Klinikai Genomikai és Személyre Szabott Orvoslási Központ. Tudományos Hétf!

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Klinikai Genomikai és Személyre Szabott Orvoslási Központ. Tudományos Hétf!"

Átírás

1 Klinikai Genomikai és Személyre Szabott Orvoslási Központ 2012 Tudományos Hétf!

2 Biomarker azonosítás feltételei: eszközök, készségek és kollaboráció Minták, Vizsgálatok, Beteg adatok Klinikus + bioinfo Diagnosztikai kiválóság Klinikus Sikeres biomarker program Minta vizsgálati eszközök Mol biol labor Információs kincs Molekuláris biológiai jártasság Klinikus+mol biol

3 Biomarkerek használatával Betegbiztonság növekszik Toxicitási Biomarkerek Beteg specifikus Biomarkerek PHC Hatékonysági Biomarkerek Betegség specifikus Biomarkerek Kezelés hatékonyság növekszik

4 Mi az epigenetika? epi- [!"#] túl, fölött, mellett gennó [$!%%&], nemzeni, életet adni

5 Mi az epigenetika? Tágan értelmezve: TRANSZKRIPCIÓ SZABÁLYOZÁS DNS nukleotid sorrendjét nem befolyásoló de a génexpressziót befolyásoló tényez'k összessége Sz(ken értelmezve: ÖRÖKL)DÉS DNS bázissorrendjében nem kódolt, sejt vagy él'lény szinten örökl'd' tényez'k összessége

6 Valódi epigenetikai hatáshoz három generáció nyomonkövetése szükséges

7 Transzkripció szabályozás szintjei: kromatin szinten szabályozott a fehérjék hozzáférése a DNS-hez DNS metiláció replikáció során propagálódik Módosított hisztonvégek fehérjék kapcsolódását szabályozzák Szabályozó RNS molekulák módosíthatják a transzkripciót

8 DNS metilációs mintázat örökl'dése

9 Anyai babusgatás életen át tartó hatása DNS metiláció és hiszton módosítások változnak a babusgatás hatására és a következmények életen át tartanak. Következmény: bátrabbak és jobban tolerálják a stressz szignálokat. HDAC inhibitorral visszafordítható hatás. Nevel'anya cserével a hatás is cserél'dik tehát nem genetikai hatás.

10 Epi allélek Agouti vy Jirtle NRG 2007

11 Epi allél eltolódás diétás hatásra

12 Az epi allélek közös nevez'je a transzpozon jelenléte. A transzpozonok ellen a sejt epigenetikai csendesítéssel védekezik. Az epigenetika módosítások szétterjednek nagy genomi szakaszokon, ezáltal csendesítik a beekel'dött szakaszokat, pl. transzpozonokat.

13 Transzpozonok és DNS metiláció Fred Gage (Salk Institute): 1. A genom 20% L1 (LINE1) traszpozonból áll 2. A neuronális differenciáció els' fázisában az L1 transzpozonok rövid ideig aktiválódnak 3. Az L1 aktivitás összefügg a neuroplaszticitással (hipokampuszban 8x nagyobb marad) 4. A DNS metiláció a MECP2 Metil DNS köt' fehérjén keresztül csendesíti a transzpozonokat a HDAC1 és SOX2 komplex segítségével. RETT szindrómában nem m(ködik a DNS metiláció függ' gátlás: 1. Általános neuronális differenciációs zavar születés utáni években. 2. Emelkedett L1 transzpozon aktivitás.

14 Terápiás szerek amelyek epigenetikai útvonalakon keresztül hatnak: DNS metiláció gátlószerek: Azacytidine és deoxyazacytidine (FDA jovahagyas Mielodiszpláziás szindrómában) HDAC inhibítorok: Vorinostat (FDA jóváhagyott T sejt limfomára) Romidepsin (FDA 2009) Valproát egyéb Biomarker térképezések: Epigenom projektek, Methylome projektek

15 HETEROKROMATIN AZACYTIDINE MBP TSA, BUTYRATE HDAC MBP H3K9 MET Pargyline Met CpG H3K9 MET HDAC MBP H3K9 MET MBP H3K9 MET MBP HP1 HP1 HP1 HP1 H3K9 METH3K9 METH3K9 MET H3K9 MET HP1 MBP MBP MBP MBP

16 A több nyelven írt genom Tripletek nyelve Kötöhelyek kódja

17 Három szintje a transzkripciós esemény vizsgálatának Genomi köt'helyek RNS profil Proteom profil

18 Hisztonvég Módosítások H3 H4 Acetyl K Methyl R Methyl K Phos. S Ubiq. K H2A C-term H H H2B H2A Turner: Cell 2002 (111)285.

19 ChIP TAQMAN Q-PCR / ABI NTC

20 Automatizált CHIP a maximális reprodukálhatóságért IP-Star Magnetic ChIP

21 Illumina HiScan SQ= 150 Giga bázis/ futás 1 humán genom/ futás 30X lefedettséggel / 48 teljes transzkriptóm RNA-Seq / 24 exom-seq minta

22 P300 binding to enhancers is detectable by monitoring H3K27 acetylation C57Bl6: MCSF+IL4 Replicate C57Bl6: MCSF+IL4 Adipo PPRE Technical Replicates of Library preparation and sequencing ChIP Seq results of technical replicates show sharp signal on the CORE PROMOTER of ap2, and a widely expanded region on the well described ENHANCER ELEMENT (adipo PPRE).

23 Citogenetika Affymetrix Rendszereken

24 Traditional Cytogenetics Traditional Cytogenetic Techniques Excellent and robust techniques Their limitations are well recognised (resolution, variability in sample preparation)

25 Microarrays revolutionizing Cytogenetics "increased resolution of microarray technology over conventional cytogenetic analysis allows for identification of chromosomal imbalances with greater precision, accuracy, and technical sensitivity. Within the last 3 years, the cytogenetics community has refined: Array design and content requirements Consensus of clinically important regions and genes Resolution requirements: " Clinical regions " Other genes " Genomic backbone The value of heterozygosity data The value of SNP genotypes

26 Classical Cytogenetics and Microarrays Whole Genome Low Res Targeted Hi Res + Dx Yield = 3% Karyotype FISH =Confirmatory Microarray-Based Cytogenetics Simpler & more reliable Standardized workflow More information per test Quicker time to result 3 days versus 7 days Quantitative vs subjective Less expensive High earning potential for labs Dx Yield = 20%

27 Guidelines are available! All CNVs detected, regarding of size shall be reported! Most relevant CNVs, regions are rich in gene content! Small unknown CNVS should be reported including all the RefSeq genes in the region " Microarrays should detect gains & losses >400kb "Desirable to have good coverage along the genome and in clinical relevant genes " SNPs are important to detect regions of homozygocity, UPD and mosaicism.

28 The targeted plus genome-wide design Schematic of genomic region Known pathological variant Gene Known pathological variant Gene Microarray marker density

29 Simple chromosome visualisation Data types Files list

30 Fejlesztéseink UPL alapú mérési rendszerek (QPCR és mirns) Nagy átereszt! képesség# új generációs szekvenálási techonlógiák (DNS metilációs és epigenetikai profilírozás) Fehérje/ antitest el!állítási szolgáltatás (Keresztessy Zsolt)

31 UPL alapú oligó tervezés mirns detektálásra Astrid Research

32 Assay tervez' eredmény oldala

33 UPL alapú oligó tervezés mirns detektálásra Hsa-mir-181a: AACAUUCAACGCUGUCGGUGAGU Hsa-mir-181b: AACAUUCAUUGCUGUCGGUGGGU Hsa-mir-181c: AACAUUCAAC*CUGUCGGUGAGU Czimmerer Zsolt, UDGenomed

34 UPL alapú oligó tervezés mirns detektálásra (egér szív) Czimmerer Zsolt

35 Vállalásaink Mit tudunk vállalni: 1. Gyakorlati segítség a kísérlet megtervezéséhez 2. Gyakorlati segítség az els!dleges adat elemzéshez 3. Speciális protokolok ismertetése 4. M#szerhasználat, hozzáférés 5. Közös projekt esetén biobankolási rendszer megtervezése felállítása 6. Közös pályázat kofinanszirozásra Beteg Klinikai minta Minta feldolgozás, Mérés Statiszt ika Ellátási kérdések Kutatási kérdések Eredmények értelmezése Publikáció

36 Vállalásaink Mit NEM tudunk vállalni: 1. Nagy érték# reagensek finanszirozása 2. Méréseken túli kísérletek végrehajtása 3. Eredmények másodlagos és harmadlagos analízise és értelmezése 4. Biobank felállítása pályázati vagy más finanszirozási háttér nélkül Beteg Klinikai minta Minta feldolgozás, Mérés Statiszt ika Ellátási kérdések Kutatási kérdések Eredmények értelmezése Publikáció

37 Finanszirozás/Kollaboráció Minden készülékünk használati díja csak a karbantartást és fogyóeszközök árát fedezi (Roche QPCR üzembérleti díja csökkent) Szekvenálási díj nagyobb volumennél csökkenthet! Affymetrix szolgáltatás díja nagyrészt a reagensek díját fedezik Kifizetett szolgáltatásnál nem javasoljuk a társ szerz!séget, de kérjük az anyagok, módszereknél való megemlítést Kollaboratív projekteknél el!re írásban meghatározandó: finanszírozási forrás, résztvev!k feladatai, projekt vezet! személye és a projekt befejezésének a várható id!pontja Finanszirozási nehézségek esetén lehetséges megoldás a közös pályázás

38 Összefoglalás 2 Általános információk: " (fejlesztés alatt) M#szer naptár: " Elérhet!ség: "

39 Scholtz Beáta (Biobanking) Keresztessy Zsolt (Citokin/Antitest) Póliska Szilárd (kapilláris szekvenálás, Affymetrix) Gyuris Tibor (Illumina szekvenálás) Zahuczky Gábor (UDGenomed)

40 Köszönet Debreceni Egyetem Barta Endre Gyuris Tibor Pap Attila Dániel Bence Balogh Marika Pallér Ádám Astrid Research: Steiner Laszló Laczik Miklós Nagy Otto DIAGENODE SA: Ignacio Mazon Dominique Poncelet Dider Allaer Nagy László EMBL Genomics Core Facility Vladimir Benes

41 Köszönöm a figyelmet!!!

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

Astrid research INC. Introducing

Astrid research INC. Introducing Astrid research INC. Introducing FACTSHEET Debrecen based 22 full time employees 6 researchers (life sciences), 13 software engineers, 3 economists) All employees have a a university degree and are able

Részletesebben

A genomiális medicina szép új világa

A genomiális medicina szép új világa A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012 2014 2015. ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet A medicina

Részletesebben

Nagy áteresztő képességű SNP mérések hasznosítása. Dr. Szalai Csaba

Nagy áteresztő képességű SNP mérések hasznosítása. Dr. Szalai Csaba Nagy áteresztő képességű SNP mérések hasznosítása Dr. Szalai Csaba 1 2 SNP-k SNP = single nucleotide polymorphism = kb. pontmutáció Általában biallélikusak, általában funkcionálisan semlegesek Több mint

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók

Részletesebben

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Magyarósi Szilvia Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem DEMIN 2014. május 22.

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Méhes Károly Genetikai Továbbképző Napok. Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek

Méhes Károly Genetikai Továbbképző Napok. Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek Méhes Károly Genetikai Továbbképző Napok Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek Kötelező szinten tartó tanfolyam Pécs 2011. október 19-21 PROGRAMFÜZET Kedves Vendégeink!

Részletesebben

7. Rendszerszemléletű biológia a kémikus szemével. Genomika, proteomika, metabolomika

7. Rendszerszemléletű biológia a kémikus szemével. Genomika, proteomika, metabolomika 7. Rendszerszemléletű biológia a kémikus szemével Genomika, proteomika, metabolomika 7. Rendszerszemléletű biológia Redukcionista vs. Holisztikus szemlélet A rendszerszemléletű biológia (systems biology)

Részletesebben

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

Nemzeti Akkreditáló Testület. BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz Az Országos Epidemiológiai Központ Virológiai főosztály (1097 Budapest, Albert

Részletesebben

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban 11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban HIV fertőzés kimutatása - (fiktív) esettanulmány 35 éves nő, HIV fertőzöttség gyanúja. Két partner az elmúlt időszakban. Fertőzött-e

Részletesebben

Genetika 2. előadás. Bevezető

Genetika 2. előadás. Bevezető Genetika 2. előadás Genetikai alapelvek: hogyan öröklődnek a tulajdonságok Mendeli genetika Bevezető Mi okozza a hasonlóságokat és különbségeket a családtagok között? Gének: biológiai információ alapegysége

Részletesebben

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése Kereskedelmi forgalomban kapható készülékek 1 Fogalmak

Részletesebben

BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ

BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ V. M A G Y A R S E J T A N A L I T I K A I K O N F E R E N C I A M O L E

Részletesebben

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26 Hamar Péter RNS világ Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. 1 26 Főszereplők: DNS -> RNS -> fehérje A kód lefordítása Dezoxy-ribo-Nuklein-Sav: DNS az élet kódja megkettőződés (replikáció)

Részletesebben

ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan

ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan 02/15/39/2008 ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan ÁLLATEGÉSZSÉGÜGYI BIZONYÍTVÁNY rágcsálók Magyar Köztársaságból Japánba történő exportjához Number

Részletesebben

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban 11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban HIV fertőzés kimutatása (fiktív) esettanulmány 35 éves nő, HIV fertőzöttség gyanúja. Két partner az elmúlt időszakban. Fertőzött-e

Részletesebben

EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE. Falus András. Összefoglalás

EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE. Falus András. Összefoglalás 1 EPIGENETIKA, A BIOLÓGIAI MŰKÖDÉS SZOFTVERE Falus András Összefoglalás Az epigenetika, az örökítőanyag softvere Kovalens módosulások Anyai hatás és az egyedfejlődés Mitokondriális öröklés Táplálkozás

Részletesebben

Molekuláris Medicina Alapjai

Molekuláris Medicina Alapjai Molekuláris Medicina Alapjai Bálint Bálint, László Meskó, Bertalan Nagy, László Lányi, Árpád Scholtz, Beáta Széles, Lajos Varga, Tamás Szerkesztette Nagy, László és Bálint, László, Debreceni Egyetem Molekuláris

Részletesebben

MŰANYAGOK ÉS A FENNTARTHATÓ FEJLŐDÉS. Nyéki Anikó, 2012. december 7.

MŰANYAGOK ÉS A FENNTARTHATÓ FEJLŐDÉS. Nyéki Anikó, 2012. december 7. MŰANYAGOK ÉS A FENNTARTHATÓ FEJLŐDÉS Nyéki Anikó, 2012. december 7. EZ A SABIC A PETROLKÉMIAI IPAR LEGVÁLTOZATOSABB PORTFOLIÓJA 6 STRATÉGIAI ÜZLETI EGYSÉG VEGYI ANYAGOK POLIMEREK INNOVATÍV MŰANYAGOK TELJESÍTMÉNYJAVÍTÓ

Részletesebben

Vállalati WIFI használata az OTP Banknál

Vállalati WIFI használata az OTP Banknál Vállalati WIFI használata az OTP Banknál Ujvári Dániel OTP BANK IKO rendszermérnök 2013. május. 23. OTP BANK ITÜIG IKO kompetenciák 2 Alap hálózati infrastruktúra tervezés és üzemeltetés Cisco IP telefónia

Részletesebben

Lehetőségek és korlátok a core-biopszián alapuló limfóma diagnosztikában

Lehetőségek és korlátok a core-biopszián alapuló limfóma diagnosztikában Lehetőségek és korlátok a core-biopszián alapuló limfóma diagnosztikában Strausz Tamás Tóth Erika Országos Onkológiai Intézet Sebészeti és Molekuláris Patológiai Osztály FiPaT 2012 Elvi alapok WHO klasszifikáció

Részletesebben

Prof. Dr. Szabad János Tantárgyfelelős beosztása

Prof. Dr. Szabad János Tantárgyfelelős beosztása Tantárgy neve Genetika Tantárgy kódja BIB 1506 Meghírdetés féléve 5 Kreditpont 4 Összóraszám (elmélet + gyakorlat) 3+0 Számonkérés módja Kollokvium Előfeltétel (tantárgyi kód) BIB 1411 Tantárgyfelelős

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós Összefoglalás A humángenetika korunk egyik legdinamikusabban fejlődő tudományága. Ennek a fejlődésnek legfőbb mozgatórugója az, hogy a humángenetika,

Részletesebben

Genetikai tanácsadók és laboratóriumok működése, akkreditációja Magyarországon

Genetikai tanácsadók és laboratóriumok működése, akkreditációja Magyarországon Genetikai tanácsadók és laboratóriumok működése, akkreditációja Magyarországon Dr. Melegh Béla PTE, Orvosi Genetikai Intézet DEMIN Debrecen, 2012 május 31. Genetikai tanácsadók és laboratóriumok működése,

Részletesebben

A projekt a Magyar Kormány támogatásával, a Kutatási és Fejlesztési Innovációs Alap támogatásával valósul meg. resides in the

A projekt a Magyar Kormány támogatásával, a Kutatási és Fejlesztési Innovációs Alap támogatásával valósul meg. resides in the A projekt a Magyar Kormány támogatásával, a Kutatási és Fejlesztési Innovációs Alap támogatásával valósul meg. 1 Szakmai jegyzőkönyv (utolsó frissítés: 2015.04.20) A projekt céljának összefoglalása 3DHISTECH

Részletesebben

FÜGGETLEN KONTROLLOK ALKALMAZÁSA A NAPI GYAKORLATBAN

FÜGGETLEN KONTROLLOK ALKALMAZÁSA A NAPI GYAKORLATBAN FÜGGETLEN KONTROLLOK ALKALMAZÁSA A NAPI GYAKORLATBAN Debreczeni Lóránd, Kovácsay Anna, Komlovszki Éva Fővárosi Önkormányzat Szent Imre Kórház, Központi Laboratórium Bio-Rad, Budapest 2006 Establishing

Részletesebben

Orvosi Genomika. 1. Trendek a modern orvostudományban. 2. Genomika és modern orvostudomány

Orvosi Genomika. 1. Trendek a modern orvostudományban. 2. Genomika és modern orvostudomány 1 1. ORVOSI GENOMIKA Orvosi Genomika 1. Trendek a modern orvostudományban DIA 1 Az emberi genom megfejtése óta eltelt 10 évben rendkívül gyors fejlődés ment végbe a genomikai technikákban, ill. a genomikai

Részletesebben

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN

POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN POSZTGENOMIKAI SZEMLÉLETVÁLTÁS ELSİ ELEMEINEK MEGJELENÉSE A MEDICINÁBAN Kötelezı szinten tartó tanfolyam PÉCS 2009. október 14-16. PROGRAMFÜZET Kedves Kollégák! Közel egy évvel ezelıtt, 2008 júniusában

Részletesebben

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A TM vizsgálatok alapkérdései A vizsgálatok célja, információértéke? Az alkalmazás területei? Hogyan válasszuk ki az alkalmazott

Részletesebben

Energetika az építész kezében

Energetika az építész kezében 2013 Energetika az építész kezében Reicher Péter kereskedelmi vezető Natural resources are exploited What can architects do? 2 1 Environmental impact of buildings 40% of global raw materials is consumed

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Az RNS-interferencia és távlatai

Az RNS-interferencia és távlatai Sipiczki Mátyás Az RNS-interferencia és távlatai Genetika és genom-projektek A modern biológia egyik leggyorsabban és leglátványosabban fejlődő területe a genetika, az a tudomány, amely az öröklődés mechanizmusát

Részletesebben

Bemutatkozás Dr. Lehoczky István. 2013. december 4..

Bemutatkozás Dr. Lehoczky István. 2013. december 4.. Bemutatkozás Dr. Lehoczky István 2013. december 4.. A baromfihoz eddig ilyen viszony fűzött Képzettség: 1991 1995. Szinyei Merse Pál Gimnázium, Budapest, Érettségi. 1995 2001. Kaposvári Egyetem, Állattudományi

Részletesebben

A Lynch szindróma molekuláris genetikai háttere Magyarországon

A Lynch szindróma molekuláris genetikai háttere Magyarországon A Lynch szindróma molekuláris genetikai háttere Magyarországon A doktori értekezés tézisei Kovács Marietta Éva Eötvös Loránd Tudományegyetem Természettudományi Kar Biológiai Doktori Iskola Klasszikus és

Részletesebben

a legérzékenyebb markerkombináció emlôdaganatoknál

a legérzékenyebb markerkombináció emlôdaganatoknál TPA és CA 15-3 a legérzékenyebb markerkombináció emlôdaganatoknál Bevezetés Az emlôrák a leggyakoribb rosszindulatú betegség nôknél. Elôfordulásának gyakorisága 100.000 személybôl átlagosan 60 eset (1)

Részletesebben

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2.

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2. BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február 1. Az IPK bemutatása 2. A TILLING módszer Hol található az IPK? Gatersleben Általános adatok az IPK-ról Leibniz

Részletesebben

Tudásmenedzsment és gyógyszerinnováció

Tudásmenedzsment és gyógyszerinnováció Tudásmenedzsment és gyógyszerinnováció Ipari szükségletek / elvárások Dr. Bátori Sándor Sanofi-aventis Innovatív Gyógyszerek Kutatása, MAGYOSZ, 2009.01.07. Alapvető együttm ttműködések Hosszútávú elhatározás:

Részletesebben

ható gyógyszerjel Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26.

ható gyógyszerjel Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26. Légzőrendszerre ható gyógyszerjel gyszerjelöltek ltek hatásoss sossága Innovatív Gyógyszerek Kutatására Irányuló Nemzeti Technológiai Platform, Gyógyszerhatásossági munkaértekezlet 2008 Nov. 26. Tudományos

Részletesebben

Biotechnológiai Innovációs Bázis Klaszter. Pohli Krisztina, klaszter-koordinátor

Biotechnológiai Innovációs Bázis Klaszter. Pohli Krisztina, klaszter-koordinátor Biotechnológiai Innovációs Bázis Klaszter Pohli Krisztina, klaszter-koordinátor Alapok Kutatási hagyományok a régióban: Orvostudomány Biotechnológia A kezdetek Pannónia Kutatási Park Forrásvidék Kft. ImmunGenomika

Részletesebben

Celluláris és molekuláris neurobiológia SzJDI 2014. őszi félév. Neuron-specifikus génműködés. Szabó Gábor MTA KOKI szabog@koki.hu

Celluláris és molekuláris neurobiológia SzJDI 2014. őszi félév. Neuron-specifikus génműködés. Szabó Gábor MTA KOKI szabog@koki.hu Celluláris és molekuláris neurobiológia SzJDI 2014. őszi félév Neuron-specifikus génműködés Szabó Gábor MTA KOKI szabog@koki.hu Génexpressziós szintek Génhez való hozzáférés kromatin DNS metiláció kromatin

Részletesebben

Technotel Kft. Megfelelségi Nyilatkozat

Technotel Kft. Megfelelségi Nyilatkozat a tagja Megfelelségi Nyilatkozat elektronikus hírközlési szolgáltatás 229/2008. (IX.12.) Korm. rendelet szerinti megfelelségérl a 2009 évben nyújtott internet szolgáltatásra vonatkozóan INT_Megfelelosegi_Nyilatkozat_2009.doc

Részletesebben

A metabolikus szindróma epidemiológiája a felnőtt magyar lakosság körében

A metabolikus szindróma epidemiológiája a felnőtt magyar lakosság körében DEBRECENI EGYETEM ORVOS- ÉS EGÉSZSÉGTUDOMÁNYI CENTRUM NÉPEGÉSZSÉGÜGYI KAR A metabolikus szindróma epidemiológiája a felnőtt magyar lakosság körében HMAP munkaértekezletek 2009 A METABOLIKUS SZINDRÓMA EPIDEMIOLÓGI

Részletesebben

A HUEDU OpenLab iskolai alkalmazáscsomag Kovács Lajos

A HUEDU OpenLab iskolai alkalmazáscsomag Kovács Lajos A HUEDU OpenLab iskolai alkalmazáscsomag Kovács Lajos Rendszermérnök kovacs.lajos@npsh.hu A HUEDU program háttere 2 2009: 3 éves megállapodás az NFM és a Novell között --» 2012: keretszerződés meghosszabbítása

Részletesebben

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B) 0.1 Member State HU 0.2.1 Species code 1358 0.2.2 Species name Mustela putorius 0.2.3 Alternative species scientific name 0.2.4 Common name házigörény 1. National Level 1.1 Maps 1.1.1 Distribution Map

Részletesebben

Using the CW-Net in a user defined IP network

Using the CW-Net in a user defined IP network Using the CW-Net in a user defined IP network Data transmission and device control through IP platform CW-Net Basically, CableWorld's CW-Net operates in the 10.123.13.xxx IP address range. User Defined

Részletesebben

KIS RNS-MOLEKULÁK NEMCSAK TRANSZKRIPCIÓS ZAJ A GÉNSZABÁLYOZÁS ÚJ SZINTJE Molnár Viktor, Falus András

KIS RNS-MOLEKULÁK NEMCSAK TRANSZKRIPCIÓS ZAJ A GÉNSZABÁLYOZÁS ÚJ SZINTJE Molnár Viktor, Falus András KIS RNS-MOLEKULÁK NEMCSAK TRANSZKRIPCIÓS ZAJ A GÉNSZABÁLYOZÁS ÚJ SZINTJE Molnár Viktor, Falus András A többsejtű szervezetekben az egyes szövetek közötti munkamegosztás meghatározott feladatokra specializálódott

Részletesebben

Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16.

Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16. Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16. Tracsek Ferenc igazgató Alapvető változások kora Az IT iparágban alapvető

Részletesebben

Az interjú id pontja: Kezel hely kódszáma: Interjúkészít kódszáma: A kérdez súlyosság-értékelése. Név: A kliens kódja:

Az interjú id pontja: Kezel hely kódszáma: Interjúkészít kódszáma: A kérdez súlyosság-értékelése. Név: A kliens kódja: Név: A kliens kódja: Az interjú id pontja: Kezel hely kódszáma: Interjúkészít kódszáma: év hó nap A kérdez súlyosság-értékelése 0-1 Valódi probléma nem áll fenn /nincs szükség segítségre 2-3 Kevésbé súlyos

Részletesebben

SUSE Success Stories Varga Zsolt

SUSE Success Stories Varga Zsolt SUSE Success Stories Varga Zsolt operatív igazgató / Novell PSH Varga.zsolt@npsh.hu 2 Nagy forgalmú webes portál infrastruktúra kialakítása (közszféra) Megoldandó feladatok, nehézségek Igen nagy számú

Részletesebben

Poligénes v. kantitatív öröklődés

Poligénes v. kantitatív öröklődés 1. Öröklődés komplexebb sajátosságai 2. Öröklődés molekuláris alapja Poligénes v. kantitatív öröklődés Azok a tulajdonságokat amelyek mértékegységgel nem, vagy csak nehezen mérhetők, kialakulásuk kevéssé

Részletesebben

A USER Kft - mint Open Text partner - bemutatása

A USER Kft - mint Open Text partner - bemutatása A USER Kft - mint Open Text partner - bemutatása SAP konferencia 2008.szeptember 22. Tihany Copyright 2008 Open Text Inc. All rights reserved. Kárász Vilmos Sales Manager USER KFT vilmos.karasz@user.hu

Részletesebben

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 Zárójelentés: 2001. május 15.-2004.

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Molekuláris diagnosztika

Molekuláris diagnosztika CE-IVD LightCycler System Real-time PCR - as flexible as you are Molekuláris diagnosztika Becságh Péter Roche Magyarország Kft MOLSZE 2007. 08. 30. BIOKÉMIA: az élet molekuláris logikája MOLEKULÁRIS BIOLÓGIA:

Részletesebben

GENOMIKA Fogalmak genom genetika genomika szerkezetét összehasonlít funkcióit A genomika főbb területei (1) Strukturális (szerkezeti) genomika (2)

GENOMIKA Fogalmak genom genetika genomika szerkezetét összehasonlít funkcióit A genomika főbb területei (1) Strukturális (szerkezeti) genomika (2) GENOMIKA Fogalmak A genom az élőlényekben, illetve azok egyetlen sejtjében található öröklési anyag (DNS) teljes állománya. A genetika a tulajdonságok öröklésével, egyes gének szerkezetével és működésével

Részletesebben

Omikák a modern biológiában

Omikák a modern biológiában Prof. Dr. Pócsi István Omikák a modern biológiában Kőrösi Csoma Sándor Gimnázium, Szakközép-, Szakképző Iskola és Kollégium Hajdúnánás, 2014. január 29. www.meetthescientist.hu 1 26 Fordított nap 1979.

Részletesebben

A hólyagrák aktuális kérdései a pathologus szemszögéből. Iványi Béla SZTE Pathologia

A hólyagrák aktuális kérdései a pathologus szemszögéből. Iványi Béla SZTE Pathologia A hólyagrák aktuális kérdései a pathologus szemszögéből Iványi Béla SZTE Pathologia Hólyagrák 7. leggyakoribb carcinoma Férfi : nő arány 3.5 : 1 Csúcsa: 60-80 év között Oka: jórészt ismeretlen Rizikótényezők:

Részletesebben

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1.

Biobankok a Semmelweis Egyetemen. Szalai Csaba 2009. július 1. Biobankok a Semmelweis Egyetemen Szalai Csaba 2009. július 1. Molnár Mária Judit MD, PhD A Semmelweis Egyetem Molekuláris Neurológiai Klinikai és Kutatási Központ igazgatója SE Molekuláris Neurológiai

Részletesebben

A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában. Derzsy Napok, Sárvár, 2011 Június 2-3.

A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában. Derzsy Napok, Sárvár, 2011 Június 2-3. A kvantitatív PCR alkalmazhatósága a fertőző bronchitis vakcinák hatékonysági vizsgálatában Pénzes Zoltán PhD, Soós Pál PhD, Nógrády Noémi PhD, Varga Mária, Jorge Chacón PhD, Zolnai Anna PhD, Nagy Zoltán

Részletesebben

A WHO HRH támogató tevékenysége és prioritásai A WHO és a Semmelweis Egyetem Egészségügyi Menedzserképző Központja közötti együttműködés

A WHO HRH támogató tevékenysége és prioritásai A WHO és a Semmelweis Egyetem Egészségügyi Menedzserképző Központja közötti együttműködés A WHO HRH támogató tevékenysége és prioritásai A WHO és a Semmelweis Egyetem Egészségügyi Menedzserképző Központja közötti együttműködés WHO ~ HRH Millenium Development Goals (Achieving the health related

Részletesebben

A KÖRNYEZETI NEHÉZFÉM EXPOZÍCIÓ EPIGENETIKAI VONATKOZÁSAI

A KÖRNYEZETI NEHÉZFÉM EXPOZÍCIÓ EPIGENETIKAI VONATKOZÁSAI Egészségtudományi Közlemények, 2. kötet, 1. szám (2012), pp. 39 47. A KÖRNYEZETI NEHÉZFÉM EXPOZÍCIÓ EPIGENETIKAI VONATKOZÁSAI NIŠTIAR FERENC 1, DR. RÁCZ OLIVÉR 1, LUKAČÍNOVÁ ÁGNES 2, HUBKOVÁ BEÁTA 3, DR.

Részletesebben

Az e-learning-től az u-learning-ig

Az e-learning-től az u-learning-ig Az e-learning-től az u-learning-ig Tananyagfejlesztés, tanulás több (web, mobil és digitális televíziós) csatornán keresztül. MÁRKUS Zsolt László Antenna Hungária Zrt. TARTALOMJEGYZÉK BEVEZETŐ CÉLOK, EREDMÉNYEK

Részletesebben

Az Idegsebészeti Szövetbank jelentősége a neuro-onkológiai kutatásokban

Az Idegsebészeti Szövetbank jelentősége a neuro-onkológiai kutatásokban Az Idegsebészeti Szövetbank jelentősége a neuro-onkológiai kutatásokban Augusta - Idegsebészet Klekner Álmos 1, Bognár László 1,2 1 Debreceni Egyetem, OEC, Idegsebészeti Klinika, Debrecen 2 Országos Idegsebészeti

Részletesebben

Több laboratórium összehasonlítása, körmérés

Több laboratórium összehasonlítása, körmérés Több oratórium összehasonlítása, körmérés colorative test, round robin a rendszeres hibák ellenőrzése, számszerűsítése Statistical Manual of AOAC, W. J. Youden: Statistical Techniques for Colorative Tests,

Részletesebben

Várandós nők Streptococcus agalactiaeszűrése

Várandós nők Streptococcus agalactiaeszűrése Várandós nők Streptococcus agalactiaeszűrése MALDI-TOF MS módszerrel Pappné Ábrók Marianna, Arcson Ágnes, Urbán Edit, Deák Judit Szegedi Tudományegyetem, Általános Orvostudományi Kar Klinikai Mikrobiológiai

Részletesebben

SEMMELWEIS SZIMPÓZIUM SEJTANALITIKA- MOLEKULÁRIS GASZTROENTEROLÓGIA

SEMMELWEIS SZIMPÓZIUM SEJTANALITIKA- MOLEKULÁRIS GASZTROENTEROLÓGIA SEMMELWEIS SZIMPÓZIUM SEJTANALITIKA- MOLEKULÁRIS GASZTROENTEROLÓGIA 2007. NOVEMBER 15-17. MÁSODIK ÉRTESÍTŐ A SZIMPÓZIUM CÉLJA A Sejtanalitika - Molekuláris Gasztroenterológia konferencia célja, hogy az

Részletesebben

Daganat immunterápia molekuláris markereinek tanulmányozása biofizikai módszerekkel. Áramlási és képalkotó citometria

Daganat immunterápia molekuláris markereinek tanulmányozása biofizikai módszerekkel. Áramlási és képalkotó citometria Daganat immunterápia molekuláris markereinek tanulmányozása biofizikai módszerekkel. Áramlási és képalkotó citometria Szöllősi János, Vereb György Biofizikai és Sejtbiológiai Intézet Orvos- és Egészségtudományi

Részletesebben

Ismeri Magyarországot?

Ismeri Magyarországot? instrukciók Instrukciók angolul Preparation: print out the worksheets You will need: a dictionary Time: 25-30 minutes With this worksheet, you will learn and share basic information about the location

Részletesebben

"Omikai" módszerek alkalmazása a neuropszichofarmakológiában. Tamási Viola PharmD, PhD OKTATÁSI SEGÉDANYAG

Omikai módszerek alkalmazása a neuropszichofarmakológiában. Tamási Viola PharmD, PhD OKTATÁSI SEGÉDANYAG "Omikai" módszerek alkalmazása a neuropszichofarmakológiában Tamási Viola PharmD, PhD 2013 Omikai-módszerek A biológiai adatok kölcsönhatásának vizsgálata egy ome-on belül. Genom Transkriptom Proteom Metabolom

Részletesebben

Áramlási citometria 2011. / 4. Immunológiai és Biotechnológiai Intézet PTE KK

Áramlási citometria 2011. / 4. Immunológiai és Biotechnológiai Intézet PTE KK Áramlási citometria 2011. / 4 Immunológiai és Biotechnológiai Intézet PTE KK Az áramlási citometria elve Az áramlási citometria ( Flow cytometria ) sejtek gyors, multiparaméteres vizsgálatára alkalmas

Részletesebben

Az ellenanyagok orvosbiológiai. PhD kurzus 2011/2012 II. félév

Az ellenanyagok orvosbiológiai. PhD kurzus 2011/2012 II. félév Az ellenanyagok orvosbiológiai alkalmazása PhD kurzus 2011/2012 II. félév Ellenanyaggal működő módszerek Analitikai felhasználás Analitikai felhasználás Ellenanyag / antigén kapcsolódás Az Ab/Ag kapcsolat

Részletesebben

Longman Exams Dictionary egynyelvű angol szótár nyelvvizsgára készülőknek

Longman Exams Dictionary egynyelvű angol szótár nyelvvizsgára készülőknek Longman Exams Dictionary egynyelvű angol szótár nyelvvizsgára készülőknek Egynyelvű angol nagyszótár haladó nyelvtanulóknak és nyelvvizsgázóknak 212,000 szócikkel A szótárban minden definíció egyszerű

Részletesebben

1. A megyében végzett jelentősebb kutatási témák, projektek ráfordításainak ágazati megoszlása (összesen 4 859 millió Ft-ról áll rendelkezésre adat):

1. A megyében végzett jelentősebb kutatási témák, projektek ráfordításainak ágazati megoszlása (összesen 4 859 millió Ft-ról áll rendelkezésre adat): Megyei statisztikai profil a Smart Specialisation Strategy (S3) megalapozásához c. dokumentum kiegészítése a Magyar Tudományos Akadémia adataival Csongrád megye Az alábbi dokumentum a Smart Specialisation

Részletesebben

19.Budapest Nephrologiai Iskola/19th Budapest Nephrology School angol 44 6 napos rosivall@net.sote.hu

19.Budapest Nephrologiai Iskola/19th Budapest Nephrology School angol 44 6 napos rosivall@net.sote.hu 1.sz. Elméleti Orvostudományok Doktori Iskola 3 éves kurzus terve 2011/2012/ 2 félév - 2014/2015/1 félév 2011//2012 tavaszi félév Program sz. Kurzusvezető neve Kurzus címe magyarul/angolul Kurzus nyelve

Részletesebben

Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata

Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata Gén kópiaszám és mikrorns kötőhely polimorfizmusok vizsgálata Doktori tézisek Dr. Kovács-Nagy Réka Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola Témavezető: Dr. Rónai Zsolt egyetemi adjunktus,

Részletesebben

ELO Digital Office ERP integráció

ELO Digital Office ERP integráció ELO Digital Office ERP integráció Lázár Péter ECM Business Unit Manager peter.lazar@itelligence.hu Enterprise Content Management www.elo.com Miért kell ERP integráció? Hozzáféréseket szabályozni és auditálni

Részletesebben

Kémiai biológia avagy mit nyújt(hat) a kémia az élettudományoknak

Kémiai biológia avagy mit nyújt(hat) a kémia az élettudományoknak A Magyar Tudomány Ünnepe 2007 Kémiai biológia avagy mit nyújt(hat) a kémia az élettudományoknak Tudományos ülésszak A Debreceni Egyetem Természettudományi Karának Kémiai Intézete és A Debreceni Akadémiai

Részletesebben

Daganatok kialakulásában szerepet játszó molekuláris folyamatok

Daganatok kialakulásában szerepet játszó molekuláris folyamatok Daganatok kialakulásában szerepet játszó molekuláris folyamatok Genetikai változások Onkogének Tumorszuppresszor gének DNS hibajavító gének Telomer és telomeráz Epigenetikai változások DNS-metiláció Mikro-RNS

Részletesebben

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend)

A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) A krónikus myeloid leukémia kezelésének finanszírozási protokollja (eljárásrend) Országos Egészségbiztosítási Pénztár Elemzési, Orvosszakértői és Szakmai Ellenőrzési Főosztály Budapest, 2013. június 26.

Részletesebben

Genetikai vizsgálatok módszerei. Dr. Gál Anikó galaniko77@gmail.com

Genetikai vizsgálatok módszerei. Dr. Gál Anikó galaniko77@gmail.com Genetikai vizsgálatok módszerei Dr. Gál Anikó galaniko77@gmail.com Genetikai vizsgálat fogalma A vizsgált egyén DNS állományában (genomjában) történő elkésések kimutatása A genetikai vizsgálatot A humángenetikai

Részletesebben

SOPHOS simple + secure. A dobozba rejtett biztonság UTM 9. Kókai Gábor - Sophos Advanced Engineer Balogh Viktor - Sophos Architect SOPHOS

SOPHOS simple + secure. A dobozba rejtett biztonság UTM 9. Kókai Gábor - Sophos Advanced Engineer Balogh Viktor - Sophos Architect SOPHOS SOPHOS simple + secure A dobozba rejtett biztonság UTM 9 Kókai Gábor - Sophos Advanced Engineer Balogh Viktor - Sophos Architect SOPHOS SOPHOS simple + secure Megint egy UTM? Egy újabb tűzfal extrákkal?

Részletesebben

Új funkciók az RBP-ben 2015. október 1-től New functions in RBP from 1 October 2015. Tatár Balázs

Új funkciók az RBP-ben 2015. október 1-től New functions in RBP from 1 October 2015. Tatár Balázs Új funkciók az RBP-ben 2015. október 1-től New functions in RBP from 1 October 2015 Tatár Balázs Üzletfejlesztés vezető / Business Development Manager Rendszerhasználói Tájékoztató Nap, 2015. szeptember

Részletesebben

Témakereséstől a fejlesztési jelölt kiválasztásáig. sanofi-aventis

Témakereséstől a fejlesztési jelölt kiválasztásáig. sanofi-aventis Témakereséstől a fejlesztési jelölt kiválasztásáig sanofi-aventis A sanofi-aventis aventis számokban (2007) - First in class - Disease modifying - Personalized medicines Translational research 2 A kutatás

Részletesebben

Felhők teljesítményelemzése felhő alapokon

Felhők teljesítményelemzése felhő alapokon Felhők teljesítményelemzése felhő alapokon Kocsis Imre ikocsis@mit.bme.hu HTE Infokom 2014 Budapest University of Technology and Economics Department of Measurement and Information Systems 1 IT Szolgáltatásmenedzsment

Részletesebben

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 NÖVÉNYÉLETTAN Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Sejtfal szintézis és megnyúlás Környezeti tényezők hatása a növények növekedésére és fejlődésére Előadás áttekintése

Részletesebben

Heterogeneous Networks

Heterogeneous Networks Heterogeneous Networks Kis cellák, WiFi és LTE az okos hozzáférésben Equicomferencia, 2014. május 6.-7. Bordás Csaba Ericsson csaba.bordas@ericsson.com Bevezető helyett Egyre kevesebb réz a hozzáférésben

Részletesebben

A genetikai tesztek jelentősége a személyre szabott orvoslás korszakában

A genetikai tesztek jelentősége a személyre szabott orvoslás korszakában 16 Összefoglaló közlemény A genetikai tesztek jelentősége a személyre szabott orvoslás korszakában Molnár Mária Judit 1,3, Magyarósi Szilvia 1,2, Németh György 2,3 1 Genomikai Medicina és Ritka Betegségek

Részletesebben

Zárójelentés. A D4-es dopamin receptor gén 5 régiójának haplotípus szerkezete: molekuláris és pszichiátriai vonatkozások (2003 2006) F042730

Zárójelentés. A D4-es dopamin receptor gén 5 régiójának haplotípus szerkezete: molekuláris és pszichiátriai vonatkozások (2003 2006) F042730 Zárójelentés A D4-es dopamin receptor gén 5 régiójának haplotípus szerkezete: molekuláris és pszichiátriai vonatkozások (2003 2006) F042730 Betegségeink kialakításában két f etiológiai faktor, a környezeti

Részletesebben

2012.11.01-2012.11.30 dátumok közti fuvarok:

2012.11.01-2012.11.30 dátumok közti fuvarok: 2012.11.01-2012.11.30 dátumok közti fuvarok: Anat. Szöv.- és Fejl.tani Int./Közp.ált. 41201K0000 7 Szállítási kód: 41 Darabszám: 1 Aneszteziológiai és Intenzív Terápiás Klinika 61255K0000 ÁOK Dékáni Hivatal/Közp.

Részletesebben

Sejtek - őssejtek dióhéjban. 2014. február. Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest

Sejtek - őssejtek dióhéjban. 2014. február. Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest Sejtek - őssejtek dióhéjban 2014. február Sarkadi Balázs, MTA-TTK Molekuláris Farmakológiai Intézet - SE Kutatócsoport, Budapest A legtöbb sejtünk osztódik, differenciálódik, elpusztul... vérsejtek Vannak

Részletesebben

A nyelv genetikai háttere

A nyelv genetikai háttere A nyelv genetikai háttere Szalontai Ádám ELTE Elméleti Nyelvészeti Doktori Program MTA Nyelvtudományi Intézet 2014. április 29. 1 / 41 Az előadás menete Genetikai bevezető Gének és nyelv elmélet KE család

Részletesebben