BMGE, Alkalmazott biokémia, transzgénikus organizmusok, 2012 Búza beltartalmi tulajdonságok módosítása molekuláris nemesítéssel

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "BMGE, Alkalmazott biokémia, transzgénikus organizmusok, 2012 Búza beltartalmi tulajdonságok módosítása molekuláris nemesítéssel"

Átírás

1 BMGE, Alkalmazott biokémia, transzgénikus organizmusok, 2012 Búza beltartalmi tulajdonságok módosítása molekuláris nemesítéssel

2 A búza b (Triticum( aestivum) általános összetételetele A búzaszem fő összetevőinek mennyiségi eloszlása (%) víz; 13 nyers fehérje; 12,2 nyers zsír; 1,9 keményítő; 71,9 rost; 1,9 hamu; 1,7 (Lásztity R., 1981)

3 Kémiai komponensek előfordulása a búzaszemben

4 Komponensek közötti k kölcsk lcsönhatások Keményítő Fehérjék

5 A tészta t reológiai tulajdonságait meghatároz rozó fehérj rjék és s génjeikg Búza sikérfehérjék monomer gliadinok polimer gluteninek ω- α- γ- LMW HMW S-szegény- S-gazdag- HMW- prolaminok Gén n család Lokusz Kromoszóma ma Kénben szegény Gli-1 Gli-A3, Gli-B3 nyújthatóság prolaminok rugalmasság 1A, 1B, 1D 1A, 1B, short arm Kénben gazdag prolaminok HMW-prolaminok Gli-1 Glu-3 Gli-2 Glu-1 1A, 1B, 1D r 1A, 1B, 1D r 6A, 6B, 6D novem 1A, 1B, ber 30. 1D Rakszegi long M ariann arm

6 Tartalékfehérjék vizsgálata SDS-PAGE SE-HPLC Gli/Glu arány Abszorbancia Glutenin Gliadin Albumin + Globulin Elúciós idő DNA markerek 2.60 RP-HPLC x/y arány AU Minutes

7 Régi magyar fajták felhasználása génforrásként a nemesítési programokban Bánkúti 1201 fajtapopuláció Fehérje tartalom > 15% Sikér tartalom > 40% Nagy SDS szedimentáció kiváló technológiai minőség 2+12/3+12 allélek jelenléte 1Ax2* gén mutáció, 1Bx7 túltermelés OTKA80292, FVM46028/2004 pályázatok támogatásával Vida et al 1998, Juhász et al 2003

8 Markerfejlesztés 1Bx7 HMW Glutenin túltermelő genotípusok azonosítására Cheyenne, Bánkúti 1201 (11299 AB line) 1Bx7 HMW glutenin gene 18 bp duplication Bánkúti 1201 OE Bánkúti 1201 (11305 TB line) CAA CCA GGA CAA GGG CAA 1Bx7 HMW glutenin gene CAA CCA GGA CAA GGG CAA CAA CCA GGA CAA GGG CAA Bánkúti 1201 N Cheyenne, Bánkúti 1201 (11301 line) promoter 43 bp insertion Glu-1Bx7 Bánkúti 1201 (11305 line) promoter TTAAATATATTGTAAAATATTCCGGCAACAACTTGTGGGG Glu-1Bx7 TTAAATATATTGTAAAATATTCCGGCAACAACTTGTGGGGGCCTTAAATATATTGTAAAATATTCCGGCAACAACTTGTGGGG FVM46028/2004 pályázat támogatásával

9 Keresztezési utódgeneráció vizsgálata 1Bx7 túltermelésre és technológiai minőségre 35 frequency (%) Bx7 % Zeleny sedimentation (ml) Bx7% FVM46028/2004 pályázat támogatásával

10 1Bx7 túltermelő genotípus előállítása, szelekciója Developed lines and genotypes Bx7/ HMW Far. curve stability (sec) ICC quality number Water absorption (%) Development time (sec) Bánkúti1201 population 22,3 6, Bánkúti ,9 12, Mv ,1 16, Mv B 3539/05 34,7 12, Glenlea (kontroll) 34,1 17, Red River 68 (kontroll) 33,0 16, FVM46028/2004 pályázat támogatásával

11 1Ax1 tartalékfehérje alegység túltermelő genotípusok előállítása biolisztikus módszerrel *

12 1Ax1 génnel transzformált genotípusok reológiai tulajdonságai Imp line 1 control line 3 line8 Canon Cadenza line 12 line 17 (Rakszegi et al. 2008, J. Cer. Sci.)

13 A kemény nyítő bioszintézis zis enzimei és s génjeikg szaharóz G1P ADPGPP ADP-glükóz ADPGPP 75% amilopektin citoplazma G1P szacharózszacharóz ADPG SSI SSII szacharóz ADPGPP BEII DBE BEI SSIII GBSS 7A, 7D, 4A citoplazma Locusz amiloplaszt Wx-A1 Wx-D1 Wx-B1 Kromoszóma ma 25% amilóz 7A 7D 4A

14 Nagy amilóz tartalmú búza genotípusok előállítása Agrobacterium-közvetített transzformációval Fajta: Vektor: Promóter: Hasznos gén: NB1 (kb. 30% amilóz tartalom) pdv03000+psb11 és psb1 1Dx5 HMW glutenin gén promótere SBEIIa és SBEIIb Transzformációs módszer: Agrobacterium-közvetített Kimutatási módszerek: Eredmény: PCR, Southern blot, SEM, HPLC 1-6 kópia SBEIIa, 1-7 kópia SBEIIb SBEIIa és SBEIIb enzimek alul-szabályozása RNS interferenciával, több mint 70% amilóz tartalom, rezisztens keményítő mennyisége nő, rostanyagként pozitív hatása van az egészségre (patkány kísérletek) segít az érrendszeri betegségek, a bélrák és a cukorbetegség megelőzésében (Regina et at PNAS)

15 MUTAGENEZIS és TILLING (Targeting Induced Local Lesions in Genomes) Mutagenesis with a chemical mutagen such as Ethyl methanesulfonate (EMS) with a sensitive DNA screeningtechnique that identifies single base mutations (also called point mutations) in a target gene The TILLING method relies on the formation of heteroduplexes that are formed when multiple alleles (which could be from a heterozygote, or a pool of multiple homozygotes and heterozygotes) are amplified in a PCR, heated, and then slowly cooled. A bubble forms at the mismatch of the two DNA strands (the induced mutation in TILLING or the natural mutation or SNP in EcoTILLING), which is then cleaved by single stranded nucleases. The products are then separated by size on several different platforms homoduplexes heteroduplexes

16 Keményítő szintézis génekre mutáns genotípusok előállítása mutagenezissel és azonosításuk Agronómiai és morfológiai tulajdonságok diverzitása Cadenza M3 - M6 populációkban ( ) Rakszegi et al Euphytica

17 Búzakalászok morfológiai tulajdonságai M3-M6 generációkban Rakszegi et al Euphytica

18 Búzakalászok deformációja és sterilitása az EMS kezelés hatására Rakszegi et al Euphytica

19 Extrém tulajdonságokkal rendelkező genotípusok azonosítása Properties Heading date Plant height Leaf colour Ear length Ear density Awn length Sterility Mutation Min Early Short Green Very short Very lax With awns Some sterile spikes Malformed ears Max Late Tall Light green Very long Very dense Very short awns

20 Amilopektin szintézis génekre (SGP) mutáns vonalak előállítása és azonosítása N11 nemesítési vonalból Sgp-A1- Sgp-B1- Sgp-D1- Cadenza (wt) Triple mutant lines: SDS-PAGE separation of starch granule proteins extracted from Sgp-1 mutants. (Sestili et al 2010 Molecular Breeding)

21 Keresztezési program indítása köztermesztésben levő fajtákkal High amylose gének átvitele (Sgp-A1, Sgp-B1, Sgp-D1) Heterozigóta genotípusok azonosítása M x N F1 MN (x N) BC1 MN 300 plants BC1F2 MM MN NN (x N) 388 plants BC2 MN NN (x N) 377 plants

22 Növénymagasság a BC1F2 populációban Frequency (%) mutáns Solstice Ukrainka Koreli Lona Yumai plant height (cm) Szálkás Tar 256 növény 127 növény 22 növény kalásztípusa hasonló a mutánséhoz

23 Amilóz tartalom a BC1 generáció tripla heterogén vonalaiban amylose content (%) 3/15T 11/19T 10/18T 10/2T 4/22T 13/5T 11/16T 10/17T 10/20T 4/5T 2/45T 3/34T 13/4T 1/5T 6/1T 4/40T 3/20T 7/5T 11/38T 10/25T 11/25T 2/30T 4/28T 7/7T 3/23T Lona Yumai-34 Solstice Koreli Ukrainka mutáns

24 Markerszelekció SSII-A1 null (289 bp deletion) N M 454 bp SSII-A 173 bp SSII-A null SSII-B1 null (175 bp insertion) N M 846 bp SSII-B null 671 bp SSII-B SSII-D1 null (63 bp deletion) N M 558 bp SSII-D 495 bp SSII-D null Shimbata et. al TAG

25 Mutáns és heterogén vonalak aránya különböző visszakeresztezések után Generation BC1 BC1F2 BC2 Triple mutant 0.78 % Triple heterozygote % 26.26% Mutant +heterozygote % A normal % % 7.43% B normal % 8.62 % 27.32% D normal % % 9.02%

26 Szemkeménys nységet meghatároz rozó fehérj rjék és s génjeikg Friabilin 15 kda, detergensben oldható puroindolin-a puroindolin-b GSP-1 egyéb komponensek keményítő és fehérjemátrix határfelületén helyezkednek el Triptofán-ban gazdag doménnel rendelkeznek lipidkötő képességgel és jó habképző tulajdonsággal rendelkeznek Kromoszóma Molekuláris változás Fenotípus 5D kromoszóma, Ha lokusz Pur-a, pur-b jelenléte puha, vad típus Pur-a null Pur-b mutáció, Gly-46 Ser-46 Befolyásolt minőségi tulajdonságok: lisztkihozatal, keményítősérülés -őrlés vízfelvétel, kenyértérfogat - sütőipar fehérje tartalom - söripar Pur-b mutáció, Leu-60 Pro-60 Pur-b mutáció, Trp-44 Arg-44 Pur-b null, Trp-39 stop codon Pur-b null, Trp-44 stop codon kemény kemény kemény kemény kemény kemény Pur-b null, Cys-56 stop codon novem kemény ber 30. 2A, 2B, 5B, 6D, 4B, 4D

27 Fajta: pinb szekvencia hatása a szemkeménységre Hi-Line keményszemű búza, pinb-d1b allél Kontroll: Chinese Spring puhaszemű búza, vad típus Vektor: Promóter: Szelekciós gén: bar Hasznos gén: pgb4.2, prq101a Dy10 promóter, CaMV35S pinb-d1a Transzformációs módszer: biolisztikus (PDS1000/He) Kimutatási módszerek: rezisztencia teszt, PCR, Southern blot, Northern blot, SDS-PAGE, SEM, Perten SKCS, starch damage Eredmény: a vad típusú pinb transzgén több kópiában épült be a 6 transzformáns növénybe, több friabilin fehérje expresszlódik (4-10-szeres mennyiség), szemkeménység és keményítősérülés csökkent, (Beecher et al TAG)

28 Puroindolin A géncsendesítésének hatása a szemkeménységre Fajta: Zhongyou (puha, HI=30.5) Kontroll: Stewart (durum, very hard) Vektor: Promóter: pubpa Ubi Szelekciós gén: bar Hasznos gén: pina Transzformációs módszer: biolisztikus (PDS1000/He) Kimutatási módszerek: Eredmény: rezisztencia teszt, PCR, Southern blot, SDS- PAGE, SEM 6 transzgénikus növény (3 puha, 3 kemény) illusztráció keményszeműekben több kópiában van jelen a gén, de az expresszált fehérje mennyisége kisebb, kettőben csak a pinb van jelen, az exogén pina gén jelenléte több kópiában, csendesíti az endogén géneket (Xia et al J. Cer. Sci.)

29 Bioaktív v komponensek gabonafélékben Rostanyagok Definíció: Növényi szénhidrátok, melyek a vékonybélben nem emésztődnek meg és nem is kötődnek meg, a vastagbélben részben vagy egészben megemésztődnek Komponensei: -β-glükán (árpa, zab) - Arabinoxilán (búza, rozs) - Cellulóz - Lignin Hatásai: - koleszterin és vércukorszint csökkentő hatása van, - csökkenti a vastagbélrák kialakulásának kockázatát Napi ajánlott mennyisége : g / nap

30 Bioaktív komponensek mennyisége különböző gabonafélékben Rostanyagok eloszlása Rostanyag B-glükán árpa dicoccum durum monococcum zab rozs spelta tavaszi búza őszi búza árpa dicoccum durum monococcum zab rozs spelta tavaszi búza őszi búza m g /g (sz áraz an yag ) m g /g (sz áraz an yag ) Arabinoxilán mennyisége korpában Arabinoxilán mennyisége lisztben árpa dicoccum durum monococcum zab rozs spelta tavaszi búza őszi búza árpa dicoccum durum monococcum zab rozs spelta tavaszi búza őszi búza m g /g (sz áraz an yag) m g/g (szárazanyag)

31 Bioaktív v komponensek gabonafélékben ANTIOXIDÁNSOK NSOK oxidációt késleltető, vagy gátló anyag, a sejtek öregedéséért felelős szabad gyökök ellen termelődik a szervezetben Szterolok Tokolok Fenolsavak Folát Alkilrezorcin csökkenti a vér koleszterinszintjét, a magas vérnyomást és a szívinfarktus kockázatát, ajánlott napi mennyiség : 1-3 g/nap E-vitamin aktivitású antioxidáns, megakadályozza a többszörösen telítetlen zsírsavak oxidációját, hiánya vérszegénységet, meddőséget, izomsorvadást okoz, gyulladásgátló hatása is ismert ajánlott napi mennyiség: mg/nap antioxidánsok, de antitumor hatásuk is van Túl nagy mennyiségben akadályozzák a rostanyagok oldódását ajánlott napi mennyiség: 200 mg/nap B vitamin aktivitású antioxidáns, szerepe van még a fehérvérsejtek, vörösvértestek, vérlemezkék képzésében, az aminosavak, és nukleinsavak anyagcseréjében hiánya növeli a vérszegénység, az érrendszeri betegségek, az Alzheimer kór és néhány rákfajta kialakulásának kockázatát ajánlott napi mennyiség: 400 g/nap (B komplex) a teljeskiőrlésű gabonák fogyasztásának biológiai markere (nyomonkövetés) antimikrobiális hatása van, a biológiai membránok működésére hatással van, antimutagén aktivitással rendelkezik ajánlott napi mennyiség: mg/nap

32 Terpenoid komponensek eloszlása gabonafélékben Szterolok árpa dicoccum durum mono coccum zab rozs spelta tavaszi búza őszi búza Tokolok árpa dicoccum durum monococcum zab rozs spelta tavaszi búza őszi búza u g /g (sz áraz an yag ) ug/g (szárazanyag)

33 Fenolos komponensek eloszlása gabonafélékben Fenolsavak Folát árpa dicoccum durum mono coccum zab rozs spelta tavaszi bú za őszi búza árpa dicoccum durum monococcum zab rozs spelta tavaszi búza őszi búza u g /g (sz áraz an yag ) ng/g (szárazanyag) Alkilrezorcinol árpa dicoccum durum monococcum zab rozs spelta tavaszi búza őszi búza ug/g (szárazanyag)

34 Egészségmegőrzés és hagyomány: alapanyag-, termék-és technológiafejlesztésa gabonavertikumban HTcereal No. TECH_08_A3/

35 Yumai-34 34,, hagyományos nemesítés nagy rostanyag komponens tartalomra - Exotikus kínai búzafajta - kiemelkedő vízoldható arabinoxilán (WE-AX) tartalom a lisztben ~(1%) - keresztezés : Mv-Emese Mv-Mambo Ukrainka Golia WE-AX % Lupus Courtot 0.0 YUMAI-34 COURTOT MV-EMESE MV-MAMBO KG-KUNGLORIA UKRAINKA LUPUS HTcereal No. TECH_08_A3/

36 Rostanyag tartalom befolyásolása (1,3; 1,4)-β-D-glükán Fajta: Hasznos gén: Kimutatási módszerek: Eredmény: Arabidopsis árpa β-glükán / rizs cellulóz-szintáz szerű CslF gén öszehasonlító genomika enzimes módszer monoklonális antitestekkel CslF gén részvételének bizonyítása a glükán szintézisben Gabona és fű-félék sejtfal alkotója, Rostanyag Segít a bélrák, magas vérkoleszterinszint, érrendszeri betegségek, elhízás, nem-inzulinfüggő cukorbetegség megelőzésében (Burton et al Science)

37 Fajta: Vektor: Promóter: Rostanyag tartalom befolyásolása (1,3; 1,4)-β-D-glükán Cadenza Szelekciós gén: NptII Hasznos gén: Transzformációs módszer: Kimutatási módszerek: Eredmény: pgem-t Easy, RNS interferencia génkonstrukciók 1Dx5 HMW glutenin gén promóter CSLF6 cellulose synthase-like F6 gene biolisztikus (PDS1000/He) Megazyme, HPAEC géncsendesítés, 5 genotípus β-glükán tartalom csökkent 30-52%-al vízoldhatóβ-glükán csökkent 50%-al (Nemeth et al Plant Physiology)

38 Arabinoxilán tartalom befolyásolása Arabinoxilán szintézisében résztvevő gének azonosítása: - Mitchell et al Plant Physiology, bioinformtics - Masood Quraishi et al Funct. Integr. Genomics, metagenomika

39 Fajta: Vektor: Promóter: Hasznos gén: Szelekciós gén: A vitamin hiánybetegségek megelőzése Taipei 309, rizs fajta pb19hpc és pzpsc vagy pcacar vagy pfun3 CaMV35S PSY (phytoene synthase gén nárciszból) CRTI (bakteriális carotene desaturase) β-lcy (lycopeneβcyclase) aph IV vagy pmi Transzformációs módszer: Agrobacterium-közvetített Eredmény: Aranyrizs (1999), mely β-karotin-t termel (provitamina) ug/g 6000 haláleset/nap, 500e gyermek megvakul/év A-vitamin hiány miatt, cél a vas és a fehérjehiány okozta betegségek visszaszorítása számos próbálkozás a koncentráció növelésére (Al-Babili Trends in Plant Science)

40 Karotinoidok bioszintézise Vektorok Fitoén szintáz 1.6 µg/g 6 µg/g Karotin deszaturáz Likopinβcikláz 37 µg/g

41 Tokoferol bioszintézise növényekben

42 E-vitamin antioxidáns mennyiségének növelése Gén HPPD Hidroxifenil piruvát dioxigenáz DXP Deoxi-xilul xilulóz foszfát szintáz HPT Homogentizát fitiltranszferáz Árpa HPT variáns Homogenizát geranilgeraniltranszferáz aktivitás γ-tmt és s MPBQMT Tokoferol és metilfitil- benzokinon metiltranszferáz Transzformált növényny Arabidopsis, dohány Arabidopsis Arabidopsis kukorica szója Enzim túltermelt ltermelés helye levél mag Tokoferol mennyiségének nek növekedése 10% 30% levél 40% levél mag 4.4 szeres szeres mag 20-szoros tokotrienol 8-szoros total tokol mag Tokolok 95% -a aktív α-tokoferollá alakul (Ajjawi et al Trends in Biotechnology)

43 Fajta: Vektor: Promóter: Hasznos gén: Szelekciós gén: C-vitamin tartalom növelése A188xB73 kukorica, Xanthi dohány pet19b vagy pet11 és pahc18 Ubi1 vagy Sh2, CaMV35S DHAR (dehidroaszkorbát reduktáz) (búza) bar Transzformációs módszer: Kimutatási módszer: biolisztikus Western blot, PCR, enzim assay Eredmény: DHAR expresszió 32-szeresére nőtt dohány levélben, 100- szorosára nőtt kukorica magban aszkorbinsav mennyisége 2, 4-szeresére nőtt (d, k) az ember nem tudja szintetizálni az utolsó bioszintézis enzim gén mutációja miatt, ezért fel kell vennie (Chen et al PNAS)

44 Fajta: Vektor: Promóter: Arabidopsis ptk202 CaMV35S Hasznos gén: fole (GTP ciklohidroláz1) Szelekciós gén: bar Transzformációs módszer: Agrobacterium-közvetített Kimutatási módszerek: Eredmény: Folát tartalom növelése rezisztencia teszt, PCR, SDS-PAGE, GCH és pterin assay, mikrobiológiai assay pterin bioszintézis aktiválásával nő a folát tartalom GTP ciklohodroláz1 expressziója 1250-szeresére nőtt, a pterinek és folátok mennyisége sorban 2 és 4 szeresére nőtt vérszegénység, születési rendellenességek, szívérrendszeri betegségek, rák kockázatát csökkenti emberi szervezetben nem termelődik (Hossain et al PNAS)

45 Pterinek és folátok bioszintézise növényekben GTP ciklohidroláz1 Para-aminobenzoic acid

46 Ásványi anyagok mennyiségének növelése gabonafélékben Ajánlott UK tolerálható biztonságos napi referencia felső konc. felső konc. mennyiség adatok határ határ Fe, Zn, Cu, I, Se - nagy mennyiségben káros 6 billió ember 60-80%-a Fe hiányos, 30%-a Zn hiányos 30%-a I hiányos 15%-a Se hiányos (White et al Trends in Plant Science)

47 Fe és Zn koncentráció variabilitása ehető szövetekben core kollekciókban Fe mg/kg Zn mg/kg Rizs Búza Kukorica Borsó Spenót

48 Transzformációs kísérletek az ásványi anyagok mennyiségének növelésére Probléma megközel zelítése Gén Koncentráci ció nő (csökken*) Fe felvétel előseg segítése talajból, l, Fe-ban szegény talaj tolerálása Biológiailag hasznosíthat tható Fe és Zn tartalom növeln velése Fe(III) reduktáz AtNAS1 Nikotianamin szintáz AtZIP1 Arabidopsis Zn transzporter Ferritin Laktoferritin Zn 2+ Promóterek génjei Segítik az ásványi anyagok abszorpcióját t emberben Antinutriensek génjei Gátolják k a Fe, Zn, Ca abszorpcióját Fe,, de Zn, Ca,, Mg, Cu, Mn is Fe, Zn, Mn Fe és Zn Fe, Zn és Cu Fe Aszkorbinsav Β-karotin Cisztein tartalmú peptidek Fitát* (bioszintézis zis enzimgének nek kiütése vagy fitáz túltermelése) Tannin* Transzformált növényny Nem fás f növényeknyek dohány árpa Rizs saláta Saláta Rizs gabonafélék Rizs, búza, b szója, repce

49 Fajta: Fe hiánybetegségek megelőzése Taipei 309, rizs Vektor: pcambia 1390 Promóter: Hasznos gén: pgluchi Gt1 glutelin promóter CaMV35S pfe (ferritin, Phaseolus vulgaris-ból) és rgmt (metallothionein-szerű fehérje) gén (Fe tartalom növelés) A.famigatus fitáz gén és árpa β-glükanáz szignál peptid gén (biológiai hasznosíthatóság javítása) Transzformációs módszer: Agrobacterium-közvetített biolisztikus Kimutatási módszerek: Western blot, HPLC, atomabszorpciós spektofotométer Eredmény: nagy vastartalmú rizsszemek, nagy fitáz aktivitással és ciszteinben gazdag fehérjével, Fe hozzáférhetősésének javítása (Lucca et al TAG)

50 Zn, Ca és Fe ionok hozzáférhetőségének növelése Fajta: Vektor: Promóter: Hasznos gén: Bob white, tavaszi búza Ubi-SP-Phy vagy p1dx5spphyn Ubi1 vagy 1Dx5 promóter phya (Aspergillus niger fitáz génje) Transzformációs módszer: biolisztikus Kimutatási módszerek: Eredmény: Western blot expresszió a magban (endosperm, aleuron, korpa), embrióban nincs expresszió növeli a Zn, Ca és Fe ionok hozzáférhetőségét a bélrendszerben nem-kérődző állatokban, azáltal, hogy a fitáz bontja az inozitol hexafoszforsavat (phytic acid), a szabad foszfor pedig hozzájárul az emészthetetlen komplexek bontásához (Brinch-Petersen et al Mol.Breed.)

51 Egy öregedést szabályozó NAC gén hatása a búzaszemre Fajta: Hasznos gén: Eredmény: Búza Gpc-B1 gén tönke búzából (modern búzában nem aktív) NAC transzkripciós faktort expresszál (NAM-B1) gyorsítja az öregedést, a tápanyagok mobilizációját segíti a levélből a fejlődő mag irányába növeli a mag fehérje, vas és cink tartalmát géncsendesítéssel 30%-al csökken a szem fehérje, vas és cinktartalma, 3 héttel lassul az öregedés (Uauy et al Scinece)

52 Esszenciális aminosavak Amarantusz gén (ama1) bevitele búzába albumin, nem-allergén fehérje AmA1 magas táplálkozástani értékű, FAO/WHO (1991) ajánlásával nagy esszenciális aminósav tartalom lizin 7.7 % - WHO 5.5% tirozin 7.0 % - WHO 6.0% treonin 5.4 % - WHO 4.0% (Tamás et al Plant Cell Report)

53 Amaranthus hypochondriacus tartalék fehérje gén (Ama1) bevitele búzába AmA1-pTLZ hasznos gén, 1Bx17 HMW-GS endosperm specifikus promóter 1Bx17 HMW-GS Ama1 1 géng nos ~5 kb pahc25 vektor 12 független vonal PCR analízis Southern-blot RT-PCR Western-blot ama1 gén Southern-blot analízise (T1 generációban) ~1 kb (Tamás et al Plant Cell Report)

54 Búza táplálkozástani tulajdonságának megváltoztatása Ama1 génnel 28-as vonal Western-blot analízise AmA1 protein DPA AmA1 fehérje/total fehérje lisztben (5 minta) (indirekt ELISA): % Non specific band +6% +2.8% +3.8% T2 magok aminósav összetétele Aminosav total aminosav %-ában% Cadenza (donor) line #28 His 2.26± ±0.01 (0.9) Ile 3.38± ±0.01 (2.4) Leu 6.53± ±0.01 (0.8) Lys 2.19± ±0.01 (6.0) Met 1.32± ±0.01 (0.0) Phe 5.03± ± (1.0) Thr 2.53± ± (2.8) Tyr 2.61± ±0.01 (3.8) Val 4.28± ±0.01 (1.4) (Tamás et al Plant Cell Report)

55 Lizin tartalom növelése kukoricában QPM (quality protein maize) kukorica előállítása (CIMMYT) Bevitt géng Pozitív v hatás Negatív v hatás opaque (o2) Lizin tartalom nőn a szemben Zein prolaminok mennyisége csökken Alacsony szemtermés Puha szem Nagyobb rovarkár Törékenység g nőn o2 modifiers (mo2) (és s fl2, De-B30, Mc= α-zein gének) Módosítja a puha endospermium szerkezetet, a túl t l nagy kemény nyítő tartalmat Technikai komplexitás Pontos működésük m k nem ismert (Gibbon et al Trends is Genetics)

56 Köszönöm a figyelmet!

NÖVÉNYNEMESÍTÉS. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

NÖVÉNYNEMESÍTÉS. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 NÖVÉNYNEMESÍTÉS Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Előadás áttekintése A beltartalomra történő nemesítés klasszikus példája A búza minőségjavítása Genetikailag módosított

Részletesebben

Szelekciós lehetőségek a búza minőség-orientált nemesítésében fehérjekémiai és DNS markerekkel

Szelekciós lehetőségek a búza minőség-orientált nemesítésében fehérjekémiai és DNS markerekkel Budapesti Műszaki és Gazdaságtudományi Egyetem, Vegyészmérnöki Kar Biokémiai és Élelmiszertechnológiai Tanszék Szelekciós lehetőségek a búza minőség-orientált nemesítésében fehérjekémiai és DNS markerekkel

Részletesebben

ZÖLD BIOTECHNOLÓGIA. 6. évf. - 2010/2. február. http://www.zoldbiotech.hu

ZÖLD BIOTECHNOLÓGIA. 6. évf. - 2010/2. február. http://www.zoldbiotech.hu ZÖLD BIOTECHNOLÓGIA 6. évf. - 2010/2. február http://www.zoldbiotech.hu Transzgenikus növények a jövõ biofermentorai? Oszvald Mária Növényélettani és Molekuláris Növénybiológiai Tanszék, ELTE, Budapest

Részletesebben

Oszvald Mária. A búza tartalékfehérjék tulajdonságainak in vitro és in vivo vizsgálata rizs modell rendszerben

Oszvald Mária. A búza tartalékfehérjék tulajdonságainak in vitro és in vivo vizsgálata rizs modell rendszerben Budapesti Műszaki és Gazdaságtudományi Egyetem Alkalmazott Biotechnológia és Élelmiszertudományi Tanszék PHD ÉRTEKEZÉS TÉZISEI Készítette: Oszvald Mária A búza tartalékfehérjék tulajdonságainak in vitro

Részletesebben

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1560/2012 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1560/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület SZŰKÍTETT RÉSZLETEZŐ OKIRAT (2) a NAT-1-1560/2012 nyilvántartási számú akkreditált státuszhoz A Bonafarm-Bábolna Takarmány Kft. Vizsgálólaboratórium (2942 Nagyigmánd, Burgert

Részletesebben

Szelekciós lehetőségek a búza minőség-orientált nemesítésében fehérjekémiai és DNS markerekkel

Szelekciós lehetőségek a búza minőség-orientált nemesítésében fehérjekémiai és DNS markerekkel Budapesti Műszaki és Gazdaságtudományi Egyetem, Vegyészmérnöki Kar Biokémiai és Élelmiszertechnológiai Tanszék Szelekciós lehetőségek a búza minőség-orientált nemesítésében fehérjekémiai és DNS markerekkel

Részletesebben

A közönséges búza élelmiszeripari minısége

A közönséges búza élelmiszeripari minısége A közönséges búza élelmiszeripari minısége BÚZAMINİSÉG Felhasználási területek az élelmiszeriparban: Malomipar Sütıipar Kekszgyártás Száraztésztagyártás Keményítı és vitális glutin elıállítás (sikérélelmiszeripari

Részletesebben

AZ ALACSONY HŐMÉRSÉKLET HATÁSÁRA BEKÖVETKEZŐ REDOX ÉS GÉNEXPRESSZIÓS VÁLTOZÁSOK GABONAFÉLÉKBEN

AZ ALACSONY HŐMÉRSÉKLET HATÁSÁRA BEKÖVETKEZŐ REDOX ÉS GÉNEXPRESSZIÓS VÁLTOZÁSOK GABONAFÉLÉKBEN A martonvásári agrárkutatások hatodik évtizede AZ ALAONY HŐMÉRSÉKLET HATÁSÁRA BEKÖVETKEZŐ REDOX ÉS GÉNEXPRESSZIÓS VÁLTOZÁSOK GABONAFÉLÉKBEN KOY GÁBOR, VÁGÚJFALVI ATTILA, TÓTH BALÁZS, SZALAI GABRIELLA,

Részletesebben

Az ABO CSOPORT. ABO MILL Zrt. ABO MIX Zrt. ABO TRADE Zrt. ABO TRADE s.r.o. ABO MILL s.r.o. TOV ABO TRADE TOV ABO MIX. ABO TRADE s.r.l. ABO MILL S.A.

Az ABO CSOPORT. ABO MILL Zrt. ABO MIX Zrt. ABO TRADE Zrt. ABO TRADE s.r.o. ABO MILL s.r.o. TOV ABO TRADE TOV ABO MIX. ABO TRADE s.r.l. ABO MILL S.A. Az ABO CSOPORT gabonakereskedelem malomipar takarmányozás ABO TRADE Zrt. ABO MILL Zrt. ABO MIX Zrt. ABO TRADE s.r.o. ABO MILL s.r.o. TOV ABO TRADE TOV ABO MIX ABO TRADE s.r.l. ABO MILL S.A. ABO MIX S.A.

Részletesebben

3. Sejtalkotó molekulák III.

3. Sejtalkotó molekulák III. 3. Sejtalkotó molekulák III. Fehérjék, fehérjeszintézis (transzkripció, transzláció, posztszintetikus módosítások). Enzimműködés 3.1 Fehérjék A genetikai információ egyik fő manifesztálódása Számos funkció

Részletesebben

A tejfehérje és a fehérjeellátás

A tejfehérje és a fehérjeellátás A tejfehérje A tejfehérje és a fehérjeellátás Fejlődő országok: a lakosság 20 30%-a hiányosan ellátott fehérjével. Fejlett ipari országok: fehérje túlfogyasztás. Az emberiség éves fehérjeszükséglete: 60

Részletesebben

Baby Top prestarter E 10

Baby Top prestarter E 10 Baby Top prestarter E 10 Késztakarmány szopós malacoknak, a fialást követö 3. naptól 42-45 napos korig. Növényi zsír, szója, tejpor, búza, kukorica, korpa, foszfor forrás, vitaminok, nyomelemek, takarmány

Részletesebben

Transzgénikus növények előállítása

Transzgénikus növények előállítása Transzgénikus növények előállítása Növényi biotechnológia Területei: A növények szaporításának új módszerei Növényi sejt és szövettenyészetek alkalmazása Mikroszaporítás Vírusmentes szaporítóanyag előállítása

Részletesebben

Modern múlt Étkezésünk fenntarthatóságáért. 1.Tematikus nap: A hal mint helyben találhatóegészséges, finom élelmiszer

Modern múlt Étkezésünk fenntarthatóságáért. 1.Tematikus nap: A hal mint helyben találhatóegészséges, finom élelmiszer Modern múlt Étkezésünk fenntarthatóságáért 1.Tematikus nap: A hal mint helyben találhatóegészséges, finom élelmiszer Halat? Amit tartalmaz a halhús 1. Vitaminok:a halhús A, D, B 12, B 1, B 2 vitaminokat

Részletesebben

Táplálék. Szénhidrát Fehérje Zsír Vitamin Ásványi anyagok Víz

Táplálék. Szénhidrát Fehérje Zsír Vitamin Ásványi anyagok Víz Étel/ital Táplálék Táplálék Szénhidrát Fehérje Zsír Vitamin Ásványi anyagok Víz Szénhidrát Vagyis: keményítő, élelmi rostok megemésztve: szőlőcukor, rostok Melyik élelmiszerben? Gabona, és feldolgozási

Részletesebben

TRANSZGÉNIKUS NIKUS. GM gyapot - KÍNA. GM szója - ARGENTÍNA

TRANSZGÉNIKUS NIKUS. GM gyapot - KÍNA. GM szója - ARGENTÍNA TRANSZGÉNIKUS NIKUS NÖVÉ GM gyapot - KÍNA GM szója - ARGENTÍNA TRANSZGÉNIKUS NIKUS NÖVÉN Élelmezési probléma: mg-i i termények, élelmiszer alapanyagok károsk rosításasa (rovar, gyom, baktérium, gomba,

Részletesebben

BMGE, Alkalmazott biokémia, transzgénikus organizmusok, 2009 Transzformációs módszerek

BMGE, Alkalmazott biokémia, transzgénikus organizmusok, 2009 Transzformációs módszerek BMGE, Alkalmazott biokémia, transzgénikus organizmusok, 2009 Transzformációs módszerek Definíció Génbevitel vagy géntranszfer alatt azt a folyamatot értjük, aminek során egy meghatározott DNSmolekuladarab

Részletesebben

GABONANÖVÉNYEK TERMESZTÉSE. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

GABONANÖVÉNYEK TERMESZTÉSE. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 GABONANÖVÉNYEK TERMESZTÉSE Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 6. hét Előadás áttekintése Tápanyagellátás Vetéstechnológia Tápanyagellátás TÁPANYAGGAZDÁLKODÁS A talaj

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

Földi mandula (Cyperus esculentus L.)

Földi mandula (Cyperus esculentus L.) Földi mandula (Cyperus esculentus L.) A földi mandulát (Cyperus esculentus L.) értékes gumójáért már az ókori egyiptomiak, a görögök és nem utolsó sorban a rómaiak is termesztették és előszeretettel fogyasztották.

Részletesebben

Növénytermesztéstani alapismeretek (SMKNZ2023XN) Minőség, minőségvizsgálat

Növénytermesztéstani alapismeretek (SMKNZ2023XN) Minőség, minőségvizsgálat Növénytermesztéstani alapismeretek (SMKNZ2023XN) Minőség, minőségvizsgálat Környezetgazdálkodási agrármérnök (BSc) II. gyakorlata 2013. október 30. Minőség A minőség a követelményeknek való megfelelés

Részletesebben

Molecular farming Mi mindent termelnek a transzgénikus növények?

Molecular farming Mi mindent termelnek a transzgénikus növények? Molecular farming Mi mindent termelnek a transzgénikus növények? Tamás László ELTE, Növényélettani és Molekuláris Növénybiológiai Tanszék Élő Adás ELTE, TTK, Biológiai Intézet Lágymányos 2013 November

Részletesebben

A fehérjék hierarchikus szerkezete

A fehérjék hierarchikus szerkezete Fehérjék felosztása A fehérjék hierarchikus szerkezete Smeller László Semmelweis Egyetem Biofizikai és Sugárbiológiai Intézet Biológiai funkció alapján Enzimek (pl.: tripszin, citokróm-c ) Transzportfehérjék

Részletesebben

3. Aminosavak gyártása

3. Aminosavak gyártása 3. Aminosavak gyártása Előállításuk Fehérje-hidrolizátumokból: cisztein, leucin, aszparaginsav, tirozin, glutaminsav Kémiai szintézissel: metionin, glicin, alanin, triptofán (reszolválás szükséges) Biotechnológiai

Részletesebben

a NAT-1-1560/2012 nyilvántartási számú akkreditált státuszhoz

a NAT-1-1560/2012 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület RÉSZLETEZÕ OKIRAT a NAT-1-1560/2012 nyilvántartási számú akkreditált státuszhoz A Bonafarm-Bábolna Takarmány Kft. Vizsgálólaboratórium (2942 Nagyigmánd, Burgert Róbert Agrár-Ipari

Részletesebben

TAKARMÁNYOZÁSTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

TAKARMÁNYOZÁSTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 TAKARMÁNYOZÁSTAN Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Takarmányok fehérjetartalma Az állati szervezet létfontosságú vegyületei fehérje természetűek Az állati termékek

Részletesebben

ORGANIKUS GAZDÁLKODÁS BIOLÓGIAI ALAPJAINAK BIOANALITIKAI VIZSGÁLATA AZ ÉSZAK-ALFÖLDI RÉGIÓT JÓL REPREZENTÁLÓ FAJTÁK TEKINTETÉBEN

ORGANIKUS GAZDÁLKODÁS BIOLÓGIAI ALAPJAINAK BIOANALITIKAI VIZSGÁLATA AZ ÉSZAK-ALFÖLDI RÉGIÓT JÓL REPREZENTÁLÓ FAJTÁK TEKINTETÉBEN ORGANIKUS GAZDÁLKODÁS BIOLÓGIAI ALAPJAINAK BIOANALITIKAI VIZSGÁLATA AZ ÉSZAK-ALFÖLDI RÉGIÓT JÓL REPREZENTÁLÓ FAJTÁK TEKINTETÉBEN EA_NORVÉGALAP-BIOBEL9 BIO/NEM BIO AGRÁRTERMÉKEK BELTARTALMI ÉRTÉKEINEK ÖSSZEHASONLÍTÁSA

Részletesebben

Környezetvédelmi analitika II. (BMEVESAM108) Immunanalitika, Lab-on-a-chip

Környezetvédelmi analitika II. (BMEVESAM108) Immunanalitika, Lab-on-a-chip Környezetvédelmi analitika II. (BMEVESAM108) Immunanalitika, Lab-on-a-chip Helyszín: Ch 1.emelet 106. Gyakorlatvezetők: Hajas Lívia és Török Kitti Email: ktorok@mail.bme.hu Lab-on-a-chip (LOC) technika

Részletesebben

A sikérfehérjék összetétele, hatásuk a sikér reológiai tulajdonságaira (Szemle)

A sikérfehérjék összetétele, hatásuk a sikér reológiai tulajdonságaira (Szemle) A sikérfehérjék összetétele, hatásuk a sikér reológiai tulajdonságaira (Szemle) Uri Csilla Tóth Árpád Sipos Péter Borbélyné Varga Mária Győri Zoltán Debreceni Egyetem Agrártudományi Centrum, Mezőgazdaságtudományi

Részletesebben

A Pannon minôségû búza nemesítése és termesztése. Szerkesztette: Bedô Zoltán

A Pannon minôségû búza nemesítése és termesztése. Szerkesztette: Bedô Zoltán A Pannon minôségû búza nemesítése és termesztése Szerkesztette: Bedô Zoltán A Pannon minôségû búza fejlesztési programjában résztvevôk Magyar Tudományos Akadémia Mezôgazdasági Kutatóintézete, Martonvásár

Részletesebben

Új temékek az UD-GenoMed Kft. kínálatában!

Új temékek az UD-GenoMed Kft. kínálatában! Új temékek az UD-GenMed Kft. kínálatában! Műanyag termékek: SARSTEDT műanyag termékek teljes választéka Egyszer használats labratóriumi műanyag eszközök szövet és sejttenyésztéshez Vérvételi és diagnsztikai

Részletesebben

a NAT-1-1054/2006 számú akkreditálási ügyirathoz

a NAT-1-1054/2006 számú akkreditálási ügyirathoz Nemzeti Akkreditáló Testület MELLÉKLET a NAT-1-1054/2006 számú akkreditálási ügyirathoz A Debreceni Egyetem Agrártudományi Centrum Mezõgazdaságtudományi Kar Agrármûszerközpont (4032 Debrecen, Böszörményi

Részletesebben

Bioinformatika 2 5.. előad

Bioinformatika 2 5.. előad 5.. előad adás Prof. Poppe László BME Szerves Kémia és Technológia Tsz. Bioinformatika proteomika Előadás és gyakorlat 2009. 03. 21. Fehérje térszerkezet t megjelenítése A fehérjék meglehetősen összetett

Részletesebben

KDOP 2.1.2-2011-0015 A

KDOP 2.1.2-2011-0015 A A kenderliszt tulajdonságai, gyógyhatásai, elérhetősége a szántóföldtől az asztalig Dr. Iványiné, Dr. Gergely Ildikó EVÉSZ Klaszter KDOP 2.1.2-2011-0015 A kendermag A kender termése, makkocska. Külső,

Részletesebben

Molekuláris biológiai technikák

Molekuláris biológiai technikák Molekuláris biológiai technikák Wunderlich Lívius A Molekuláris biológiai technikák jegyzet igyekszik átfogó képet adni a jövő tudományának, a molekuláris biológiának a módszertanáról. A technikák elméleti

Részletesebben

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2.

BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február. 1. Az IPK bemutatása 2. BÁLINT András Beszámoló az AGRISAFE által támogatott tanulmányútról 2008 november 2009 február 1. Az IPK bemutatása 2. A TILLING módszer Hol található az IPK? Gatersleben Általános adatok az IPK-ról Leibniz

Részletesebben

Gabonacsíra- és amarant fehérjék funkcionális jellemzése modell és komplex rendszerekben

Gabonacsíra- és amarant fehérjék funkcionális jellemzése modell és komplex rendszerekben Budapesti Műszaki és Gazdaságtudományi Egyetem Biokémiai és Élelmiszertechnológiai Tanszék Gabonacsíra- és amarant fehérjék funkcionális jellemzése modell és komplex rendszerekben c. PhD értekezés Készítette:

Részletesebben

HEALTHY FOOD Egészséges Étel az Egészséges Élethez Az élelmiszer és az egészség

HEALTHY FOOD Egészséges Étel az Egészséges Élethez Az élelmiszer és az egészség HEALTHY FOOD Egészséges Étel az Egészséges Élethez Az élelmiszer és az egészség Készült a vas megyei Markusovszky Kórház Nonprofit Zrt. megbízásából, a Healthy Food Egészséges Étel az Egészséges Élethez

Részletesebben

Dr. GYŐRI ZOLTÁN DSc.

Dr. GYŐRI ZOLTÁN DSc. DEBRECENI EGYETEM AGRÁRTUDOMÁNYI CENTRUM MEZŐGAZDASÁGTUDOMÁNYI KAR ÉLELMISZERTUDOMÁNYI, MINŐSÉGBIZTOSÍTÁSI ÉS MIKROBIOLÓGIAI TANSZÉK NÖVÉNYTERMESZTÉSI ÉS KERTÉSZETI TUDOMÁNYOK DOKTORI ISKOLA Doktori iskola

Részletesebben

Baby Gold malactápszer 99-3010

Baby Gold malactápszer 99-3010 Baby Gold malactápszer 99-3010 Szopós malacok részére, a megszületést követı naptól 8-9 kg-os élıtömeg eléréséig Hıkezelt tejtermék, növényi fehérje, szerves savak, növényizsír, vitaminok, ásványi anyagok,

Részletesebben

Szójabab és búza csírázási folyamatainak összehasonlítása NIR spektrumok segítségével

Szójabab és búza csírázási folyamatainak összehasonlítása NIR spektrumok segítségével Szójabab és búza csírázási folyamatainak összehasonlítása NIR spektrumok segítségével Bartalné Berceli Mónika BME VBK ABÉT NIR Klub, Budapesti Corvinus Egyetem, 2015. október 6. 2. Búza összetétele (sz.a.)

Részletesebben

A -tól Z -ig. Koleszterin Kisokos

A -tól Z -ig. Koleszterin Kisokos A -tól Z -ig Koleszterin Kisokos A SZÍV EGÉSZSÉGÉÉRT Szívügyek Magyarországon Hazánkban minden második ember szív- és érrendszerrel kapcsolatos betegség következtében veszíti életét*, ez Magyarországon

Részletesebben

(11) Lajstromszám: E 008 257 (13) T2 EURÓPAI SZABADALOM SZÖVEGÉNEK FORDÍTÁSA

(11) Lajstromszám: E 008 257 (13) T2 EURÓPAI SZABADALOM SZÖVEGÉNEK FORDÍTÁSA !HU00000827T2! (19) HU (11) Lajstromszám: E 008 27 (13) T2 MAGYAR KÖZTÁRSASÁG Szellemi Tulajdon Nemzeti Hivatala EURÓPAI SZABADALOM SZÖVEGÉNEK FORDÍTÁSA (21) Magyar ügyszám: E 0 727848 (22) A bejelentés

Részletesebben

VIRÁGPOR HELYETTESÍTÉSÉRE ALKALMAS KIEGÉSZÍTŐ TAKARMÁNY

VIRÁGPOR HELYETTESÍTÉSÉRE ALKALMAS KIEGÉSZÍTŐ TAKARMÁNY F O R T E V I T TAKARMÁNY KONCENTRÁTUM MÉHEK RÉSZÉRE VIRÁGPOR HELYETTESÍTÉSÉRE ALKALMAS KIEGÉSZÍTŐ TAKARMÁNY A FORTEVIT az első magyar fejlesztésű méhtáplálék, mely összetételénél fogva alkalmas a virágpor

Részletesebben

5. A talaj szerves anyagai. Dr. Varga Csaba

5. A talaj szerves anyagai. Dr. Varga Csaba 5. A talaj szerves anyagai Dr. Varga Csaba A talaj szerves anyagainak csoportosítása A talaj élőlényei és a talajon élő növények gyökérzete Elhalt növényi és állati maradványok A maradványok bomlása során

Részletesebben

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu)

A metabolikus szindróma genetikai háttere. Kappelmayer János, Balogh István (www.kbmpi.hu) A metabolikus szindróma genetikai háttere Kappelmayer János, Balogh István (www.kbmpi.hu) Definíció WHO, 1999 EGIR, 1999 ATP III, 2001 Ha három vagy több komponens jelen van a betegben: Vérnyomás: > 135/85

Részletesebben

A sikéralkotó fehérjék bioszintézise és a sikérkomplex reológiai sajátságai

A sikéralkotó fehérjék bioszintézise és a sikérkomplex reológiai sajátságai BUDAPESTI MŰSZAKI ÉS GAZDASÁGTUDOMÁNYI EGYETEM VEGYÉSZMÉRNÖKI ÉS BIOMÉRNÖKI KAR OLÁH GYÖRGY DOKTORI ISKOLA A sikéralkotó fehérjék bioszintézise és a sikérkomplex reológiai sajátságai c. PhD értekezés Készítette:

Részletesebben

Zárójelentés. Gabonafélék stresszadaptációját befolyásoló jelátviteli folyamatok tanulmányozása. (K75584 sz. OTKA pályázat)

Zárójelentés. Gabonafélék stresszadaptációját befolyásoló jelátviteli folyamatok tanulmányozása. (K75584 sz. OTKA pályázat) Zárójelentés Gabonafélék stresszadaptációját befolyásoló jelátviteli folyamatok tanulmányozása (K75584 sz. OTKA pályázat) A tervezett kísérletek célja, hogy jobban megértsük a növények változó környezetre

Részletesebben

A szövetek tápanyagellátásának hormonális szabályozása

A szövetek tápanyagellátásának hormonális szabályozása A szövetek tápanyagellátásának hormonális szabályozása Periódikus táplálékfelvétel Sejtek folyamatos tápanyagellátása (glükóz, szabad zsírsavak stb.) Tápanyag raktározás Tápanyag mobilizálás Vér glükóz

Részletesebben

Lipidek anyagcseréje és az ateroszklerózis (érelmeszesedés)

Lipidek anyagcseréje és az ateroszklerózis (érelmeszesedés) Lipidek anyagcseréje és az ateroszklerózis (érelmeszesedés) Rácz Olivér Miskolci Egyetem Egészségügyi Kar 22.9.2009 ateromisk.ppt 1 Az érelmeszesedés csak a XIX. évszázad második felétől orvosi probléma

Részletesebben

Amit az Omega 3-ról tudni érdemes

Amit az Omega 3-ról tudni érdemes Amit az Omega 3-ról tudni érdemes November 2012 POLARIS 5 Chemin du Quilourin - Moulin du Pont, 29170 PLEUVEN France Tel. + 33 298 548 420 Fax. + 33 298 548 451 www. polaris.fr Merüljünk el az Omega 3

Részletesebben

elektrokémiai-, ozmózisos folyamatokban, sav bázis egyensúly fenntartásában, kolloidok állapotváltozásaiban, enzimreakciókban.

elektrokémiai-, ozmózisos folyamatokban, sav bázis egyensúly fenntartásában, kolloidok állapotváltozásaiban, enzimreakciókban. Ásványi anyagok Ásványi anyagok Ami az elhamvasztás után visszamarad. Szerepük: elektrokémiai-, ozmózisos folyamatokban, sav bázis egyensúly fenntartásában, kolloidok állapotváltozásaiban, enzimreakciókban.

Részletesebben

A Talaj-és Növényvizsgáló Laboratórium szolgáltatásai

A Talaj-és Növényvizsgáló Laboratórium szolgáltatásai A Talaj-és Növényvizsgáló Laboratórium szolgáltatásai TALAJVIZSGÁLAT Szűkített talajvizsgálat paraméterei: - ph(kcl) és/vagy ph(h2o) - nitrit-nitrát nitrogén-tartalom (NO2-+NO3-)-N - P2O5 (foszfortartalom)

Részletesebben

A BIOETANOL GYÁRTÁS MELLÉKTERMÉKEI MINT ALTERNATÍV FEHÉRJEFORRÁSOK. Mézes Miklós Szent István Egyetem Takarmányozástani Tanszék

A BIOETANOL GYÁRTÁS MELLÉKTERMÉKEI MINT ALTERNATÍV FEHÉRJEFORRÁSOK. Mézes Miklós Szent István Egyetem Takarmányozástani Tanszék A BIOETANOL GYÁRTÁS MELLÉKTERMÉKEI MINT ALTERNATÍV FEHÉRJEFORRÁSOK Mézes Miklós Szent István Egyetem Takarmányozástani Tanszék MELLÉKTERMÉKEK FELHASZNÁLÁSÁNAK CÉLJA - Nagy mennyiségben és folyamatosan

Részletesebben

A búzanemesítés - és búzatermesztés előtt álló kihívások. Láng László MTA ATKI MGI, Martonvásár

A búzanemesítés - és búzatermesztés előtt álló kihívások. Láng László MTA ATKI MGI, Martonvásár A búzanemesítés - és búzatermesztés előtt álló kihívások Láng László MTA ATKI MGI, Martonvásár A Világ búzatermesztése A búza fedezi az emberiség kalória igényének 19%-át, fehérje igényének 20%-át A Világ

Részletesebben

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 NÖVÉNYÉLETTAN Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Sejtfal szintézis és megnyúlás Környezeti tényezők hatása a növények növekedésére és fejlődésére Előadás áttekintése

Részletesebben

Materials and methods

Materials and methods Research background and aims of the study Similar to the landraces and to other old Hungarian varieties, Bánkúti 1201 is a genetically heterogeneous population. They may possess special storage protein

Részletesebben

Belső hasznosítás. Kémiai struktúra. Fibersol-2

Belső hasznosítás. Kémiai struktúra. Fibersol-2 Fibersol-2 A Fibersol-2 egy egyedülállóan oldódó étkezési rost melyet keményítőből állítanak elő dexrtinizációs és enzimes eljárások kombinációjával. A Fibersol-2 jól működő szerteágazó kémiai struktúrával

Részletesebben

TIENS KARDI. Krill olaj étrend-kiegészítő kapszula homoktövis olajjal és amaránt magolajjal. A világ legtisztább vizeiből

TIENS KARDI. Krill olaj étrend-kiegészítő kapszula homoktövis olajjal és amaránt magolajjal. A világ legtisztább vizeiből TIENS KARDI Krill olaj étrend-kiegészítő kapszula homoktövis olajjal és amaránt magolajjal A világ legtisztább vizeiből Krill olaj étrend-kiegészítő kapszula homoktövis olajjal és amaránt magolajjal Ez

Részletesebben

A flavonoidok az emberi szervezet számára elengedhetetlenül szükségesek, akárcsak a vitaminok, vagy az ásványi anyagok.

A flavonoidok az emberi szervezet számára elengedhetetlenül szükségesek, akárcsak a vitaminok, vagy az ásványi anyagok. Amit a FLAVIN 7 -ről és a flavonoidokról még tudni kell... A FLAVIN 7 gyümölcsök flavonoid és más növényi antioxidánsok koncentrátuma, amely speciális molekulaszeparációs eljárással hét féle gyümölcsből

Részletesebben

A kadmium okozta nehézfémstressz vizsgálata

A kadmium okozta nehézfémstressz vizsgálata A kertészeti és mezőgazdasági növények termőképességét a környezeti biotikus és abiotikus stresszhatások nagymértékben befolyásolják. Az abiotikus környezeti stressz, mint például a szárazság, a nagy sótartalom,

Részletesebben

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére

Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Genetikai panel kialakítása a hazai tejhasznú szarvasmarha állományok hasznos élettartamának növelésére Dr. Czeglédi Levente Dr. Béri Béla Kutatás-fejlesztés támogatása a megújuló energiaforrások és agrár

Részletesebben

Grilla Stúdiója - gyógytorna, szülésfelkészítés

Grilla Stúdiója - gyógytorna, szülésfelkészítés Az éltetõ vitaminok A vitaminok olyan szerves vegyületek, amelyek feltétlenül szükségesek testünk kifogástalan mûködéséhez. A vitamin elnevezés a vita (élet) és az amin (NH2-tartalmú kémiai gyök) szavakból

Részletesebben

Lehet!ségek gombabetegségeknek ellenálló GM búza el!állítására

Lehet!ségek gombabetegségeknek ellenálló GM búza el!állítására Lehet!ségek gombabetegségeknek ellenálló GM búza el!állítására Jenes Barnabás, Várallyay Éva, Tóth Gábor, Ivanics Milán, Giczey Gábor, Balogh Andrea, Oreifig S. Aid, Burgyán József Mez!gazdasági Biotechnológiai

Részletesebben

Transzgénikus állatok előállítása

Transzgénikus állatok előállítása Transzgénikus állatok előállítása A biotechnológia alapjai Pomázi Andrea Mezőgazdasági biotechnológia A gazdasági állatok és növények nemesítése új biotechnológiai eljárások felhasználásával. Cél: jobb

Részletesebben

Alternatív kalászosok nemesítése és termesztése

Alternatív kalászosok nemesítése és termesztése Alternatív kalászosok nemesítése és termesztése, Megyeri Mária, Láng László, Bedő Zoltán Gabonafélék Agronómiai csoport (nagy keményítőtartalom, lisztes szemtermés) Főleg Poaceae fajok és pszeudocereáliák

Részletesebben

A búza (Triticum aestivum L.) táplálkozástani értékének javítása géntechnológiai módszerrel

A búza (Triticum aestivum L.) táplálkozástani értékének javítása géntechnológiai módszerrel Doktori (Ph.D.) értekezés A búza (Triticum aestivum L.) táplálkozástani értékének javítása géntechnológiai módszerrel Készítette Tamásné Nyitrai Erzsébet Cecília Eötvös Loránd Tudományegyetem, Természettudományi

Részletesebben

ZÖLDSÉGEK, GYÜMÖLCSÖK. -jelentős források: vitamin, ásványi elem, élelmi rost, szerves sav, pigment

ZÖLDSÉGEK, GYÜMÖLCSÖK. -jelentős források: vitamin, ásványi elem, élelmi rost, szerves sav, pigment ZÖLDSÉGEK, GYÜMÖLCSÖK -olcsók, könnyen beszerezhetők gyakoriak -100 kg évente -napi élelem egyötöde -arányuk általában nem kielégítő -nyersen, feldolgozva, tartósítva -gyökér, gumó, hagyma, szár, levél,

Részletesebben

Nemesítési haladás. Főbb trendek a növénynemesítésben. R. W. Allard (1996) Genetikai elszegényedés és a hasznos gének akkumulációja.

Nemesítési haladás. Főbb trendek a növénynemesítésben. R. W. Allard (1996) Genetikai elszegényedés és a hasznos gének akkumulációja. Főbb trendek a növénynemesítésben R. W. Allard (1996) Termesztett növények Tájfajta Régi fajtapopulációk populáció heterogenitás igen nagy nagy Genetikai elszegényedés és a hasznos gének akkumulációja

Részletesebben

Egészségtámogató és élelmiszerbiztonsági kockázatot jelentő összetevők meghatározására alkalmas analitikai módszerek fejlesztése

Egészségtámogató és élelmiszerbiztonsági kockázatot jelentő összetevők meghatározására alkalmas analitikai módszerek fejlesztése Egészségtámogató és élelmiszerbiztonsági kockázatot jelentő összetevők meghatározására alkalmas analitikai módszerek fejlesztése Tömösközi Sándor, Bucsella Blanka, Bugyi Zsuzsanna, Hajas Lívia, Harasztos

Részletesebben

Az élő szervezetek felépítése I. Biogén elemek biomolekulák alkotóelemei a természetben előforduló elemek közül 22 fordul elő az élővilágban O; N; C; H; P; és S; - élő anyag 99%-a Biogén elemek sajátosságai:

Részletesebben

A sejtek élete. 5. Robotoló törpék és óriások Az aminosavak és fehérjék R C NH 2. C COOH 5.1. A fehérjeépítőaminosavak általános

A sejtek élete. 5. Robotoló törpék és óriások Az aminosavak és fehérjék R C NH 2. C COOH 5.1. A fehérjeépítőaminosavak általános A sejtek élete 5. Robotoló törpék és óriások Az aminosavak és fehérjék e csak nézd! Milyen protonátmenetes reakcióra képes egy aminosav? R 2 5.1. A fehérjeépítőaminosavak általános képlete 5.2. A legegyszerűbb

Részletesebben

Nemzeti Akkreditáló Testület. RÉSZLETEZŐ OKIRAT a NAT-1-1169/2015 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. RÉSZLETEZŐ OKIRAT a NAT-1-1169/2015 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület RÉSZLETEZŐ OKIRAT a NAT-1-1169/2015 nyilvántartási számú akkreditált státuszhoz A CONCORDIA KÖZRAKTÁR Zrt. "Gabona Control" Központi Laboratóriuma (1024 Budapest, Kis Rókus

Részletesebben

Megfelelőségi határértékek az étrend-kiegészítőknél Uniós ajánlás a kompetens hatóságoknak

Megfelelőségi határértékek az étrend-kiegészítőknél Uniós ajánlás a kompetens hatóságoknak Megfelelőségi határértékek az étrend-kiegészítőknél Uniós ajánlás a kompetens hatóságoknak Horányi Tamás Magyarországi Étrend-kiegészítő Gyártók és Forgalmazók Egyesülte Étrend-kiegészítők, gyógyhatású

Részletesebben

Fehérjebiotechnológia Emri, Tamás Csősz, Éva Tőzsér, József Szerkesztette Tőzsér, József, Debreceni Egyetem

Fehérjebiotechnológia Emri, Tamás Csősz, Éva Tőzsér, József Szerkesztette Tőzsér, József, Debreceni Egyetem Fehérjebiotechnológia Emri, Tamás Csősz, Éva Tőzsér, József Szerkesztette Tőzsér, József, Debreceni Egyetem Fehérjebiotechnológia írta Emri, Tamás, Csősz, Éva, Tőzsér, József, Tőzsér, József, és Szerzői

Részletesebben

CzB 2010. Élettan: a sejt

CzB 2010. Élettan: a sejt CzB 2010. Élettan: a sejt Sejt - az élet alapvető egysége Prokaryota -egysejtű -nincs sejtmag -nincsenek sejtszervecskék -DNS = egy gyűrű - pl., bactériumok Eukaryota -egy-/többsejtű -sejmag membránnal

Részletesebben

INFORMATIKA EMELT SZINT%

INFORMATIKA EMELT SZINT% Szövegszerkesztés, prezentáció, grafika, weblapkészítés 1. A fényképezés története Táblázatkezelés 2. Maradékos összeadás Adatbázis-kezelés 3. Érettségi Algoritmizálás, adatmodellezés 4. Fehérje Maximális

Részletesebben

A búza termőterülete és termésátlaga 1901-2000 között a Világon

A búza termőterülete és termésátlaga 1901-2000 között a Világon 250000 200000 150000 100000 50000 0 A búza termőterülete és termésátlaga 1901-2000 között a Világon 3 2,5 2 1,5 1 0,5 0 Év Termő terület ( 1000 ha) 1901-1905 1906-1910 1911-1915 1916-1920 1921-1925 1926-1930

Részletesebben

MAGYAR ÉLELMISZERKÖNYV. Codex Alimentarius Hungaricus 1-1-90/496 számú előírás Az élelmiszerek tápértékének jelölése

MAGYAR ÉLELMISZERKÖNYV. Codex Alimentarius Hungaricus 1-1-90/496 számú előírás Az élelmiszerek tápértékének jelölése MAGYAR ÉLELMISZERKÖNYV Codex Alimentarius Hungaricus 1-1-90/496 számú előírás Az élelmiszerek tápértékének jelölése Nutrition labelling for foodstuffs Az előírás az Európai Közösségek Tanácsa 90/496/EGK

Részletesebben

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

NÖVÉNYÉLETTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 NÖVÉNYÉLETTAN Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Létfontosságú tápelemek, Tápelem hiánytünetek Előadás áttekintése 1. A növények tápelem ellátásának a vizsgálatára

Részletesebben

Normál változat EGYSÉGES DIÉTÁS RENDSZER II. Könnyű vegyes 2. Az ételek emészthetősége. Könnyű vegyes változat 1.

Normál változat EGYSÉGES DIÉTÁS RENDSZER II. Könnyű vegyes 2. Az ételek emészthetősége. Könnyű vegyes változat 1. Normál változat EGYSÉGES DIÉTÁS RENDSZER II. KONYHATECHNOLÓGIAI VÁLTOZATOK A normál konyhatechnikai műveleteket alkalmazva is készíthetünk diétás ételeket. Ebben a változatban minden ételkészítési eljárás

Részletesebben

A gasztrointesztinális (GI) rendszer élettana IV. Táplálkozás élettan.

A gasztrointesztinális (GI) rendszer élettana IV. Táplálkozás élettan. A gasztrointesztinális (GI) rendszer élettana IV. Táplálkozás élettan. A táplálékfelvétel célja: Nyersanyagok biztosítása a test számára a növekedéshez a szöveti regenerációhoz az ivarsejtek képzéséhez

Részletesebben

Gramix Prog. Gramix Program. Gramix Program. egyedülálló. célszerűség. célszerűség. gyártástechnológia K+F K+F K+F K+F. minőség. minőség.

Gramix Prog. Gramix Program. Gramix Program. egyedülálló. célszerűség. célszerűség. gyártástechnológia K+F K+F K+F K+F. minőség. minőség. K+F Gramix Program tudatos gazdálkodás gyedi etétel yság s kelát prémium minőség mezo- és mikroelemek egyedülálló gyártástechnológia rugalmasság prémium minőség Program hozzáadott érték ezo- és elemek

Részletesebben

Transzgénikus növények alkalmazása a funkcionális genomikai kutatásokban

Transzgénikus növények alkalmazása a funkcionális genomikai kutatásokban Transzgénikus növények alkalmazása a funkcionális genomikai kutatásokban MTA Agrártudományi Kutatóközpont Növényi Sejtbiológia Osztály Gyakorlatban alkalmazható transzgénikus növények létrehozásának alapfeltétele:

Részletesebben

EGYSEJTŰ REAKTOROK BIOKATALÍZIS:

EGYSEJTŰ REAKTOROK BIOKATALÍZIS: EGYSEJTŰ REAKTOROK BIOKATALÍZIS: A GÉNMÓDOSÍTÁSTÓL AZ IPARI FERMENTÁCIÓIG SZAMECZ BÉLA BIOKATALÍZIS - DEFINÍCIÓ szerves vegyületek átalakítása biológiai rendszer a katalizátor Enzim: élő sejt vagy tisztított

Részletesebben

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással

Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Biomassza alapú bioalkohol előállítási technológia fejlesztése metagenomikai eljárással Kovács Zoltán ügyvezető DEKUT Debreceni Kutatásfejlesztési Közhasznú Nonprofit Kft. Problémadefiníció Első generációs

Részletesebben

R. W. Allard (1996) Nemesítési haladás

R. W. Allard (1996) Nemesítési haladás Főbb trendek a növénynemesítésben Termesztett populáció növények heterogenitás R. W. Allard (1996) Tájfajta igen nagy Genetikai elszegényedés és a hasznos gének akkumulációja Régi fajtapopulációk nagy

Részletesebben

A fehérjék harmadlagos vagy térszerkezete. Még a globuláris fehérjék térszerkezete is sokféle lehet.

A fehérjék harmadlagos vagy térszerkezete. Még a globuláris fehérjék térszerkezete is sokféle lehet. A fehérjék harmadlagos vagy térszerkezete Még a globuláris fehérjék térszerkezete is sokféle lehet. A ribonukleáz redukciója és denaturálódása Chrisian B. Anfinsen A ribonukleáz renaturálódása 1972 obel-díj

Részletesebben

Áttekintés Az ALKOBEER projekt hét esztendeje Az alakor organikus nemesítése

Áttekintés Az ALKOBEER projekt hét esztendeje Az alakor organikus nemesítése Áttekintés Az ALKOBEER projekt hét esztendeje Az alakor organikus nemesítése MTA Agrártudományi Kutatóközpont Kovács Géza - - Mikó Péter Áttekintés Áttekintés Az Az ALKOBEER ALKOBEER projekt projekt hét

Részletesebben

Az örökítőanyag. Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase

Az örökítőanyag. Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase SZTE, Orv. Biol. Int., Mol- és Sejtbiol. Gyak., VIII. Az örökítőanyag Az élőlények örökítőanyaga minden esetben nukleinsav (DNS,RNS) (1)Griffith, (2)Avery, MacLeod and McCarty (3)Hershey and Chase Ez az

Részletesebben

TAKARMÁNYOZÁSTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010

TAKARMÁNYOZÁSTAN. Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 TAKARMÁNYOZÁSTAN Az Agrármérnöki MSc szak tananyagfejlesztése TÁMOP-4.1.2-08/1/A-2009-0010 Ásványi anyagok vázrendszer, fogak (Ca, P, F) enzim aktivátorok (Zn, Mn) ozmotikus viszonyok (K, Na, Cl) sav-bázis

Részletesebben

Az elhízás hatása az emberi szervezetre. Dr. Polyák József Pharmamedcor Kardiológiai Szakambulancia 1137. Budapest, Katona J. u. 27.

Az elhízás hatása az emberi szervezetre. Dr. Polyák József Pharmamedcor Kardiológiai Szakambulancia 1137. Budapest, Katona J. u. 27. Az elhízás hatása az emberi szervezetre Dr. Polyák József Pharmamedcor Kardiológiai Szakambulancia 1137. Budapest, Katona J. u. 27. Melyek az élő szervezet elemi életjelenségei közül minőségében testtömeg

Részletesebben

KITTEN 1-12 HÓNAP. Teljes értékű, kiegyensúlyozott táplálék kiscicák, vemhes vagy szoptató macskák számára.

KITTEN 1-12 HÓNAP. Teljes értékű, kiegyensúlyozott táplálék kiscicák, vemhes vagy szoptató macskák számára. www.farmina.hu A MATISSE termékcsalád a kiváló minőségű macskatápok teljes választékát kínálja mindenfajta macska számára, melyek: Étvágygerjesztőek, így a legigényesebb és legkényesebb ízlés kielégítésére

Részletesebben

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK

Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Juhász Angéla MTA ATK MI Alkalmazott Genomikai Osztály SZEKVENCIA ADATBÁZISOK Fehérjét kódol? Tulajdonságai? -Hol lokalizálódik? -Oldható? -3D szerkezete? -Accession #? -Annotációja elérhető? Már benne

Részletesebben

Gáz halmazállapotú energiahordozók és biohajtóanyagok (biogáz, biohidrogén)

Gáz halmazállapotú energiahordozók és biohajtóanyagok (biogáz, biohidrogén) Gáz halmazállapotú energiahordozók és biohajtóanyagok (biogáz, biohidrogén) Bagi Zoltán 1, Dr. Kovács Kornél 1,2 1 SZTE Biotechnológiai Tanszék 2 MTA Szegedi Biológiai Központ Megújuló energiaforrások

Részletesebben

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (7) a NAT-1-1514/2011 nyilvántartási számú akkreditált státuszhoz

Nemzeti Akkreditáló Testület. SZŰKÍTETT RÉSZLETEZŐ OKIRAT (7) a NAT-1-1514/2011 nyilvántartási számú akkreditált státuszhoz Nemzeti Akkreditáló Testület SZŰKÍTETT RÉSZLETEZŐ OKIRAT (7) a NAT-1-1514/2011 nyilvántartási számú akkreditált státuszhoz A Nemzeti Élelmiszerlánc-biztonsági Hivatal 1 Élelmiszer- és Takarmánybiztonsági

Részletesebben

Búza László, M Schill Judit, Szentgyörgyi Mária, Ábrahám Ágnes, Debreczeni Lajos, Keresztúri József, Muránszky Géza. 2009. április 22.

Búza László, M Schill Judit, Szentgyörgyi Mária, Ábrahám Ágnes, Debreczeni Lajos, Keresztúri József, Muránszky Géza. 2009. április 22. Gondolatok a MÉZ hamisítása kapcsán MIT-MIKOR-MELY Szereplő- MIKÉPPEN-MIÉRT hamisít, hamisíthat? Szofisztikált analitikai módszerek a hamisítások megelőzésére Búza László, M Schill Judit, Szentgyörgyi

Részletesebben

Kiegyensúlyozott táplálkozás. Energiát adó tápanyagok. Energia. Kiegyensúlyozott étrend. Energiát nem szolgáltató tápanyagok.

Kiegyensúlyozott táplálkozás. Energiát adó tápanyagok. Energia. Kiegyensúlyozott étrend. Energiát nem szolgáltató tápanyagok. Nem lehet elég korán kezdeni Kiegyensúlyozott táplálkozás Energia- és tápanyagszükséglet és a fogyasztás közötti egyensúly RENDSZERESSÉG+VÁLTOZATOSSÁG+MÉRTÉKLETESSÉG Életműködésekhez alapanyagcsere Növekedéshez

Részletesebben