés -hez szakirodalom: (Plomin: Viselekedésgenetika 2. fejezet) *

Téma 2: Genetikai alapelvek, a monogénes öröklődés -hez szakirodalom: (Plomin: Viselekedésgenetika 2. fejezet) * Téma 2: Genetikai alapelvek, a monogénes öröklődés -hez szakirodalom: (Plomin: Viselekedésgenetika 2. fejezet) * A mendeli öröklődés törvényei A Huntington-kór (HD) kezdetét személyiségbeli változások,

Részletesebben

Prof. Dr. Szabad János Tantárgyfelelős beosztása

Prof. Dr. Szabad János Tantárgyfelelős beosztása Tantárgy neve Genetika Tantárgy kódja BIB 1506 Meghírdetés féléve 5 Kreditpont 4 Összóraszám (elmélet + gyakorlat) 3+0 Számonkérés módja Kollokvium Előfeltétel (tantárgyi kód) BIB 1411 Tantárgyfelelős

Részletesebben

Génmódosítás: bioszféra

Génmódosítás: bioszféra bioszféra Génmódosítás: Nagy butaság volt politikusaink részérôl az alaptalan GMO-ellenesség alaptörvényben való rögzítése. A témával foglalkozó akadémikusok véleménye külföldön és Magyarországon egészen

Részletesebben

Silhavy Dániel. A növényi génexpresszió RNS-szintű minőségbiztosítási rendszereinek molekuláris biológiája. című Doktori Értekezésének bírálata.

Silhavy Dániel. A növényi génexpresszió RNS-szintű minőségbiztosítási rendszereinek molekuláris biológiája. című Doktori Értekezésének bírálata. Silhavy Dániel A növényi génexpresszió RNS-szintű minőségbiztosítási rendszereinek molekuláris biológiája című Doktori Értekezésének bírálata. Bíráló: Dr. Szabados László, MTA doktora MTA Szegedi Biológiai

Részletesebben

Transzgénikus növények előállítása

Transzgénikus növények előállítása Transzgénikus növények előállítása Növényi biotechnológia Területei: A növények szaporításának új módszerei Növényi sejt és szövettenyészetek alkalmazása Mikroszaporítás Vírusmentes szaporítóanyag előállítása

Részletesebben

Receptorok és szignalizációs mechanizmusok

Receptorok és szignalizációs mechanizmusok Molekuláris sejtbiológia: Receptorok és szignalizációs mechanizmusok Dr. habil Kőhidai László Semmelweis Egyetem Genetikai, Sejt- és Immunbiológiai Intézet Sejtek szignalizációs kapcsolatai Sejtek szignalizációs

Részletesebben

Egy új, a szimbiotikus gümőfejlődésben szerepet játszó ubiquitin ligáz funkcionális jellemzése

Egy új, a szimbiotikus gümőfejlődésben szerepet játszó ubiquitin ligáz funkcionális jellemzése Zárójelentés 76843 sz. pályázat 2009 2012 Egy új, a szimbiotikus gümőfejlődésben szerepet játszó ubiquitin ligáz funkcionális jellemzése A tervezett munka a kutatócsoportunkban korábban genetikai térképezésen

Részletesebben

A BIZOTTSÁG 2009/120/EK IRÁNYELVE

A BIZOTTSÁG 2009/120/EK IRÁNYELVE 2009.9.15. Az Európai Unió Hivatalos Lapja L 242/3 IRÁNYELVEK A BIZOTTSÁG 2009/120/EK IRÁNYELVE (2009. szeptember 14.) a fejlett terápiás gyógyszerkészítmények tekintetében az emberi felhasználásra szánt

Részletesebben

ADATBÁNYÁSZAT I. ÉS OMICS

ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT

Részletesebben

TRANSZGENIKUS NYÚL ELŐÁLLITÁSA HUMÁN BETEGSÉGMODELL CÉLJÁBÓL BŐSZE ZSUZSANNA 2013

TRANSZGENIKUS NYÚL ELŐÁLLITÁSA HUMÁN BETEGSÉGMODELL CÉLJÁBÓL BŐSZE ZSUZSANNA 2013 TRANSZGENIKUS NYÚL ELŐÁLLITÁSA HUMÁN BETEGSÉGMODELL CÉLJÁBÓL BŐSZE ZSUZSANNA 2013 Transzgenikus nyúl előállítása mikroinjektálással Donorok 6x FSH vagy 1xPMSG HCG+ 2x termékenyít Recipiensek HCG vagy GnRh

Részletesebben

Transzgénikus növények alkalmazása a funkcionális genomikai kutatásokban

Transzgénikus növények alkalmazása a funkcionális genomikai kutatásokban Transzgénikus növények alkalmazása a funkcionális genomikai kutatásokban MTA Agrártudományi Kutatóközpont Növényi Sejtbiológia Osztály Gyakorlatban alkalmazható transzgénikus növények létrehozásának alapfeltétele:

Részletesebben

Két kevéssé ismert humán ABCG fehérje expressziója és funkcionális vizsgálata: ABCG1 és ABCG4 jellemzése

Két kevéssé ismert humán ABCG fehérje expressziója és funkcionális vizsgálata: ABCG1 és ABCG4 jellemzése Két kevéssé ismert humán ABCG fehérje expressziója és funkcionális vizsgálata: ABCG1 és ABCG4 jellemzése Doktori tézisek Dr. Cserepes Judit Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola

Részletesebben

Bakteriális identifikáció 16S rrns gén szekvencia alapján

Bakteriális identifikáció 16S rrns gén szekvencia alapján Bakteriális identifikáció 16S rrns gén szekvencia alapján MOHR ANITA SIPOS RITA, SZÁNTÓ-EGÉSZ RÉKA, MICSINAI ADRIENN 2100 Gödöllő, Szent-Györgyi Albert út 4. info@biomi.hu, www.biomi.hu TÖRZS AZONOSÍTÁS

Részletesebben

Natív antigének felismerése. B sejt receptorok, immunglobulinok

Natív antigének felismerése. B sejt receptorok, immunglobulinok Natív antigének felismerése B sejt receptorok, immunglobulinok B és T sejt receptorok A B és T sejt receptorok is az immunglobulin fehérje család tagjai A TCR nem ismeri fel az antigéneket, kizárólag az

Részletesebben

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan

3. Általános egészségügyi ismeretek az egyes témákhoz kapcsolódóan 11. évfolyam BIOLÓGIA 1. Az emberi test szabályozása Idegi szabályozás Hormonális szabályozás 2. Az érzékelés Szaglás, tapintás, látás, íz érzéklés, 3. Általános egészségügyi ismeretek az egyes témákhoz

Részletesebben

Evolúció. Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet

Evolúció. Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet Evolúció Dr. Szemethy László egyetemi docens Szent István Egyetem VadVilág Megőrzési Intézet Mi az evolúció? Egy folyamat: az élőlények tulajdonságainak változása a környezethez való alkalmazkodásra Egy

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi

Részletesebben

KOAGULÁCIÓS FAKTOROK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA

KOAGULÁCIÓS FAKTOROK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 KOAGULÁCIÓS FAKTOROK

Részletesebben

Genetikai modell állatok és transzgénia - genomikai megközelítések

Genetikai modell állatok és transzgénia - genomikai megközelítések Genetikai modell állatok és transzgénia - genomikai megközelítések Vellai Tibor (vellai@falco.elte.hu) Eötvös Loránd Tudományegyetem Genetikai Tanszék 2012.10.18 GENETIKA A jelen biológiai kutatások integráló

Részletesebben

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 NÖVÉNYÉLETTAN Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Sejtfal szintézis és megnyúlás Környezeti tényezők hatása a növények növekedésére és fejlődésére Előadás áttekintése

Részletesebben

Új terápiás lehetőségek (receptorok) a kardiológiában

Új terápiás lehetőségek (receptorok) a kardiológiában Új terápiás lehetőségek (receptorok) a kardiológiában Édes István Kardiológiai Intézet, Debreceni Egyetem Kardiomiociták Ca 2+ anyagcseréje és új terápiás receptorok 2. 1. 3. 6. 6. 7. 4. 5. 8. 9. Ca

Részletesebben

Génkifejeződési vizsgálatok. Kocsy Gábor

Génkifejeződési vizsgálatok. Kocsy Gábor Génkifejeződési vizsgálatok MTA Mezőgazdasági Kutatóintézete Növényi Molekuláris Biológia Osztály A génkifejeződés A sejtmag géneket tartalmaz; (fehérjéket, RNSeket kódoló); A gének átíródnak mrns; Pre-mRNS

Részletesebben

ENZIMEK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA

ENZIMEK BIOTECHNOLÓGIAI ELŐÁLLÍTÁSA Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ENZIMEK BIOTECHNOLÓGIAI

Részletesebben

INCZÉDY GYÖRGY SZAKKÖZÉPISKOLA, SZAKISKOLA ÉS KOLLÉGIUM

INCZÉDY GYÖRGY SZAKKÖZÉPISKOLA, SZAKISKOLA ÉS KOLLÉGIUM INCZÉDY GYÖRGY SZAKKÖZÉPISKOLA, SZAKISKOLA ÉS KOLLÉGIUM Szakközépiskola Tesztlapok Biológia - egészségtan tantárgy 12. évfolyam Készítette: Perinecz Anasztázia Név: Osztály: 1. témakör: Az élet kódja.

Részletesebben

Immunológia I. 4. előadás. Kacskovics Imre

Immunológia I. 4. előadás. Kacskovics Imre Immunológia I. 4. előadás Kacskovics Imre (imre.kacskovics@ttk.elte.hu) 3.1. ábra A vérsejtek képződésének helyszínei az élet folyamán 3.2. ábra A hemopoetikus őssejt aszimmetrikus osztódása 3.3. ábra

Részletesebben

Immunológia alapjai előadás MHC. szerkezete és genetikája, és az immunológiai felismerésben játszott szerepe. Antigén bemutatás.

Immunológia alapjai előadás MHC. szerkezete és genetikája, és az immunológiai felismerésben játszott szerepe. Antigén bemutatás. Immunológia alapjai 5-6. előadás MHC szerkezete és genetikája, és az immunológiai felismerésben játszott szerepe. Antigén bemutatás. Antigén felismerés Az ellenanyagok és a B sejt receptorok natív formában

Részletesebben

Irányított DNS Transzpozíció Humán Sejtekben

Irányított DNS Transzpozíció Humán Sejtekben SZENT ISTVÁN EGYETEM Irányított DNS Transzpozíció Humán Sejtekben Doktori értekezés tézisei Dr. Ivics Zoltán Gödöllô 2008 1 A doktori iskola megnevezése: Biológia Tudományi Doktori Iskola tudományága:

Részletesebben

A Globális regulátor mutációknak mint az attenuálás lehetőségének vizsgálata Escherichia coli-ban

A Globális regulátor mutációknak mint az attenuálás lehetőségének vizsgálata Escherichia coli-ban A Globális regulátor mutációknak mint az attenuálás lehetőségének vizsgálata Escherichia coli-ban című támogatott kutatás fő célja az volt, hogy olyan regulációs mechanizmusoknak a virulenciára kifejtett

Részletesebben

10. Genomika 2. Microarrayek és típusaik

10. Genomika 2. Microarrayek és típusaik 10. Genomika 2. 1. Microarray technikák és bioinformatikai vonatkozásaik Microarrayek és típusaik Korrelált génexpresszió mint a funkcionális genomika eszköze 2. Kombinált megközelítés a funkcionális genomikában

Részletesebben

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal

Intelligens Rendszerek Elmélete. Párhuzamos keresés genetikus algoritmusokkal Intelligens Rendszerek Elmélete Dr. Kutor László Párhuzamos keresés genetikus algoritmusokkal http://mobil.nik.bmf.hu/tantargyak/ire.html login: ire jelszó: IRE0 IRE / A természet általános kereső algoritmusa:

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

AZ EMBERI MIKROBIOM: AZ EGYÉN, MINT SAJÁTOS ÉLETKÖZÖSSÉG Duda Ernő

AZ EMBERI MIKROBIOM: AZ EGYÉN, MINT SAJÁTOS ÉLETKÖZÖSSÉG Duda Ernő AZ EMBERI MIKROBIOM: AZ EGYÉN, MINT SAJÁTOS ÉLETKÖZÖSSÉG Duda Ernő Az NIH, az Egyesült Államok Nemzeti Egészségügyi Hivatala (az orvosi- és biológiai kutatásokat koordináló egyik intézmény) 2007 végén

Részletesebben

Antibiotikumok I. Selman Abraham Waksman 1888-1973

Antibiotikumok I. Selman Abraham Waksman 1888-1973 Antibiotikumok I. Az antibiotikumok az élő szervezetek elsősorban mikroorganizmusok által termelt úgynevezett másodlagos anyagcseretermékek (szekunder metabolitok) legfontosabb csoportja. Ökológiai szerepük,

Részletesebben