Klinikai Genomikai és Személyre Szabott Orvoslási Központ. Tudományos Hétf!

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Klinikai Genomikai és Személyre Szabott Orvoslási Központ. Tudományos Hétf!"


1 Klinikai Genomikai és Személyre Szabott Orvoslási Központ 2012 Tudományos Hétf!

2 Biomarker azonosítás feltételei: eszközök, készségek és kollaboráció Minták, Vizsgálatok, Beteg adatok Klinikus + bioinfo Diagnosztikai kiválóság Klinikus Sikeres biomarker program Minta vizsgálati eszközök Mol biol labor Információs kincs Molekuláris biológiai jártasság Klinikus+mol biol

3 Biomarkerek használatával Betegbiztonság növekszik Toxicitási Biomarkerek Beteg specifikus Biomarkerek PHC Hatékonysági Biomarkerek Betegség specifikus Biomarkerek Kezelés hatékonyság növekszik

4 Mi az epigenetika? epi- [!"#] túl, fölött, mellett gennó [$!%%&], nemzeni, életet adni

5 Mi az epigenetika? Tágan értelmezve: TRANSZKRIPCIÓ SZABÁLYOZÁS DNS nukleotid sorrendjét nem befolyásoló de a génexpressziót befolyásoló tényez'k összessége Sz(ken értelmezve: ÖRÖKL)DÉS DNS bázissorrendjében nem kódolt, sejt vagy él'lény szinten örökl'd' tényez'k összessége

6 Valódi epigenetikai hatáshoz három generáció nyomonkövetése szükséges

7 Transzkripció szabályozás szintjei: kromatin szinten szabályozott a fehérjék hozzáférése a DNS-hez DNS metiláció replikáció során propagálódik Módosított hisztonvégek fehérjék kapcsolódását szabályozzák Szabályozó RNS molekulák módosíthatják a transzkripciót

8 DNS metilációs mintázat örökl'dése

9 Anyai babusgatás életen át tartó hatása DNS metiláció és hiszton módosítások változnak a babusgatás hatására és a következmények életen át tartanak. Következmény: bátrabbak és jobban tolerálják a stressz szignálokat. HDAC inhibitorral visszafordítható hatás. Nevel'anya cserével a hatás is cserél'dik tehát nem genetikai hatás.

10 Epi allélek Agouti vy Jirtle NRG 2007

11 Epi allél eltolódás diétás hatásra

12 Az epi allélek közös nevez'je a transzpozon jelenléte. A transzpozonok ellen a sejt epigenetikai csendesítéssel védekezik. Az epigenetika módosítások szétterjednek nagy genomi szakaszokon, ezáltal csendesítik a beekel'dött szakaszokat, pl. transzpozonokat.

13 Transzpozonok és DNS metiláció Fred Gage (Salk Institute): 1. A genom 20% L1 (LINE1) traszpozonból áll 2. A neuronális differenciáció els' fázisában az L1 transzpozonok rövid ideig aktiválódnak 3. Az L1 aktivitás összefügg a neuroplaszticitással (hipokampuszban 8x nagyobb marad) 4. A DNS metiláció a MECP2 Metil DNS köt' fehérjén keresztül csendesíti a transzpozonokat a HDAC1 és SOX2 komplex segítségével. RETT szindrómában nem m(ködik a DNS metiláció függ' gátlás: 1. Általános neuronális differenciációs zavar születés utáni években. 2. Emelkedett L1 transzpozon aktivitás.

14 Terápiás szerek amelyek epigenetikai útvonalakon keresztül hatnak: DNS metiláció gátlószerek: Azacytidine és deoxyazacytidine (FDA jovahagyas Mielodiszpláziás szindrómában) HDAC inhibítorok: Vorinostat (FDA jóváhagyott T sejt limfomára) Romidepsin (FDA 2009) Valproát egyéb Biomarker térképezések: Epigenom projektek, Methylome projektek


16 A több nyelven írt genom Tripletek nyelve Kötöhelyek kódja

17 Három szintje a transzkripciós esemény vizsgálatának Genomi köt'helyek RNS profil Proteom profil

18 Hisztonvég Módosítások H3 H4 Acetyl K Methyl R Methyl K Phos. S Ubiq. K H2A C-term H H H2B H2A Turner: Cell 2002 (111)285.


20 Automatizált CHIP a maximális reprodukálhatóságért IP-Star Magnetic ChIP

21 Illumina HiScan SQ= 150 Giga bázis/ futás 1 humán genom/ futás 30X lefedettséggel / 48 teljes transzkriptóm RNA-Seq / 24 exom-seq minta

22 P300 binding to enhancers is detectable by monitoring H3K27 acetylation C57Bl6: MCSF+IL4 Replicate C57Bl6: MCSF+IL4 Adipo PPRE Technical Replicates of Library preparation and sequencing ChIP Seq results of technical replicates show sharp signal on the CORE PROMOTER of ap2, and a widely expanded region on the well described ENHANCER ELEMENT (adipo PPRE).

23 Citogenetika Affymetrix Rendszereken

24 Traditional Cytogenetics Traditional Cytogenetic Techniques Excellent and robust techniques Their limitations are well recognised (resolution, variability in sample preparation)

25 Microarrays revolutionizing Cytogenetics "increased resolution of microarray technology over conventional cytogenetic analysis allows for identification of chromosomal imbalances with greater precision, accuracy, and technical sensitivity. Within the last 3 years, the cytogenetics community has refined: Array design and content requirements Consensus of clinically important regions and genes Resolution requirements: " Clinical regions " Other genes " Genomic backbone The value of heterozygosity data The value of SNP genotypes

26 Classical Cytogenetics and Microarrays Whole Genome Low Res Targeted Hi Res + Dx Yield = 3% Karyotype FISH =Confirmatory Microarray-Based Cytogenetics Simpler & more reliable Standardized workflow More information per test Quicker time to result 3 days versus 7 days Quantitative vs subjective Less expensive High earning potential for labs Dx Yield = 20%

27 Guidelines are available! All CNVs detected, regarding of size shall be reported! Most relevant CNVs, regions are rich in gene content! Small unknown CNVS should be reported including all the RefSeq genes in the region " Microarrays should detect gains & losses >400kb "Desirable to have good coverage along the genome and in clinical relevant genes " SNPs are important to detect regions of homozygocity, UPD and mosaicism.

28 The targeted plus genome-wide design Schematic of genomic region Known pathological variant Gene Known pathological variant Gene Microarray marker density

29 Simple chromosome visualisation Data types Files list

30 Fejlesztéseink UPL alapú mérési rendszerek (QPCR és mirns) Nagy átereszt! képesség# új generációs szekvenálási techonlógiák (DNS metilációs és epigenetikai profilírozás) Fehérje/ antitest el!állítási szolgáltatás (Keresztessy Zsolt)

31 UPL alapú oligó tervezés mirns detektálásra Astrid Research

32 Assay tervez' eredmény oldala

33 UPL alapú oligó tervezés mirns detektálásra Hsa-mir-181a: AACAUUCAACGCUGUCGGUGAGU Hsa-mir-181b: AACAUUCAUUGCUGUCGGUGGGU Hsa-mir-181c: AACAUUCAAC*CUGUCGGUGAGU Czimmerer Zsolt, UDGenomed

34 UPL alapú oligó tervezés mirns detektálásra (egér szív) Czimmerer Zsolt

35 Vállalásaink Mit tudunk vállalni: 1. Gyakorlati segítség a kísérlet megtervezéséhez 2. Gyakorlati segítség az els!dleges adat elemzéshez 3. Speciális protokolok ismertetése 4. M#szerhasználat, hozzáférés 5. Közös projekt esetén biobankolási rendszer megtervezése felállítása 6. Közös pályázat kofinanszirozásra Beteg Klinikai minta Minta feldolgozás, Mérés Statiszt ika Ellátási kérdések Kutatási kérdések Eredmények értelmezése Publikáció

36 Vállalásaink Mit NEM tudunk vállalni: 1. Nagy érték# reagensek finanszirozása 2. Méréseken túli kísérletek végrehajtása 3. Eredmények másodlagos és harmadlagos analízise és értelmezése 4. Biobank felállítása pályázati vagy más finanszirozási háttér nélkül Beteg Klinikai minta Minta feldolgozás, Mérés Statiszt ika Ellátási kérdések Kutatási kérdések Eredmények értelmezése Publikáció

37 Finanszirozás/Kollaboráció Minden készülékünk használati díja csak a karbantartást és fogyóeszközök árát fedezi (Roche QPCR üzembérleti díja csökkent) Szekvenálási díj nagyobb volumennél csökkenthet! Affymetrix szolgáltatás díja nagyrészt a reagensek díját fedezik Kifizetett szolgáltatásnál nem javasoljuk a társ szerz!séget, de kérjük az anyagok, módszereknél való megemlítést Kollaboratív projekteknél el!re írásban meghatározandó: finanszírozási forrás, résztvev!k feladatai, projekt vezet! személye és a projekt befejezésének a várható id!pontja Finanszirozási nehézségek esetén lehetséges megoldás a közös pályázás

38 Összefoglalás 2 Általános információk: " (fejlesztés alatt) M#szer naptár: " Elérhet!ség: "

39 Scholtz Beáta (Biobanking) Keresztessy Zsolt (Citokin/Antitest) Póliska Szilárd (kapilláris szekvenálás, Affymetrix) Gyuris Tibor (Illumina szekvenálás) Zahuczky Gábor (UDGenomed)

40 Köszönet Debreceni Egyetem Barta Endre Gyuris Tibor Pap Attila Dániel Bence Balogh Marika Pallér Ádám Astrid Research: Steiner Laszló Laczik Miklós Nagy Otto DIAGENODE SA: Ignacio Mazon Dominique Poncelet Dider Allaer Nagy László EMBL Genomics Core Facility Vladimir Benes

41 Köszönöm a figyelmet!!!

Klinikai Genomika Központ Biobankok

Klinikai Genomika Központ Biobankok Klinikai Genomika Központ Biobankok Dr. Scholtz Beáta Célunk: Tudásbázis és laboratóriumi infrastuktúra a Debreceni Egyetem biobank projektjeihez Egy biobank felállításának folyamata 1. Miben tud közreműködni


Epigenetikai Szabályozás

Epigenetikai Szabályozás Epigenetikai Szabályozás Kromatin alapegysége a nukleoszóma 1. DNS Linker DNS Nukleoszóma mag H1 DNS 10 nm 30 nm Nukleoszóma gyöngy (4x2 hiszton molekula + 146 nukleotid pár) 10 nm-es szál 30 nm-es szál



ADATBÁNYÁSZAT I. ÉS OMICS Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére TÁMOP-4.1.1.C-13/1/KONV-2014-0001 ADATBÁNYÁSZAT


Klinikai Genomikai és Személyreszabott Orvoslási Központ. Biobankok. Dr. Scholtz Beáta

Klinikai Genomikai és Személyreszabott Orvoslási Központ. Biobankok. Dr. Scholtz Beáta Klinikai Genomikai és Személyreszabott Orvoslási Központ Biobankok Dr. Scholtz Beáta Célunk: Tudásbázis és laboratóriumi infrastuktúra a Debreceni Egyetem biobank projektjeihez Egy biobank felállításának


Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May

Orvosi Genomtudomány 2014 Medical Genomics 2014. Április 8 Május 22 8th April 22nd May Orvosi Genomtudomány 2014 Medical Genomics 2014 Április 8 Május 22 8th April 22nd May Hét / 1st week (9. kalendariumi het) Takács László / Fehér Zsigmond Magyar kurzus Datum/ido Ápr. 8 Apr. 9 10:00 10:45


A genomikai oktatás helyzete a Debreceni Egyetemen

A genomikai oktatás helyzete a Debreceni Egyetemen A genomikai oktatás helyzete a Debreceni Egyetemen Bálint Bálint L. GNTP Oktatás és Tudásmenedzsment Munkabizottság, 2009. június 10. Tények Debreceni Egyetemről 21000 nappali és 33000 összes hallgató


Új utak az antipszichotikus gyógyszerek fejlesztésében

Új utak az antipszichotikus gyógyszerek fejlesztésében Új utak az antipszichotikus gyógyszerek fejlesztésében SCHIZO-08 projekt Dr. Zahuczky Gábor, PhD, ügyvezető igazgató UD-GenoMed Kft. Debrecen, 2010. november 22. A múlt orvostudománya Mindenkinek ugyanaz


Új temékek az UD-GenoMed Kft. kínálatában!

Új temékek az UD-GenoMed Kft. kínálatában! Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai


Diagnosztikai célú molekuláris biológiai vizsgálatok

Diagnosztikai célú molekuláris biológiai vizsgálatok Diagnosztikai célú molekuláris biológiai vizsgálatok Dr. Patócs Attila, PhD MTA-SE Molekuláris Medicina Kutatócsoport, Semmelweis Egyetem II. sz. Belgyógyászati Klinika Laboratóriumi Medicina Intézet Genetikai


Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi


Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű


VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti


The nontrivial extraction of implicit, previously unknown, and potentially useful information from data.

The nontrivial extraction of implicit, previously unknown, and potentially useful information from data. Budapesti Műszaki és Gazdaságtudományi Egyetem Méréstechnika és Információs rendszerek Tanszék Adatelemzés intelligens módszerekkel Hullám Gábor Adatelemzés hagyományos megközelítésben I. Megválaszolandó


mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6 Agilent 2100 Bioanalyzer mikrokapilláris gélelektroforézis rendszer G2943CA 2100 Bioanalyzer system forgalmazó: Kromat Kft. 1112 Budapest Péterhegyi u. 98. t:36 (1) 248-2110 www.kromat.hu bio@kromat.hu


VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti


Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében

Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Mangalica specifikus DNS alapú módszer kifejlesztés és validálása a MANGFOOD projekt keretében Szántó-Egész Réka 1, Mohr Anita 1, Sipos Rita 1, Dallmann Klára 1, Ujhelyi Gabriella 2, Koppányné Szabó Erika


GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás

GNTP. Személyre Szabott Orvoslás (SZO) Munkacsoport. Kérdőív Értékelő Összefoglalás GNTP Személyre Szabott Orvoslás (SZO) Munkacsoport Kérdőív Értékelő Összefoglalás Választ adott: 44 fő A válaszok megoszlása a válaszolók munkahelye szerint Személyre szabott orvoslás fogalma Kérdőív meghatározása:


Epigenetika kihívások az ökotoxikológiában

Epigenetika kihívások az ökotoxikológiában Epigenetika kihívások az ökotoxikológiában Bakonyi Gábor és Szabó Borbála Szent István Egyetem, Gödöllő Állattani és Állatökológiai Tanszék V. ÖKOTOXIKOLÓGIAI KONFERENCIA, MAGYAR ÖKOTOXIKOLÓGIAI TÁRSASÁG,


A genomiális medicina szép új világa

A genomiális medicina szép új világa A genomiális medicina szép új világa HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012 2014 2015. ÁPRILIS 16. Falus András Semmelweis Egyetem Genetikai Sejt és Immunbiológiai Intézet A medicina


Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem

Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem Tisztelt Hölgyem, Tisztelt Uram! Örömmel jelentjük be Önöknek, hogy a Genomikai Medicina és Ritka Betegségek Intézetének egyik új projektje azon betegségek genetikai hátterének feltérképezésére irányul,


DOKTORI ÉRTEKEZÉS TÉZISEI. Az MDR1 gén kromatin szerkezetének tanulmányozása gyógyszerérzékeny és gyógyszerrezisztens humán sejtekben.

DOKTORI ÉRTEKEZÉS TÉZISEI. Az MDR1 gén kromatin szerkezetének tanulmányozása gyógyszerérzékeny és gyógyszerrezisztens humán sejtekben. DOKTORI ÉRTEKEZÉS TÉZISEI Az MDR1 gén kromatin szerkezetének tanulmányozása gyógyszerérzékeny és gyógyszerrezisztens humán sejtekben Tóth Mónika Témavezető: Dr. Bálint Éva SZTE TTIK Biológia Doktori Iskola


RNS-ek. 1. Az ősi RNS Világ: - az élet hajnalán. 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek

RNS-ek. 1. Az ősi RNS Világ: - az élet hajnalán. 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek RNS-ek RNS-ek 1. Az ősi RNS Világ: - az élet hajnalán 2. Egy már ismert RNS Világ: - a fehérjeszintézis ben résztvevő RNS-ek 3. Egy újonnan felfedezett RNS Világ: - szabályozó RNS-ek 4. Transzkripció Ősi


TÉMAKÖRÖK. Ősi RNS világ BEVEZETÉS. RNS-ek tradicionális szerepben



Astrid research INC. Introducing

Astrid research INC. Introducing Astrid research INC. Introducing FACTSHEET Debrecen based 22 full time employees 6 researchers (life sciences), 13 software engineers, 3 economists) All employees have a a university degree and are able


A proteomika új tudománya és alkalmazása a rákdiagnosztikában

A proteomika új tudománya és alkalmazása a rákdiagnosztikában BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK A proteomika új tudománya és alkalmazása a rákdiagnosztikában Tárgyszavak: proteom; proteomika; rák; diagnosztika; molekuláris gyógyászat; biomarker;


Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai markerek kutatása

Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai markerek kutatása A 48750 OTKA pályázat eredményeit összefoglaló szakmai záróbeszámoló A pályázat címe Genomiális eltérések és génexpressszió közötti kapcsolat vizsgálata, melanomák metasztázisképzésére jellemző genetikai


A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban

A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban Összefoglaló közlemény 21 A funkcionális genomikai eszköztár szerepe az onkológiai kutatásokban Bálint Bálint L. 1, Nagy László 1,2 1 Debreceni Egyetem Orvos- és Egészségtudományi Centrum, Biokémiai és


A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék

A PET szerepe a gyógyszerfejlesztésben. Berecz Roland DE KK Pszichiátriai Tanszék A PET szerepe a gyógyszerfejlesztésben Berecz Roland DE KK Pszichiátriai Tanszék Gyógyszerfejlesztés Felfedezés gyógyszertár : 10-15 év Kb. 1 millárd USD/gyógyszer (beleszámolva a sikertelen fejlesztéseket)


I. A sejttől a génekig

I. A sejttől a génekig Gén A gének olyan nukleinsav-szakaszok a sejtek magjainak kromoszómáiban, melyek a szervezet működését és növekedését befolyásoló fehérjék szabályozásához és előállításához szükséges információkat tartalmazzák.


Humán genom variációk single nucleotide polymorphism (SNP)

Humán genom variációk single nucleotide polymorphism (SNP) Humán genom variációk single nucleotide polymorphism (SNP) A genom ~ 97 %-a két különböző egyedben teljesen azonos ~ 1% különbség: SNP miatt ~2% különbség: kópiaszámbeli eltérés, deléciók miatt 11-12 millió


A genetikai lelet értelmezése monogénes betegségekben

A genetikai lelet értelmezése monogénes betegségekben A genetikai lelet értelmezése monogénes betegségekben Tory Kálmán Semmelweis Egyetem, I. sz. Gyermekklinika A ~20 ezer fehérje-kódoló gén a 23 pár kromoszómán A kromoszómán található bázisok száma: 250M


DNS-szekvencia meghatározás

DNS-szekvencia meghatározás DNS-szekvencia meghatározás Gilbert 1980 (1958) Sanger 3-1 A DNS-polimerázok jellemzői 5'-3' polimeráz aktivitás 5'-3' exonukleáz 3'-5' exonukleáz aktivitás Az új szál szintéziséhez kell: templát DNS primer


10. Genomika 2. Microarrayek és típusaik

10. Genomika 2. Microarrayek és típusaik 10. Genomika 2. 1. Microarray technikák és bioinformatikai vonatkozásaik Microarrayek és típusaik Korrelált génexpresszió mint a funkcionális genomika eszköze 2. Kombinált megközelítés a funkcionális genomikában


Nagy áteresztő képességű SNP mérések hasznosítása. Dr. Szalai Csaba

Nagy áteresztő képességű SNP mérések hasznosítása. Dr. Szalai Csaba Nagy áteresztő képességű SNP mérések hasznosítása Dr. Szalai Csaba 1 2 SNP-k SNP = single nucleotide polymorphism = kb. pontmutáció Általában biallélikusak, általában funkcionálisan semlegesek Több mint


BD Vacutainer Molekuláris Diagnosztikai termékei

BD Vacutainer Molekuláris Diagnosztikai termékei BD Vacutainer Molekuláris Diagnosztikai termékei Andrea Süle, PhD Termékspecialista BD Diagnostics, Preanalytical Systems MOLSZE XI. Nagygyőlés, Pécs, 2009 augusztus 27-29. BD A BD egy orvostechnológiai


Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában

Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Finanszírozási Mechanizmus által támogatott projekt Közös stratégia kifejlesztése molekuláris módszerek alkalmazásával a rák kezelésére Magyarországon és Norvégiában Norvég Alap támogatással javul


A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete)

A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete) A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia (SE, Genomikai Medicina és Ritka Betegségek Intézete) I. Ritka Betegség regiszterek Európában II. Ritka betegség regiszterek


VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában

VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában VIII. Magyar Sejtanalitikai Konferencia Fény a kutatásban és a diagnosztikában Budapest, 2015. szeptember 3 5. Semmelweis Egyetem II. sz. Belgyógyászati Klinika, valamint I. sz. Patológiai és Kísérleti



KÖZVETLEN BRÜSSZELI FORRÁS PÁLYÁZATI TÁJÉKOZTATÓ KÖZVETLEN BRÜSSZELI FORRÁS PÁLYÁZATI TÁJÉKOZTATÓ Program Horizon 2020 Pályázat megnevezése (magyar) Pályázat megnevezése (angol) Pályázat kódja Az egészségügyi biotechnológia szektor innovatív kis- és


TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK


HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat

HAPMAP -2010 Nemzetközi HapMap Projekt. SNP GWA Haplotípus: egy kromoszóma szegmensen lévő SNP mintázat HAPMAP -2010 Nemzetközi HapMap Projekt A Nemzetközi HapMap Project célja az emberi genom haplotípus* térképének(hapmap; haplotype map) megszerkesztése, melynek segítségével katalogizálni tudjuk az ember


Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata

Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata Lymphoma sejtvonalak és gyerekkori leukémia (ALL) sejtek mikro RNS (mir) profiljának vizsgálata Dr. Nemes Karolina, Márk Ágnes, Dr. Hajdu Melinda, Csorba Gézáné, Dr. Kopper László, Dr. Csóka Monika, Dr.


Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.)

Genomadatbázisok Ld. Entrez Genome: Összes ismert genom, hierarchikus szervezésben (kromoszóma, térképek, gének, stb.) Genomika Új korszak, paradigmaváltás, forradalom: a teljes genomok ismeretében a biológia adatokban gazdag tudománnyá válik. Új kutatási módszerek, új szemlélet. Hajtóerõk: Genomszekvenálási projektek


2011. január április 10. IPK Gatersleben (Németország) május 17. Kruppa Klaudia

2011. január április 10. IPK Gatersleben (Németország) május 17. Kruppa Klaudia 2011. január 10. 2011. április 10. IPK Gatersleben (Németország) Gatersleben (G-life) Country State District Town Administration Germany Saxony-Anhalt Salzlandkreis Seeland Basic statistics Area 16.00



OTKA ZÁRÓJELENTÉS (F48921) OTKA ZÁRÓJELENTÉS (F48921) Salamon Dániel F48921 1. A korábbi munkáinkban leírt, jól karakterizált látens Epstein-Barr vírus (EBV) genomokat hordozó, I. látencia-típusú Rael és Mutu-BL-I-cl-216 Burkitt


Epigenetikai szabályozás

Epigenetikai szabályozás Epigenetikai szabályozás 1. A Transzkripció epigenetikai szabályozása Dia 1 A kromatin szerkezete A sejtciklus S fázisában egyetlen sejtben kb 4x1 méter hosszúságú DNS található 4x23 darabra vágva (4N


Élettudományi Kollégium 2014/1 K

Élettudományi Kollégium 2014/1 K KISOR K 112807 Ábrahám István: A nem-klasszikus ösztrogén jelátvivő pályaaktivátorok neuroprotektív mechanizmusa basalis előagyi kolinerg neuronokban: új hatóanyagok vizsgálata (Pécsi Tudományegyetem)


Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi


NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A

NÖVÉNYGENETIKA. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP /1/A NÖVÉNYGENETIKA Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 A citológia és a genetika társtudománya Citogenetika A kromoszómák eredetét, szerkezetét, genetikai funkcióját,


Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához?

Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Mely humán génvariációk és környezeti faktorok járulnak hozzá az allergiás megbetegedések kialakulásához? Falus András Genetikai, Sejt- és Immunbiológiai Intézet Semmelweis Egyetem Antal Péter Hadadi Éva


Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9

Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 Roche Personalised Healthcare Megfelelő kezelést az egyénnek 2009 szeptember 9 dr Kollár György Elvárás az egészségügytől Több hatékonyabb és biztonságosabb gyógyszer legyen elérhető 80 Kezelésre válaszolók


Biomolekuláris nanotechnológia. Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium

Biomolekuláris nanotechnológia. Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium Biomolekuláris nanotechnológia Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium Az élő szervezetek példája azt mutatja, hogy a fehérjék és nukleinsavak kiválóan alkalmasak önszerveződő molekuláris


Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására

Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Szalma Katalin Biológiai módszerek alkalmazása környezeti hatások okozta terhelések kimutatására Témavezető: Dr. Turai István, OSSKI Budapest, 2010. október 4. Az ionizáló sugárzás sejt kölcsönhatása Antone



A BIOLÓGIAI GYÓGY- SZEREK FEJLESZTÉSÉNEK FINANSZÍROZÁSA ÉS TERÁPIÁS CÉLTERÜLETEI Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére A BIOLÓGIAI GYÓGY- SZEREK FEJLESZTÉSÉNEK FINANSZÍROZÁSA


A replikáció mechanizmusa

A replikáció mechanizmusa Az öröklődés molekuláris alapjai A DNS megkettőződése, a replikáció Szerk.: Vizkievicz András A DNS-molekula az élőlények örökítő anyaga, kódolt formában tartalmazza mindazon információkat, amelyek a sejt,


Proteomkutatás egy új tudományág születése

Proteomkutatás egy új tudományág születése BIOTECHNOLÓGIAI FEJLESZTÉSI POLITIKA, KUTATÁSI IRÁNYOK Proteomkutatás egy új tudományág születése Tárgyszavak: humán genom; genomika; proteomika; kutatás; fehérjeszerkezet; háromdimenziós szerkezet; gyógyszeripar.


Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR)

Genomika. Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel. DNS szekvenálási eljárások. DNS ujjlenyomat (VNTR) Genomika (A genom, génállomány vizsgálata) Mutációk (SNP-k) és vizsgálatuk egyszerű módszerekkel DNS szekvenálási eljárások DNS ujjlenyomat (VNTR) DNS chipek statikus és dinamikus információk vizsgálata


Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon


GOP 1.1.1 Project UDG Debreceni Egyetem kollaborációs munka

GOP 1.1.1 Project UDG Debreceni Egyetem kollaborációs munka GOP 1.1.1 Project UDG Debreceni Egyetem kollaborációs munka Dr. Csutak Adrienne PhD, MSc Debreceni Egyetem Szemklinika UD-GenoMed Kft. szakért! GOP 1.1.1 Depletáló kit fejlesztés könny proteomikai alkalmazásokhoz


A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet

A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet A HUMÁN GENOM PROJEKT Sasvári-Székely Mária* Semmelweis Egyetem, Orvosi Vegytani, Molekuláris Biológiai és Pathobiokémiai Intézet *Levelezési cím: Dr. Sasvári-Székely Mária, Semmelweis Egyetem, Orvosi


Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai

Engedélyszám: 18211-2/2011-EAHUF Verziószám: 1. 2460-06 Humángenetikai vizsgálatok követelménymodul szóbeli vizsgafeladatai 1. feladat Ismertesse a gyakorlaton lévő szakasszisztens hallgatóknak a PCR termékek elválasztása céljából végzett analitikai agaróz gélelektroforézis során használt puffert! Az ismertetés során az alábbi


Genetika. Tartárgyi adatlap: tantárgy adatai

Genetika. Tartárgyi adatlap: tantárgy adatai Genetika Előadás a I. éves Génsebészet szakos hallgatók számára Tartárgyi adatlap: tantárgy adatai 2.1. Tantárgy címe Genetika 2.2. Előadás felelőse Dr. Mara Gyöngyvér, docens 2.3. Egyéb oktatási tevékenységek


DNS replikáció. DNS RNS Polipeptid Amino terminus. Karboxi terminus. Templát szál

DNS replikáció. DNS RNS Polipeptid Amino terminus. Karboxi terminus. Templát szál DNS replikáció DNS RNS Polipeptid Amino terminus Templát szál Karboxi terminus Szuper-csavarodott prokarióta cirkuláris DNS Hisztonok komplexe DNS hisztonokra történő felcsvarodása Hiszton-kötött negatív


Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai

Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése, diagnosztikai alkalmazásai Az áramlási citométer és sejtszorter felépítése és működése Kereskedelmi forgalomban kapható készülékek 1 Fogalmak


Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen

Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Biobank Hálózat kialakításának minőségügyi kérdései a Semmelweis Egyetemen Magyarósi Szilvia Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete Semmelweis Egyetem DEMIN 2014. május 22.


0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5.

0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. 0. Kurzusok tudnivalók 1. Az anyag - csak az írott anyagban 2. Az élet molekulái - csak az írott anyagban 3. Mi az Élet? 4. A Világ keletkezése 5. Az Élet keletkezése 6. Modellek a biológiában - csak az


Molekuláris terápiák

Molekuláris terápiák Molekuláris terápiák Aradi, János Balajthy, Zoltán Csősz, Éva Scholtz, Beáta Szatmári, István Tőzsér, József Varga, Tamás Szerkesztette Balajthy, Zoltán és Tőzsér, József, Debreceni Egyetem Molekuláris


Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár



BIG DATA ELEMZÉSEK LEHETŐSÉGEI BIG DATA ELEMZÉSEK LEHETŐSÉGEI A KÖRNYEZETVÉDELMI MODELLEZÉSBEN Dr. Torma A. 2015.11.13. 2015/11/13 Dr. TORMA A. >> Széchenyi István Egyetem 2 Tartalom 1. A Big Data fogalma 2. Pár érdekes adat a Big Data


A laboratóriumi medicina fejlődése az elmúlt 35 évben

A laboratóriumi medicina fejlődése az elmúlt 35 évben A laboratóriumi medicina fejlődése az elmúlt 35 évben Kovács L. Gábor egyetemi tanár, az MTA rendes tagja Pécsi Tudományegyetem 1976 2011? INTÉZETIGAZGATÓ PROFESSZOROK KLINIKAI KÉMIA 1976 Mérleg Spektrofotométer


Genetika 2. előadás. Bevezető

Genetika 2. előadás. Bevezető Genetika 2. előadás Genetikai alapelvek: hogyan öröklődnek a tulajdonságok Mendeli genetika Bevezető Mi okozza a hasonlóságokat és különbségeket a családtagok között? Gének: biológiai információ alapegysége


Hogyan lesznek új gyógyszereink? Bevezetés a gyógyszerkutatásba

Hogyan lesznek új gyógyszereink? Bevezetés a gyógyszerkutatásba Hogyan lesznek új gyógyszereink? Bevezetés a gyógyszerkutatásba Keserű György Miklós, PhD, DSc Magyar Tudományos Akadémia Természettudományi Kutatóközpont A gyógyszerkutatás folyamata Megalapozó kutatások


Méhes Károly Genetikai Továbbképző Napok. Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek

Méhes Károly Genetikai Továbbképző Napok. Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek Méhes Károly Genetikai Továbbképző Napok Genomika a gyakorló orvos számára: új módszerek, új eredmények, új trendek Kötelező szinten tartó tanfolyam Pécs 2011. október 19-21 PROGRAMFÜZET Kedves Vendégeink!


A Ritka Betegség Regiszterek szerepe a klinikai kutatásban

A Ritka Betegség Regiszterek szerepe a klinikai kutatásban A Ritka Betegség Regiszterek szerepe a klinikai kutatásban Magyarósi Szilvia Varga Noémi Ágnes Molnár Mária Judit SE Genomikai Medicina és Ritka Betegségek Intézete DEMIN XIII. 2013. május 29-31. Ritka


Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16.

Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16. Ön a megfelelő mennyiségű és minőségű információk alapján hozza meg döntéseit? Stratis Kft. / Autonomy üzleti reggeli / 2014.10.16. Tracsek Ferenc igazgató Alapvető változások kora Az IT iparágban alapvető


A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere

A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere Nagy Szabolcs 1 Benedek Zsuzsanna 2 Polgár J. Péter 3 Magnus Andersson 4 A sertések lágyék- és heresérv tünetegyüttesének genetikai háttere Genetic background of scrotal and inguinal hernia in swine nagy.szabolcs@georgikon.hu


Sejtmag, magvacska magmembrán

Sejtmag, magvacska magmembrán Sejtmag, magvacska magmembrán Láng Orsolya Semmelweis Egyetem, Genetikai, Sejt- és Immunbiológiai Intézet Kompartmentalizáció Prokaryóta Cytoplazma Eukaryóta Endomembrán Kromatin Plazma membrán Eredménye



DG(SANCO)/2012-6290-MR 1 Ensure official controls of food contaminants across the whole food chain in order to monitor the compliance with the requirements of Regulation (EC) No 1881/2006 in all food establishments, including


Tudásmenedzsment és gyógyszerinnováció

Tudásmenedzsment és gyógyszerinnováció Tudásmenedzsment és gyógyszerinnováció Ipari szükségletek / elvárások Dr. Bátori Sándor Sanofi-aventis Innovatív Gyógyszerek Kutatása, MAGYOSZ, 2009.01.07. Alapvető együttm ttműködések Hosszútávú elhatározás:


ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma, 1979-1983

ÖNÉLETRAJZ. Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997) Középiskola: JATE Ságvári Endre Gyakorló Gimnáziuma, 1979-1983 ÖNÉLETRAJZ Személyes adatok Név: Születési hely: Széll Márta Szeged Születési idő: 1965. március 28. Családi állapota: férjezett (Dr. Balogh Nándor) Gyermekei: Lőrinc (1993), Ádám (1997) és Árpád (1997)


Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen

Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Az orvosi biotechnológiai mesterképzés megfeleltetése az Európai Unió új társadalmi kihívásainak a Pécsi Tudományegyetemen és a Debreceni Egyetemen Azonosító szám: TÁMOP-4.1.2-08/1/A-2009-0011 Az orvosi


A C. elegans TRA-1/GLI/Ci szex-determinációs faktor célgénjeinek meghatározása és analízise. Doktori értekezés tézisei.

A C. elegans TRA-1/GLI/Ci szex-determinációs faktor célgénjeinek meghatározása és analízise. Doktori értekezés tézisei. A C. elegans TRA-1/GLI/Ci szex-determinációs faktor célgénjeinek meghatározása és analízise Doktori értekezés tézisei Hargitai Balázs Eötvös Loránd Tudományegyetem Természettudományi Kar Biológia Doktori


Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté!

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté! Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában Kiss Máté! Magreceptor Kutató Laboratórium Biokémiai és Molekuláris Biológiai Intézet Debreceni Egyetem, Általános Orvostudományi








Támogatóink: Neurogenetikai Társaság. X. Konferenciája. Budapest. 2011. December 2-3. Genzyme Europe B.V. Képviselet. Társrendező:

Támogatóink: Neurogenetikai Társaság. X. Konferenciája. Budapest. 2011. December 2-3. Genzyme Europe B.V. Képviselet. Társrendező: MEGHÍVÓ Regisztrációs díj: MNKT tagoknak: 23.000 Ft Nem tagoknak 27.000 Ft Rezidenseknek, PhD hallgatóknak, nyugdíjasoknak: 16.000 Ft Helyszíni regisztráció: 35.000 Ft A regisztrációs díj tartalmazza az


7. Rendszerszemléletű biológia a kémikus szemével. Genomika, proteomika, metabolomika

7. Rendszerszemléletű biológia a kémikus szemével. Genomika, proteomika, metabolomika 7. Rendszerszemléletű biológia a kémikus szemével Genomika, proteomika, metabolomika 7. Rendszerszemléletű biológia Redukcionista vs. Holisztikus szemlélet A rendszerszemléletű biológia (systems biology)


Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Fehérjét kódol? Tulajdonságai? -Hol lokalizálódik? -Oldható? -3D szerkezete? -Accession #? -Annotációja elérhető? Már benne


Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék

Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék Budapesti Corvinus Egyetem Élelmiszertudományi Kar Mikrobiológiai és Biotechnológiai Tanszék PATOGÉN MIKROORGANIZMUSOK KIMUTATÁSÁRA SZOLGÁLÓ GYORS MÓDSZEREK ÖSSZEHASONLÍTÓ VIZSGÁLATA Rohonczy Kata Doktori


Norvég Finanszírozási Mechanizmus által támogatott projekt HU-0115/NA/2008-3/ÖP-9 ÚJ TERÁPIÁS CÉLPONTOK AZONOSÍTÁSA GENOMIKAI MÓDSZEREKKEL



TÁMOP-4.1.2-08/1/A-2009-0011 Tantárgy címe: Transzdifferenciáció és regeneratív medicina Dr. Balogh Péter és Dr. Engelmann Péter

TÁMOP-4.1.2-08/1/A-2009-0011 Tantárgy címe: Transzdifferenciáció és regeneratív medicina Dr. Balogh Péter és Dr. Engelmann Péter Előadás Előadás címe Dia Dia címe száma 1. Őssejtek és transzdifferenciáció: bevezetés, alapok 2. Őssejt-típusok, fenntartásuk és homeosztázisuk 3. Regeneráció állatmodellekben 2. Alapfogalmak 3. Őssejt-kutatás


és biztonságoss Prof. Dr. János J CHMP member Hungary

és biztonságoss Prof. Dr. János J CHMP member Hungary Gyógyszerek hatásoss sossága és biztonságoss gosságaga Prof. Dr. János J Borvendég CHMP member Hungary A ma gyógyszerkutat gyszerkutatásának legfontosabb célbetegségei: gei: malignus betegségek gek cardiovascularis


11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban

11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban 11. Dr. House. Biokémiai és sejtbiológiai módszerek alkalmazása az orvoslásban HIV fertőzés kimutatása - (fiktív) esettanulmány 35 éves nő, HIV fertőzöttség gyanúja. Két partner az elmúlt időszakban. Fertőzött-e


KÉPI INFORMÁCIÓK KEZELHETŐSÉGE. Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet. Összefoglaló

KÉPI INFORMÁCIÓK KEZELHETŐSÉGE. Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet. Összefoglaló KÉPI INFORMÁCIÓK KEZELHETŐSÉGE Forczek Erzsébet SZTE ÁOK Orvosi Informatikai Intézet Összefoglaló Tanórákon és az önálló tanulás részeként is, az informatika világában a rendelkezésünkre álló óriási mennyiségű


2016 év eleji ajánlatok. Speciális áraink 2016 május 31-ig érvényesek!

2016 év eleji ajánlatok. Speciális áraink 2016 május 31-ig érvényesek! 2016 év eleji ajánlatok Speciális áraink 2016 május 31-ig érvényesek! BIOBASE műszerek a NucleotestBio Kft. kínálatában! Steril box-ok, lamináris box-ok: Hűtők, fagyasztók, ultramélyhűtők, autoklávok,


Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata

Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata Doktori értekezés tézisei Türk Dóra Témavezető: Dr. Szakács Gergely MTA TTK ENZIMOLÓGIAI INTÉZET


Orvosi laboratóriumi és képalkotó diagnosztikai analitikus alapszak. A szak képzési és kimeneti követelményei a 15/2006. (IV. 3.) OM rendelet alapján:

Orvosi laboratóriumi és képalkotó diagnosztikai analitikus alapszak. A szak képzési és kimeneti követelményei a 15/2006. (IV. 3.) OM rendelet alapján: Debreceni Egyetem Egészségügyi Főiskolai Kar Orvosi laboratóriumi és képalkotó diagnosztikai analitikus alapszak A szak képzési és kimeneti követelményei a 15/2006. (IV. 3.) OM rendelet alapján: 1. Az


Best Practices for TrusBest Practices for Trusted Digital Repositories in HOPE. ted Digital Repositories in HOPE.

Best Practices for TrusBest Practices for Trusted Digital Repositories in HOPE. ted Digital Repositories in HOPE. Best Practices for TrusBest Practices for Trusted Digital Repositories in HOPE. ted Digital Repositories in HOPE. OAIS alapú digitális archívumok: best practice and HOPE (2010-2013) http://www.peoplesheritage.eu/pdf/d5_1_grant250549_ho


eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program

eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program Agydaganatok sugárterápia iránti érzékenységének növelése génterápiás eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program Doktori


1. A megyében végzett jelentősebb kutatási témák, projektek ráfordításainak ágazati megoszlása (összesen 4 859 millió Ft-ról áll rendelkezésre adat):

1. A megyében végzett jelentősebb kutatási témák, projektek ráfordításainak ágazati megoszlása (összesen 4 859 millió Ft-ról áll rendelkezésre adat): Megyei statisztikai profil a Smart Specialisation Strategy (S3) megalapozásához c. dokumentum kiegészítése a Magyar Tudományos Akadémia adataival Csongrád megye Az alábbi dokumentum a Smart Specialisation
