Klinikai Genomikai és Személyre Szabott Orvoslási Központ. Tudományos Hétf!

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Klinikai Genomikai és Személyre Szabott Orvoslási Központ. Tudományos Hétf!"

Átírás

1 Klinikai Genomikai és Személyre Szabott Orvoslási Központ 2012 Tudományos Hétf!

2 Biomarker azonosítás feltételei: eszközök, készségek és kollaboráció Minták, Vizsgálatok, Beteg adatok Klinikus + bioinfo Diagnosztikai kiválóság Klinikus Sikeres biomarker program Minta vizsgálati eszközök Mol biol labor Információs kincs Molekuláris biológiai jártasság Klinikus+mol biol

3 Biomarkerek használatával Betegbiztonság növekszik Toxicitási Biomarkerek Beteg specifikus Biomarkerek PHC Hatékonysági Biomarkerek Betegség specifikus Biomarkerek Kezelés hatékonyság növekszik

4 Mi az epigenetika? epi- [!"#] túl, fölött, mellett gennó [$!%%&], nemzeni, életet adni

5 Mi az epigenetika? Tágan értelmezve: TRANSZKRIPCIÓ SZABÁLYOZÁS DNS nukleotid sorrendjét nem befolyásoló de a génexpressziót befolyásoló tényez'k összessége Sz(ken értelmezve: ÖRÖKL)DÉS DNS bázissorrendjében nem kódolt, sejt vagy él'lény szinten örökl'd' tényez'k összessége

6 Valódi epigenetikai hatáshoz három generáció nyomonkövetése szükséges

7 Transzkripció szabályozás szintjei: kromatin szinten szabályozott a fehérjék hozzáférése a DNS-hez DNS metiláció replikáció során propagálódik Módosított hisztonvégek fehérjék kapcsolódását szabályozzák Szabályozó RNS molekulák módosíthatják a transzkripciót

8 DNS metilációs mintázat örökl'dése

9 Anyai babusgatás életen át tartó hatása DNS metiláció és hiszton módosítások változnak a babusgatás hatására és a következmények életen át tartanak. Következmény: bátrabbak és jobban tolerálják a stressz szignálokat. HDAC inhibitorral visszafordítható hatás. Nevel'anya cserével a hatás is cserél'dik tehát nem genetikai hatás.

10 Epi allélek Agouti vy Jirtle NRG 2007

11 Epi allél eltolódás diétás hatásra

12 Az epi allélek közös nevez'je a transzpozon jelenléte. A transzpozonok ellen a sejt epigenetikai csendesítéssel védekezik. Az epigenetika módosítások szétterjednek nagy genomi szakaszokon, ezáltal csendesítik a beekel'dött szakaszokat, pl. transzpozonokat.

13 Transzpozonok és DNS metiláció Fred Gage (Salk Institute): 1. A genom 20% L1 (LINE1) traszpozonból áll 2. A neuronális differenciáció els' fázisában az L1 transzpozonok rövid ideig aktiválódnak 3. Az L1 aktivitás összefügg a neuroplaszticitással (hipokampuszban 8x nagyobb marad) 4. A DNS metiláció a MECP2 Metil DNS köt' fehérjén keresztül csendesíti a transzpozonokat a HDAC1 és SOX2 komplex segítségével. RETT szindrómában nem m(ködik a DNS metiláció függ' gátlás: 1. Általános neuronális differenciációs zavar születés utáni években. 2. Emelkedett L1 transzpozon aktivitás.

14 Terápiás szerek amelyek epigenetikai útvonalakon keresztül hatnak: DNS metiláció gátlószerek: Azacytidine és deoxyazacytidine (FDA jovahagyas Mielodiszpláziás szindrómában) HDAC inhibítorok: Vorinostat (FDA jóváhagyott T sejt limfomára) Romidepsin (FDA 2009) Valproát egyéb Biomarker térképezések: Epigenom projektek, Methylome projektek

15 HETEROKROMATIN AZACYTIDINE MBP TSA, BUTYRATE HDAC MBP H3K9 MET Pargyline Met CpG H3K9 MET HDAC MBP H3K9 MET MBP H3K9 MET MBP HP1 HP1 HP1 HP1 H3K9 METH3K9 METH3K9 MET H3K9 MET HP1 MBP MBP MBP MBP

16 A több nyelven írt genom Tripletek nyelve Kötöhelyek kódja

17 Három szintje a transzkripciós esemény vizsgálatának Genomi köt'helyek RNS profil Proteom profil

18 Hisztonvég Módosítások H3 H4 Acetyl K Methyl R Methyl K Phos. S Ubiq. K H2A C-term H H H2B H2A Turner: Cell 2002 (111)285.

19 ChIP TAQMAN Q-PCR / ABI NTC

20 Automatizált CHIP a maximális reprodukálhatóságért IP-Star Magnetic ChIP

21 Illumina HiScan SQ= 150 Giga bázis/ futás 1 humán genom/ futás 30X lefedettséggel / 48 teljes transzkriptóm RNA-Seq / 24 exom-seq minta

22 P300 binding to enhancers is detectable by monitoring H3K27 acetylation C57Bl6: MCSF+IL4 Replicate C57Bl6: MCSF+IL4 Adipo PPRE Technical Replicates of Library preparation and sequencing ChIP Seq results of technical replicates show sharp signal on the CORE PROMOTER of ap2, and a widely expanded region on the well described ENHANCER ELEMENT (adipo PPRE).

23 Citogenetika Affymetrix Rendszereken

24 Traditional Cytogenetics Traditional Cytogenetic Techniques Excellent and robust techniques Their limitations are well recognised (resolution, variability in sample preparation)

25 Microarrays revolutionizing Cytogenetics "increased resolution of microarray technology over conventional cytogenetic analysis allows for identification of chromosomal imbalances with greater precision, accuracy, and technical sensitivity. Within the last 3 years, the cytogenetics community has refined: Array design and content requirements Consensus of clinically important regions and genes Resolution requirements: " Clinical regions " Other genes " Genomic backbone The value of heterozygosity data The value of SNP genotypes

26 Classical Cytogenetics and Microarrays Whole Genome Low Res Targeted Hi Res + Dx Yield = 3% Karyotype FISH =Confirmatory Microarray-Based Cytogenetics Simpler & more reliable Standardized workflow More information per test Quicker time to result 3 days versus 7 days Quantitative vs subjective Less expensive High earning potential for labs Dx Yield = 20%

27 Guidelines are available! All CNVs detected, regarding of size shall be reported! Most relevant CNVs, regions are rich in gene content! Small unknown CNVS should be reported including all the RefSeq genes in the region " Microarrays should detect gains & losses >400kb "Desirable to have good coverage along the genome and in clinical relevant genes " SNPs are important to detect regions of homozygocity, UPD and mosaicism.

28 The targeted plus genome-wide design Schematic of genomic region Known pathological variant Gene Known pathological variant Gene Microarray marker density

29 Simple chromosome visualisation Data types Files list

30 Fejlesztéseink UPL alapú mérési rendszerek (QPCR és mirns) Nagy átereszt! képesség# új generációs szekvenálási techonlógiák (DNS metilációs és epigenetikai profilírozás) Fehérje/ antitest el!állítási szolgáltatás (Keresztessy Zsolt)

31 UPL alapú oligó tervezés mirns detektálásra Astrid Research

32 Assay tervez' eredmény oldala

33 UPL alapú oligó tervezés mirns detektálásra Hsa-mir-181a: AACAUUCAACGCUGUCGGUGAGU Hsa-mir-181b: AACAUUCAUUGCUGUCGGUGGGU Hsa-mir-181c: AACAUUCAAC*CUGUCGGUGAGU Czimmerer Zsolt, UDGenomed

34 UPL alapú oligó tervezés mirns detektálásra (egér szív) Czimmerer Zsolt

35 Vállalásaink Mit tudunk vállalni: 1. Gyakorlati segítség a kísérlet megtervezéséhez 2. Gyakorlati segítség az els!dleges adat elemzéshez 3. Speciális protokolok ismertetése 4. M#szerhasználat, hozzáférés 5. Közös projekt esetén biobankolási rendszer megtervezése felállítása 6. Közös pályázat kofinanszirozásra Beteg Klinikai minta Minta feldolgozás, Mérés Statiszt ika Ellátási kérdések Kutatási kérdések Eredmények értelmezése Publikáció

36 Vállalásaink Mit NEM tudunk vállalni: 1. Nagy érték# reagensek finanszirozása 2. Méréseken túli kísérletek végrehajtása 3. Eredmények másodlagos és harmadlagos analízise és értelmezése 4. Biobank felállítása pályázati vagy más finanszirozási háttér nélkül Beteg Klinikai minta Minta feldolgozás, Mérés Statiszt ika Ellátási kérdések Kutatási kérdések Eredmények értelmezése Publikáció

37 Finanszirozás/Kollaboráció Minden készülékünk használati díja csak a karbantartást és fogyóeszközök árát fedezi (Roche QPCR üzembérleti díja csökkent) Szekvenálási díj nagyobb volumennél csökkenthet! Affymetrix szolgáltatás díja nagyrészt a reagensek díját fedezik Kifizetett szolgáltatásnál nem javasoljuk a társ szerz!séget, de kérjük az anyagok, módszereknél való megemlítést Kollaboratív projekteknél el!re írásban meghatározandó: finanszírozási forrás, résztvev!k feladatai, projekt vezet! személye és a projekt befejezésének a várható id!pontja Finanszirozási nehézségek esetén lehetséges megoldás a közös pályázás

38 Összefoglalás 2 Általános információk: " (fejlesztés alatt) M#szer naptár: " Elérhet!ség: "

39 Scholtz Beáta (Biobanking) Keresztessy Zsolt (Citokin/Antitest) Póliska Szilárd (kapilláris szekvenálás, Affymetrix) Gyuris Tibor (Illumina szekvenálás) Zahuczky Gábor (UDGenomed)

40 Köszönet Debreceni Egyetem Barta Endre Gyuris Tibor Pap Attila Dániel Bence Balogh Marika Pallér Ádám Astrid Research: Steiner Laszló Laczik Miklós Nagy Otto DIAGENODE SA: Ignacio Mazon Dominique Poncelet Dider Allaer Nagy László EMBL Genomics Core Facility Vladimir Benes

41 Köszönöm a figyelmet!!!

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45

Részletesebben

Klinikai Genomikai és Személyreszabott Orvoslási Központ. Biobankok. Dr. Scholtz Beáta

Klinikai Genomikai és Személyreszabott Orvoslási Központ. Biobankok. Dr. Scholtz Beáta Klinikai Genomikai és Személyreszabott Orvoslási Központ Biobankok Dr. Scholtz Beáta Célunk: Tudásbázis és laboratóriumi infrastuktúra a Debreceni Egyetem biobank projektjeihez Egy biobank felállításának

Részletesebben

A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató

Részletesebben

Új temékek az UD-GenoMed Kft. kínálatában!

Új temékek az UD-GenoMed Kft. kínálatában! Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai

Részletesebben

Új utak az antipszichotikus gyógyszerek fejlesztésében

Új utak az antipszichotikus gyógyszerek fejlesztésében Új utak az antipszichotikus gyógyszerek fejlesztésében SCHIZO-08 projekt Dr. Zahuczky Gábor, PhD, ügyvezető igazgató UD-GenoMed Kft. Debrecen, 2010. november 22. A múlt orvostudománya Mindenkinek ugyanaz

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai

Részletesebben

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6 Agilent 2100 Bioanalyzer mikrokapilláris gélelektroforézis rendszer G2943CA 2100 Bioanalyzer system forgalmazó: Kromat Kft. 1112 Budapest Péterhegyi u. 98. t:36 (1) 248-2110 www.kromat.hu bio@kromat.hu

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data.

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data. Budapesti Műszaki és Gazdaságtudományi Egyetem Méréstechnika és Információs rendszerek Tanszék Adatelemzés intelligens módszerekkel Hullám Gábor Adatelemzés hagyományos megközelítésben I. Megválaszolandó

Részletesebben

A genomiális medicina szép új világa

A genomiális medicina szép új világa A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012 2014 2015. ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet A medicina

Részletesebben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben

TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben esirna mirtron BEVEZETÉS TÉMAKÖRÖK Ősi RNS világ RNS-ek tradicionális szerepben bevezetés BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek BIOLÓGIAI MOLEKULÁK FEHÉRJÉK NUKLEINSAVAK DNS-ek RNS-ek

Részletesebben

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:

Részletesebben

Astrid research INC. Introducing

Astrid research INC. Introducing Astrid research INC. Introducing FACTSHEET Debrecen based 22 full time employees 6 researchers (life sciences), 13 software engineers, 3 economists) All employees have a a university degree and are able

Részletesebben

Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai markerek kutatása

Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai markerek kutatása A 48750 OTKA pályázat eredményeit összefoglaló szakmai záróbeszámoló A pályázat címe Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai

Részletesebben

A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban

A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban Összefoglaló közlemény 21 A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban Bálint Bálint L. 1, Nagy László 1,2 1 Debreceni Egyetem Orvos- és Egészségtudományi Centrum, Biokémiai és

Részletesebben

A proteomika új tudománya és alkalmazása a rákdiagnosztikában

A proteomika új tudománya és alkalmazása a rákdiagnosztikában BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK A proteomika új tudománya és alkalmazása a rákdiagnosztikában Tárgyszavak: proteom; proteomika; rák; diagnosztika; molekuláris gyógyászat; biomarker;

Részletesebben

10. Genomika 2. Microarrayek és típusaik

10. Genomika 2. Microarrayek és típusaik 10. Genomika 2. 1. Microarray technikák és bioinformatikai vonatkozásaik Microarrayek és típusaik Korrelált génexpresszió mint a funkcionális genomika eszköze 2. Kombinált megközelítés a funkcionális genomikában

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

Nagy áteresztő képességű SNP mérések hasznosítása. Dr. Szalai Csaba

Nagy áteresztő képességű SNP mérések hasznosítása. Dr. Szalai Csaba Nagy áteresztő képességű SNP mérések hasznosítása Dr. Szalai Csaba 1 2 SNP-k SNP = single nucleotide polymorphism = kb. pontmutáció Általában biallélikusak, általában funkcionálisan semlegesek Több mint

Részletesebben

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)

Részletesebben

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti

Részletesebben

KÖZVETLEN BRÜSSZELI FORRÁS PÁLYÁZATI TÁJÉKOZTATÓ

KÖZVETLEN BRÜSSZELI FORRÁS PÁLYÁZATI TÁJÉKOZTATÓ KÖZVETLEN BRÜSSZELI FORRÁS PÁLYÁZATI TÁJÉKOZTATÓ Program Horizon 2020 Pályázat megnevezése (magyar) Pályázat megnevezése (angol) Pályázat kódja Az egészségügyi biotechnológia szektor innovatív kis- és

Részletesebben

Biomolekuláris nanotechnológia. Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium

Biomolekuláris nanotechnológia. Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium Biomolekuláris nanotechnológia Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium Az élő szervezetek példája azt mutatja, hogy a fehérjék és nukleinsavak kiválóan alkalmasak önszerveződő molekuláris

Részletesebben

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.)

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.) Genomika Új korszak, paradigmaváltás, forradalom: a teljes genomok ismeretében a biológia adatokban gazdag tudománnyá válik. Új kutatási módszerek, új szemlélet. Hajtóerõk: Genomszekvenálási projektek

Részletesebben

A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete)

A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete) A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete) I. Ritka Betegség regiszterek Európában II. Ritka betegség regiszterek

Részletesebben

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

Élettudományi Kollégium 2014/1 K

Élettudományi Kollégium 2014/1 K KISOR K 112807 Ábrahám István: A nem-klasszikus ösztrogén jelátvivő pályaaktivátorok neuroprotektív mechanizmusa basalis előagyi kolinerg neuronokban: új hatóanyagok vizsgálata (Pécsi Tudományegyetem)

Részletesebben

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához?

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Falus András Genetikai, Sejt- és Immunbiológiai Intézet Semmelweis Egyetem Antal Péter Hadadi Éva

Részletesebben

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi

Részletesebben

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók

Részletesebben

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Finanszírozási Mechanizmus által támogatott projekt Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Alap támogatással javul

Részletesebben

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár

Részletesebben

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi

Részletesebben

A replikáció mechanizmusa

A replikáció mechanizmusa Az öröklődés molekuláris alapjai A DNS megkettőződése, a replikáció Szerk.: Vizkievicz András A DNS-molekula az élőlények örökítő anyaga, kódolt formában tartalmazza mindazon információkat, amelyek a sejt,

Részletesebben

Genetika 2. előadás. Bevezető

Genetika 2. előadás. Bevezető Genetika 2. előadás Genetikai alapelvek: hogyan öröklődnek a tulajdonságok Mendeli genetika Bevezető Mi okozza a hasonlóságokat és különbségeket a családtagok között? Gének: biológiai információ alapegysége

Részletesebben

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Magyarósi Szilvia Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem DEMIN 2014. május 22.

Részletesebben

Molekuláris terápiák

Molekuláris terápiák Molekuláris terápiák Aradi, János Balajthy, Zoltán Csősz, Éva Scholtz, Beáta Szatmári, István Tőzsér, József Varga, Tamás Szerkesztette Balajthy, Zoltán és Tőzsér, József, Debreceni Egyetem Molekuláris

Részletesebben

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5.

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. 0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. Az Élet keletkezése 6. Modellek a biológiában - csak az

Részletesebben

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése Kereskedelmi forgalomban kapható készülékek 1 Fogalmak

Részletesebben

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon

Részletesebben

Proteomkutatás egy új tudományág születése

Proteomkutatás egy új tudományág születése BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK Proteomkutatás egy új tudományág születése Tárgyszavak: humán genom; genomika; proteomika; kutatás; fehérjeszerkezet; háromdimenziós szerkezet; gyógyszeripar.

Részletesebben

A laboratóriumi medicina fejlődése az elmúlt 35 évben

A laboratóriumi medicina fejlődése az elmúlt 35 évben A laboratóriumi medicina fejlődése az elmúlt 35 évben Kovács L. Gábor egyetemi tanár, az MTA rendes tagja Pécsi Tudományegyetem 1976 2011? INTÉZETIGAZGATÓ PROFESSZOROK KLINIKAI KÉMIA 1976 Mérleg Spektrofotométer

Részletesebben

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté!

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté! Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában Kiss Máté! Magreceptor Kutató Laboratórium Biokémiai és Molekuláris Biológiai Intézet Debreceni Egyetem, Általános Orvostudományi

Részletesebben

Méhes Károly Genetikai Továbbképző Napok. Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek

Méhes Károly Genetikai Továbbképző Napok. Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek Méhes Károly Genetikai Továbbképző Napok Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek Kötelező szinten tartó tanfolyam Pécs 2011. október 19-21 PROGRAMFÜZET Kedves Vendégeink!

Részletesebben

GOP 1.1.1 Project UDG Debreceni Egyetem kollaborációs munka

GOP 1.1.1 Project UDG Debreceni Egyetem kollaborációs munka GOP 1.1.1 Project UDG Debreceni Egyetem kollaborációs munka Dr. Csutak Adrienne PhD, MSc Debreceni Egyetem Szemklinika UD-GenoMed Kft. szakért! GOP 1.1.1 Depletáló kit fejlesztés könny proteomikai alkalmazásokhoz

Részletesebben

Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16.

Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16. Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16. Tracsek Ferenc igazgató Alapvető változások kora Az IT iparágban alapvető

Részletesebben

A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere

A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere Nagy Szabolcs 1 Benedek Zsuzsanna 2 Polgár J. Péter 3 Magnus Andersson 4 A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere Genetic background of scrotal and inguinal hernia in swine nagy.szabolcs@georgikon.hu

Részletesebben

DG(SANCO)/2012-6290-MR

DG(SANCO)/2012-6290-MR 1 Ensure official controls of food contaminants across the whole food chain in order to monitor the compliance with the requirements of Regulation (EC) No 1881/2006 in all food establishments, including

Részletesebben

Tudásmenedzsment és gyógyszerinnováció

Tudásmenedzsment és gyógyszerinnováció Tudásmenedzsment és gyógyszerinnováció Ipari szükségletek / elvárások Dr. Bátori Sándor Sanofi-aventis Innovatív Gyógyszerek Kutatása, MAGYOSZ, 2009.01.07. Alapvető együttm ttműködések Hosszútávú elhatározás:

Részletesebben

1. A megyében végzett jelentősebb kutatási témák, projektek ráfordításainak ágazati megoszlása (összesen 4 859 millió Ft-ról áll rendelkezésre adat):

1. A megyében végzett jelentősebb kutatási témák, projektek ráfordításainak ágazati megoszlása (összesen 4 859 millió Ft-ról áll rendelkezésre adat): Megyei statisztikai profil a Smart Specialisation Strategy (S3) megalapozásához c. dokumentum kiegészítése a Magyar Tudományos Akadémia adataival Csongrád megye Az alábbi dokumentum a Smart Specialisation

Részletesebben

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi

Részletesebben

7. Rendszerszemléletű biológia a kémikus szemével. Genomika, proteomika, metabolomika

7. Rendszerszemléletű biológia a kémikus szemével. Genomika, proteomika, metabolomika 7. Rendszerszemléletű biológia a kémikus szemével Genomika, proteomika, metabolomika 7. Rendszerszemléletű biológia Redukcionista vs. Holisztikus szemlélet A rendszerszemléletű biológia (systems biology)

Részletesebben

Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék

Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék PATOGÉN MIKROORGANIZMUSOK KIMUTATÁSÁRA SZOLGÁLÓ GYORS MÓDSZEREK ÖSSZEHASONLÍTÓ VIZSGÁLATA Rohonczy Kata Doktori

Részletesebben

TÁMOP-4.1.2-08/1/A-2009-0011 Tantárgy címe: Transzdifferenciáció és regeneratív medicina Dr. Balogh Péter és Dr. Engelmann Péter

TÁMOP-4.1.2-08/1/A-2009-0011 Tantárgy címe: Transzdifferenciáció és regeneratív medicina Dr. Balogh Péter és Dr. Engelmann Péter Előadás Előadás címe Dia Dia címe száma 1. Őssejtek és transzdifferenciáció: bevezetés, alapok 2. Őssejt-típusok, fenntartásuk és homeosztázisuk 3. Regeneráció állatmodellekben 2. Alapfogalmak 3. Őssejt-kutatás

Részletesebben

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Fehérjét kódol? Tulajdonságai? -Hol lokalizálódik? -Oldható? -3D szerkezete? -Accession #? -Annotációja elérhető? Már benne

Részletesebben

AZ ALACSONY HŐMÉRSÉKLET HATÁSÁRA BEKÖVETKEZŐ REDOX ÉS GÉNEXPRESSZIÓS VÁLTOZÁSOK GABONAFÉLÉKBEN

AZ ALACSONY HŐMÉRSÉKLET HATÁSÁRA BEKÖVETKEZŐ REDOX ÉS GÉNEXPRESSZIÓS VÁLTOZÁSOK GABONAFÉLÉKBEN A martonvásári agrárkutatások hatodik évtizede AZ ALAONY HŐMÉRSÉKLET HATÁSÁRA BEKÖVETKEZŐ REDOX ÉS GÉNEXPRESSZIÓS VÁLTOZÁSOK GABONAFÉLÉKBEN KOY GÁBOR, VÁGÚJFALVI ATTILA, TÓTH BALÁZS, SZALAI GABRIELLA,

Részletesebben

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban 11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban HIV fertőzés kimutatása - (fiktív) esettanulmány 35 éves nő, HIV fertőzöttség gyanúja. Két partner az elmúlt időszakban. Fertőzött-e

Részletesebben

2016 év eleji ajánlatok. Speciális áraink 2016 május 31-ig érvényesek!

2016 év eleji ajánlatok. Speciális áraink 2016 május 31-ig érvényesek! 2016 év eleji ajánlatok Speciális áraink 2016 május 31-ig érvényesek! BIOBASE műszerek a NucleotestBio Kft. kínálatában! Steril box-ok, lamináris box-ok: Hűtők, fagyasztók, ultramélyhűtők, autoklávok,

Részletesebben

Best Practices for TrusBest Practices for Trusted Digital Repositories in HOPE. ted Digital Repositories in HOPE.

Best Practices for TrusBest Practices for Trusted Digital Repositories in HOPE. ted Digital Repositories in HOPE. Best Practices for TrusBest Practices for Trusted Digital Repositories in HOPE. ted Digital Repositories in HOPE. OAIS alapú digitális archívumok: best practice and HOPE (2010-2013) http://www.peoplesheritage.eu/pdf/d5_1_grant250549_ho

Részletesebben

eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program

eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program Agydaganatok sugárterápia iránti érzékenységének növelése génterápiás eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program Doktori

Részletesebben

A géntechnológia genetikai alapjai (I./3.)

A géntechnológia genetikai alapjai (I./3.) Az I./2. rész (Gének és funkciójuk) rövid összefoglalója A gének a DNS információt hordozó szakaszai, melyekben a 4 betű (ATCG) néhány ezerszer, vagy százezerszer ismétlődik. A gének önálló programcsomagként

Részletesebben

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26

Hamar Péter. RNS világ. Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. www.meetthescientist.hu 1 26 Hamar Péter RNS világ Lánczos Kornél Gimnázium, Székesfehérvár, 2014. október 21. 1 26 Főszereplők: DNS -> RNS -> fehérje A kód lefordítása Dezoxy-ribo-Nuklein-Sav: DNS az élet kódja megkettőződés (replikáció)

Részletesebben

Genetika és epigenetika: gének és környezet. Az ikerkutatások epigenetikai vonatkozásai

Genetika és epigenetika: gének és környezet. Az ikerkutatások epigenetikai vonatkozásai Genetika és epigenetika: gének és környezet. Az ikerkutatások epigenetikai vonatkozásai Melicher Dóra Ikerkutatás, epigenetika és radiogenomika PhD kurzus 2015/16 7-8. óra 2016.02.23. Az emberi genom Az

Részletesebben

ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan

ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan 02/15/39/2008 ANIMAL HEALTH CERTFICATE for the exportation of rodents from the Republic of Hungary to Japan ÁLLATEGÉSZSÉGÜGYI BIZONYÍTVÁNY rágcsálók Magyar Köztársaságból Japánba történő exportjához Number

Részletesebben

Nemzeti Akkreditáló Testület. BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület BŐVÍTETT RÉSZLETEZŐ OKIRAT (1) a NAT-1-1668/2012 nyilvántartási számú akkreditált státuszhoz Az Országos Epidemiológiai Központ Virológiai főosztály (1097 Budapest, Albert

Részletesebben

A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE

A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE KARSZTFEJLŐDÉS XIX. Szombathely, 2014. pp. 137-146. A BÜKKI KARSZTVÍZSZINT ÉSZLELŐ RENDSZER KERETÉBEN GYŰJTÖTT HIDROMETEOROLÓGIAI ADATOK ELEMZÉSE ANALYSIS OF HYDROMETEOROLIGYCAL DATA OF BÜKK WATER LEVEL

Részletesebben

ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma, 1979-1983

ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma, 1979-1983 ÖNÉLETRAJZ Személyes adatok Név: Születési hely: Széll Márta Szeged Születési idő: 1965. március 28. Családi állapota: férjezett (Dr. Balogh Nándor) Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997)

Részletesebben

Támogatóink: Neurogenetikai Társaság. X. Konferenciája. Budapest. 2011. December 2-3. Genzyme Europe B.V. Képviselet. Társrendező:

Támogatóink: Neurogenetikai Társaság. X. Konferenciája. Budapest. 2011. December 2-3. Genzyme Europe B.V. Képviselet. Társrendező: MEGHÍVÓ Regisztrációs díj: MNKT tagoknak: 23.000 Ft Nem tagoknak 27.000 Ft Rezidenseknek, PhD hallgatóknak, nyugdíjasoknak: 16.000 Ft Helyszíni regisztráció: 35.000 Ft A regisztrációs díj tartalmazza az

Részletesebben

Egyetemi doktori (PhD) értekezés tézisei

Egyetemi doktori (PhD) értekezés tézisei Egyetemi doktori (PhD) értekezés tézisei HUMÁN PAPILLOMAVÍRUS 16 E6 ÉS E7 ONKOPROTEINEK HATÁSA A KERATINOCITÁK DIFFERENCIÁLÓDÁSÁBAN RÉSZTVEVŐ GÉNEK TRANSZKRIPCIÓS SZABÁLYOZÁSÁRA Oraveczné Gyöngyösi Eszter

Részletesebben

10. CSI. A molekuláris biológiai technikák alkalmazásai

10. CSI. A molekuláris biológiai technikák alkalmazásai 10. CSI. A molekuláris biológiai technikák alkalmazásai A DNS mint azonosító 3 milliárd bázispár az emberi DNS-ben (99.9%-ban azonos) 0.1%-nyi különbség elegendő az egyedek megkülönböztetéséhez Genetikai

Részletesebben

Az emberi erőforrás értéke

Az emberi erőforrás értéke Szabó László SZABÓ LÁSZLÓ Az emberi erőforrás értéke A génvizsgálat, mint egészségügyi prevenció Az emberi tényező fontos elem a stratégiai kezdeményezésekben, a versenyelőny megszerzésében és megtartásában.

Részletesebben

A MAGZATI SEJTEKBŐL VÉGZETT JÖVŐBELI NONINVAZÍV DIAGNOSZTIKA KIBONTAKOZÁSÁNAK ELSŐ LÉPÉSEI. Doktori (Ph.D.) értekezés tézisei

A MAGZATI SEJTEKBŐL VÉGZETT JÖVŐBELI NONINVAZÍV DIAGNOSZTIKA KIBONTAKOZÁSÁNAK ELSŐ LÉPÉSEI. Doktori (Ph.D.) értekezés tézisei A MAGZATI SEJTEKBŐL VÉGZETT JÖVŐBELI NONINVAZÍV DIAGNOSZTIKA KIBONTAKOZÁSÁNAK ELSŐ LÉPÉSEI Doktori (Ph.D.) értekezés tézisei Készítette: Dr. Nagy Gyula Richárd Témavezető: Dr. Papp Zoltán egyetemi tanár

Részletesebben

AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, TILLING

AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, TILLING Hagyomány és haladás a növénynemesítésben AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, BÁLINT ANDRÁS FERENC 1, SZIRA FRUZSINA 1, ANDREAS BÖRNER 2, KERSTIN

Részletesebben

és biztonságoss Prof. Dr. János J CHMP member Hungary

és biztonságoss Prof. Dr. János J CHMP member Hungary Gyógyszerek hatásoss sossága és biztonságoss gosságaga Prof. Dr. János J Borvendég CHMP member Hungary A ma gyógyszerkutat gyszerkutatásának legfontosabb célbetegségei: gei: malignus betegségek gek cardiovascularis

Részletesebben

96/2009. (IX. 24.) számú hat. A SEMMELWEIS EGYETEM BIOBANK HÁLÓZATÁNAK MŐKÖDÉSI RENDJE IDEIGLENES SZABÁLYOZÁS

96/2009. (IX. 24.) számú hat. A SEMMELWEIS EGYETEM BIOBANK HÁLÓZATÁNAK MŐKÖDÉSI RENDJE IDEIGLENES SZABÁLYOZÁS 96/2009. (IX. 24.) számú hat. A SEMMELWEIS EGYETEM BIOBANK HÁLÓZATÁNAK MŐKÖDÉSI RENDJE IDEIGLENES SZABÁLYOZÁS BUDAPEST 2009 Semmelweis Egyetem S z e n á t u s á n a k 96/2009. (IX. 24.) számú h a t á r

Részletesebben

KÉPI INFORMÁCIÓK KEZELHETŐSÉGE. Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet. Összefoglaló

KÉPI INFORMÁCIÓK KEZELHETŐSÉGE. Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet. Összefoglaló KÉPI INFORMÁCIÓK KEZELHETŐSÉGE Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet Összefoglaló Tanórákon és az önálló tanulás részeként is, az informatika világában a rendelkezésünkre álló óriási mennyiségű

Részletesebben

Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata

Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata Doktori értekezés tézisei Türk Dóra Témavezető: Dr. Szakács Gergely MTA TTK ENZIMOLÓGIAI INTÉZET

Részletesebben

Adatkezelő szoftver. Továbbfejlesztett termékvizsgálat-felügyelet Fokozott minőség és gyártási hatékonyság

Adatkezelő szoftver. Továbbfejlesztett termékvizsgálat-felügyelet Fokozott minőség és gyártási hatékonyság Adatkezelő szoftver ProdX Inspect szoftver Fokozott termelékenység Páratlan termékminőség Magas fokú biztonság Teljesen átlátható folyamatok Továbbfejlesztett termékvizsgálat-felügyelet Fokozott minőség

Részletesebben

TRANSZGENERÁCIÓS EPIGENEZIS. 2016. 03. 29. Dr. Tóth Sára Semmelweis Egyetem Genetikai, Sejt- és Immunbiológiai Intézet

TRANSZGENERÁCIÓS EPIGENEZIS. 2016. 03. 29. Dr. Tóth Sára Semmelweis Egyetem Genetikai, Sejt- és Immunbiológiai Intézet TRANSZGENERÁCIÓS EPIGENEZIS 2016. 03. 29. Dr. Tóth Sára Semmelweis Egyetem Genetikai, Sejt- és Immunbiológiai Intézet EPIGENETIKA Olyan jelenségekkel foglalkozik, amelyek következtében anélkül nő a genom

Részletesebben

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós

A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós A HUMÁNGENETIKA LEGÚJABB EREDMÉNYEI Péterfy Miklós Összefoglalás A humángenetika korunk egyik legdinamikusabban fejlődő tudományága. Ennek a fejlődésnek legfőbb mozgatórugója az, hogy a humángenetika,

Részletesebben

Génkifejeződési vizsgálatok. Kocsy Gábor

Génkifejeződési vizsgálatok. Kocsy Gábor Génkifejeződési vizsgálatok MTA Mezőgazdasági Kutatóintézete Növényi Molekuláris Biológia Osztály A génkifejeződés A sejtmag géneket tartalmaz; (fehérjéket, RNSeket kódoló); A gének átíródnak mrns; Pre-mRNS

Részletesebben

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 NÖVÉNYÉLETTAN Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Sejtfal szintézis és megnyúlás Környezeti tényezők hatása a növények növekedésére és fejlődésére Előadás áttekintése

Részletesebben

Az interjú id pontja: Kezel hely kódszáma: Interjúkészít kódszáma: A kérdez súlyosság-értékelése. Név: A kliens kódja:

Az interjú id pontja: Kezel hely kódszáma: Interjúkészít kódszáma: A kérdez súlyosság-értékelése. Név: A kliens kódja: Név: A kliens kódja: Az interjú id pontja: Kezel hely kódszáma: Interjúkészít kódszáma: év hó nap A kérdez súlyosság-értékelése 0-1 Valódi probléma nem áll fenn /nincs szükség segítségre 2-3 Kevésbé súlyos

Részletesebben

AZ IS30 BAKTERIÁLIS INSZERCIÓS ELEM CÉLSZEKVENCIA VÁLASZTÁSÁNAK MOLEKULÁRIS TÉNYEZŐI DOKTORI ÉRTEKEZÉS TÉZISEI SZABÓ MÓNIKA

AZ IS30 BAKTERIÁLIS INSZERCIÓS ELEM CÉLSZEKVENCIA VÁLASZTÁSÁNAK MOLEKULÁRIS TÉNYEZŐI DOKTORI ÉRTEKEZÉS TÉZISEI SZABÓ MÓNIKA AZ IS30 BAKTERIÁLIS INSZERCIÓS ELEM CÉLSZEKVENCIA VÁLASZTÁSÁNAK MOLEKULÁRIS TÉNYEZŐI DOKTORI ÉRTEKEZÉS TÉZISEI SZABÓ MÓNIKA Gödöllő 2007. 1 A Doktori Iskola megnevezése: Szent István Egyetem Biológia Tudományi

Részletesebben

A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán

A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán Doktori értekezés tézisei Dr. Mayer László Semmelweis Egyetem Mentális Egészségtudományok

Részletesebben

HTS (High Throughput Screening) Lehetőségek a Debreceni Egyetemen. DE OEC Orvosi Vegytani Intézet

HTS (High Throughput Screening) Lehetőségek a Debreceni Egyetemen. DE OEC Orvosi Vegytani Intézet HTS in HTS (High Throughput Screening) Lehetőségek a Debreceni Egyetemen Virág László DE OEC Orvosi Vegytani Intézet ET III. emelet BIO MMKK DE-BIK Mi a HTS? Robotizált mintamozgatási, műszeres mérési

Részletesebben

A metabolikus szindróma epidemiológiája a felnőtt magyar lakosság körében

A metabolikus szindróma epidemiológiája a felnőtt magyar lakosság körében DEBRECENI EGYETEM ORVOS- ÉS EGÉSZSÉGTUDOMÁNYI CENTRUM NÉPEGÉSZSÉGÜGYI KAR A metabolikus szindróma epidemiológiája a felnőtt magyar lakosság körében HMAP munkaértekezletek 2009 A METABOLIKUS SZINDRÓMA EPIDEMIOLÓGI

Részletesebben

Minőségbiztosítás, validálás

Minőségbiztosítás, validálás Minőségbiztosítás, validálás Előzetes tanulmányok (BSc): Műszeres analitika gyakorlatok inorg.unideb.hu/oktatas Kapcsolódó tanulmányok (MSc): Minőségbiztosítás című előadás Tételek: 1. Minőségbiztosítási

Részletesebben

BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ

BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ BUDAPEST 2006. május 4-6. V. Magyar Sejtanalitikai Konferencia Molekuláris medicina: Sejtanalitika Innováció Alkalmazás ÉRTESÍTÔ V. M A G Y A R S E J T A N A L I T I K A I K O N F E R E N C I A M O L E

Részletesebben

SZARVASMARHÁK MENTESÍTÉSÉNEK KÖLTSÉG-HASZON ELEMZÉSE I. ÓZSVÁRI LÁSZLÓ dr. - BÍRÓ OSZKÁR dr. ÖSSZEFOGLALÁS

SZARVASMARHÁK MENTESÍTÉSÉNEK KÖLTSÉG-HASZON ELEMZÉSE I. ÓZSVÁRI LÁSZLÓ dr. - BÍRÓ OSZKÁR dr. ÖSSZEFOGLALÁS SZARVASMARHÁK MENTESÍTÉSÉNEK KÖLTSÉG-HASZON ELEMZÉSE I. ÓZSVÁRI LÁSZLÓ dr. - BÍRÓ OSZKÁR dr. ÖSSZEFOGLALÁS A politikai és gazdasági rendszerváltás gyors és sok vonatkozásban nem várt változásokat eredményezett

Részletesebben

Orvosi laboratóriumi és képalkotó diagnosztikai analitikus alapszak. A szak képzési és kimeneti követelményei a 15/2006. (IV. 3.) OM rendelet alapján:

Orvosi laboratóriumi és képalkotó diagnosztikai analitikus alapszak. A szak képzési és kimeneti követelményei a 15/2006. (IV. 3.) OM rendelet alapján: Debreceni Egyetem Egészségügyi Főiskolai Kar Orvosi laboratóriumi és képalkotó diagnosztikai analitikus alapszak A szak képzési és kimeneti követelményei a 15/2006. (IV. 3.) OM rendelet alapján: 1. Az

Részletesebben

A minta feldolgozásának alternatívái malignus lymphomák molekuláris diagnosztikájában

A minta feldolgozásának alternatívái malignus lymphomák molekuláris diagnosztikájában A minta feldolgozásának alternatívái malignus lymphomák molekuláris diagnosztikájában Méhes Gábor DEOEC Pathologiai Intézet Debrecen MPT 69. Kongresszusa, Siófok, 2010 A sebészi minta (pl. nyirokcsomó)

Részletesebben

BIOINFORMATIKA Ungvári Ildikó

BIOINFORMATIKA Ungvári Ildikó 1 BIOINFORMATIKA Ungvári Ildikó Az elmúlt évtizedekben a molekuláris biológiai, genomikai technológiák robbanásszerű fejlődése a biológiai adatok mennyiségének exponenciális növekedéséhez vezetett. Ebben

Részletesebben

A Védelem Egészségügyi Laboratóriumi Intézet tevékenységének a bemutatása

A Védelem Egészségügyi Laboratóriumi Intézet tevékenységének a bemutatása A Védelem Egészségügyi Laboratóriumi Intézet tevékenységének a bemutatása Veress Enikő őrnagy főtiszt, minőségirányítási megbízott Mályi, 2014.Október 02. Előadás tematika 1. Az MH EK szervezetének bemutatása

Részletesebben

Hogyan növelhető a lombikbébi program hatékonysága?

Hogyan növelhető a lombikbébi program hatékonysága? Hogyan növelhető a lombikbébi program hatékonysága? Dr Bálint Bálint László Prelife Kft Debrecen Bizonyára mindannyian ismerünk olyan házaspárt aki évek óta időt, pénzt és fáradtságot nem kímélve igyekszik

Részletesebben

Hazai méhészeti genomikai és genetikai vizsgálatok

Hazai méhészeti genomikai és genetikai vizsgálatok AKÁCKÖRÚTON Hazai méhészeti genomikai és genetikai vizsgálatok Előző cikkünkben arról írtunk, milyen új eszköztárral rendelkezünk a XXI. században a genetikai vizsgálatok területén, és mit adhat a molekuláris

Részletesebben