Bevezetés az R-be Betekintés az expressziós chipek kiértekelésébe

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "Bevezetés az R-be Betekintés az expressziós chipek kiértekelésébe"


1 Bevezetés az R-be Betekintés az expressziós chipek kiértekelésébe Solymosi Norbert Állatorvos-tudományi Kar, Szent István Egyetem Komplex Rendszerek Fizikája Tanszék, ELTE Neuroinformatika SE Szentágothai Doktori Iskola november 7. NKTH TECH08:3dhist08, TÁMOP B-11/2/KMR

2 R-Bioconductor S, S-Plus Robert Gentleman, Ross Ihaka Szkript-nyelv Függvények (csomagok, könyvtárak) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 2 / 65

3 R-Bioconductor Robert Gentleman Csomagok Software Metadata (Annotation, CDF and Probe) Custom CDF Experiment Data Complete Taxonomy Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 3 / 65

4 Telepítés R-Bioconductor R Bioconductor Binárisok forrásból Alaptelepítés csomagjai Csomagok telepítése > install.packages( vcd ) Csomagok telepítése > setrepositories() > install.packages( affy ) Csomagcsoportok telepítése > source( ) > bioclite( RBioinf ) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 4 / 65

5 R-nyelv > > [1] 3 objektum <- kifejezés. > a < > a [1] 3 > (a < ) [1] 3 > (a <- 5) [1] 5 > fuggveny.neve(arg1,arg2,...) > length(a) [1] 1 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 5 / 65

6 R-nyelv Könyvtárak A függvények könyvtárakban érhetők el Könyvtárak telepítése > setrepositories() --- Please select repositories for use in this session --- 1: + CRAN 2: Omegahat 3: BioC software 4: BioC annotation 5: BioC experiment 6: BioC extra 7: R-Forge Enter one or more numbers separated by spaces 1: > install.packages( vcd ) Könyvtárak betöltése > library(lattice) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 6 / 65

7 Súgó R-nyelv > help(t.test) >?t.test t.test package:stats R Documentation Student s t-test Description: Performs one and two sample t-tests on vectors of data. Usage: t.test(x,...) ## Default S3 method: t.test(x, y = NULL, alternative = c("two.sided", "less", "greater"), mu = 0, paired = FALSE, var.equal = FALSE, conf.level = 0.95,...) ## S3 method for class formula : t.test(formula, data, subset, na.action,...) Arguments: x: a (non-empty) numeric vector of data values. y: an optional (non-empty) numeric vector of data values. alternative: a character string specifying the alternative hypothesis, must be one of "two.sided" (default), "greater" or Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 7 / 65

8 Fájlok, adatok R-nyelv > setwd( /home/user/chip ) > getwd() [1] "/home/user/chip" read.table(file, header = FALSE, sep = "", quote = "\" ", dec = ".", row.names, col.names, =!stringsasfactors, na.strings = "NA", colclasses = NA, nrows = -1, skip = 0, check.names = TRUE, fill =!blank.lines.skip, strip.white = FALSE, blank.lines.skip = TRUE, comment.char = "#", allowescapes = FALSE, flush = FALSE, stringsasfactors = default.stringsasfactors(), fileencoding = "", encoding = "unknown") függvény sep dec quote fill read.line "". \"!blank.lines.skip read.csv,. \" TRUE read.csv2 ;, \" TRUE read.delim \t. \" TRUE read.delim2 \t, \" TRUE Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 8 / 65

9 Fájlok, adatok R-nyelv write() write.table() save() save(list = ls(all=true), file = "minden_objektum.rdata") save.image() dput() dget() dump() source() savehistory() loadhistory() Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 9 / 65

10 Vektor R-nyelv > (a <- 1:5) [1] > (a <- c(9,4,6,7,1,2,5)) [1] > a[3] [1] 6 > (a <- vector(mode = "numeric", length = 5)) > (a <- numeric(length = 5)) [1] > (a <- vector(mode = "logical", length = 5)) > (a <- logical(length = 5)) [1] FALSE FALSE FALSE FALSE FALSE > (a <- vector(mode = "character", length = 5)) > (a <- character(length = 5)) [1] "" "" "" "" "" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 10 / 65

11 Mátrix R-nyelv > a <- 1:6 > (m <- matrix(a, nr = 3)) [,1] [,2] [1,] 1 4 [2,] 2 5 [3,] 3 6 > (m <- matrix(a, nr = 3, byrow = T)) [,1] [,2] [1,] 1 2 [2,] 3 4 [3,] 5 6 > dim(a) <- c(3, 2) > a [,1] [,2] [1,] 1 4 [2,] 2 5 [3,] 3 6 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 11 / 65

12 Mátrix R-nyelv > (x <- matrix(1:9, nc = 3)) [,1] [,2] [,3] [1,] [2,] [3,] > x[2, 2] [1] 5 > x[2, ] [1] > x[, 2] [1] > x[-1, ] [,1] [,2] [,3] [1,] [2,] > x[, -1] [,1] [,2] [1,] 4 7 [2,] 5 8 [3,] 6 9 > x[-1, -1] [,1] [,2] [1,] 5 8 [2,] 6 9 > x[-c(1, 3), ] [1] Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 12 / 65

13 Data frame R-nyelv > x <- 1:4 > n <- 10 > (r <- data.frame(x, n)) x n > (r <- data.frame(oszlop1 = x, oszlop2 = n)) oszlop1 oszlop > r$oszlop1 [1] > r[, oszlop1 ] [1] Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 13 / 65

14 Lista R-nyelv > x <- matrix(1:9, nc = 3) > y <- 1:5 > allista <- list(c("a", "b", "c"), + c(8, 5, 2, 4, 1, 3)) > lista <- list(x, y, allista) > names(lista) <- c("r", "t", "z") > lista $r [,1] [,2] [,3] [1,] [2,] [3,] > lista[[1]] [,1] [,2] [,3] [1,] [2,] [3,] > lista$r [,1] [,2] [,3] [1,] [2,] [3,] $t [1] $z $z[[1]] [1] "a" "b" "c" $z[[2]] [1] Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 14 / 65

15 Affymetrix expressziós chip CEL Gén Egy vagy több probeset Több probe (PM, MM) 25 mer Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 15 / 65

16 Affymetrix expressziós chip CEL Gén Egy vagy több probeset Több probe (PM, MM) 25 mer Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 15 / 65

17 CEL Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 16 / 65

18 CEL Minden probeset 1. probe-ja Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 17 / 65

19 CEL Intenzitás Probe Probe: 8 8 pixel Rács illesztése Keret elhagyása 75. percentilis intenzitás CEL-állomány: PM- és MM-intenzitás Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 18 / 65

20 AffyBatch CEL > library( affy ) > setwd( munkakönyvtár ) > beolvasott.chipek = ReadAffy() > library("cll") Loading required package: affy Loading required package: Biobase Welcome to Bioconductor Vignettes contain introductory material. To view, type openvignette(). To cite Bioconductor, see citation("biobase") and for packages citation(pkgname). > data("cllbatch") Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 19 / 65

21 AffyBatch CEL > CLLbatch AffyBatch object size of arrays=640x640 features (91212 kb) cdf=hg_u95av2 (12625 affyids) number of samples=24 number of genes=12625 annotation=hgu95av2 notes= The AffyBatch object has 24 samples that were affixed to Affymetrix hgu95av2 arrays. These 24 samples came from 24 CLL patients that were either classified as stable or progressive in regards to disease progression. The CLL package contains the chronic lymphocytic leukemia (CLL) gene expression data. The CLL data had 24 samples that were either classified as progressive or stable in regards to disease progression. The CLL microarray data came from Dr. Sabina Chiaretti at Division of Hematology, Department of Cellular Biotechnologies and Hematology, University La Sapienza, Rome, Italy and Dr. Jerome Ritz at Department of Medicine, Brigham and Women s Hospital, Harvard Medical School, Boston, Massachusetts. Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 20 / 65

22 AffyBatch CEL Minták > samplenames(cllbatch) [1] "CLL10.CEL" "CLL11.CEL" "CLL12.CEL" "CLL13.CEL" "CLL14.CEL" "CLL15.CEL" [7] "CLL16.CEL" "CLL17.CEL" "CLL18.CEL" "CLL19.CEL" "CLL1.CEL" "CLL20.CEL" [13] "CLL21.CEL" "CLL22.CEL" "CLL23.CEL" "CLL24.CEL" "CLL2.CEL" "CLL3.CEL" [19] "CLL4.CEL" "CLL5.CEL" "CLL6.CEL" "CLL7.CEL" "CLL8.CEL" "CLL9.CEL" > length(samplenames(cllbatch)) [1] 24 Probesetek > featurenames(cllbatch)[1:10] [1] "1000_at" "1001_at" "1002_f_at" "1003_s_at" "1004_at" "1005_at" [7] "1006_at" "1007_s_at" "1008_f_at" "1009_at" > length(featurenames(cllbatch)) [1] Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 21 / 65

23 CEL AffyBatch PM > pm(cllbatch, "1000_at")[,1:2] CLL10.CEL CLL11.CEL 1000_at _at _at _at _at _at _at _at _at _at _at _at _at _at _at _at MM > mm(cllbatch, "1000_at")[,1:2] CLL10.CEL CLL11.CEL 1000_at _at _at _at _at _at _at _at _at _at _at _at _at _at _at _at Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 22 / 65

24 AffyBatch leíró adatok CEL AffyBatch-ben eddigi info > head(pdata(cllbatch)) sample CLL10.CEL 1 CLL11.CEL 2 CLL12.CEL 3 CLL13.CEL 4 CLL14.CEL 5 CLL15.CEL 6 A minták leírása > data(disease) > head(disease) SampleID Disease 1 CLL10 <NA> 2 CLL11 progres. 3 CLL12 stable 4 CLL13 progres. 5 CLL14 progres. 6 CLL15 progres. Egyesítve az AffyBatch-ben > rownames(disease) = disease$sampleid > uj.nev = sub( \\.CEL$,, + samplenames(cllbatch)) > uj.nev[1:5] [1] "CLL10" "CLL11" "CLL12" "CLL13" "CLL14" > samplenames(cllbatch) = uj.nev > = match(rownames(disease), samplenames(cllbatch)) > vmd = data.frame(labeldescription = c( Sample ID, + Disease status: progressive or stable disease )) > phenodata(cllbatch) = new( AnnotatedDataFrame, + data = disease[, ], varmetadata = vmd) > head(pdata(cllbatch)) SampleID Disease CLL10 CLL10 <NA> CLL11 CLL11 progres. CLL12 CLL12 stable CLL13 CLL13 progres. CLL14 CLL14 progres. CLL15 CLL15 progres. Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 23 / 65

25 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok 4 4 grid mindegyik cellán belül az alsó 2% lesz a háttér ezek átlaga az átlagos háttér legnagyobb legkisebb < 3 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65

26 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok MAS 5.0 normalizáció alapgondolat, hogy a transzkriptumok kis hányada különbözik csak minták trimmelt átlagos intenzitása megegyezik alsó, felső 2% elhagyása az legnagyobb < 3 átlag Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65

27 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok Probesetek hány % expresszálódik? PM > MM: hiányzik, határeset, jelen van legnagyobb legkisebb < 3 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65

28 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok RNS-minősége, bomlottsága β-aktin, GAPDH a legtöbb sejt azonos szinten expresszálja hosszúak, probesetek az 5 - és a 3 -végről, ill. közepéről a 3 - és az 5 -jel aránya ha magas pl. bomlott β-aktin: < 3 GAPDH: 1 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65

29 Minőségellenőrzés Mértékek Átlagos háttér Átskálázási factor Jelenlét % 3 /5 arány Hibridizációs kontrollok BioB, BioC, BioD, CreX Bacillus subtillis intenzitás hibridizáció, szkennelés BioB: mindegyik chipen jelen kell lennie, de legalább 70%-ukban Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 24 / 65

30 Minőségellenőrzés Minta H. átlag S. faktor Jelenlét % CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL CLL Arány actin3/actin5 gapdh3/gapdh CLL9 CLL8 CLL7 CLL6 CLL5 CLL4 CLL3 CLL2 CLL24 CLL23 CLL22 CLL21 CLL20 CLL1 CLL19 CLL18 CLL17 CLL16 CLL15 CLL14 CLL13 CLL12 CLL % % % % % % % % % % % % % % % % % % % % % % % QC Stats 0 biob biob biob biob biob biob biob biob biob 2 3 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 25 / 65

31 Probe-adatok Annotáció > library("annotate") Loading required package: AnnotationDbi > annotation(cllbatch) [1] "hgu95av2" > library(hgu95av2probe) > data(hgu95av2probe) > hgu95av2probe Object of class probetable data.frame with rows and 6 columns. >[1:10,-5]) sequence x y Probe.Set.Name Target.Strandedness 1 TGGCTCCTGCTGAGGTCCCCTTTCC _at Antisense 2 GGCTGTGAATTCCTGTACATATTTC _at Antisense 3 GCTTCAATTCCATTATGTTTTAATG _at Antisense 4 GCCGTTTGACAGAGCATGCTCTGCG _at Antisense 5 TGACAGAGCATGCTCTGCGTTGTTG _at Antisense 6 CTCTGCGTTGTTGGTTTCACCAGCT _at Antisense 7 GGTTTCACCAGCTTCTGCCCTCACA _at Antisense 8 TTCTGCCCTCACATGCACAGGGATT _at Antisense 9 CCTCACATGCACAGGGATTTAACAA _at Antisense 10 TCCTTGGTACTCTGCCCTCCTGTCA _at Antisense Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 26 / 65

32 Annotáció Probeset-kapcsolódások (hgu95av2.db) > hgu95av2() Quality control information for hgu95av2: This package has the following mappings: hgu95av2accnum has mapped keys (of keys) hgu95av2alias2probe has mapped keys (of keys) hgu95av2chr has mapped keys (of keys) hgu95av2chrlengths has 25 mapped keys (of 25 keys) hgu95av2chrloc has mapped keys (of keys) hgu95av2chrlocend has mapped keys (of keys) hgu95av2ensembl has mapped keys (of keys) hgu95av2ensembl2probe has 9021 mapped keys (of 9021 keys) hgu95av2entrezid has mapped keys (of keys) hgu95av2enzyme has 1978 mapped keys (of keys) hgu95av2enzyme2probe has 725 mapped keys (of 725 keys) hgu95av2genename has mapped keys (of keys) hgu95av2go has mapped keys (of keys) hgu95av2go2allprobes has 9581 mapped keys (of 9581 keys) hgu95av2go2probe has 6774 mapped keys (of 6774 keys) hgu95av2map has mapped keys (of keys) hgu95av2omim has mapped keys (of keys) hgu95av2path has 4585 mapped keys (of keys) hgu95av2path2probe has 203 mapped keys (of 203 keys) hgu95av2pfam has mapped keys (of keys) hgu95av2pmid has mapped keys (of keys) hgu95av2pmid2probe has mapped keys (of keys) hgu95av2prosite has mapped keys (of keys) hgu95av2refseq has mapped keys (of keys) hgu95av2symbol has mapped keys (of keys) hgu95av2unigene has mapped keys (of keys) hgu95av2uniprot has mapped keys (of keys) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 27 / 65

33 Annotáció > (chrom = buildchromlocation( hgu95av2.db )) Instance of a chromlocation class with the following fields: Organism: Homo sapiens Data source: hgu95av2.db Number of chromosomes for this organism: 25 Chromosomes of this organism and their lengths in base pairs: 1 : : : : : : : : : : : : : : : : : : : : : : M : X : Y : Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 28 / 65

34 Annotáció > chromlocs(chrom)[[ Y ]][1:10] 266_s_at 31911_at 32930_f_at 32991_f_at 35885_at 35929_s_at 35930_at _at 37583_at 38182_at > get( 35885_at, probestochrom(chrom)) [1] "Y" > probesets = featurenames(cllbatch) > getsymbol(probesets[1:3], hgu95av2.db ) 1000_at "MAPK3" 1001_at 1002_f_at "TIE1" "CYP2C19" > mget(probesets[1:3], hgu95av2symbol) $ 1000_at [1] "MAPK3" $ 1001_at [1] "TIE1" $ 1002_f_at [1] "CYP2C19" > get(probesets[1:3], hgu95av2symbol) [1] "MAPK3" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 29 / 65

35 Annotáció > hgu95av2symbol$ 1000_at [1] "MAPK3" > hgu95av2symbol[[ 1000_at ]] [1] "MAPK3" > hgu95av2genename$ 1000_at [1] "mitogen-activated protein kinase 3" > hgu95av2ensembl$ 1000_at [1] "ENSG " > hgu95av2accnum$ 1000_at [1] "X60188" > sym.2.hgu95av2 = revmap(hgu95av2symbol) > sym.2.hgu95av2$ MAPK3 [1] "1000_at" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 30 / 65

36 GO Annotáció > totable(hgu95av2go[ 1000_at ]) probe_id go_id Evidence Ontology _at GO: IDA BP _at GO: IEA BP _at GO: EXP BP _at GO: IEA BP _at GO: EXP CC _at GO: IDA CC _at GO: EXP CC _at GO: IDA CC _at GO: IDA CC _at GO: IEA MF _at GO: IPI MF _at GO: EXP MF _at GO: IEA MF _at GO: EXP MF _at GO: NAS MF _at GO: IEA MF Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 31 / 65

37 Annotáció KEGG > (ps.paths = as.list(hgu95av2path)[[ 1000_at ]]) [1] "04010" "04012" "04150" "04350" "04360" "04370" "04510" "04520" "04540" [10] "04620" "04650" "04664" "04720" "04730" "04810" "04910" "04912" "04916" [19] "04930" "05010" "05210" "05211" "05212" "05213" "05214" "05215" "05216" [28] "05218" "05219" "05220" "05221" "05223" > library(kegg.db) > = as.list(keggpathid2name) > = as.list(keggpathname2id) > length( [1] 336 for (ps in ps.paths) print([[ps]]) [1] "MAPK signaling pathway" [1] "ErbB signaling pathway" [1] "mtor signaling pathway" [1] "TGF-beta signaling pathway" [1] "Axon guidance" [1] "VEGF signaling pathway" [1] "Focal adhesion" [1] "Adherens junction" [1] "Gap junction" [1] "Toll-like receptor signaling pathway" [1] "Natural killer cell mediated cytotoxicity" [1] "Fc epsilon RI signaling pathway" [1] "Long-term potentiation" [1] "Long-term depression" [1] "Regulation of actin cytoskeleton" [1] "Insulin signaling pathway" [1] "GnRH signaling pathway" [1] "Melanogenesis" [1] "Type II diabetes mellitus" [1] "Alzheimer s disease" [1] "Colorectal cancer" [1] "Renal cell carcinoma" [1] "Pancreatic cancer" [1] "Endometrial cancer" [1] "Glioma" [1] "Prostate cancer" [1] "Thyroid cancer" [1] "Melanoma" [1] "Bladder cancer" [1] "Chronic myeloid leukemia" [1] "Acute myeloid leukemia" [1] "Non-small cell lung cancer" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 32 / 65

38 KEGG Annotáció >[[ Colorectal cancer ]] [1] "05210" >[[ ]] [1] "Colorectal cancer" > ( = as.list(hgu95av2path2probe)[[ ]][1:10]) [1] "34055_at" "34056_g_at" "34415_at" "36451_at" "39199_at" [6] "1564_at" "2022_at" "2023_g_at" "40972_at" "1912_s_at" > as.character(getsymbol(, hgu95av2.db )) [1] "ACVR1B" "ACVR1B" "ACVR1B" "ACVR1B" "ACVR1B" "AKT1" "AKT2" "AKT2" [9] "AKT2" "APC" > unique(as.character(getsymbol(, hgu95av2.db ))) [1] "ACVR1B" "AKT1" "AKT2" "APC" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 33 / 65

39 PubMed Annotáció > absts = pm.getabst( 37809_at, "hgu95av2") > absts[[ 37809_at ]][[58]] An object of class pubmedabst : Title: HOX expression patterns identify a common signature for favorable AML. PMID: Authors: M Andreeff, V Ruvolo, S Gadgil, C Zeng, K Coombes, W Chen, S Kornblau, AE Barón, HA Drabkin Journal: Leukemia Date: Nov 2008 > absttext(absts[[ 37809_at ]][[58]]) [1] "Deregulated HOX expression, by chromosomal translocations and myeloid-lymphoid leukemia (MLL) rearrangements, is causal in some types of leukemia. Using real-time reverse transcription-pcr, we examined the expression of 43 clustered HOX, polycomb, MLL and FLT3 genes in 119 newly diagnosed adult acute myeloid leukemias (AMLs) selected from all major cytogenetic groups. Downregulated HOX expression was a consistent feature of favorable AMLs and, among these cases, inv(16) cases had a distinct expression profile. Using a 17-gene predictor in 44 additional samples, we observed a 94.7% specificity for classifying favorable vs intermediate/unfavorable cytogenetic groups. Among other AMLs, HOX overexpression was associated with nucleophosmin (NPM) mutations and we also identified a phenotypically similar subset with wt-npm. In many unfavorable and other intermediate cytogenetic AMLs, HOX levels resembled those in normal CD34+ cells, except that the homogeneity characteristic of normal samples was not present. We also observed that HOXA9 levels were significantly inversely correlated with survival and that BMI-1 was overexpressed in cases with 11q23 rearrangements, suggesting that p19(arf) suppression may be involved in MLL-associated leukemia. These results underscore the close relationship between HOX expression patterns and certain forms of AML and emphasize the need to determine whether these differences play a role in the disease process." Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 34 / 65

40 Preprocess Mérési adatok előkészítése elemzésre Probe-intenzitás összehasonlítható probeset-expressziós érték Lépései: 1 Háttér-korrekció Chipen belüli normálás 2 Normalizáció Chipek összehasonlíthatósága 3 Expressziós érték számítása Intenzitásból expressziós érték Számos módszer mindegyik lépésre N.B. a függvény neve eljárás Pl. rma() háttér-korrekció RMA-korrekció normalizáció kvantilis expresszió-számítás medián Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 35 / 65

41 ExpressionSet Preprocess > eset = rma(cllbatch) Background correcting Normalizing Calculating Expression > eset ExpressionSet (storagemode: lockedenvironment) assaydata: features, 23 samples element names: exprs phenodata samplenames: CLL11, CLL12,..., CLL9 (23 total) varlabels and varmetadata description: SampleID: Sample ID Disease: Disease status: progressive or stable disease featuredata featurenames: 1000_at, 1001_at,..., AFFX-YEL024w/RIP1_at (12625 total) fvarlabels and fvarmetadata description: none experimentdata: use experimentdata(object) Annotation: hgu95av2 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 36 / 65

42 ExpressionSet Preprocess > eset$disease [1] progres. stable progres. progres. progres. progres. stable stable [9] progres. stable stable progres. stable progres. stable stable [17] progres. progres. progres. progres. progres. progres. stable Levels: progres. stable > eset[,eset$disease== stable ] ExpressionSet (storagemode: lockedenvironment) assaydata: features, 9 samples element names: exprs phenodata samplenames: CLL12, CLL17,..., CLL9 (9 total) varlabels and varmetadata description: SampleID: Sample ID Disease: Disease status: progressive or stable disease featuredata featurenames: 1000_at, 1001_at,..., AFFX-YEL024w/RIP1_at (12625 total) fvarlabels and fvarmetadata description: none experimentdata: use experimentdata(object) Annotation: hgu95av2 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 37 / 65

43 Expressziós mátrix Preprocess > = exprs(eset) > dim( [1] > colnames([1:5] [1] "CLL11" "CLL12" "CLL13" "CLL14" "CLL15" > rownames([1:5] [1] "1000_at" "1001_at" "1002_f_at" "1003_s_at" "1004_at" >[1:5,1:5] CLL11 CLL12 CLL13 CLL14 CLL _at _at _f_at _s_at _at Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 38 / 65

44 Expressziós különbségek Expressziós különbségek Expressziós értékek összehasonlítása, fenotípus szerint Probeseteket külön-külön hasonlítja össze Gyakoribb módszerek: Fold-change átlagok, mediánok hányadosa általában log2-skálán nem kezeli a csoportokon belüli variabilitást kisebb mintaszámok Paraméteres próbák variabilitást bevonja a feltételek ritkán teljesülnek nagyobb az ereje Nemparaméteres próbák variabilitást bevonja enyhébb feltételek kisebb az ereje Egyebek: ROC, permutációs próbák, stb. Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 39 / 65

45 ALL Expressziós különbségek > library(all) > data(all) > ALL ExpressionSet (storagemode: lockedenvironment) assaydata: features, 128 samples element names: exprs phenodata samplenames: 01005, 01010,..., LAL4 (128 total) varlabels and varmetadata description: cod: Patient ID diagnosis: Date of diagnosis...:... date last seen: date patient was last seen (21 total) featuredata featurenames: 1000_at, 1001_at,..., AFFX-YEL024w/RIP1_at fvarlabels and fvarmetadata description: none experimentdata: use experimentdata(object) pubmedids: Annotation: hgu95av2 (12625 total) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 40 / 65

46 ALL Expressziós különbségek > head(pdata(all)) cod diagnosis sex age BT remission CR t(4;11) t(9;22) /21/1997 M 53 B2 CR CR 8/6/1997 FALSE TRUE /29/2000 M 19 B2 CR CR 6/27/2000 FALSE FALSE /24/1998 F 52 B4 CR CR 8/17/1998 NA NA /17/1997 M 38 B1 CR CR 9/8/1997 TRUE FALSE /22/1997 M 57 B2 CR CR 9/17/1997 FALSE FALSE /30/1997 M 17 B1 CR CR 9/27/1997 FALSE FALSE cyto.normal citog mol.biol fusion protein mdr kinet ccr FALSE t(9;22) BCR/ABL p210 NEG dyploid FALSE FALSE simple alt. NEG <NA> POS dyploid FALSE NA <NA> BCR/ABL p190 NEG dyploid FALSE FALSE t(4;11) ALL1/AF4 <NA> NEG dyploid FALSE FALSE del(6q) NEG <NA> NEG dyploid FALSE FALSE complex alt. NEG <NA> NEG hyperd. FALSE relapse transplant f.u date last seen FALSE TRUE BMT / DEATH IN CR <NA> TRUE FALSE REL 8/28/ TRUE FALSE REL 10/15/ TRUE FALSE REL 1/23/ TRUE FALSE REL 11/4/ TRUE FALSE REL 12/15/1997 Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 41 / 65

47 ALL Expressziós különbségek B-sejtes tumor minták indexeinek kigyűjtése > b.sejt.idxs = grep("^b", as.character(all$bt)) Molekuláris biológiai tulajdonság alapján 2 csoport indexeinek lekérdezése (BCR/ABL-translokáció, negatív a vizsgált eltérésekre) > mol.tipus.idxs = which(as.character(all$mol.biol) %in% c( NEG, BCR/ABL )) Közös metszetük alapján új eset létrehozása > ALL.bcr.neg = ALL[,intersect(b.sejt.idxs, mol.tipus.idxs)] > ALL.bcr.neg$mol.biol = factor(all.bcr.neg$mol.biol) > ALL.bcr.neg ExpressionSet (storagemode: lockedenvironment) assaydata: features, 79 samples element names: exprs phenodata samplenames: 01005, 01010,..., (79 total) varlabels and varmetadata description: cod: Patient ID diagnosis: Date of diagnosis...:... date last seen: date patient was last seen (21 total) featuredata featurenames: 1000_at, 1001_at,..., AFFX-YEL024w/RIP1_at fvarlabels and fvarmetadata description: none experimentdata: use experimentdata(object) pubmedids: Annotation: hgu95av2 (12625 total) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 42 / 65

48 Fold change Expressziós különbségek > ALL.bcr.neg.exprs.m = exprs(all.bcr.neg) > csoportok = as.numeric(all.bcr.neg$mol.biol) > table(csoportok) csoportok > idx1 = which(csoportok==1) > idx2 = which(csoportok==2) > Fc = rowmeans(all.bcr.neg.exprs.m[,idx2])-rowmeans(all.bcr.neg.exprs.m[,idx1]) > atlag = rowmeans(all.bcr.neg.exprs.m) > plot(atlag, Fc, xlab = átlag, ylab = Fold change, las=1, pch=20) > abline(h=0, col= grey ) > abline(h=1, col= grey, lty=2) > abline(h=-1, col= grey, lty=2) > smoothscatter(atlag, Fc, xlab = Átlag, ylab = Fold change, las=1) > abline(h=1, col= grey, lty=2) > abline(h=-1, col= grey, lty=2) Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 43 / 65

49 Expressziós különbségek Fold change Átlag Fold change Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 44 / 65

50 Fold change Expressziós különbségek Fold change Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 44 / 65 Átlag

51 Fold change Expressziós különbségek > sum(abs(fc)>=1) [1] 36 > ( = rownames(all.bcr.neg.exprs.m[abs(fc)>=1, ])) [1] "1211_s_at" "1635_at" "1636_g_at" "1674_at" "32434_at" [6] "32542_at" "33232_at" "33440_at" "33462_at" "34472_at" [11] "35926_s_at" "36275_at" "36536_at" "36543_at" "36591_at" [16] "36617_at" "36638_at" "36927_at" "37006_at" "37014_at" [21] "37015_at" "37027_at" "37043_at" "37363_at" "37403_at" [26] "38052_at" "38111_at" "38514_at" "38578_at" "39329_at" [31] "39730_at" "40202_at" "40504_at" "40516_at" "40953_at" [36] "41123_s_at" > sort(unique(as.character(getsymbol(, hgu95av2.db )))) [1] "ABL1" "ACTN1" "AHNAK" "AHR" "ALDH1A1" "ANXA1" "CD27" [8] "CNN3" "CRADD" "CRIP1" "CTGF" "ENPP2" "F13A1" "F3" [15] "FHL1" "FZD6" "ID1" "ID3" "IFI44L" "IGJ" "IGLL1" [22] "KLF9" "LILRB1" "MARCKS" "MTSS1" "MX1" "P2RY14" "PON2" [29] "SCHIP1" "SEMA6A" "TUBA4A" "VCAN" "YES1" "ZEB1" Szentágothai Doktori Iskola (2012. XI. 7.) Neuroinformatika Expressziós chipek 45 / 65

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,


Széchenyi István Egyetem

Széchenyi István Egyetem Oldal: 1/6 A feladat során megismerkedünk a C# és a LabVIEW összekapcsolásának egy lehetőségével, pontosabban nagyon egyszerű C#- ban írt kódból fordítunk DLL-t, amit meghívunk LabVIEW-ból. Az eljárás



STATISZTIKA PRÓBAZH 2005 STATISZTIKA PRÓBAZH 2005 1. FELADATSOR: számítógépes feladatok (még bővülni fog számítógép nélkül megoldandó feladatokkal is) Használjuk a Dislexia Excel fájlt (internet: http://! 1.) Hasonlítsuk


Statistical Dependence

Statistical Dependence Statistical Dependence Petra Petrovics Statistical Dependence Deinition: Statistical dependence exists when the value o some variable is dependent upon or aected by the value o some other variable. Independent


Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Hypothesis Testing. Petra Petrovics.

Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet. Hypothesis Testing. Petra Petrovics. Hypothesis Testing Petra Petrovics PhD Student Inference from the Sample to the Population Estimation Hypothesis Testing Estimation: how can we determine the value of an unknown parameter of a population


Szívkatéterek hajlékonysága, meghajlítása

Szívkatéterek hajlékonysága, meghajlítása Szívkatéterek hajlékonysága, meghajlítása Összefoglalás A szívkatéter egy olyan intravaszkuláris katéter, amelyet a szívbe vezetnek, ültetnek be diagnosztikus vagy terápiás célból. A katéterek felvezetés/eltávolítás


Adatbázis-kezelés ODBC driverrel



Személyes adatváltoztatási formanyomtatvány - Magyarország / Personal Data Change Form - Hungary

Személyes adatváltoztatási formanyomtatvány - Magyarország / Personal Data Change Form - Hungary Személyes adatváltoztatási formanyomtatvány - Magyarország / Personal Data Change Form - Hungary Kitöltési útmutató: A formanyomtatványon a munkavállaló a személyes adatainak módosítását kezdeményezheti.


Statistical Inference

Statistical Inference Petra Petrovics Statistical Inference 1 st lecture Descriptive Statistics Inferential - it is concerned only with collecting and describing data Population - it is used when tentative conclusions about


Személyes adatváltoztatási formanyomtatvány- Magyarország / Personal Data Change Form - Hungary

Személyes adatváltoztatási formanyomtatvány- Magyarország / Personal Data Change Form - Hungary Személyes adatváltoztatási formanyomtatvány- Magyarország / Personal Data Change Form - Hungary KITÖLTÉSI ÚTMUTATÓ: A formanyomtatványon a munkavállaló a személyes adatainak módosítását kezdeményezheti.


Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ

Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ Azért, mert a kemoterápia bizonyított módon fokozza a gyógyulás esélyét! A kemoterápiának az a célja, hogy az esetleg, vagy biztosan visszamaradt daganatsejtek





Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI

Gottsegen National Institute of Cardiology. Prof. A. JÁNOSI Myocardial Infarction Registry Pilot Study Hungarian Myocardial Infarction Register Gottsegen National Institute of Cardiology Prof. A. JÁNOSI A A Web based study with quality assurance





1., Egy területen véletlenszerűen kihelyezet kvadrátokban megszámlálták az Eringium maritimum (tengerparti ördögszekér) egyedeit.

1., Egy területen véletlenszerűen kihelyezet kvadrátokban megszámlálták az Eringium maritimum (tengerparti ördögszekér) egyedeit. 1., Egy területen véletlenszerűen kihelyezet kvadrátokban megszámlálták az Eringium maritimum (tengerparti ördögszekér) egyedeit. 1., Határozza meg az átlagos egyedszámot és a szórást. Egyedszám (x i )


Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis

Miskolci Egyetem Gazdaságtudományi Kar Üzleti Információgazdálkodási és Módszertani Intézet Factor Analysis Factor Analysis Factor analysis is a multiple statistical method, which analyzes the correlation relation between data, and it is for data reduction, dimension reduction and to explore the structure. Aim


First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25.

First experiences with Gd fuel assemblies in. Tamás Parkó, Botond Beliczai AER Symposium 2009.09.21 25. First experiences with Gd fuel assemblies in the Paks NPP Tams Parkó, Botond Beliczai AER Symposium 2009.09.21 25. Introduction From 2006 we increased the heat power of our units by 8% For reaching this


Statisztikai hipotézisvizsgálatok. Paraméteres statisztikai próbák

Statisztikai hipotézisvizsgálatok. Paraméteres statisztikai próbák Statisztikai hipotézisvizsgálatok Paraméteres statisztikai próbák 1. Magyarországon a lakosság élelmiszerre fordított kiadásainak 2000-ben átlagosan 140 ezer Ft/fő volt. Egy kérdőíves felmérés során Veszprém


10. Gyakorlat: Alkalmazások publikálása Remote Desktop Szervízen keresztül

10. Gyakorlat: Alkalmazások publikálása Remote Desktop Szervízen keresztül 10. Gyakorlat: Alkalmazások publikálása Remote Desktop Szervízen keresztül 10.1. Jogosultságok és csoportok létrehozása 10.2. Az RDS szerver szerepkör telepítése a DC01-es szerverre 10.3. Az RDS01-es szerver


KIEGÉSZÍTŽ FELADATOK. Készlet Bud. Kap. Pápa Sopr. Veszp. Kecsk. 310 4 6 8 10 5 Pécs 260 6 4 5 6 3 Szomb. 280 9 5 4 3 5 Igény 220 200 80 180 160

KIEGÉSZÍTŽ FELADATOK. Készlet Bud. Kap. Pápa Sopr. Veszp. Kecsk. 310 4 6 8 10 5 Pécs 260 6 4 5 6 3 Szomb. 280 9 5 4 3 5 Igény 220 200 80 180 160 KIEGÉSZÍTŽ FELADATOK (Szállítási probléma) Árut kell elszállítani három telephelyr l (Kecskemét, Pécs, Szombathely) öt területi raktárba, melyek Budapesten, Kaposváron, Pápán, Sopronban és Veszprémben


A magyar racka juh tejének beltartalmi változása a laktáció alatt

A magyar racka juh tejének beltartalmi változása a laktáció alatt A magyar racka juh tejének beltartalmi változása a laktáció alatt Nagy László Komlósi István Debreceni Egyetem Agrártudományi Centrum, Mezőgazdaságtudományi Kar, Állattenyésztés- és Takarmányozástani Tanszék,


Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté!

Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában. Kiss Máté! Retinoid X Receptor, egy A-vitamin szenzor a tüdőmetasztázis kontrolljában Kiss Máté! Magreceptor Kutató Laboratórium Biokémiai és Molekuláris Biológiai Intézet Debreceni Egyetem, Általános Orvostudományi


Szoftver-technológia II. Tervezési minták. Irodalom. Szoftver-technológia II.

Szoftver-technológia II. Tervezési minták. Irodalom. Szoftver-technológia II. Tervezési minták Irodalom Steven R. Schach: Object Oriented & Classical Software Engineering, McGRAW-HILL, 6th edition, 2005, chapter 8. E. Gamma, R. Helm, R. Johnson, J. Vlissides:Design patterns: Elements





Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B) 0.1 Member State HU 0.2.1 Species code 1358 0.2.2 Species name Mustela putorius 0.2.3 Alternative species scientific name 0.2.4 Common name házigörény 1. National Level 1.1 Maps 1.1.1 Distribution Map


Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B) 0.1 Member State HU 0.2.1 Species code 1050 0.2.2 Species name Saga pedo 0.2.3 Alternative species scientific name 0.2.4 Common name fűrészlábú szöcske 1. National Level 1.1 Maps 1.1.1 Distribution Map


már mindenben úgy kell eljárnunk, mint bármilyen viaszveszejtéses öntés esetén. A kapott öntvény kidolgozásánál még mindig van lehetőségünk

már mindenben úgy kell eljárnunk, mint bármilyen viaszveszejtéses öntés esetén. A kapott öntvény kidolgozásánál még mindig van lehetőségünk Budapest Régiségei XLII-XLIII. 2009-2010. Vecsey Ádám Fémeszterga versus viaszesztergálás Bev e z e t é s A méhviaszt, mint alapanyagot nehéz besorolni a műtárgyalkotó anyagok különböző csoportjaiba, mert


BEVEZETÉS Az objektum fogalma

BEVEZETÉS Az objektum fogalma BEVEZETÉS Az objektum fogalma Program (1) Adat (2) Objektum Kiadványszerkesztés Word Táblázatkezelés Excel CAD AutoCad Adatbáziskezelés Access 1 Program (1) Adat (2) Objektum Adatmodell (2) A valós világ


Expansion of Red Deer and afforestation in Hungary

Expansion of Red Deer and afforestation in Hungary Expansion of Red Deer and afforestation in Hungary László Szemethy, Róbert Lehoczki, Krisztián Katona, Norbert Bleier, Sándor Csányi Background and importance large herbivores are overpopulated



FATERMÉSI FOK MEGHATÁROZÁSA AZ EGÉSZÁLLOMÁNY ÁTLAGNÖVEDÉKE ALAPJÁN 4. évfolyam 2. szám 2 0 1 4 101 107. oldal FATERMÉSI FOK MEGHATÁROZÁSA AZ EGÉSZÁLLOMÁNY ÁTLAGNÖVEDÉKE ALAPJÁN Veperdi Gábor Nyugat-magyarországi Egyetem, Erdômérnöki Kar Kivonat A fatermési fok meghatározása


Excel vagy Given-When-Then? Vagy mindkettő?

Excel vagy Given-When-Then? Vagy mindkettő? TESZT & TEA BUDAPEST AGILE MEETUP Pénzügyi számítások automatizált agilis tesztelése: Excel vagy Given-When-Then? Vagy mindkettő? NAGY GÁSPÁR TechTalk developer coach Budapest, 2014 február 6. SpecFlow


STATISZTIKA. A maradék független a kezelés és blokk hatástól. Maradékok leíró statisztikája. 4. A modell érvényességének ellenőrzése

STATISZTIKA. A maradék független a kezelés és blokk hatástól. Maradékok leíró statisztikája. 4. A modell érvényességének ellenőrzése 4. A modell érvényességének ellenőrzése STATISZTIKA 4. Előadás Variancia-analízis Lineáris modellek 1. Függetlenség 2. Normális eloszlás 3. Azonos varianciák A maradék független a kezelés és blokk hatástól


Epithelialis-mesenchymalis átmenet vastagbél daganatokban

Epithelialis-mesenchymalis átmenet vastagbél daganatokban Epithelialis-mesenchymalis átmenet vastagbél daganatokban Éles Klára Országos Onkológiai Intézet Sebészi és Molekuláris Daganatpatológiai Centrum Budapest, 2010. 12. 03. Epithelialis-mesenchymalis átmenet





Egyenlőtlenségi mérőszámok alkalmazása az adatbányászatban. Hajdu Ottó BCE: Statisztika Tanszék BME: Pénzügyek tanszék Budapest, 2011

Egyenlőtlenségi mérőszámok alkalmazása az adatbányászatban. Hajdu Ottó BCE: Statisztika Tanszék BME: Pénzügyek tanszék Budapest, 2011 Egyenlőtlenségi mérőszámok alkalmazása az adatbányászatban Hajdu Ottó BCE: Statisztika Tanszék BME: Pénzügyek tanszék Budapest, 2011 Adatbányászati feladatok 1. Ismert mintákon, példákon való tanulás (extracting


Ellenőrző lista. 2. Hálózati útvonal beállítások, kapcsolatok, névfeloldások ellenőrzése: WebEC és BKPR URL-k kliensről történő ellenőrzése.

Ellenőrző lista. 2. Hálózati útvonal beállítások, kapcsolatok, névfeloldások ellenőrzése: WebEC és BKPR URL-k kliensről történő ellenőrzése. Ellenőrző lista 1. HW/SW rendszer követelmények meglétének ellenőrzése: A telepítési segédlet által megjelölt elemek meglétének, helyes üzemének ellenőrzése. 2. Hálózati útvonal beállítások, kapcsolatok,


Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B) 0.1 Member State HU 0.2.1 Species code 1903 0.2.2 Species name Liparis loeselii 0.2.3 Alternative species scientific name 0.2.4 Common name loesel-hagymaburok 1. National Level 1.1 Maps 1.1.1 Distribution


Eladni könnyedén? Oracle Sales Cloud. Horváth Tünde Principal Sales Consultant 2014. március 23.

Eladni könnyedén? Oracle Sales Cloud. Horváth Tünde Principal Sales Consultant 2014. március 23. Eladni könnyedén? Oracle Sales Cloud Horváth Tünde Principal Sales Consultant 2014. március 23. Oracle Confidential Internal/Restricted/Highly Restricted Safe Harbor Statement The following is intended


USER MANUAL Guest user

USER MANUAL Guest user USER MANUAL Guest user 1 Welcome in Kutatótér (Researchroom) Top menu 1. Click on it and the left side menu will pop up 2. With the slider you can make left side menu visible 3. Font side: enlarging font


Heveny myeloid leukaemiás betegeink kezelésével szerzett tapasztalataink (2007 2013)

Heveny myeloid leukaemiás betegeink kezelésével szerzett tapasztalataink (2007 2013) EREDETI KÖZLEMÉNY Heveny myeloid leukaemiás betegeink kezelésével szerzett tapasztalataink (2007 2013) Selmeczi Anna dr. 1 Udvardy Miklós dr. 1 Illés Árpád dr. 1 Telek Béla dr. 1 Kiss Attila dr. 1 Batár








Jelátviteli uatk és daganatképződés

Jelátviteli uatk és daganatképződés Jelátviteli uatk és daganatképződés Tímár József Semmelweis Egyetem, Klinikai Központ Patológiai Intézet MTA-SE Molekuláris Onkológia Kutatócsoport, Budapest A HER-2 genetikája emberi daganatokban


Office and computing machinery, equipment and supplies except furniture and software packages

Office and computing machinery, equipment and supplies except furniture and software packages Office and computing machinery, equipment and supplies except furniture and software packages Info Version 1 Url External tender id 93963-2012 Tender type


Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán

Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán 1.Számú Patológiai és Kísérleti Rákkutató Intézet Diagnózis (definitív): benignus, malignus, intermedier malignitás, borderline


Szükségletre korrigált egészségügyi ellátás igénybevételének egyenlôtlenségei Magyarországon

Szükségletre korrigált egészségügyi ellátás igénybevételének egyenlôtlenségei Magyarországon Szükségletre korrigált egészségügyi ellátás igénybevételének egyenlôtlenségei Magyarországon VITRAI József, BAKACS Márta, KAPOSVÁRI Csilla, NÉMETH Renáta BEVEZETÉS Az egészségügyi ellátás szükségletre


Feldspar: Nyelv digitális jelfeldolgozáshoz

Feldspar: Nyelv digitális jelfeldolgozáshoz Feldspar: Nyelv digitális jelfeldolgozáshoz Eötvös Loránd Tudományegyetem, Budapest Támogatja: Ericsson, KMOP-1.1.2-08 Feldspar funkcionális beágyazott nyelv Feldspar digitális jelfeldolgozáshoz párhuzamossághoz


A vastagbélhám sejtkinetikai változásainak vizsgálata gyulladásos vastagbélbetegségekben a gyulladás szövettani aktivitásának függvényében

A vastagbélhám sejtkinetikai változásainak vizsgálata gyulladásos vastagbélbetegségekben a gyulladás szövettani aktivitásának függvényében A vastagbélhám sejtkinetikai változásainak vizsgálata gyulladásos vastagbélbetegségekben a gyulladás szövettani aktivitásának függvényében Doktori (PhD) dolgozat Gastroenterológia c. PhD program keretében


Csima Judit március 9. és 16.

Csima Judit március 9. és 16. Grafika Csima Judit BME, VIK, Számítástudományi és Információelméleti Tanszék 2017. március 9. és 16. Csima Judit Grafika 1 / 18 Grafika általában Grafika az R-ben Van néhány alapvető package az ábrázolásra:


Implementation of water quality monitoring

Implementation of water quality monitoring Joint Ipoly/Ipel Catchment Management HUSK/1101/2.1.1/0153 Implementation of water quality monitoring Dr. Adrienne Clement Budapest University of Technology and Economics Department



EBBEN A VIZSGARÉSZBEN A VIZSGAFELADAT ARÁNYA Az Országos Képzési Jegyzékről és az Országos Képzési Jegyzékbe történő felvétel és törlés eljárási rendjéről szóló 133/2010. (IV. 22.) Korm. rendelet alapján. Szakképesítés, szakképesítés-elágazás, rész-szakképesítés,


4. Gyakorlat ellenőrzött osztályozás

4. Gyakorlat ellenőrzött osztályozás 4. Gyakorlat ellenőrzött osztályozás Hozzávalók: MultiSpec program (d: meghajtó, MultiSpecWin32 könyvtár, MultiSpecWin32.exe); ag020522_dpac_cd.lan állomány Ebben a gyakorlatban az ellenőrzött osztályozás


Biomatematika 15. Szent István Egyetem Állatorvos-tudományi Kar. Fodor János

Biomatematika 15. Szent István Egyetem Állatorvos-tudományi Kar. Fodor János Szent István Egyetem Állatorvos-tudományi Kar Biomatematikai és Számítástechnikai Tanszék Biomatematika 15. Nemparaméteres próbák Fodor János Copyright c Last Revision Date: November


Minden az adatról. Csima Judit. 2015. február 11. BME, VIK, Csima Judit Minden az adatról 1 / 41

Minden az adatról. Csima Judit. 2015. február 11. BME, VIK, Csima Judit Minden az adatról 1 / 41 Minden az adatról Csima Judit BME, VIK, Számítástudományi és Információelméleti Tanszék 2015. február 11. Csima Judit Minden az adatról 1 / 41 Adat: alapfogalmak Adathalmaz elvileg bármi, ami információt


- Bevándoroltak részére kiadott személyazonosító igazolvány

- Bevándoroltak részére kiadott személyazonosító igazolvány HUNGARY - Bevándoroltak részére kiadott személyazonosító igazolvány (Blue booklet form or card format issued for permanent residents - from 1 January 2000 a new card format has been introduced and issued)


10. Genomika 2. Microarrayek és típusaik

10. Genomika 2. Microarrayek és típusaik 10. Genomika 2. 1. Microarray technikák és bioinformatikai vonatkozásaik Microarrayek és típusaik Korrelált génexpresszió mint a funkcionális genomika eszköze 2. Kombinált megközelítés a funkcionális genomikában


sikeresnek bizonyult, és ami a legfontosabb az onkoterápiában, hogy a vegyület nem toxikus, ezért igen magas dózissal is eredményesn alkalmazható.

sikeresnek bizonyult, és ami a legfontosabb az onkoterápiában, hogy a vegyület nem toxikus, ezért igen magas dózissal is eredményesn alkalmazható. Turmeric Live Extract 30db A teljes kurkuma kivonat hatásának rövid jellemzése A Turmeric Live Extract bonyolult, számos eltérő molekulát tartalmazó összetett hatóanyag. A turmeron/ol különböző formáit,


Reiczigel Jenő Harnos Andrea Solymosi Norbert. BIOSTATISZTIKA nem statisztikusoknak

Reiczigel Jenő Harnos Andrea Solymosi Norbert. BIOSTATISZTIKA nem statisztikusoknak Reiczigel Jenő Harnos Andrea Solymosi Norbert BIOSTATISZTIKA nem statisztikusoknak Tartalomjegyzék Előszó 1 Köszönetnyilvánítás........................... 4 Hogyan olvassuk ezt a könyvet?....................


Road construction works

Road construction works Road construction works Info Version 2 Url External tender id 246818-2014 Tender type Tender Document type Additional information Procurement procedure Open

Részletesebben Tumor immunológia Tumor immunológia Tumor immunológia A tumorok és az immunrendszer kapcsolatai Tumorspecifikus és tumorasszociált antigének A tumor sejteket ölő sejtek és mechanizmusok Az immunológiai felügyelet


A fő egészségügyi kihívások

A fő egészségügyi kihívások A fő egészségügyi kihívások Öregedés Mentális betegségek Fertőző betegségek Elhízás, diabetes Allergia, asztma Szív- és érbetegségek Autoimmun kórképek Rák Komplex betegségek Rendszerbiológia Bioinformatika,





1. Gyakorlat: Telepítés: Windows Server 2008 R2 Enterprise, Core, Windows 7

1. Gyakorlat: Telepítés: Windows Server 2008 R2 Enterprise, Core, Windows 7 1. Gyakorlat: Telepítés: Windows Server 2008 R2 Enterprise, Core, Windows 7 1.1. Új virtuális gép és Windows Server 2008 R2 Enterprise alap lemez létrehozása 1.2. A differenciális lemezek és a két új virtuális


Vállalatirányítási rendszerek

Vállalatirányítási rendszerek Vállalatirányítási rendszerek Varga Zsigmond Üzletfejlesztési igazgató Budapest, 2015. március 03. Nyilvános Motiváció? 2013 SAP AG. All rights reserved. 2 Adatrögzítés része a fejlődésnek 3 Mestermunkától


COOPERATION IN THE CEREAL SECTOR OF THE SOUTH PLAINS REGIONS STRÉN, BERTALAN. Keywords: cooperation, competitiveness, cereal sector, region, market.

COOPERATION IN THE CEREAL SECTOR OF THE SOUTH PLAINS REGIONS STRÉN, BERTALAN. Keywords: cooperation, competitiveness, cereal sector, region, market. COOPERATION IN THE CEREAL SECTOR OF THE SOUTH PLAINS REGIONS STRÉN, BERTALAN Keywords: cooperation, competitiveness, cereal sector, region, market. Using a questionnaire, we determined the nature and strength


Skills Development at the National University of Public Service

Skills Development at the National University of Public Service Skills Development at the National University of Public Service Presented by Ágnes Jenei National University of Public Service Faculty of Public Administration Public Ethics and Communication 13. 12. 2013


Szakmai továbbképzési nap akadémiai oktatóknak. 2012. december 14. HISZK, Hódmezővásárhely / Webex

Szakmai továbbképzési nap akadémiai oktatóknak. 2012. december 14. HISZK, Hódmezővásárhely / Webex Szakmai továbbképzési nap akadémiai oktatóknak 2012. december 14. HISZK, Hódmezővásárhely / Webex 14.00-15.00 15.00-15.30 15.30-15.40 Mai program 1. Amit feltétlenül ismernünk kell: az irányítótábla közelebbről.


3. Gyakorlat ellenőrzés nélküli osztályozás

3. Gyakorlat ellenőrzés nélküli osztályozás 3. Gyakorlat ellenőrzés nélküli osztályozás Hozzávalók: MultiSpec program (d: meghajtó, MultiSpecWin32 könyvtár, MultiSpecWin32.exe); ag020522_dpac_cd.lan állomány Ebben a gyakorlatban az ellenőrzés nélküli


Végeselem módszer 3. gyakorlat

Végeselem módszer 3. gyakorlat b SZÉCHENYI ISTVÁN EGYETEM ALKALMAZOTT MECHANIKA TANSZÉK Végeselem módszer 3. gyakorlat (kidolgozta: Dr.Molnár Zoltán egyetemi adjunktus,szüle Veronika egyetemi tanársegéd) Feladat: Saját síkjában terhelt


Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B)

Report on the main results of the surveillance under article 11 for annex II, IV and V species (Annex B) 0.1 Member State HU 0.2.1 Species code 2633 0.2.2 Species name Mustela eversmanii 0.2.3 Alternative species scientific name 0.2.4 Common name molnárgörény 1. National Level 1.1 Maps 1.1.1 Distribution


Emlődaganatok gyógyszeres kezelés. Dr.Tóth Judit DE OEC Onkológiai Tanszék

Emlődaganatok gyógyszeres kezelés. Dr.Tóth Judit DE OEC Onkológiai Tanszék Emlődaganatok gyógyszeres kezelés Dr.Tóth Judit DE OEC Onkológiai Tanszék Epidemiológia Kb.7000-8000 új eset évente Mo-on Idősebbek betegsége: -25 éves korban: 5/100 000-50 éves korban: 150/100 000-75


Bird species status and trends reporting format for the period 2008-2012 (Annex 2)

Bird species status and trends reporting format for the period 2008-2012 (Annex 2) 1. Species Information 1.1 Member State Hungary 1.2.2 Natura 2000 code A129 1.3 Species name Otis tarda 1.3.1 Sub-specific population 1.4 Alternative species name 1.5 Common name túzok 1.6 Season Breeding


Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz

Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz Bevezetés a kvantum-informatikába és kommunikációba 2015/2016 tavasz Kvantumkapuk, áramkörök 2016. március 3. A kvantummechanika posztulátumai (1-2) 1. Állapotleírás Zárt fizikai rendszer aktuális állapota


Publish date 1/7/2012 4:09 AM. Change date 1/7/2012 4:09 AM

Publish date 1/7/2012 4:09 AM. Change date 1/7/2012 4:09 AM X-ray devices Info Version 2 Url External tender id 5260-2012 Tender type Contract Award Document type Contract award Procurement procedure Open procedure


Adattípusok. Max. 2GByte

Adattípusok. Max. 2GByte Adattípusok Típus Méret Megjegyzés Konstans BIT 1 bit TRUE/FALSE SMALLINT 2 byte -123 INTEGER 4 byte -123 COUNTER 4 byte Automatikus 123 REAL 4 byte -12.34E-2 FLOAT 8 byte -12.34E-2 CURRENCY / MONEY 8


Csatlakozás a BME eduroam hálózatához Setting up the BUTE eduroam network

Csatlakozás a BME eduroam hálózatához Setting up the BUTE eduroam network Csatlakozás a BME eduroam hálózatához Setting up the BUTE eduroam network Table of Contents Windows 7... 2 Windows 8... 6 Windows Phone... 11 Android... 12 iphone... 14 Linux (Debian)... 20 Sebők Márton


Operációs Rendszerek II. labor. 2. alkalom

Operációs Rendszerek II. labor. 2. alkalom Operációs Rendszerek II. labor 2. alkalom Mai témák (e)grep Shell programozás (részletesebben, példákon keresztül) grep Alapvető működés: mintákat keres a bemeneti csatorna (STDIN vagy fájl) soraiban,


Receptor Tyrosine-Kinases

Receptor Tyrosine-Kinases Receptor Tyrosine-Kinases MAPkinase pathway PI3Kinase Protein Kinase B pathway PI3K/PK-B pathway Phosphatidyl-inositol-bisphosphate...(PI(4,5)P 2...) Phosphatidyl-inositol-3-kinase (PI3K) Protein kinase


Adatbázis-kezelés. Harmadik előadás

Adatbázis-kezelés. Harmadik előadás Adatbázis-kezelés Harmadik előadás 39 Műveletek csoportosítása DDL adat definiálás Objektum létrehozás CREATE Objektum törlés DROP Objektum módosítás ALTER DML adat módosítás Rekord felvitel INSERT Rekord


Office and computing machinery, equipment and supplies except furniture and software packages

Office and computing machinery, equipment and supplies except furniture and software packages Office and computing machinery, equipment and supplies except furniture and software packages Info Version 4 Url External tender id 154049-2013 Tender type


Adattípusok. Max. 2GByte

Adattípusok. Max. 2GByte Adattípusok Típus Méret Megjegyzés Konstans BIT 1 bit TRUE/FALSE TINIINT 1 byte 12 SMALLINT 2 byte -123 INTEGER 4 byte -123 COUNTER 4 byte Automatikus 123 REAL 4 byte -12.34E-2 FLOAT 8 byte -12.34E-2 CURRENCY


BKI13ATEX0030/1 EK-Típus Vizsgálati Tanúsítvány/ EC-Type Examination Certificate 1. kiegészítés / Amendment 1 MSZ EN 60079-31:2014

BKI13ATEX0030/1 EK-Típus Vizsgálati Tanúsítvány/ EC-Type Examination Certificate 1. kiegészítés / Amendment 1 MSZ EN 60079-31:2014 (1) EK-TípusVizsgálati Tanúsítvány (2) A potenciálisan robbanásveszélyes környezetben történő alkalmazásra szánt berendezések, védelmi rendszerek 94/9/EK Direktíva / Equipment or Protective Systems Intended


Coal and coal-based fuels

Coal and coal-based fuels Coal and coal-based fuels Info Version 3 Url External tender id 384513-2014 Tender type Contract Award Document type Contract award Procurement procedure


Komponensek együttműködése web-alkalmazás környezetben. Jónás Richárd Debreceni Egyetem T-Soft Mérnökiroda KFT richard.jonas@tsoft.

Komponensek együttműködése web-alkalmazás környezetben. Jónás Richárd Debreceni Egyetem T-Soft Mérnökiroda KFT richard.jonas@tsoft. Komponensek együttműködése web-alkalmazás környezetben Jónás Richárd Debreceni Egyetem T-Soft Mérnökiroda KFT Komponensek a gyakorlatban A szoftverkomponenseket fejlesztő csoportoknak szüksége van olyan


Social services. Info. Buyer. Version changes Contract award. Description. Version 3. Publish date 11/13/2013 4:25 AM

Social services. Info. Buyer. Version changes Contract award. Description. Version 3. Publish date 11/13/2013 4:25 AM Social services Info Version 3 Url External tender id 383594-2013 Tender type Contract Award Document type Contract award Procurement procedure Open procedure


Publish date 2/9/2013 4:11 AM. Change date 2/9/2013 4:11 AM

Publish date 2/9/2013 4:11 AM. Change date 2/9/2013 4:11 AM X-ray devices Info Version 2 Url External tender id 44296-2013 Tender type Contract Award Document type Contract award Procurement procedure Open procedure


Road traffic-control equipment

Road traffic-control equipment Road traffic-control equipment Info Version 3 Url External tender id 44515-2014 Tender type Contract Award Document type Contract award Procurement procedure


(Asking for permission) (-hatok/-hetek?; Szabad ni? Lehet ni?) Az engedélykérés kifejezésére a következő segédigéket használhatjuk: vagy vagy vagy

(Asking for permission) (-hatok/-hetek?; Szabad ni? Lehet ni?) Az engedélykérés kifejezésére a következő segédigéket használhatjuk: vagy vagy vagy (Asking for permission) (-hatok/-hetek?; Szabad ni? Lehet ni?) SEGÉDIGÉKKEL Az engedélykérés kifejezésére a következő segédigéket használhatjuk: vagy vagy vagy A fenti felsorolásban a magabiztosság/félénkség



FÜGGETLEN KONTROLLOK ALKALMAZÁSA A NAPI GYAKORLATBAN FÜGGETLEN KONTROLLOK ALKALMAZÁSA A NAPI GYAKORLATBAN Debreczeni Lóránd, Kovácsay Anna, Komlovszki Éva Fővárosi Önkormányzat Szent Imre Kórház, Központi Laboratórium Bio-Rad, Budapest 2006 Establishing





IMAQ kamera kiválasztása. Rendszám. U:\Users\me\Desktop\VirtMűszer\Rendszámfelismerő\pattern_database

IMAQ kamera kiválasztása. Rendszám. U:\Users\me\Desktop\VirtMűszer\Rendszámfelismerő\pattern_database Front Panel Kamera aktuális képe IMAQ kamera kiválasztása Rendszám Beolvasott rendszámok cam KWX-626 Kiolvasás 1632x1224.21X 32-bit RGB image 23,174,168 (,) STOP 388x21.87X 8-bit image (2,137) Behajtó


Adatkezelő szoftver. Továbbfejlesztett termékvizsgálat-felügyelet Fokozott minőség és gyártási hatékonyság

Adatkezelő szoftver. Továbbfejlesztett termékvizsgálat-felügyelet Fokozott minőség és gyártási hatékonyság Adatkezelő szoftver ProdX Inspect szoftver Fokozott termelékenység Páratlan termékminőség Magas fokú biztonság Teljesen átlátható folyamatok Továbbfejlesztett termékvizsgálat-felügyelet Fokozott minőség








20 éves a Mamma Klinika

20 éves a Mamma Klinika 20 éves a Mamma Klinika A sejtdiagnosztika modern eszközei a diagnosztikában és terápiában dr Járay Balázs, dr Székely Eszter Medserv Kft, Semmelweis Egyetem II. Patológiai Intézet Budapest 1 22196 betegből


Elemi alkalmazások fejlesztése IV. Adatbázis-kezelés ActiveX vezérlıkkel - 1

Elemi alkalmazások fejlesztése IV. Adatbázis-kezelés ActiveX vezérlıkkel - 1 ADATBÁZIS-KEZELÉS ACTIVEX VEZÉRLİK ALKALMAZÁSÁVAL I.... 1 ACTIVEX... 1 ACTIVEX CONTROL... 1 SAJÁT ACTIVEX VEZÉRLİ LÉTREHOZÁSA... 1 circctrl.cpp... 2 Háttérszín tulajdonság hozzárendelése a vezérlıhöz...



HALLGATÓI KÉRDŐÍV ÉS TESZT ÉRTÉKELÉSE HALLGATÓI KÉRDŐÍV ÉS TESZT ÉRTÉKELÉSE EVALUATION OF STUDENT QUESTIONNAIRE AND TEST Daragó László, Dinyáné Szabó Marianna, Sára Zoltán, Jávor András Semmelweis Egyetem, Egészségügyi Informatikai Fejlesztő


Symfony kurzus 2014/2015 I. félév. Controller, Routing

Symfony kurzus 2014/2015 I. félév. Controller, Routing Symfony kurzus 2014/2015 I. félév Controller, Routing Request - Response GET / HTTP/1.1 Host: Accept: text/html User-Agent: Mozilla/5.0 (Macintosh) HTTP/1.1 200 OK Date: Sat, 02 Apr 2011 21:05:05


Dodé Réka (ELTE BTK Nyelvtudomány Doktori IskolaAlkalmazott Alknyelvdok 2017 nyelvészet program) február 3. 1 / 17

Dodé Réka (ELTE BTK Nyelvtudomány Doktori IskolaAlkalmazott Alknyelvdok 2017 nyelvészet program) február 3. 1 / 17 Doménspecifikus korpusz építése és validálása Dodé Réka ELTE BTK Nyelvtudomány Doktori Iskola Alkalmazott nyelvészet program 2017. február 3. Dodé Réka (ELTE BTK Nyelvtudomány Doktori IskolaAlkalmazott


Pacemaker készülékek szoftverének verifikációja. Hesz Gábor

Pacemaker készülékek szoftverének verifikációja. Hesz Gábor Pacemaker készülékek szoftverének verifikációja Hesz Gábor A szív felépítéseájl:diagram_of_the_human_heart_hu.svg
