Bevezetés az R-be Betekintés az expressziós chipek kiértekelésébe
|
|
|
- Tamás Soós
- 8 évvel ezelőtt
- Látták:
Átírás
1 Bevezetés az R-be Betekintés az expressziós chipek kiértekelésébe Solymosi Norbert Állatorvos-tudományi Kar, Szent István Egyetem Komplex Rendszerek Fizikája Tanszék, ELTE Neuroinformatika SE Szentágothai Doktori Iskola november 7. NKTH TECH08:3dhist08, TÁMOP B-11/2/KMR
2 R-Bioconductor S, S-Plus Robert Gentleman, Ross Ihaka Szkript-nyelv Függvények (csomagok, könyvtárak) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 2 / 65
3 R-Bioconductor Robert Gentleman Csomagok Software Metadata (Annotation, CDF and Probe) Custom CDF Experiment Data Complete Taxonomy Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 3 / 65
4 Telepítés R-Bioconductor R Bioconductor Binárisok forrásból Alaptelepítés csomagjai Csomagok telepítése > install.packages( vcd ) Csomagok telepítése > setrepositories() > install.packages( affy ) Csomagcsoportok telepítése > source( ) > bioclite( RBioinf ) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 4 / 65
5 R-nyelv > > [1] 3 objektum <- kifejezés. > a < > a [1] 3 > (a < ) [1] 3 > (a <- 5) [1] 5 > fuggveny.neve(arg1,arg2,...) > length(a) [1] 1 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 5 / 65
6 R-nyelv Könyvtárak A függvények könyvtárakban érhetők el Könyvtárak telepítése > setrepositories() --- Please select repositories for use in this session --- 1: + CRAN 2: Omegahat 3: BioC software 4: BioC annotation 5: BioC experiment 6: BioC extra 7: R-Forge Enter one or more numbers separated by spaces 1: > install.packages( vcd ) Könyvtárak betöltése > library(lattice) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 6 / 65
7 Súgó R-nyelv > help(t.test) >?t.test t.test package:stats R Documentation Student s t-test Description: Performs one and two sample t-tests on vectors of data. Usage: t.test(x,...) ## Default S3 method: t.test(x, y = NULL, alternative = c("two.sided", "less", "greater"), mu = 0, paired = FALSE, var.equal = FALSE, conf.level = 0.95,...) ## S3 method for class formula : t.test(formula, data, subset, na.action,...) Arguments: x: a (non-empty) numeric vector of data values. y: an optional (non-empty) numeric vector of data values. alternative: a character string specifying the alternative hypothesis, must be one of "two.sided" (default), "greater" or Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 7 / 65
8 Fájlok, adatok R-nyelv > setwd( /home/user/chip ) > getwd() [1] "/home/user/chip" read.table(file, header = FALSE, sep = "", quote = "\" ", dec = ".", row.names, col.names, as.is =!stringsasfactors, na.strings = "NA", colclasses = NA, nrows = -1, skip = 0, check.names = TRUE, fill =!blank.lines.skip, strip.white = FALSE, blank.lines.skip = TRUE, comment.char = "#", allowescapes = FALSE, flush = FALSE, stringsasfactors = default.stringsasfactors(), fileencoding = "", encoding = "unknown") függvény sep dec quote fill read.line "". \"!blank.lines.skip read.csv,. \" TRUE read.csv2 ;, \" TRUE read.delim \t. \" TRUE read.delim2 \t, \" TRUE Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 8 / 65
![char = "#", allowescapes = FALSE, flush = FALSE, stringsasfactors = default.stringsasfactors(), fileencoding = "", encoding = "unknown") függvény sep dec quote fill read.line "". \"!](/docs-images/44/2368825/images/page_8.jpg "blank.lines.skip read.csv,. \\" TRUE read.csv2 ;, \\" TRUE read.delim \t. \\" TRUE read.delim2 \t, \\" TRUE Szentágothai Doktori Iskola (2012. XI. 7.")
9 Fájlok, adatok R-nyelv write() write.table() save() save(list = ls(all=true), file = "minden_objektum.rdata") save.image() dput() dget() dump() source() savehistory() loadhistory() Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 9 / 65
10 Vektor R-nyelv > (a <- 1:5) [1] > (a <- c(9,4,6,7,1,2,5)) [1] > a[3] [1] 6 > (a <- vector(mode = "numeric", length = 5)) > (a <- numeric(length = 5)) [1] > (a <- vector(mode = "logical", length = 5)) > (a <- logical(length = 5)) [1] FALSE FALSE FALSE FALSE FALSE > (a <- vector(mode = "character", length = 5)) > (a <- character(length = 5)) [1] "" "" "" "" "" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 10 / 65
![logical(length = 5)) [1] FALSE FALSE FALSE FALSE FALSE > (a <- vector(mode = "character", length = 5)) > (a <-](/docs-images/44/2368825/images/page_10.jpg "character(length = 5)) [1] \"\" \"\" \"\" \"\" \"\" Szentágothai Doktori Iskola (2012. XI. 7.")
11 Mátrix R-nyelv > a <- 1:6 > (m <- matrix(a, nr = 3)) [,1] [,2] [1,] 1 4 [2,] 2 5 [3,] 3 6 > (m <- matrix(a, nr = 3, byrow = T)) [,1] [,2] [1,] 1 2 [2,] 3 4 [3,] 5 6 > dim(a) <- c(3, 2) > a [,1] [,2] [1,] 1 4 [2,] 2 5 [3,] 3 6 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 11 / 65
![4 [3,] 5 6 > dim(a) <- c(3, 2) > a [,1] [,2] [1,] 1 4 [2,] 2 5 [3,] 3 6](/docs-images/44/2368825/images/page_11.jpg "Szentágothai Doktori Iskola (2012. XI. 7.")
12 Mátrix R-nyelv > (x <- matrix(1:9, nc = 3)) [,1] [,2] [,3] [1,] [2,] [3,] > x[2, 2] [1] 5 > x[2, ] [1] > x[, 2] [1] > x[-1, ] [,1] [,2] [,3] [1,] [2,] > x[, -1] [,1] [,2] [1,] 4 7 [2,] 5 8 [3,] 6 9 > x[-1, -1] [,1] [,2] [1,] 5 8 [2,] 6 9 > x[-c(1, 3), ] [1] Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 12 / 65
![9 > x[, -1] [,1] [,2] [1,] 4 7 [2,] 5 8 [3,] 6 9 > x[-1, -1] [,1] [,2] [1,] 5 8 [2,] 6 9 >](/docs-images/44/2368825/images/page_12.jpg "x[-c(1, 3), ] [1] 2 5 8 Szentágothai Doktori Iskola (2012. XI. 7.")
13 Data frame R-nyelv > x <- 1:4 > n <- 10 > (r <- data.frame(x, n)) x n > (r <- data.frame(oszlop1 = x, oszlop2 = n)) oszlop1 oszlop > r$oszlop1 [1] > r[, oszlop1 ] [1] Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 13 / 65
14 Lista R-nyelv > x <- matrix(1:9, nc = 3) > y <- 1:5 > allista <- list(c("a", "b", "c"), + c(8, 5, 2, 4, 1, 3)) > lista <- list(x, y, allista) > names(lista) <- c("r", "t", "z") > lista $r [,1] [,2] [,3] [1,] [2,] [3,] > lista[[1]] [,1] [,2] [,3] [1,] [2,] [3,] > lista$r [,1] [,2] [,3] [1,] [2,] [3,] $t [1] $z $z[[1]] [1] "a" "b" "c" $z[[2]] [1] Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 14 / 65
![[,1] [,2] [,3] [1,] 1 4 7 [2,] 2 5 8 [3,] 3 6 9 > lista$r [,1] [,2] [,3] [1,] 1 4 7 [2,] 2 5 8 [3,] 3 6 9 $t [1] 1 2 3 4 5 $z](/docs-images/44/2368825/images/page_14.jpg "$z[[1]] [1] \"a\" \"b\" \"c\" $z[[2]] [1] 8 5 2 4 1 3 Szentágothai Doktori Iskola (2012. XI. 7.")
15 Affymetrix expressziós chip CEL Gén Egy vagy több probeset Több probe (PM, MM) 25 mer Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 15 / 65
16 Affymetrix expressziós chip CEL Gén Egy vagy több probeset Több probe (PM, MM) 25 mer Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 15 / 65
17 CEL Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 16 / 65
18 CEL Minden probeset 1. probe-ja Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 17 / 65
19 CEL Intenzitás Probe Probe: 8 8 pixel Rács illesztése Keret elhagyása 75. percentilis intenzitás CEL-állomány: PM- és MM-intenzitás Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 18 / 65
20 AffyBatch CEL > library( affy ) > setwd( munkakönyvtár ) > beolvasott.chipek = ReadAffy() > library("cll") Loading required package: affy Loading required package: Biobase Welcome to Bioconductor Vignettes contain introductory material. To view, type openvignette(). To cite Bioconductor, see citation("biobase") and for packages citation(pkgname). > data("cllbatch") Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 19 / 65
21 AffyBatch CEL > CLLbatch AffyBatch object size of arrays=640x640 features (91212 kb) cdf=hg_u95av2 (12625 affyids) number of samples=24 number of genes=12625 annotation=hgu95av2 notes= The AffyBatch object has 24 samples that were affixed to Affymetrix hgu95av2 arrays. These 24 samples came from 24 CLL patients that were either classified as stable or progressive in regards to disease progression. The CLL package contains the chronic lymphocytic leukemia (CLL) gene expression data. The CLL data had 24 samples that were either classified as progressive or stable in regards to disease progression. The CLL microarray data came from Dr. Sabina Chiaretti at Division of Hematology, Department of Cellular Biotechnologies and Hematology, University La Sapienza, Rome, Italy and Dr. Jerome Ritz at Department of Medicine, Brigham and Women s Hospital, Harvard Medical School, Boston, Massachusetts. Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 20 / 65
22 AffyBatch CEL Minták > samplenames(cllbatch) [1] "CLL10.CEL" "CLL11.CEL" "CLL12.CEL" "CLL13.CEL" "CLL14.CEL" "CLL15.CEL" [7] "CLL16.CEL" "CLL17.CEL" "CLL18.CEL" "CLL19.CEL" "CLL1.CEL" "CLL20.CEL" [13] "CLL21.CEL" "CLL22.CEL" "CLL23.CEL" "CLL24.CEL" "CLL2.CEL" "CLL3.CEL" [19] "CLL4.CEL" "CLL5.CEL" "CLL6.CEL" "CLL7.CEL" "CLL8.CEL" "CLL9.CEL" > length(samplenames(cllbatch)) [1] 24 Probesetek > featurenames(cllbatch)[1:10] [1] "1000_at" "1001_at" "1002_f_at" "1003_s_at" "1004_at" "1005_at" [7] "1006_at" "1007_s_at" "1008_f_at" "1009_at" > length(featurenames(cllbatch)) [1] Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 21 / 65
23 CEL AffyBatch PM > pm(cllbatch, "1000_at")[,1:2] CLL10.CEL CLL11.CEL 1000_at _at _at _at _at _at _at _at _at _at _at _at _at _at _at _at MM > mm(cllbatch, "1000_at")[,1:2] CLL10.CEL CLL11.CEL 1000_at _at _at _at _at _at _at _at _at _at _at _at _at _at _at _at Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 22 / 65
24 AffyBatch leíró adatok CEL AffyBatch-ben eddigi info > head(pdata(cllbatch)) sample CLL10.CEL 1 CLL11.CEL 2 CLL12.CEL 3 CLL13.CEL 4 CLL14.CEL 5 CLL15.CEL 6 A minták leírása > data(disease) > head(disease) SampleID Disease 1 CLL10 <NA> 2 CLL11 progres. 3 CLL12 stable 4 CLL13 progres. 5 CLL14 progres. 6 CLL15 progres. Egyesítve az AffyBatch-ben > rownames(disease) = disease$sampleid > uj.nev = sub( \\.CEL$,, + samplenames(cllbatch)) > uj.nev[1:5] [1] "CLL10" "CLL11" "CLL12" "CLL13" "CLL14" > samplenames(cllbatch) = uj.nev > e.id = match(rownames(disease), samplenames(cllbatch)) > vmd = data.frame(labeldescription = c( Sample ID, + Disease status: progressive or stable disease )) > phenodata(cllbatch) = new( AnnotatedDataFrame, + data = disease[e.id, ], varmetadata = vmd) > head(pdata(cllbatch)) SampleID Disease CLL10 CLL10 <NA> CLL11 CLL11 progres. CLL12 CLL12 stable CLL13 CLL13 progres. CLL14 CLL14 progres. CLL15 CLL15 progres. Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 23 / 65
25 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok 4 4 grid mindegyik cellán belül az alsó 2% lesz a háttér ezek átlaga az átlagos háttér legnagyobb legkisebb < 3 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65
26 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok MAS 5.0 normalizáció alapgondolat, hogy a transzkriptumok kis hányada különbözik csak minták trimmelt átlagos intenzitása megegyezik alsó, felső 2% elhagyása az legnagyobb < 3 átlag Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65
27 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok Probesetek hány % expresszálódik? PM > MM: hiányzik, határeset, jelen van legnagyobb legkisebb < 3 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65
28 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok RNS-minősége, bomlottsága β-aktin, GAPDH a legtöbb sejt azonos szinten expresszálja hosszúak, probesetek az 5 - és a 3 -végről, ill. közepéről a 3 - és az 5 -jel aránya ha magas pl. bomlott β-aktin: < 3 GAPDH: 1 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65
29 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok BioB, BioC, BioD, CreX Bacillus subtillis intenzitás hibridizáció, szkennelés BioB: mindegyik chipen jelen kell lennie, de legalább 70%-ukban Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65
30 Minőségellenőrzés Minta H. átlag S. faktor Jelenlét % CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL Arány actin3/actin5 gapdh3/gapdh CLL9 CLL8 CLL7 CLL6 CLL5 CLL4 CLL3 CLL2 CLL24 CLL23 CLL22 CLL21 CLL20 CLL1 CLL19 CLL18 CLL17 CLL16 CLL15 CLL14 CLL13 CLL12 CLL % % % % % % % % % % % % % % % % % % % % % % % QC Stats 0 biob biob biob biob biob biob biob biob biob 2 3 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 25 / 65
31 Probe-adatok Annotáció > library("annotate") Loading required package: AnnotationDbi > annotation(cllbatch) [1] "hgu95av2" > library(hgu95av2probe) > data(hgu95av2probe) > hgu95av2probe Object of class probetable data.frame with rows and 6 columns. > as.data.frame(hgu95av2probe[1:10,-5]) sequence x y Probe.Set.Name Target.Strandedness 1 TGGCTCCTGCTGAGGTCCCCTTTCC _at Antisense 2 GGCTGTGAATTCCTGTACATATTTC _at Antisense 3 GCTTCAATTCCATTATGTTTTAATG _at Antisense 4 GCCGTTTGACAGAGCATGCTCTGCG _at Antisense 5 TGACAGAGCATGCTCTGCGTTGTTG _at Antisense 6 CTCTGCGTTGTTGGTTTCACCAGCT _at Antisense 7 GGTTTCACCAGCTTCTGCCCTCACA _at Antisense 8 TTCTGCCCTCACATGCACAGGGATT _at Antisense 9 CCTCACATGCACAGGGATTTAACAA _at Antisense 10 TCCTTGGTACTCTGCCCTCCTGTCA _at Antisense Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 26 / 65
32 Annotáció Probeset-kapcsolódások (hgu95av2.db) > hgu95av2() Quality control information for hgu95av2: This package has the following mappings: hgu95av2accnum has mapped keys (of keys) hgu95av2alias2probe has mapped keys (of keys) hgu95av2chr has mapped keys (of keys) hgu95av2chrlengths has 25 mapped keys (of 25 keys) hgu95av2chrloc has mapped keys (of keys) hgu95av2chrlocend has mapped keys (of keys) hgu95av2ensembl has mapped keys (of keys) hgu95av2ensembl2probe has 9021 mapped keys (of 9021 keys) hgu95av2entrezid has mapped keys (of keys) hgu95av2enzyme has 1978 mapped keys (of keys) hgu95av2enzyme2probe has 725 mapped keys (of 725 keys) hgu95av2genename has mapped keys (of keys) hgu95av2go has mapped keys (of keys) hgu95av2go2allprobes has 9581 mapped keys (of 9581 keys) hgu95av2go2probe has 6774 mapped keys (of 6774 keys) hgu95av2map has mapped keys (of keys) hgu95av2omim has mapped keys (of keys) hgu95av2path has 4585 mapped keys (of keys) hgu95av2path2probe has 203 mapped keys (of 203 keys) hgu95av2pfam has mapped keys (of keys) hgu95av2pmid has mapped keys (of keys) hgu95av2pmid2probe has mapped keys (of keys) hgu95av2prosite has mapped keys (of keys) hgu95av2refseq has mapped keys (of keys) hgu95av2symbol has mapped keys (of keys) hgu95av2unigene has mapped keys (of keys) hgu95av2uniprot has mapped keys (of keys) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 27 / 65
33 Annotáció > (chrom = buildchromlocation( hgu95av2.db )) Instance of a chromlocation class with the following fields: Organism: Homo sapiens Data source: hgu95av2.db Number of chromosomes for this organism: 25 Chromosomes of this organism and their lengths in base pairs: 1 : : : : : : : : : : : : : : : : : : : : : : M : X : Y : Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 28 / 65
34 Annotáció > chromlocs(chrom)[[ Y ]][1:10] 266_s_at 31911_at 32930_f_at 32991_f_at 35885_at 35929_s_at 35930_at _at 37583_at 38182_at > get( 35885_at, probestochrom(chrom)) [1] "Y" > probesets = featurenames(cllbatch) > getsymbol(probesets[1:3], hgu95av2.db ) 1000_at "MAPK3" 1001_at 1002_f_at "TIE1" "CYP2C19" > mget(probesets[1:3], hgu95av2symbol) $ 1000_at [1] "MAPK3" $ 1001_at [1] "TIE1" $ 1002_f_at [1] "CYP2C19" > get(probesets[1:3], hgu95av2symbol) [1] "MAPK3" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 29 / 65
35 Annotáció > hgu95av2symbol$ 1000_at [1] "MAPK3" > hgu95av2symbol[[ 1000_at ]] [1] "MAPK3" > hgu95av2genename$ 1000_at [1] "mitogen-activated protein kinase 3" > hgu95av2ensembl$ 1000_at [1] "ENSG " > hgu95av2accnum$ 1000_at [1] "X60188" > sym.2.hgu95av2 = revmap(hgu95av2symbol) > sym.2.hgu95av2$ MAPK3 [1] "1000_at" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 30 / 65
36 GO Annotáció > totable(hgu95av2go[ 1000_at ]) probe_id go_id Evidence Ontology _at GO: IDA BP _at GO: IEA BP _at GO: EXP BP _at GO: IEA BP _at GO: EXP CC _at GO: IDA CC _at GO: EXP CC _at GO: IDA CC _at GO: IDA CC _at GO: IEA MF _at GO: IPI MF _at GO: EXP MF _at GO: IEA MF _at GO: EXP MF _at GO: NAS MF _at GO: IEA MF Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 31 / 65
37 Annotáció KEGG > (ps.paths = as.list(hgu95av2path)[[ 1000_at ]]) [1] "04010" "04012" "04150" "04350" "04360" "04370" "04510" "04520" "04540" [10] "04620" "04650" "04664" "04720" "04730" "04810" "04910" "04912" "04916" [19] "04930" "05010" "05210" "05211" "05212" "05213" "05214" "05215" "05216" [28] "05218" "05219" "05220" "05221" "05223" > library(kegg.db) > pathways.by.ids = as.list(keggpathid2name) > pathways.by.names = as.list(keggpathname2id) > length(pathways.by.names) [1] 336 for (ps in ps.paths) print(pathways.by.ids[[ps]]) [1] "MAPK signaling pathway" [1] "ErbB signaling pathway" [1] "mtor signaling pathway" [1] "TGF-beta signaling pathway" [1] "Axon guidance" [1] "VEGF signaling pathway" [1] "Focal adhesion" [1] "Adherens junction" [1] "Gap junction" [1] "Toll-like receptor signaling pathway" [1] "Natural killer cell mediated cytotoxicity" [1] "Fc epsilon RI signaling pathway" [1] "Long-term potentiation" [1] "Long-term depression" [1] "Regulation of actin cytoskeleton" [1] "Insulin signaling pathway" [1] "GnRH signaling pathway" [1] "Melanogenesis" [1] "Type II diabetes mellitus" [1] "Alzheimer s disease" [1] "Colorectal cancer" [1] "Renal cell carcinoma" [1] "Pancreatic cancer" [1] "Endometrial cancer" [1] "Glioma" [1] "Prostate cancer" [1] "Thyroid cancer" [1] "Melanoma" [1] "Bladder cancer" [1] "Chronic myeloid leukemia" [1] "Acute myeloid leukemia" [1] "Non-small cell lung cancer" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 32 / 65
38 KEGG Annotáció > pathways.by.names[[ Colorectal cancer ]] [1] "05210" > pathways.by.ids[[ ]] [1] "Colorectal cancer" > (probesets.in.path = as.list(hgu95av2path2probe)[[ ]][1:10]) [1] "34055_at" "34056_g_at" "34415_at" "36451_at" "39199_at" [6] "1564_at" "2022_at" "2023_g_at" "40972_at" "1912_s_at" > as.character(getsymbol(probesets.in.path, hgu95av2.db )) [1] "ACVR1B" "ACVR1B" "ACVR1B" "ACVR1B" "ACVR1B" "AKT1" "AKT2" "AKT2" [9] "AKT2" "APC" > unique(as.character(getsymbol(probesets.in.path, hgu95av2.db ))) [1] "ACVR1B" "AKT1" "AKT2" "APC" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 33 / 65
39 PubMed Annotáció > absts = pm.getabst( 37809_at, "hgu95av2") > absts[[ 37809_at ]][[58]] An object of class pubmedabst : Title: HOX expression patterns identify a common signature for favorable AML. PMID: Authors: M Andreeff, V Ruvolo, S Gadgil, C Zeng, K Coombes, W Chen, S Kornblau, AE Barón, HA Drabkin Journal: Leukemia Date: Nov 2008 > absttext(absts[[ 37809_at ]][[58]]) [1] "Deregulated HOX expression, by chromosomal translocations and myeloid-lymphoid leukemia (MLL) rearrangements, is causal in some types of leukemia. Using real-time reverse transcription-pcr, we examined the expression of 43 clustered HOX, polycomb, MLL and FLT3 genes in 119 newly diagnosed adult acute myeloid leukemias (AMLs) selected from all major cytogenetic groups. Downregulated HOX expression was a consistent feature of favorable AMLs and, among these cases, inv(16) cases had a distinct expression profile. Using a 17-gene predictor in 44 additional samples, we observed a 94.7% specificity for classifying favorable vs intermediate/unfavorable cytogenetic groups. Among other AMLs, HOX overexpression was associated with nucleophosmin (NPM) mutations and we also identified a phenotypically similar subset with wt-npm. In many unfavorable and other intermediate cytogenetic AMLs, HOX levels resembled those in normal CD34+ cells, except that the homogeneity characteristic of normal samples was not present. We also observed that HOXA9 levels were significantly inversely correlated with survival and that BMI-1 was overexpressed in cases with 11q23 rearrangements, suggesting that p19(arf) suppression may be involved in MLL-associated leukemia. These results underscore the close relationship between HOX expression patterns and certain forms of AML and emphasize the need to determine whether these differences play a role in the disease process." Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 34 / 65
40 Preprocess Mérési adatok előkészítése elemzésre Probe-intenzitás összehasonlítható probeset-expressziós érték Lépései: 1 Háttér-korrekció Chipen belüli normálás 2 Normalizáció Chipek összehasonlíthatósága 3 Expressziós érték számítása Intenzitásból expressziós érték Számos módszer mindegyik lépésre N.B. a függvény neve eljárás Pl. rma() háttér-korrekció RMA-korrekció normalizáció kvantilis expresszió-számítás medián Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 35 / 65
41 ExpressionSet Preprocess > eset = rma(cllbatch) Background correcting Normalizing Calculating Expression > eset ExpressionSet (storagemode: lockedenvironment) assaydata: features, 23 samples element names: exprs phenodata samplenames: CLL11, CLL12,..., CLL9 (23 total) varlabels and varmetadata description: SampleID: Sample ID Disease: Disease status: progressive or stable disease featuredata featurenames: 1000_at, 1001_at,..., AFFX-YEL024w/RIP1_at (12625 total) fvarlabels and fvarmetadata description: none experimentdata: use experimentdata(object) Annotation: hgu95av2 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 36 / 65
42 ExpressionSet Preprocess > eset$disease [1] progres. stable progres. progres. progres. progres. stable stable [9] progres. stable stable progres. stable progres. stable stable [17] progres. progres. progres. progres. progres. progres. stable Levels: progres. stable > eset[,eset$disease== stable ] ExpressionSet (storagemode: lockedenvironment) assaydata: features, 9 samples element names: exprs phenodata samplenames: CLL12, CLL17,..., CLL9 (9 total) varlabels and varmetadata description: SampleID: Sample ID Disease: Disease status: progressive or stable disease featuredata featurenames: 1000_at, 1001_at,..., AFFX-YEL024w/RIP1_at (12625 total) fvarlabels and fvarmetadata description: none experimentdata: use experimentdata(object) Annotation: hgu95av2 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 37 / 65
43 Expressziós mátrix Preprocess > e.tab = exprs(eset) > dim(e.tab) [1] > colnames(e.tab)[1:5] [1] "CLL11" "CLL12" "CLL13" "CLL14" "CLL15" > rownames(e.tab)[1:5] [1] "1000_at" "1001_at" "1002_f_at" "1003_s_at" "1004_at" > e.tab[1:5,1:5] CLL11 CLL12 CLL13 CLL14 CLL _at _at _f_at _s_at _at Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 38 / 65
44 Expressziós különbségek Expressziós különbségek Expressziós értékek összehasonlítása, fenotípus szerint Probeseteket külön-külön hasonlítja össze Gyakoribb módszerek: Fold-change átlagok, mediánok hányadosa általában log2-skálán nem kezeli a csoportokon belüli variabilitást kisebb mintaszámok Paraméteres próbák variabilitást bevonja a feltételek ritkán teljesülnek nagyobb az ereje Nemparaméteres próbák variabilitást bevonja enyhébb feltételek kisebb az ereje Egyebek: ROC, permutációs próbák, stb. Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 39 / 65
45 ALL Expressziós különbségek > library(all) > data(all) > ALL ExpressionSet (storagemode: lockedenvironment) assaydata: features, 128 samples element names: exprs phenodata samplenames: 01005, 01010,..., LAL4 (128 total) varlabels and varmetadata description: cod: Patient ID diagnosis: Date of diagnosis...:... date last seen: date patient was last seen (21 total) featuredata featurenames: 1000_at, 1001_at,..., AFFX-YEL024w/RIP1_at fvarlabels and fvarmetadata description: none experimentdata: use experimentdata(object) pubmedids: Annotation: hgu95av2 (12625 total) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 40 / 65
46 ALL Expressziós különbségek > head(pdata(all)) cod diagnosis sex age BT remission CR date.cr t(4;11) t(9;22) /21/1997 M 53 B2 CR CR 8/6/1997 FALSE TRUE /29/2000 M 19 B2 CR CR 6/27/2000 FALSE FALSE /24/1998 F 52 B4 CR CR 8/17/1998 NA NA /17/1997 M 38 B1 CR CR 9/8/1997 TRUE FALSE /22/1997 M 57 B2 CR CR 9/17/1997 FALSE FALSE /30/1997 M 17 B1 CR CR 9/27/1997 FALSE FALSE cyto.normal citog mol.biol fusion protein mdr kinet ccr FALSE t(9;22) BCR/ABL p210 NEG dyploid FALSE FALSE simple alt. NEG <NA> POS dyploid FALSE NA <NA> BCR/ABL p190 NEG dyploid FALSE FALSE t(4;11) ALL1/AF4 <NA> NEG dyploid FALSE FALSE del(6q) NEG <NA> NEG dyploid FALSE FALSE complex alt. NEG <NA> NEG hyperd. FALSE relapse transplant f.u date last seen FALSE TRUE BMT / DEATH IN CR <NA> TRUE FALSE REL 8/28/ TRUE FALSE REL 10/15/ TRUE FALSE REL 1/23/ TRUE FALSE REL 11/4/ TRUE FALSE REL 12/15/1997 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 41 / 65
47 ALL Expressziós különbségek B-sejtes tumor minták indexeinek kigyűjtése > b.sejt.idxs = grep("^b", as.character(all$bt)) Molekuláris biológiai tulajdonság alapján 2 csoport indexeinek lekérdezése (BCR/ABL-translokáció, negatív a vizsgált eltérésekre) > mol.tipus.idxs = which(as.character(all$mol.biol) %in% c( NEG, BCR/ABL )) Közös metszetük alapján új eset létrehozása > ALL.bcr.neg = ALL[,intersect(b.sejt.idxs, mol.tipus.idxs)] > ALL.bcr.neg$mol.biol = factor(all.bcr.neg$mol.biol) > ALL.bcr.neg ExpressionSet (storagemode: lockedenvironment) assaydata: features, 79 samples element names: exprs phenodata samplenames: 01005, 01010,..., (79 total) varlabels and varmetadata description: cod: Patient ID diagnosis: Date of diagnosis...:... date last seen: date patient was last seen (21 total) featuredata featurenames: 1000_at, 1001_at,..., AFFX-YEL024w/RIP1_at fvarlabels and fvarmetadata description: none experimentdata: use experimentdata(object) pubmedids: Annotation: hgu95av2 (12625 total) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 42 / 65
48 Fold change Expressziós különbségek > ALL.bcr.neg.exprs.m = exprs(all.bcr.neg) > csoportok = as.numeric(all.bcr.neg$mol.biol) > table(csoportok) csoportok > idx1 = which(csoportok==1) > idx2 = which(csoportok==2) > Fc = rowmeans(all.bcr.neg.exprs.m[,idx2])-rowmeans(all.bcr.neg.exprs.m[,idx1]) > atlag = rowmeans(all.bcr.neg.exprs.m) > plot(atlag, Fc, xlab = átlag, ylab = Fold change, las=1, pch=20) > abline(h=0, col= grey ) > abline(h=1, col= grey, lty=2) > abline(h=-1, col= grey, lty=2) > smoothscatter(atlag, Fc, xlab = Átlag, ylab = Fold change, las=1) > abline(h=1, col= grey, lty=2) > abline(h=-1, col= grey, lty=2) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 43 / 65
49 Expressziós különbségek Fold change Átlag Fold change Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 44 / 65
50 Fold change Expressziós különbségek Fold change Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 44 / 65 Átlag
51 Fold change Expressziós különbségek > sum(abs(fc)>=1) [1] 36 > (dif.ps = rownames(all.bcr.neg.exprs.m[abs(fc)>=1, ])) [1] "1211_s_at" "1635_at" "1636_g_at" "1674_at" "32434_at" [6] "32542_at" "33232_at" "33440_at" "33462_at" "34472_at" [11] "35926_s_at" "36275_at" "36536_at" "36543_at" "36591_at" [16] "36617_at" "36638_at" "36927_at" "37006_at" "37014_at" [21] "37015_at" "37027_at" "37043_at" "37363_at" "37403_at" [26] "38052_at" "38111_at" "38514_at" "38578_at" "39329_at" [31] "39730_at" "40202_at" "40504_at" "40516_at" "40953_at" [36] "41123_s_at" > sort(unique(as.character(getsymbol(dif.ps, hgu95av2.db )))) [1] "ABL1" "ACTN1" "AHNAK" "AHR" "ALDH1A1" "ANXA1" "CD27" [8] "CNN3" "CRADD" "CRIP1" "CTGF" "ENPP2" "F13A1" "F3" [15] "FHL1" "FZD6" "ID1" "ID3" "IFI44L" "IGJ" "IGLL1" [22] "KLF9" "LILRB1" "MARCKS" "MTSS1" "MX1" "P2RY14" "PON2" [29] "SCHIP1" "SEMA6A" "TUBA4A" "VCAN" "YES1" "ZEB1" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 45 / 65
Bevezetés az R-be Betekintés az expressziós chipek kiértekelésébe
Bevezetés az R-be Betekintés az expressziós chipek kiértekelésébe Solymosi Norbert Állatorvos-tudományi Kar, Szent István Egyetem Komplex Rendszerek Fizikája Tanszék, ELTE Neuroinformatika SE Szentágothai
STUDENT LOGBOOK. 1 week general practice course for the 6 th year medical students SEMMELWEIS EGYETEM. Name of the student:
STUDENT LOGBOOK 1 week general practice course for the 6 th year medical students Name of the student: Dates of the practice course: Name of the tutor: Address of the family practice: Tel: Please read
A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon
A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma
T-helper Type 2 driven Inflammation Defines Major Subphenotypes of Asthma Prescott G. Woodruff, M.D., M.P.H., Barmak Modrek, Ph.D., David F. Choy, B.S., Guiquan Jia, M.D., Alexander R. Abbas, Ph.D., Almut
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Nonparametric Tests
Nonparametric Tests Petra Petrovics Hypothesis Testing Parametric Tests Mean of a population Population proportion Population Standard Deviation Nonparametric Tests Test for Independence Analysis of Variance
Supplementary Table 1. Cystometric parameters in sham-operated wild type and Trpv4 -/- rats during saline infusion and
WT sham Trpv4 -/- sham Saline 10µM GSK1016709A P value Saline 10µM GSK1016709A P value Number 10 10 8 8 Intercontractile interval (sec) 143 (102 155) 98.4 (71.4 148) 0.01 96 (92 121) 109 (95 123) 0.3 Voided
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Nonparametric Tests. Petra Petrovics.
Nonparametric Tests Petra Petrovics PhD Student Hypothesis Testing Parametric Tests Mean o a population Population proportion Population Standard Deviation Nonparametric Tests Test or Independence Analysis
Széchenyi István Egyetem www.sze.hu/~herno
Oldal: 1/6 A feladat során megismerkedünk a C# és a LabVIEW összekapcsolásának egy lehetőségével, pontosabban nagyon egyszerű C#- ban írt kódból fordítunk DLL-t, amit meghívunk LabVIEW-ból. Az eljárás
On The Number Of Slim Semimodular Lattices
On The Number Of Slim Semimodular Lattices Gábor Czédli, Tamás Dékány, László Ozsvárt, Nóra Szakács, Balázs Udvari Bolyai Institute, University of Szeged Conference on Universal Algebra and Lattice Theory
STATISZTIKA PRÓBAZH 2005
STATISZTIKA PRÓBAZH 2005 1. FELADATSOR: számítógépes feladatok (még bővülni fog számítógép nélkül megoldandó feladatokkal is) Használjuk a Dislexia Excel fájlt (internet: http:// starts.ac.uk)! 1.) Hasonlítsuk
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo
Supplementary materials to: Whole-mount single molecule FISH method for zebrafish embryo Yuma Oka and Thomas N. Sato Supplementary Figure S1. Whole-mount smfish with and without the methanol pretreatment.
Correlation & Linear Regression in SPSS
Petra Petrovics Correlation & Linear Regression in SPSS 4 th seminar Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Correlation
Mapping Sequencing Reads to a Reference Genome
Mapping Sequencing Reads to a Reference Genome High Throughput Sequencing RN Example applications: Sequencing a genome (DN) Sequencing a transcriptome and gene expression studies (RN) ChIP (chromatin immunoprecipitation)
Bird species status and trends reporting format for the period (Annex 2)
1. Species Information 1.1 Member State Hungary 1.2.2 Natura 2000 code A634-B 1.3 Species name Ardea purpurea purpurea 1.3.1 Sub-specific population East Europe, Black Sea & Mediterranean/Sub-Saharan Africa
Phenotype. Genotype. It is like any other experiment! What is a bioinformatics experiment? Remember the Goal. Infectious Disease Paradigm
It is like any other experiment! What is a bioinformatics experiment? You need to know your data/input sources You need to understand your methods and their assumptions You need a plan to get from point
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Correlation & Linear. Petra Petrovics.
Correlation & Linear Regression in SPSS Petra Petrovics PhD Student Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise
Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley M. Lemon, Lawrence M. Pfeffer, Kui Li
Supplemental Material IRF3-dependent and NF- B-independent viral induction of the zinc-finger antiviral protein Nan Wang, Qingming Dong, Jingjing Li, Rohit K. Jangra, Meiyun Fan, Allan R. Brasier, Stanley
Statistical Dependence
Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent
Az R adatelemzési nyelv alapjai I.
Gyakorlati feladat megoldása Az R adatelemzési nyelv alapjai I. September 14, 2018 A feladat megoldása során egy olyan adattáblával fogunk dolgozni, amely hipotetikus személyek testmagasság és testsúly
Correlation & Linear Regression in SPSS
Correlation & Linear Regression in SPSS Types of dependence association between two nominal data mixed between a nominal and a ratio data correlation among ratio data Exercise 1 - Correlation File / Open
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Hypothesis Testing. Petra Petrovics.
Hypothesis Testing Petra Petrovics PhD Student Inference from the Sample to the Population Estimation Hypothesis Testing Estimation: how can we determine the value of an unknown parameter of a population
Egymintás próbák. Alapkérdés: populáció <paramétere/tulajdonsága> megegyezik-e egy referencia paraméter értékkel/tulajdonsággal?
Egymintás próbák σ s μ m Alapkérdés: A populáció egy adott megegyezik-e egy referencia paraméter értékkel/tulajdonsággal? egymintás t-próba Wilcoxon-féle előjeles
(A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5
Fig. S1. Brg1 ablation leads to abnormal villous structure in the duodenum in the perinatal period (A F) H&E staining of the duodenum in the indicated genotypes at E16.5 (A, D), E18.5 (B, E), and P0.5
Túlélés elemzés október 27.
Túlélés elemzés 2017. október 27. Néhány példa Egy adott betegség diagnózisától kezdve mennyi ideje van hátra a páciensnek? Tipikusan mennyi ideig élhet túl? Bizonyos ráktípus esetén mennyi idő telik el
SOLiD Technology. library preparation & Sequencing Chemistry (sequencing by ligation!) Imaging and analysis. Application specific sample preparation
SOLiD Technology Application specific sample preparation Application specific data analysis library preparation & emulsion PCR Sequencing Chemistry (sequencing by ligation!) Imaging and analysis SOLiD
Szívkatéterek hajlékonysága, meghajlítása
Szívkatéterek hajlékonysága, meghajlítása Összefoglalás A szívkatéter egy olyan intravaszkuláris katéter, amelyet a szívbe vezetnek, ültetnek be diagnosztikus vagy terápiás célból. A katéterek felvezetés/eltávolítás
Adatbázis-kezelés ODBC driverrel
ADATBÁZIS-KEZELÉS ODBC DRIVERREL... 1 ODBC: OPEN DATABASE CONNECTIVITY (NYÍLT ADATBÁZIS KAPCSOLÁS)... 1 AZ ODBC FELÉPÍTÉSE... 2 ADATBÁZIS REGISZTRÁCIÓ... 2 PROJEKT LÉTREHOZÁSA... 3 A GENERÁLT PROJEKT FELÉPÍTÉSE...
Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and
1 2 3 4 5 Journal name: Applied Microbiology and Biotechnology Manuscript Title: Identification of a thermostable fungal lytic polysaccharide monooxygenase and evaluation of its effect on lignocellulosic
Akt1 Akt kinase activity Creb signaling CCTTACAGCCCTCAAGTACTCATTC GGCGTACTCCATGACAAAGCA Arc Actin binding
Additional File 1 (Table S1): Description and primer sequences of 80 candidate genes tested as potential synaptic plasticity formation genes in qrt-pcr array. Abbreviations: LTP: long-term potentiation,
Cluster Analysis. Potyó László
Cluster Analysis Potyó László What is Cluster Analysis? Cluster: a collection of data objects Similar to one another within the same cluster Dissimilar to the objects in other clusters Cluster analysis
discosnp demo - Peterlongo Pierre 1 DISCOSNP++: Live demo
discosnp demo - Peterlongo Pierre 1 DISCOSNP++: Live demo Download and install discosnp demo - Peterlongo Pierre 3 Download web page: github.com/gatb/discosnp Chose latest release (2.2.10 today) discosnp
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing MFMER slide-1
Trinucleotide Repeat Diseases: CRISPR Cas9 PacBio no PCR Sequencing 2015 MFMER slide-1 Fuch s Eye Disease TCF 4 gene Fuchs occurs in about 4% of the US population. Leads to deteriorating vision without
A cell-based screening system for RNA Polymerase I inhibitors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information A cell-based screening system for RNA Polymerase I inhibitors Xiao Tan,
Személyes adatváltoztatási formanyomtatvány - Magyarország / Personal Data Change Form - Hungary
Személyes adatváltoztatási formanyomtatvány - Magyarország / Personal Data Change Form - Hungary Kitöltési útmutató: A formanyomtatványon a munkavállaló a személyes adatainak módosítását kezdeményezheti.
Személyes adatváltoztatási formanyomtatvány- Magyarország / Personal Data Change Form - Hungary
Személyes adatváltoztatási formanyomtatvány- Magyarország / Personal Data Change Form - Hungary KITÖLTÉSI ÚTMUTATÓ: A formanyomtatványon a munkavállaló a személyes adatainak módosítását kezdeményezheti.
Statistical Inference
Petra Petrovics Statistical Inference 1 st lecture Descriptive Statistics Inferential - it is concerned only with collecting and describing data Population - it is used when tentative conclusions about
INDEXSTRUKTÚRÁK III.
2MU05_Bitmap.pdf camü_ea INDEXSTRUKTÚRÁK III. Molina-Ullman-Widom: Adatbázisrendszerek megvalósítása Panem, 2001könyv 5.4. Bittérkép indexek fejezete alapján Oracle: Indexek a gyakorlatban Oracle Database
Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ
Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ Azért, mert a kemoterápia bizonyított módon fokozza a gyógyulás esélyét! A kemoterápiának az a célja, hogy az esetleg, vagy biztosan visszamaradt daganatsejtek
Klaszterezés, 2. rész
Klaszterezés, 2. rész Csima Judit BME, VIK, Számítástudományi és Információelméleti Tanszék 208. április 6. Csima Judit Klaszterezés, 2. rész / 29 Hierarchikus klaszterezés egymásba ágyazott klasztereket
Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes
Stem Cell Reports, Volume 2 Supplemental Information Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by ipsc-derived Oligodendrocytes Yuko
Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI
Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A https://ir.kardio.hu A Web based study with quality assurance
1., Egy területen véletlenszerűen kihelyezet kvadrátokban megszámlálták az Eringium maritimum (tengerparti ördögszekér) egyedeit.
1., Egy területen véletlenszerűen kihelyezet kvadrátokban megszámlálták az Eringium maritimum (tengerparti ördögszekér) egyedeit. 1., Határozza meg az átlagos egyedszámot és a szórást. Egyedszám (x i )
Supporting Information
Supporting Information Cell-free GFP simulations Cell-free simulations of degfp production were consistent with experimental measurements (Fig. S1). Dual emmission GFP was produced under a P70a promoter
Expressziós microarray. Dr. Győrffy Balázs
Expressziós microarray Dr. Győrffy Balázs Áttekintő 1. A technológia 2. Feldolgozás 2.1. Minőség-ellenőrzés 2.2. Jellemző kiválasztás 2.3. Vizualizálás 2.4. Kereszt-elemzés 2.5. Online diagnosztika 3.
CONCERTO COMMUNITIES IN EU DEALING WITH OPTIMAL THERMAL AND ELECTRICAL EFFICIENCY OF BUILDINGS AND DISTRICTS, BASED ON MICROGRIDS. WP 5 Del 5.
CONCERTO COMMUNITIES IN EU DEALING WITH OPTIMAL THERMAL AND ELECTRICAL EFFICIENCY OF BUILDINGS AND DISTRICTS, BASED ON MICROGRIDS WP 5 Del 5.14 1 st period Szentendre Papers and articles in specialist
FAMILY STRUCTURES THROUGH THE LIFE CYCLE
FAMILY STRUCTURES THROUGH THE LIFE CYCLE István Harcsa Judit Monostori A magyar társadalom 2012-ben: trendek és perspektívák EU összehasonlításban Budapest, 2012 november 22-23 Introduction Factors which
First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.
First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this
OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA ÁGH TAMÁS DR., MÉSZÁROS ÁGNES DR.
ALL RIGHTS RESERVED SOKSZOROSÍTÁSI CSAK A MTT ÉS A KIADÓ ENGEDÉLYÉVEL Az asthmás és COPD-s betegek életminõségét befolyásoló tényezõk OROSZ MÁRTA DR., GÁLFFY GABRIELLA DR., KOVÁCS DOROTTYA Semmelweis Egyetem
Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis
Factor Analysis Factor analysis is a multiple statistical method, which analyzes the correlation relation between data, and it is for data reduction, dimension reduction and to explore the structure. Aim
Tulajdonságalapú tesztelés
Tulajdonságalapú tesztelés QuickCheck A QuickCheck Haskell programok automatikus, tulajdonságalapú tesztelésére használható. Programspecifikáció: program által teljesítendő tulajdonságok Nagy számú, a
KIEGÉSZÍTŽ FELADATOK. Készlet Bud. Kap. Pápa Sopr. Veszp. Kecsk. 310 4 6 8 10 5 Pécs 260 6 4 5 6 3 Szomb. 280 9 5 4 3 5 Igény 220 200 80 180 160
KIEGÉSZÍTŽ FELADATOK (Szállítási probléma) Árut kell elszállítani három telephelyr l (Kecskemét, Pécs, Szombathely) öt területi raktárba, melyek Budapesten, Kaposváron, Pápán, Sopronban és Veszprémben
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK
Sebastián Sáez Senior Trade Economist INTERNATIONAL TRADE DEPARTMENT WORLD BANK Despite enormous challenges many developing countries are service exporters Besides traditional activities such as tourism;
Statisztikai hipotézisvizsgálatok. Paraméteres statisztikai próbák
Statisztikai hipotézisvizsgálatok Paraméteres statisztikai próbák 1. Magyarországon a lakosság élelmiszerre fordított kiadásainak 2000-ben átlagosan 140 ezer Ft/fő volt. Egy kérdőíves felmérés során Veszprém
Geokémia gyakorlat. 1. Geokémiai adatok értelmezése: egyszerű statisztikai módszerek. Geológus szakirány (BSc) Dr. Lukács Réka
Geokémia gyakorlat 1. Geokémiai adatok értelmezése: egyszerű statisztikai módszerek Geológus szakirány (BSc) Dr. Lukács Réka MTA-ELTE Vulkanológiai Kutatócsoport e-mail: reka.harangi@gmail.com ALAPFOGALMAK:
10. Gyakorlat: Alkalmazások publikálása Remote Desktop Szervízen keresztül
10. Gyakorlat: Alkalmazások publikálása Remote Desktop Szervízen keresztül 10.1. Jogosultságok és csoportok létrehozása 10.2. Az RDS szerver szerepkör telepítése a DC01-es szerverre 10.3. Az RDS01-es szerver
Flowering time. Col C24 Cvi C24xCol C24xCvi ColxCvi
Flowering time Rosette leaf number 50 45 40 35 30 25 20 15 10 5 0 Col C24 Cvi C24xCol C24xCvi ColxCvi Figure S1. Flowering time in three F 1 hybrids and their parental lines as measured by leaf number
EN United in diversity EN A8-0206/419. Amendment
22.3.2019 A8-0206/419 419 Article 2 paragraph 4 point a point i (i) the identity of the road transport operator; (i) the identity of the road transport operator by means of its intra-community tax identification
Elemszám becslés. Kaszaki József Ph.D. SZTE ÁOK Sebészeti Műtéttani Intézet
Elemszám becslés Kaszaki József Ph.D. SZTE ÁOK Sebészeti Műtéttani Intézet Miért fontos? Gazdasági okok: Túl kevés elem esetén nem tudjuk kimutatni a kívánt hatást Túl kevés elem esetén olyan eredmény
Forensic SNP Genotyping using Nanopore MinION Sequencing
Forensic SNP Genotyping using Nanopore MinION Sequencing AUTHORS Senne Cornelis 1, Yannick Gansemans 1, Lieselot Deleye 1, Dieter Deforce 1,#,Filip Van Nieuwerburgh 1,#,* 1 Laboratory of Pharmaceutical
C#, OOP. Osztályok tervezése C#-ban
C#, OOP Osztályok tervezése C#-ban OOP Létrehozás (creating) Megszüntetés (destroying) Túlterhelés (overlading) Felsorolás típus (enumerated types) 2 Hajó osztály Sailboat class using System; class Sailboat
Szoftver-technológia II. Tervezési minták. Irodalom. Szoftver-technológia II.
Tervezési minták Irodalom Steven R. Schach: Object Oriented & Classical Software Engineering, McGRAW-HILL, 6th edition, 2005, chapter 8. E. Gamma, R. Helm, R. Johnson, J. Vlissides:Design patterns: Elements
A magyar racka juh tejének beltartalmi változása a laktáció alatt
A magyar racka juh tejének beltartalmi változása a laktáció alatt Nagy László Komlósi István Debreceni Egyetem Agrártudományi Centrum, Mezőgazdaságtudományi Kar, Állattenyésztés- és Takarmányozástani Tanszék,
Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)
0.1 Member State HU 0.2.1 Species code 1358 0.2.2 Species name Mustela putorius 0.2.3 Alternative species scientific name 0.2.4 Common name házigörény 1. National Level 1.1 Maps 1.1.1 Distribution Map
INTELLIGENT ENERGY EUROPE PROGRAMME BUILD UP SKILLS TRAINBUD. Quality label system
INTELLIGENT ENERGY EUROPE PROGRAMME BUILD UP SKILLS TRAINBUD WP4: Deliverable 4.5 Development of voluntary qualification system Quality label system 1 INTELLIGENT ENERGY EUROPE PROGRAMME BUILD UP SKILLS
Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)
0.1 Member State HU 0.2.1 Species code 1050 0.2.2 Species name Saga pedo 0.2.3 Alternative species scientific name 0.2.4 Common name fűrészlábú szöcske 1. National Level 1.1 Maps 1.1.1 Distribution Map
THS710A, THS720A, THS730A & THS720P TekScope Reference
THS710A, THS720A, THS730A & THS720P TekScope Reference 070-9741-01 Getting Started 1 Connect probes or leads. 2 Choose SCOPE 3 or METER mode. Press AUTORANGE. Copyright Tektronix, Inc. Printed in U.S.A.
PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER
SEMMELWEIS UNIVERSITY PETER PAMANY CATLIC UNIVERSITY Development of Complex Curricula for Molecular Bionics and Infobionics Programs within a consortial* framework** Consortium leader PETER PAMANY CATLIC
practices Mosaic and timed mowing Mosaic and timed mowing Mosaic and timed mowing 10 m wide fallow strips (4 parcels)
Name of treatment (Action C5 in HUKM10004 by KMNPD and MME) Goal of the treatment Description of treatment and management practices Treated area Maximum No. of sub-groups ha pcs. Type1. Extensive mosaic
már mindenben úgy kell eljárnunk, mint bármilyen viaszveszejtéses öntés esetén. A kapott öntvény kidolgozásánál még mindig van lehetőségünk
Budapest Régiségei XLII-XLIII. 2009-2010. Vecsey Ádám Fémeszterga versus viaszesztergálás Bev e z e t é s A méhviaszt, mint alapanyagot nehéz besorolni a műtárgyalkotó anyagok különböző csoportjaiba, mert
Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté!
Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában Kiss Máté! Magreceptor Kutató Laboratórium Biokémiai és Molekuláris Biológiai Intézet Debreceni Egyetem, Általános Orvostudományi
Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)
0.1 Member State HU 0.2.1 Species code 1353 0.2.2 Species name Canis aureus 0.2.3 Alternative species scientific name 0.2.4 Common name aranysakál 1. National Level 1.1 Maps 1.1.1 Distribution Map Yes
Expansion of Red Deer and afforestation in Hungary
Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi www.vmi.szie.hu Background and importance large herbivores are overpopulated
Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)
0.1 Member State HU 0.2.1 Species code 4110 0.2.2 Species name Pulsatilla pratensis ssp. hungarica 0.2.3 Alternative species Pulsatilla flavescens scientific name 0.2.4 Common name magyar kökörcsin 1.
R alapok, Rejtett Markov modell gyakorlat
R alapok, Rejtett Markov modell gyakorlat Valószínűségi következtető és döntéstámogató rendszerek R alapok Az alábbiakban rövid (kivonatos) áttekintést adunk az R programnyelvbe és statisztikai szofvterbe.
BEVEZETÉS Az objektum fogalma
BEVEZETÉS Az objektum fogalma Program (1) Adat (2) Objektum Kiadványszerkesztés Word Táblázatkezelés Excel CAD AutoCad Adatbáziskezelés Access 1 Program (1) Adat (2) Objektum Adatmodell (2) A valós világ
Collections. Összetett adatstruktúrák
Collections Összetett adatstruktúrák Collections framework Előregyártott interface-ek és osztályok a leggyakoribb összetett adatszerkezetek megvalósítására Legtöbbször módosítás nélkül használhatók Időt,
FATERMÉSI FOK MEGHATÁROZÁSA AZ EGÉSZÁLLOMÁNY ÁTLAGNÖVEDÉKE ALAPJÁN
4. évfolyam 2. szám 2 0 1 4 101 107. oldal FATERMÉSI FOK MEGHATÁROZÁSA AZ EGÉSZÁLLOMÁNY ÁTLAGNÖVEDÉKE ALAPJÁN Veperdi Gábor Nyugat-magyarországi Egyetem, Erdômérnöki Kar Kivonat A fatermési fok meghatározása
Excel vagy Given-When-Then? Vagy mindkettő?
TESZT & TEA BUDAPEST AGILE MEETUP Pénzügyi számítások automatizált agilis tesztelése: Excel vagy Given-When-Then? Vagy mindkettő? NAGY GÁSPÁR TechTalk developer coach Budapest, 2014 február 6. SpecFlow
Epithelialis-mesenchymalis átmenet vastagbél daganatokban
Epithelialis-mesenchymalis átmenet vastagbél daganatokban Éles Klára Országos Onkológiai Intézet Sebészi és Molekuláris Daganatpatológiai Centrum Budapest, 2010. 12. 03. Epithelialis-mesenchymalis átmenet
AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, TILLING
Hagyomány és haladás a növénynemesítésben AZ ÁRPA SZÁRAZSÁGTŰRÉSÉNEK VIZSGÁLATA: QTL- ÉS ASSZOCIÁCIÓS ANALÍZIS, MARKER ALAPÚ SZELEKCIÓ, BÁLINT ANDRÁS FERENC 1, SZIRA FRUZSINA 1, ANDREAS BÖRNER 2, KERSTIN
Angol Középfokú Nyelvvizsgázók Bibliája: Nyelvtani összefoglalás, 30 kidolgozott szóbeli tétel, esszé és minta levelek + rendhagyó igék jelentéssel
Angol Középfokú Nyelvvizsgázók Bibliája: Nyelvtani összefoglalás, 30 kidolgozott szóbeli tétel, esszé és minta levelek + rendhagyó igék jelentéssel Timea Farkas Click here if your download doesn"t start
Ellenőrző lista. 2. Hálózati útvonal beállítások, kapcsolatok, névfeloldások ellenőrzése: WebEC és BKPR URL-k kliensről történő ellenőrzése.
Ellenőrző lista 1. HW/SW rendszer követelmények meglétének ellenőrzése: A telepítési segédlet által megjelölt elemek meglétének, helyes üzemének ellenőrzése. 2. Hálózati útvonal beállítások, kapcsolatok,
Az R statisztikai programozási környezet: az adatgyűjtéstől a feldolgozáson és vizualizáción át a dinamikus jelentéskészítésig
: az adatgyűjtéstől a feldolgozáson és vizualizáción át a dinamikus jelentéskészítésig Ferenci Tamás ferenci.tamas@nik.uni-obuda.hu 2017. február 23. Tartalom Az R mint programozási nyelv A könyvtárakról
Biomatematika 15. Szent István Egyetem Állatorvos-tudományi Kar. Fodor János
Szent István Egyetem Állatorvos-tudományi Kar Biomatematikai és Számítástechnikai Tanszék Biomatematika 15. Nemparaméteres próbák Fodor János Copyright c Fodor.Janos@aotk.szie.hu Last Revision Date: November
Egyenlőtlenségi mérőszámok alkalmazása az adatbányászatban. Hajdu Ottó BCE: Statisztika Tanszék BME: Pénzügyek tanszék Budapest, 2011
Egyenlőtlenségi mérőszámok alkalmazása az adatbányászatban Hajdu Ottó BCE: Statisztika Tanszék BME: Pénzügyek tanszék Budapest, 2011 Adatbányászati feladatok 1. Ismert mintákon, példákon való tanulás (extracting
Eladni könnyedén? Oracle Sales Cloud. Horváth Tünde Principal Sales Consultant 2014. március 23.
Eladni könnyedén? Oracle Sales Cloud Horváth Tünde Principal Sales Consultant 2014. március 23. Oracle Confidential Internal/Restricted/Highly Restricted Safe Harbor Statement The following is intended
o n traz naydigea ynlh Sav c risa! cisrmapcd(h)c+9 Disclaimer
o n traz naydigea ynlh Sav c risa! cisrmapcd(h)c+9 Disclaimer Thenifotrmapitfnifnphisnwresefpapitfnuasncdrrefpnapn phenpimenphenwresefpapitfnuasnctmwlieynafynytesn ftpnifcldyenswecioicnwagernwtliciesntrnctfpracpn
IES TM Evaluating Light Source Color Rendition
IES TM-30-15 Evaluating Light Source Color Rendition "Original" "CRI = 80" Desaturated "CRI = 80" Saturated More metrics Color Fidelity Color Discrimination Color Preference Metrics/Measures R f (IES TM-30-15)
USER MANUAL Guest user
USER MANUAL Guest user 1 Welcome in Kutatótér (Researchroom) Top menu 1. Click on it and the left side menu will pop up 2. With the slider you can make left side menu visible 3. Font side: enlarging font
10. Genomika 2. Microarrayek és típusaik
10. Genomika 2. 1. Microarray technikák és bioinformatikai vonatkozásaik Microarrayek és típusaik Korrelált génexpresszió mint a funkcionális genomika eszköze 2. Kombinált megközelítés a funkcionális genomikában
ENROLLMENT FORM / BEIRATKOZÁSI ADATLAP
ENROLLMENT FORM / BEIRATKOZÁSI ADATLAP CHILD S DATA / GYERMEK ADATAI PLEASE FILL IN THIS INFORMATION WITH DATA BASED ON OFFICIAL DOCUMENTS / KÉRJÜK, TÖLTSE KI A HIVATALOS DOKUMENTUMOKBAN SZEREPLŐ ADATOK
SZEZONÁLIS LÉGKÖRI AEROSZOL SZÉNIZOTÓP ÖSSZETÉTEL VÁLTOZÁSOK DEBRECENBEN
SZEZONÁLIS LÉGKÖRI AEROSZOL SZÉNIZOTÓP ÖSSZETÉTEL VÁLTOZÁSOK DEBRECENBEN Major István 1, Gyökös Brigitta 1,2, Furu Enikő 1, Futó István 1, Horváth Anikó 1, Kertész Zsófia 1, Molnár Mihály 1 1 MTA Atommagkutató
Adatok importálása R-ben
Adatok importálása R-ben Jeszenszky Péter Debreceni Egyetem, Informatikai Kar jeszenszky.peter@inf.unideb.hu Utolsó módosítás: 2019. június 11. Telepítendő csomagok A példák kipróbálásához telepítendő
Heveny myeloid leukaemiás betegeink kezelésével szerzett tapasztalataink (2007 2013)
EREDETI KÖZLEMÉNY Heveny myeloid leukaemiás betegeink kezelésével szerzett tapasztalataink (2007 2013) Selmeczi Anna dr. 1 Udvardy Miklós dr. 1 Illés Árpád dr. 1 Telek Béla dr. 1 Kiss Attila dr. 1 Batár
Logisztikus regresszió október 27.
Logisztikus regresszió 2017. október 27. Néhány példa Mi a valószínűsége egy adott betegségnek a páciens bizonyos megfigyelt jellemzői (pl. nem, életkor, laboreredmények, BMI stb.) alapján? Mely genetikai
Jelátviteli uatk és daganatképződés
Jelátviteli uatk és daganatképződés Tímár József Semmelweis Egyetem, Klinikai Központ 2.sz. Patológiai Intézet MTA-SE Molekuláris Onkológia Kutatócsoport, Budapest A HER-2 genetikája emberi daganatokban
KISTERV2_ANOVA_
Két faktor szerinti ANOVA Az A faktor minden szintjét kombináljuk a B faktor minden szintjével, minden cellában azonos számú ismétlés (kiegyensúlyozott terv). A terv szerkezete miatt a faktorok hatását
Supplementary Figure 1
Supplementary Figure 1 Plot of delta-afe of sequence variants detected between resistant and susceptible pool over the genome sequence of the WB42 line of B. vulgaris ssp. maritima. The delta-afe values
Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán
Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán 1.Számú Patológiai és Kísérleti Rákkutató Intézet Diagnózis (definitív): benignus, malignus, intermedier malignitás, borderline
ROS Remote Operations Service
ROS Remote Operations Service Adamis Gusztáv (adamis@tmit.bme.hu) Réthy György (Gyorgy.Rethy@ericsson.com) Ziegler Gábor (gabor.ziegler@ericsson.com) 2015.03.13. Távközlési szoftverek 1 Példa: szendvicsautomata