DOKTORI (PhD) ÉRTEKEZÉS BABINSZKY GERGELY

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "DOKTORI (PhD) ÉRTEKEZÉS BABINSZKY GERGELY"

Átírás

1 DOKTORI (PhD) ÉRTEKEZÉS BABINSZKY GERGELY KESZTHELY

2 2

3 PANNON EGYETEM GEORGIKON MEZİGAZDASÁGTUDOMÁNYI KAR Növénytudományi és Biotechnológia Tanszék Állat-és Agrárkörnyezet-tudományi Doktori Iskola Iskolavezetı: Dr. habil. Anda Angéla Egyetemi tanár, az MTA doktora Témavezetı: Dr. Csitári Gábor Egyetemi docens Madár-botulizmus vizsgálata a Kis-Balaton területén DOKTORI (PhD) ÉRTEKEZÉS Készítette: Babinszky Gergely Keszthely

4 Madár-botulizmus vizsgálata a Kis-Balaton területén Értekezés doktori (PhD) fokozat elnyerése érdekében Írta: Babinszky Gergely Készült a Pannon Egyetem Állat- és Agrárkörnyezet-tudományi Doktori Iskolája keretében Témavezetı: Dr. Csitári Gábor Elfogadásra javaslom (igen / nem) (aláírás) A jelölt a doktori szigorlaton... % -ot ért el, Az értekezést bírálóként elfogadásra javaslom: Bíráló neve: igen / nem. (aláírás) Bíráló neve: igen / nem. (aláírás) ***Bíráló neve: igen / nem. (aláírás) A jelölt az értekezés nyilvános vitáján...% - ot ért el Veszprém/Keszthely,. a Bíráló Bizottság elnöke A doktori (PhD) oklevél minısítése... Az EDT elnöke *** esetleges 4

5 TARTALOMJEGYZÉK KIVONAT... 7 ABSTRACT... 8 INHALTSANGABE... 9 RÖVIDÍTÉSEK JEGYZÉKE BEVEZETÉS ÉS CÉLKITŐZÉSEK IRODALMI ÁTTEKINTÉS A baktérium története A baktérium rendszertani besorolása A baktérium morfológiája, törzseinek csoportosítása, biokémiai jellemzıi A toxin jellemzése A botulinum toxin A C 2 és C 3 toxinok A botulinum toxinnal szembeni természetes immunitás Madár-botulizmus Történet, elıfordulás Kóroktan, járványtan Kórfejlıdés, tünetek Kórbonctan, kórjelzés Gyógykezelés, megelızés Humán kórtani jelentıség Környezeti faktorok szerepe a madár-botulizmus megbetegedésekben Spórák A C típusú Clostridium botulinum szaporodásának környezeti feltételei Levegı- és vízhımérséklet Szervesanyag-tartalom ph, redoxpotenciál, sótartalom (vezetıképesség), oldott oxigén-szint Gerinctelen biomassza Egyéb mikroorganizmusok gátló hatása Fágok A lehetséges áldozat toxinfelvétele A baktériumok és a toxin szétterjesztése Egyéb faktorok Madár-botulizmus Magyarországon Madár-botulizmus a Kis-Balatonon A baktérium illetve toxinja jelenlétének kimutatása Egéroltás (mouse bioassay) ELISA (Enzyme-Linked Immunosorbent Assay) Molekuláris biológiai technikák PCR (Polymerase Chain Reaction) Ribotipizálás Biokémiai tesztek API RapID ANA II ANYAG ÉS MÓDSZER A környezeti tényezık statisztikai vizsgálata A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, PCR reakcióval

6 Nested PCR reakció WILLIAMSON és mtsai. /1999/ alapján Hagyományos PCR reakció FRANCIOSA és mtsai. /1996/ alapján Módosított real-time PCR reakció, FRANCIOSA és mtsai. /1996/ alapján Lux primer-alapú real-time PCR reakciók A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, tenyésztéssel EREDMÉNYEK A környezeti tényezık statisztikai vizsgálata Vízminıségi adatok Meteorológiai adatok A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, PCR reakcióval Nested PCR reakció WILLIAMSON és mtsai. /1999/ alapján Hagyományos PCR reakció FRANCIOSA és mtsai. /1996/ alapján Módosított real-time PCR reakció, FRANCIOSA és mtsai. /1996/ alapján Lux primer-alapú real-time PCR reakciók A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, tenyésztéssel KÖVETKEZTETÉSEK, JAVASLATOK A környezeti tényezık statisztikai vizsgálata A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, PCR reakcióval Nested PCR reakció WILLIAMSON és mtsai. /1999/ alapján Hagyományos PCR reakció FRANCIOSA és mtsai. /1996/ alapján Módosított real-time PCR reakció, FRANCIOSA és mtsai. /1996/ alapján Lux primer-alapú real-time PCR reakciók A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, tenyésztéssel Javaslatok a madár-botulizmus megbetegedések megelızése illetve kártételének csökkentése érdekében ÖSSZEFOGLALÁS FELHASZNÁLT IRODALOM TÉZISPONTOK Tézispontok magyarul Thesis statement AZ ÉRTEKEZÉS TÉMAKÖRÉBEN MEGJELENT PUBLIKÁCIÓK, ELİADÁSOK FÜGGELÉK A diszkriminancia analízis vázlatos menete, GAÁL /2004/ alapján A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, PCR reakcióval Nested PCR reakció WILLIAMSON és mtsai. /1999/ alapján Hagyományos PCR reakció FRANCIOSA és mtsai. /1996/ alapján Módosított real-time PCR reakció, FRANCIOSA és mtsai. /1996/ alapján Lux primer-alapú real-time PCR reakciók A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, tenyésztéssel KÖSZÖNETNYILVÁNÍTÁS

7 KIVONAT A Clostridium botulinum egyes toxintípusai által okozott madár-botulizmus világszerte a vízimadarak egyik legjelentısebb bakteriális eredető megbetegedése. Közismert, hogy e kórforma kialakulását bizonyos környezeti tényezık nagyban segíthetik. Jelen kutatási programban ezért célul tőztük ki e faktorok és a madár-botulizmus kitörések közti kapcsolat feltérképezését a megbetegedések szempontjából endémiásnak tekinthetı Kis- Balaton területén, statisztikai számítások segítségével. Emellett kísérletet tettünk a kórokozó iszapmintákból, hagyományos mikrobiológiai valamint molekuláris biológiai módszerekkel történı detektálására, illetve utóbbi technikák alkalmazhatóságának összehasonlítására. A vizsgálatok során hazánkban elsıként mutattunk ki szoros összefüggéseket néhány környezeti paraméter (levegı- és vízhımérséklet, ph, oldott oxigén- és szervesanyagtartalom) és a madár-botulizmus fellépése között. A Kis-balatoni iszapmintákból több, Clostridium botulinum-ra emlékeztetı Clostridium-fajt különítettünk el, ezek további vizsgálata azonban nem utalt botulinum toxin termelésére. Az általunk használt molekuláris biológiai módszerek egyikével kapcsolatban elıször számoltunk be fals pozitív eredményekrıl. E mellett elsıként ültettünk át egy hagyományos, PCR alapú diagnosztikai módszert egy olvadáspont-analízissel kiegészített, LightCycler-alapú real-time környezetbe, ezzel tovább növelve annak gyorsaságát, egyszerőségét és érzékenységét. Végül kísérletet tettünk egy, a madárbotulizmus kitörések igazolására használható, több szempontból új megközelítéső realtime PCR reakció kidolgozására. 7

8 ABSTRACT The aims of this research project were to compare some water quality parameters of high and low botulism risk areas of Lake Kis-Balaton using statistical methods to determine their significance in the occurrence of avian botulism epizootics, and to detect and isolate the etiological agent Clostridium botulinum from mud samples derived from the above mentioned wetland site by conventional microbiological and various molecular techniques including a new LightCycler-based real-time PCR reaction. 8

9 INHALTSANGABE Die Ziele dieses Forschungsprogrammes waren, einige Einflussfaktoren der Wasserqualität auf Gebieten hohen und niedrigen Botulismusrisikos des Kleinen Plattensees mit Verwendung von statistischen Methoden zu vergleichen, sowie den Krankheitserreger des Clostridium botulinum aus den aus diesem Feuchtgebiet stammenden Schlammmustern mit konventionellen mikrobiologischen und verschiedenen molekularen Techniken, einschliesslich einer neuen LightCyclerbasierten Realtime-PCR-Reaktion, nachzuweisen und zu isolieren. 9

10 RÖVIDÍTÉSEK JEGYZÉKE ADP ANOVA BoNT/C 1 bp BSA BSM CBI CCFA CM dntp DRCM EYA GTP IEW ip. iv. kda MLD NAD ppt rdns SNAP-25 SNARE TBE adenozin-difoszfát varianciaanalízis (analysis of variance) C 1 típusú botulinum neurotoxin (termelés) bázispár bovin szérum albumin (bovine serum albumin) botulinum szelektív tápközeg (botulinum selective medium) Clostridium botulinum izolációs agar cikloszerin-cefoxitin-fruktóz agar fıtt hús (cooked meat) dezoxinukleotid-trifoszfát megerısített differenciáló clostridium tápközeg (differential reinforced clostridial medium) tojásagar (egg yolk agar) guanozin-trifoszfát ioncserélt víz (ion-exchanged water) intraperitoneális(an) intravénás(an) kilodalton minimális letális dózis nikotinsavamid-adenin-dinukleotid trilliomod-rész, ed rész (parts per trillion) riboszómális DNS szinaptoszómához kapcsolt fehérje (synaptosomal associated protein) oldható N-etilmaleimid-érzékeny faktorhoz kapcsolódó fehérje-receptorok (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) trisz-bór-edta 10

11 TPGY ttkg U USGS tripton-pepton-glükóz-élesztıkivonat agar (tryptone-peptone-glucose-yeast agar) testtömeg-kilogramm egység (unit) Az Egyesült Államok Geológiai Kataszteri Hivatala (United States Geological Survey) 11

12 1. BEVEZETÉS ÉS CÉLKITŐZÉSEK Az obligát anaerob Clostridium botulinum toxinjai által kiváltott madár-botulizmus az érintett madárfajok száma és a mortalitási adatok alapján világszerte a vízimadarak legjelentısebb bakteriális eredető megbetegedése, amely az 1994 és 1997 közötti idıszakban, csak az Egyesült Államok és Kanada területén több mint négymillió vízimadár életét követelte. Egyetlen, 1996-ban bekövetkezett kaliforniai kitörés során az orrszarvú pelikán (Pelecanus erythrorhynchos) teljes nyugati populációjának mintegy 15%-a pusztult el /ROCKE, 2006/. Az anyagi kár mellett a védett illetve veszélyeztetett fajok egyedeinek elhullásából adódó eszmei kár ugyancsak hatalmas lehet. Ebbıl a szempontból kiemelkedı jelentıségőek azok a védett területek, melyeken a madár-botulizmus esetek visszatérıen jelentkeznek. Hazánkban ezek közé tartozik a Balaton-felvidéki Nemzeti Park részét képezı Kis-Balaton régiója, ahol egy-egy kitörés vízimadarak ezreivel, olykor tízezreivel végzett /MAGYARI; szóbeli közlés/. Régóta ismert, hogy a megbetegedések kialakulását különféle biotikus és abiotikus tényezık kedvezıen befolyásolhatják. Amint azt WOBESER /1987/ megjegyezte, e feltételeknek nincs olyan egyszerő együttállása, ami az összes kitöréssel összefüggésbe hozható, de meghatározta azt az öt tényezıt, amely ebbıl a szempontból alapvetı fontosságú. Ezek a spórák megléte, a Clostridium botulinum szaporodásához szükséges környezeti faktorok, a baktériumok specifikus bakteriofággal történı fertızıdése, a lehetséges áldozat toxinfelvétele illetve a kórokozó és a toxin megfelelı vektorok által történı elterjesztése. Mindezek fényében meglepı lehet madár-botulizmus esetekrıl olvasni akkor, amikor ezt a környezeti tényezık egyáltalán nem indokolják, illetve a kitörések elmaradását tapasztalni a korábban említett feltételek akár legkedvezıbb együttállása során. A hazai és nemzetközi tapasztalatok alapján kijelenthetı, hogy a jelenség háttérben olyan komplex, élıhelyenként változó rendszerrel állunk szemben, melyben a kulcselemek mellett egyéb, eddig ismeretlen, vagy kevésbé jelentısnek tartott tényezık hatásaival is számolni kell. Bár a betegség etiológiája már csaknem egy évszázada ismert, a Clostridium botulinum természetes mintákból történı izolálásának nehézségei a madár-botulizmust a baktérium 12

13 oldaláról megközelítve is rejtélyessé teszik. Példaként megemlíthetı, hogy mindmáig nem létezik olyan szelektív táptalaj, melynek segítségével a C típusú, nem proteolitikus Clostridium botulinum törzsek nagy biztonsággal elkülöníthetık volnának a társflórától, s ezt csak tetézik a kórokozó szigorú anaerob voltából adódó módszertani komplikációk. E problémakört megkerülve, a diagnosztikai gyakorlatban a baktérium kimutatása helyett megelégszenek az általa termelt toxin detektálásával. Az egéroltáson alapuló toxinsemlegesítési vizsgálat a mai napig az egyetlen, széles körben elfogadott illetve alkalmazott diagnosztikai metódus, legyen szó akár humán, akár állati megbetegedésekrıl. Az állatkísérletekkel szemben felmerülı aggályok azonban idırılidıre új, etikai, gazdasági és módszertani szempontból is megfelelıbb eljárások kifejlesztését sürgetik. Az immunológiai alapú vizsgálatok mellett ilyenek lehetnek a polimeráz-láncreakción (PCR) alapuló meghatározások, melyek a madár-botulizmus kitörések megerısítésében is egyre nagyobb tért hódítanak. Nem szabad azonban elfeledni, hogy e technikák zöme egyelıre csak egymással kombinálva nyújt kellı biztonságot a megbetegedések tényének igazolása során. Az értekezésben ismertetett kutatási program legfontosabb célja különféle biotikus és abiotikus környezeti tényezık, és a madár-botulizmus kitörések közötti kapcsolat feltárása a megbetegedések szempontjából endémiásnak tekinthetı Kis-Balaton területén. E vizsgálatok alacsony illetve magas kockázatú mintavételi pontok vízhımérséklet, szervesanyag-tartalom, ph, vezetıképesség és oldott oxigén-tartalom értékeinek, illetve a térség léghımérsékleti és csapadékeloszlási adatainak összevetését foglalják magukban, alacsony (kitörésmentes) illetve magas kockázatú (elhullással járó) években. Továbbá célul tőztük ki a Kis-balatoni megbetegedéseket kiváltó C típusú, neurotoxintermelı Clostridium botulinum baktériumok jelenlétének kimutatását, helyben győjtött iszapmintákból, hagyományos és real-time polimeráz-láncreakció segítségével; egyben elvégezve e technikák alkalmazhatóságának összehasonlítását. Mindezek mellett kísérletet kívántunk tenni a kórokozó klasszikus mikrobiológiai módszerek felhasználásával történı izolálására is. Az e tárgykörben magyar nyelven olvasható csekély számú publikáció arra sarkallt bennünket, hogy az értekezés témájának szakirodalmi feldolgozása a lehetı legteljesebb 13

14 képet nyújtsa, a kórokozó oldaláról tekintve éppúgy, mint az általa kiváltott megbetegedésérıl. A kutatási program eredményei reményeink szerint közelebb visznek a madárbotulizmus kialakulásának jobb megismeréséhez, a kitörések biztosabb elırejelzéséhez illetve az általuk okozott anyagi és eszmei károk mérsékléséhez. 14

15 2. IRODALMI ÁTTEKINTÉS 2.1. A baktérium története Bár a betegség tüneteit már a XIV. század elején leírták Német- és Oroszországban /NIKODÉMUSZ és mtsai., 1960/, az elsı adatokat errıl a baktériumfajról KERNER /1822/ publikálta. A botulizmus elnevezés is tıle származik, mivel összefüggést talált bizonyos kolbászféleségek fogyasztása (botulus = kolbász; latin) és egyes csoportos ételmérgezések között. A toxikoinfekcióért felelıs kórokozóról szóló bıvebb információkat elıször VAN ERMENGEM /1897/ írta le egy botulizmus járvány kapcsán, mely decemberében, a belgiumi Ellezelles városában egy zenés összejövetelen tört ki. Ötven ember betegedett meg, közülük hárman meghaltak. A baktériumot nyers sonkából tenyésztette ki és elnevezte Bacillus botulinus-nak, ami késıbb a Clostridium botulinum elnevezést kapta. Alig száz évvel KERNER elsı publikációját követıen bebizonyosodott, hogy e baktériumfaj egyes típusai különbözı állatokban is képesek megbetegedéseket okozni A baktérium rendszertani besorolása A Clostridium botulinum faj rendszertani besorolása a Bergey s Manual of Systematic Bacteriology 2. kiadása szerint /GARRITY és mtsai., 2004/, amely a 16S rrns gén szekvenciahomológiák és eltérések alapján osztályozza a mikroorganizmusokat, a következı: Domén: Törzs: Osztály: Rend: Család: Nemzetség: Faj: Bacteria Firmicutes Clostridia Clostridiales Clostridiaceae Clostridium botulinum 15

16 2.3. A baktérium morfológiája, törzseinek csoportosítása, biokémiai jellemzıi A botulizmus kórokozóit a rendszertan egy speciesbe sorolja a tenyésztésbeli és biokémiai eltérések ellenére, mivel farmakológiailag azonos hatású neurotoxint termelnek. A fajt a toxinok szerológiai specificitása alapján osztották fel A, B, C 1, D, E, F, G típusokra. Kezdetben a C 2 típust is ide sorolták, de ma már nyilvánvaló, hogy a C 2 toxin nem okoz idegrendszeri tüneteket. Eltekintve a toxinok szerológiai specificitása alapján elvégzett felosztástól, más, fıként biokémiai tulajdonságai alapján a Clostridium botulinum fajt négy csoportra osztották: I. proteolitikus, A, B, F toxintípusú törzsek II. nem proteolitikus, B, E, F toxintípusú törzsek III. nem proteolitikus, C, D toxintípusú törzsek IV. gyengén (egyáltalán nem) proteolitikus és nem szacharolitikus, G toxintípusú törzs (1. táblázat). 1. táblázat. A Clostridium botulinum törzseinek csoportosítása fenotípusos jellemzıik alapján (HATHEWAY /1990/ nyomán, módosítva). Csoport Toxintípus Proteolitikus Glükózbontás reakció illó nem illó Lipáz Anyagcseretermékek* aktivitás I A, B, F E, ivaj, V, ival FP II B, E, F E, V III C, D +/- + + E, P, V IV G E, ivaj, V, ival FE Fenotípusosan rokon Clostridium -ok C. sporogenes C. novyi C. subterminale *Savas anyagcsere-végtermékek PYG tápközegben. E: ecetsav, P: propionsav, ivaj: izo-vajsav, V: vajsav, ival: izovaleriánsav, FP: fenil-propionsav, FE: fenil-ecetsav A III. csoportba tartozó, nem proteolitikus C és D toxintípusú törzseknél, melyek közül elıbbiek a madár-botulizmus fı kórokozói /REILLY BOROFF, 1967/, 0,5-0,7 x 3,4-7,9 µm nagyságú, peritrich csillóik segítségével mozgó egyenes pálcákat találunk. Gram-pozitívak, sejtfaluk DL-diamino-pimelinsavat tartalmaz. Spóráik oválisak, szubterminálisak. Felületi telepei kerekdedek, enyhén szabálytalanok, gyengén csipkézett szélőek, kissé kiemelkedık; áttetszı, szürkésfehér, sima, matt felületőek (1. kép). Nutrient vagy CM buillon-ban erjeszthetı szénhidrátok jelenlétében is mérsékelten növekednek. Fermentációs termékeik az ecetsav, propionsav és a vajsav. A zselatint 16

17 hidrolizálják; a tejet nem emésztik. Szaporodási optimum hımérsékletük C. DNS-ük GC tartalma mol % /BERGEY, 1974/. A ph-optimummal kapcsolatban pontos adatok a feldolgozott hazai és nemzetközi irodalomban nem találhatók. 1. kép. Lecitináz- és lipáz-aktív, C típusú Clostridium botulinum telepek (72h, EYA) /a szerzı felvétele/. Az I. csoport törzsei A, B és F típusú toxint termelhetnek (1. táblázat). Az A típusú toxint termelı törzsek a kevéssé lakott, mezıgazdasági mővelésbe nem vont, nagy kiterjedéső füves pusztákon élnek. Az USA-ban a Mississippi-tıl nyugatra, valamint Argentína és Kína területén írták le jelenlétüket. A talajmővelés intenzívebbé válása elpusztítja ıket. A kórokozók fennmaradásában a legelı, illetve füves pusztán élı állatok játszanak szerepet, amelyek bélflórájából az ott jelenlévı nem szaporodó baktérium az állat elhullásakor kiszabadul, és a bomló szöveteket nagy tömegő vegetatív forma árasztja el, amely a tetem belsejében spórásodik. A spórák terjesztésében a dögbıl táplálkozó ragadozók, rovarok, rágcsálók egyaránt szerepet játszhatnak, ürülékükkel szennyezve a talajt /GULYÁS és mtsai., 1998/. A B toxintípusú törzsek a lombos erdık éghajlati övében, túlnyomórészt savanyú talajokon fordulnak elı. Ez a típus váltja fel az A toxin-termelı törzseket a mezıgazdasági mővelésbe fogott területeken. A proteolitikus B típus foglalja el a földmővelésbe vett, kiszárított tengerfenéken az E típus helyét. A természetben való fennmaradás mechanizmusa az A típuséhoz hasonló. A baktérium a bomló állati 17

18 szövetekben szaporodik jól, de növényi szövetekben is képes növekedni, és toxint termelni /GULYÁS és mtsai., 1998/. Európában így hazánkban is a B toxintípus okozza a humán megbetegedések többségét, mely általában házi állatvágások során kerül be a különbözı húskészítményekbe. Ha a Clostridium botulinum okozta ételmérgezés földrajzi elıfordulását figyeljük, azt tapasztalhatjuk, hogy az esetek zöme a Dunántúl déli megyéire, elsısorban Baranya és Tolna megyére korlátozódott egészen a legutóbbi évekig óta azonban a Nyírségbıl is számos ételmérgezést jelentettek /GULYÁS és mtsai., 1998/. A II. csoport törzsei B, E és F típusú toxint képezhetnek. A két utóbbi toxint termelı törzsek a hideg éghajlati övezet édesvizeinek és tengerpartjainak lakói. Dán szerzık vizsgálatai alapján az E típus Európában a Balti-tenger sekély öbleiben és az édesviző, gazdag állatvilággal benépesített tavakban tenyészik /HUSS, 1980/. Valódi vízi organizmus, mely a vízben és az iszapban 10 2 /g csíraszámot is elérhet. Jelen van a vízi gerinctelen élılények és a halak bélcsatornájában, és az állat pusztulása után a tetemben elszaporodva toxint termel. A spórákat a halak és a vízáramlatok terjesztik. Az E típus Alaszka, Kanada és Szibéria területén is igen elterjedt. Az F típus Japán tengerpartjain és az USA-ban fordul elı. A III. csoportba tartozó törzsek C és D típusú toxint állíthatnak elı. E törzsek a meleg éghajlaton, az iszapban és madarak, illetve emlısök bélcsatornájában élnek. A víz felmelegedése esetén a baktérium 15 C felett képes az iszapban levı elhalt élılények tetemein szaporodni, és toxint termelni. A gerinctelenekre a toxin hatástalan, ezek baktériumhordozóként szerepelnek. Az iszapban élı férgekbıl, rovarokból táplálkozó madarak a kórokozót, illetve a toxint elfogyasztják, beteggé és tartós baktériumürítıvé válnak, a fertızést nagy területeken széthurcolhatják. Az elhullott madártetemeken élı légyálcák a toxint nagy mennyiségben tartalmazzák. Ezek elfogyasztása ismét a madarakat mérgezi. A végeredmény tömeges madárpusztulás, amely mindaddig tart, amíg a fertızési lánc meg nem szakad. A madarak, elsısorban a fiatal egyedek, igen érzékenyek a toxinnal, és fogékonyak a baktériummal szemben. A IV. csoport törzsei G típusú toxint termelhetnek, melyek fıleg kísérleti állatok megbetegedését, s igen ritkán emberi mérgezést is okoznak /GULYÁS és mtsai., 1998/. 18

19 A C típusú Clostridium botulinum törzsek biokémiai tulajdonságainak vizsgálatával kapcsolatban viszonylag kisszámú közlemény olvasható. Ennek okai egyrészt a baktérium izolálásának, fenntartásának és tenyésztésének nehézségében, másrészt pedig valószínőleg épp ebbıl adódóan a tenyésztést megkerülı diagnosztikai eljárások elterjedésében keresendık (lásd késıbb). A nemzetközi irodalomban, e témakörben fellelhetı eredményeket, melyek enzimreakciók, szénhidrát-hasznosítás és különféle anyagcseretermékek vizsgálatán alapulnak, a 2. táblázat foglalja össze. A táblázat adatait szemlélve szembetőnı eltérések figyelhetık meg az egyes törzsek biokémiai jellemzıi között. OGUMA és mtsai. /1986/ szerint például néhány munkában negatív lecitináz aktivitásról, illetve indolképzésrıl számolnak be, míg mások /SEGNER és mtsai., 1971a; NAKAMURA és mtsai., 1983/ minden esetben pozitív lecitináz reakcióról, egy törzs esetében pedig indol-pozitivitásról írnak. Bár a szénhidrát-fermentációs mintázatban az egyes izolátumok között tapasztalható különbségek az eltérı enzimkészlet okán még csak-csak magyarázhatók, azonos törzsek között azonban már aggodalomra adhatnak okot (468-as törzs: indolképzés, fruktóz- és maltózbontás; 6813-as és 6814-es törzsek: fruktózbontás 2. táblázat). OGUMA és mtsai. /1986/ szerint e meglepı eredmények okai az eltérı vizsgálati módszerekben keresendık. E tények figyelembevételével szerencsés volna egy olyan nyilvános, világszerte követendı módszertani útmutató létrehozása, melynek segítségével az efféle anomáliák kiküszöbölhetık lennének. A fenti kételyek ellenére a különféle biokémiai alapú rendszerek (pl. API, Biolog) használata meglehetısen elterjedt. 19

20 2. táblázat. Szárazföldi és tengeri eredető, C típusú Clostridium botulinum törzsek biokémiai tulajdonságai. BERGEY, 1974 SEGNER et al., 1971 OGUMA et al., 1986 nem Stockh. 468 CB D6F proteolitikus (Sz) (Sz) (T) (T) (T) (T) (?) (Sz) (Sz) (?) (?) (T) (T) B, C, D, E, F (G. I.) (?) (?) (G. IV.) (G. IV.) (?) (G. I.) (G. I.) (G. I.) (G. II.) (G. II.) (G. IV.) (G. IV.) H 2 S-termelés - n.v. n.v. n.v. n.v. n.v. n.v. + + (+) + (+) - - Ureáz - n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Zselatin hidr Kazein hidr. - n.v. n.v. n.v. n.v. n.v. n.v Nitrátred Acetoin (VP) - n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Indol-képzés (+) + (+) - - Hemolízis + n.v. n.v. n.v. n.v. n.v. n.v Lecitináz v Lipáz Adonit n.v n.v. n.v. n.v. n.v. n.v. n.v. n.v. Amygdalin d n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Arabinóz d n.v. n.v. n.v. n.v. n.v. n.v. n.v. Cellobióz - n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Dextróz n.v. - - (+) (+) (+) (+) n.v. n.v. n.v. n.v. n.v. n.v. n.v. Dulcit n.v. n.v. n.v. n.v. n.v. n.v. n.v. Eszkulin - n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Fruktóz Galaktóz d Glükóz n.v. n.v. n.v. n.v. n.v. n.v. n.v. Glicerin d n.v. n.v. n.v. n.v. n.v. n.v. n.v. Glikogén - n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Inozit d - - (+) (+) (+) (+) n.v. n.v. n.v. n.v. n.v. n.v. n.v. Inulin n.v. n.v. n.v. n.v. n.v. n.v. n.v. Laktóz n.v. n.v. n.v. n.v. n.v. n.v. n.v. Maltóz d - - (+) (+) (+) (+) Mannit n.v. n.v. n.v. n.v. n.v. n.v. n.v. Mannóz (+) (+) + + Melezitóz - n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Melibióz (+) (+) (+) (+) Raffinóz n.v. n.v. n.v. n.v. n.v. n.v. n.v. Rhamnóz - n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Ribóz d n.v. n.v. n.v. n.v. n.v. n.v. n.v. Szalicin n.v. n.v. n.v. n.v. n.v. n.v. n.v. Szorbit d n.v. n.v. n.v. n.v. n.v. n.v. n.v. Szorbóz - n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. n.v. Keményítı n.v. n.v. n.v. n.v. n.v. n.v. n.v. Szacharóz d n.v. n.v. n.v. n.v. n.v. n.v. n.v. Trehalóz d n.v. n.v. n.v. n.v. n.v. n.v. n.v. Xylóz n.v. n.v. n.v. n.v. n.v. n.v. n.v. d: a törzsek 11-89%-a pozitív; v: változó; n.v.: nem történt vizsgálat; (+): gyenge pozitivitás; (T): tengeri törzs; (Sz): szárazföldi törzs; (G. I-IV.): biokémiai tulajdonságok alapján történı csoportosítás (OGUMA et al., 1986) 20

21 2.4. A toxin jellemzése A botulinum toxin A Clostridium botulinum háromféle toxint termel (botulinum toxin, C 2 és C 3 toxin). Mielıtt ezt felfedezték, egyes sajátosságokat, mint az ADP-riboziláció, ami valójában a C 2 és C 3 toxinokkal kapcsolatos, a botulinum toxinnak tulajdonították, mivel a botulinum toxin-készítmények e másik két toxinnal voltak szennyezve. Az ADP-riboziláció során a NAD-molekuláról szabaddá válik a nikotinsav-amid, a ribozilált fehérje amino-csoportjához pedig kovalens kötéssel egy ADP-ribóz molekula kapcsolódik. Az ADP-ribozilációs aktivitás a C 2 és C 3 toxinok mellett más toxinokra is jellemzı. Ilyenek például a diphteria- és a cholera-toxinok. Botulinum-toxin esetében a ribozilált aminosav arginin helyett aszparagin /SEKINE és mtsai., 1989/. A botulinum toxin az egyetlen a három közül, amely a neuronokra hat, így kétségtelenül ez a toxin a felelıs a betegség tüneteiért. Jóval toxikusabb is a másik kettınél. A botulinum toxinnak legkevesebb hét, szerológiailag eltérı típusa van (A, B, C 1, D, E, F, G). Élettani hatásuk azonos: az idegvégzıdésen egy neurotranszmitter, az acetil-kolin felszabadulását gátolják /SALYERS WHITT, 1994/. A dolgozatban a könnyebb átláthatóság kedvéért ahol erre csak mód nyílt, a C 1 toxin kifejezés C toxin -ra lett változtatva, így a továbbiakban ezek egymás szinonimáinak tekintendık. A neuromuszkuláris szinapszisban az acetil-kolint tartalmazó vezikulumokat a synaptobrevin szállítja a preszinaptikus membrán felé. Ezt a fehérjét hasítja a toxin B, D, F, G típusa. A membránon a syntaxin és a SNAP-25 alkotják azt az aktív kötıhelyet, ahol a vezikulumok rögzítése és kiürítése végbemegy. Az A és E toxinok szubsztrátja a SNAP-25 molekula, míg a C toxin a syntaxint támadja meg /BENFENATI VALTORTA, 1995/, bár ARNON és mtsai. /2001/ szerint utóbbi szubsztrátjaként a SNAP-25 szintén elképzelhetı (1. ábra). A botulinum toxin mindegyik típusa cink-dependens metalloproteáz, így képes arra, hogy a neuroexocitózis folyamatában résztvevı fehérjekomponenseket jellegzetes helyeken hasítsa. A cink-ionok központi szerepet játszanak a peptid-kötések hidrolízisében /HUNTER POXTON, 2002/. A négykarú cink-kötı hely, mely két hisztidin, egy glutamát- és egy vízmolekulát foglal magában, a könnyő láncon található. 21

22 Ugyancsak itt helyezkedik el a HELIH konszenzus aminosav-szekvencia, amely más, cink-függı metalloproteázokra szintén jellemzı (2. ábra) /PESTRONK, 2008/. 1. ábra. A botulinum toxinok hatásmechanizmusa és támadáspontjai a kolinerg idegvégzıdésen (ARNON és mtsai. /2001/ nyomán). 22

23 A botulinum toxin egy 150 kda molekulasúlyú fehérje, amely része egy, a toxin mellett egyéb proteineket is tartalmazó komplexnek. A komplexet progenitor toxinnak, magát a toxint pedig derivatív toxinnak hívják. A derivatív toxin orálisan bejutva a szervezetbe a progenitor toxinnál kevésbé hatásos, injektálva viszont ennek épp a fordítottja tapasztalható. Ez vezetett ahhoz a feltételezéshez, hogy a progenitor toxin nem toxikus komponensei szerepet játszanak a derivatív toxin gyomorsavtól és a proteázoktól való védelmében, illetve a gyomor nyálkás felszínén történı átjutásban, majd a megkötıdésben. Az aktív derivatív toxin csakúgy, mint oly sok más exotoxin két fehérje alegységbıl áll, egy nehéz láncból (100 kda) és egy könnyő láncból (50 kda), melyek egy diszulfidhíddal kapcsolódnak. A nehéz lánc két további alegységbıl áll (HcN (Hc1) és HcC (Hc2); 2. ábra), ezek közül az utóbbi felelıs a megkötıdésért /HUNTER POXTON, 2002/. A derivatív toxint a baktérium inaktív fehérje formájában szintetizálja és választja ki. A fehérje proteolitikus hasítása aktiválja a toxint, amely megvalósulhat a Clostridium-ok által termelt és a gyomorban keletkezı proteázoktól is. A toxin kötıdési helye a nehéz lánc C-terminálisa közelében található. Úgy gondolják, hogy a lánc N-terminálisa egy csatornát képez a neuron membránjában, lehetıvé téve a könnyő lánc belépését a sejtbe /SALYERS WHITT, 1994/. A botulinum toxin igen mérgezı anyag. Nemzetközi egysége (1 U=1 LD 50 ) az a mennyiség, amely 20 g-os nıstény Swiss-Webster egereknek beadva a kísérleti csoport felét 4 napon belül elöli. Az A típusú tisztított neurotoxin 1 ng-ja 2,5 LD 50 hatáserısségő 1 a Botox (USA) készítményben, a brit Dysport toxin pedig 40 MLD/kg erısségő. Az ember letális dózisa MLD/kg az A toxintípusból /GULYÁS és mtsai., 1998/. Az A, B és D típusok egéren mért toxicitása azonos mértékő, a C, E és F típusú toxinok negyed-, illetve tizedakkora toxicitási értékek között mozognak /TOPLEY WILSON, 1990/. 1 LD 50 : az a méregadag mg/testtömeg kg-ban (vagy ml/kg-ban, mmol/kg-ban) kifejezve, amely a kezelt, kísérletbe vont állatok 50%-át elpusztítja (Dosis Lethalis 50) /VÁRNAGY BUDAI, 1995 nyomán/ 23

24 A C típusú toxin 4,4x10 7 MLD/mg protein toxicitású; a tisztított toxin molekulasúlya 141 kda (98 kda (nehéz lánc) + 53 kda (könnyő lánc)) /SYUTO KUBO, 1977/. 2. ábra. A botulinum toxin szerkezete (PESTRONK /2008/ nyomán). A C és D típusú toxinok molekulái a neurotoxin és egy nem toxikus, nem hemagglutináló, vagy egy nem toxikus, hemagglutináló komponensbıl állnak. Disszociációjukat lúgos közegben (ph=8-nál) figyelték meg. A nem toxikus, hemagglutináló komponens egy nem toxikus, nem hemagglutináló komponensbıl és a hemagglutinációs aktivitást biztosító alkomponens(ek)bıl tevıdik össze. A C és D típusú toxinok, illetve a nem toxikus rész termelése bakteriofágok által irányított /OGUMA és mtsai., 1980/ (bıvebben lásd késıbb). Annak ellenére, hogy több szerzı szerint a Clostridium botulinum C és D típusai csak állatokat betegítenek meg /ROCKE, 1983; SALYERS WHITT, 1994/, beszámoltak néhány olyan humán esetrıl, melyet a C típus okozott. Kettı az 1960-as években, a Szovjetunióban; egy Franciaországban, egy pedig az Egyesült Államokban történt 24

25 /JENSEN PRICE, 1987/, de HOLEMAN /1970/ szerint ezek nem voltak kellıen alátámasztva. OGUMA és mtsai. /1990/ ezzel szemben C típusú botulizmusról számoltak be egy 171 napos leánycsecsemınél, akit hirtelen légzésbénulással szállítottak kórházba. A beteg székletébıl kitenyésztették a Clostridium botulinum C típusát, s a kísérleti egéroltások is ugyanerre az eredményre vezettek. MAKSYMOWYCH és SIMPSON /1998/ szerint a megbetegedések az emésztırendszerben található C típusú toxin-receptorok jelenlétéhez köthetık, s a csekély humán esetszám egyik lehetséges magyarázata épp e receptorok hiánya, melynek okán a toxin nem tud a keringésbe transzlokálódni A C 2 és C 3 toxinok A C 2 és C 3 a botulinum toxinnal együtt található meg néhány Clostridium botulinum törzsben. Klinikai jelentıségük tisztázatlan. A C 2, amely csak sporuláció idején termelıdik (lásd késıbb), s melynek génje a bakteriális kromoszómán helyezkedik el, egy A-B toxin, tehát könnyő lánc-nehéz lánc struktúrájú. Az A részt I-es, a B-t pedig IIes komponensnek is nevezik. A C 2 B része (tehát a II-es komponens) kötıdik a különféle sejtekhez, az A rész pedig ADP-ribozilálja az intracelluláris aktint. Ez megzavarja a normális, mikrofilamentumok által biztosított szerkezetet, s a toxin a sejt roncsolódását okozza /SALYERS WHITT, 1994/. OHISHI és mtsai. /1980/ számításai szerint az I-es komponens molekulasúlya 55 kda, a II-es komponensé pedig 105 kda. A C 2 protoxinként keletkezik, toxicitása tripszinezve több mint 2000-szeresére növelhetı (az alap-toxicitás 1:2,5 arányú I-II keveréknél a legmagasabb: 2,2x10 4 egér ip. LD 50 /mg). A tisztított C 2 iv. hatásosabb, mint ip. (5,4 ng ill. 49 ng egér LD 50 ) /OHISHI és mtsai., 1980/. A C 2 két komponense külön-külön nem, vagy alig toxikus (még tripszinezést követıen sem), együttmőködve viszont halálosak: tripszinezést követıen a II-es komponens nagyon alacsony toxicitású volt, az I-es pedig nem bizonyult toxikusnak, sem tripszinezés elıtt, sem azután. A tripszinezett I-es és a nem tripszinezett II-es komponens keveréke nem halálos egerekben, fordítva viszont a tripszinezett C 2 toxicitásának 82%-át mérték. A maximális 25

26 aktiválás 1:2 arányú toxin-tripszin keveréknél, 30 perces inkubáció után, ph=8-nál jött létre /OHISHI és mtsai., 1980/. A C 2 -nek számos hatása van: amellett, hogy úgy hat, mint egy klasszikus enterotoxin (azaz elısegíti a folyadékok kiszabadulását a bél nyálkahártyáján), ún. vaszkuláris permeabilitási (VP) aktivitással bír, mely az erek áteresztıképességének növekedésével jár. OHISHI és SAKAGUCHI /1982/ kísérletükben 14-féle C és D típusú törzset vizsgáltak. A 14 törzsbıl 10-nek volt VP aktivitása, mely minden esetben semlegesíthetı volt anti-c 2 szérummal, illetve az I-es és II-es komponensekre specifikus antiszérumokkal, de anti-c-vel és anti-d-vel nem. Annak a 4 törzsnek, amelynek nem volt VP aktivitása, tripszinezve sem volt semmilyen hatása (még úgy sem, hogy tripszinezett I-es, illetve II-es komponenst adtak hozzájuk), tehát e törzsek sem I-es, sem II-es komponenst nem termeltek. Ezekbıl az eredményekbıl is világosan kitőnik, hogy a VP aktivitás csak a C 2 -termelı C és D típusú törzsek jellemzıje. A C 2 talán segít a botulinum toxin szervezetben történı terjedésében azzal, hogy növeli az erek permeabilitását, de önmagában mivel nem neurotoxin nem játszik fontos szerepet a botulizmus tüneteinek létrehozásában. A C 3 (25 kda) jóval kisebb a C 2 -nél és a botulinum toxinnál. A toxin mely valójában egy exoenzim génje a C 1 és D típusú toxinokéhoz hasonlóan bakteriofágon kódolt. /HUNTER POXTON, 2002/ A C 2 A részéhez hasonlóan a C 3 is ADP-ribozilációs aktivitással bír. Eddig ismeretlen módon egy 21 kda molekulasúlyú GTP-kötı fehérjét ribozilál, ahogy azt a gazdasejtek több típusánál is észlelték. A C 3 toxikus hatásával megakadályozza néhány GTP-kötı fehérje jelátalakítását és közvetítését, ezzel befolyásolva az emlısök sejtjeinek metabolizmusát, amelyet épp ezek a fehérjék szabályoznak. A tényt, amely szerint a C 3 szervezeten kívülrıl bejuttatva nem toxikus az emlısök sejtjeire, azzal magyarázzák, hogy képtelen e sejtekhez kötıdni, majd beépülni. A C 3 olyan, mint egy toxin A alegysége, mely elvesztette B alegységét. A C 3 emlıs sejtekbe történı bejuttatása elektroforetikusan vagy ozmotikus sokk létrehozásával megváltoztatja a sejtszerkezetet, de nem ismert, hogy e változásoknak bármilyen 26

27 patológiai jelentısége lenne. Ezért, ha lehet, a C 3 botulizmusban játszott szerepe még kevésbé meghatározható, mint a C 2 -é /SALYERS WHITT, 1994/. Régebben sok zavar támadt a Clostridium botulinum különbözı típusai, különösen a C α, C β és D izolálásával kapcsolatban. A C típust szinte egyszerre különítette el BENGSTON /1922/ a fémzöld döglégy (Lucilia caesar) lárváiból az Egyesült Államokban és SEDDON /1922/ szarvasmarhákból Ausztráliában. Az izolátumok két szubtípust tartalmaztak, melyek C α és C β néven váltak ismertté. SMITH, L. DS. és SUGIYAMA egy 1988-ban megjelent munkájukban nem javasolják az α és β terminológiát, helyette inkább csak C típus-t használnának, s egyben rámutatnak arra, hogy a C α törzsek C 1 és C 2 toxint is termelnek, melyek közül csak egy (C 1 ) a neurotoxin, a C β törzsek egyedül C 2 toxint termelnek, elhagyva a C 1 -termelést irányító bakteriofágot A botulinum toxinnal szembeni természetes immunitás A fogékony állatokban és az emberben az ellenanyag-válasz elindításához a letális dózisnál nagyobb toxinmennyiség szükséges, ezért a halál a humorális védelem kialakulása elıtt következik be, és a botulizmusból gyógyultak általában nem mutatnak védettséget a toxinnal szemben. Bizonyos dögevı madarak és emlısök azonban képesek ilyen hullákkal táplálkozni szemmel látható megbetegedés nélkül. OHISHI és mtsai. /1979/ Clostridium botulinum toxinokal szemben természetesen megjelenı ellenanyagokat találtak pulykakeselyőben (Cathartes aura), prérifarkasban (Canis latrans) és rövidcsırő varjúban (Corvus brachyrhynchos) passzív hemagglutinációval, és ezt szérumneutralizációs próbával is megerısítették. A passzív hemagglutinációval a 20 pulykakeselyőbıl 18 (90%), a 12 rövidcsırő varjú közül 5 (42%) és a 110 prérifarkasból 25 (23%) savója adott pozitív reakciót az egyes botulinum toxin típusokkal. Valamennyi szeropozitív keselyő protektív ellenanyagokkal rendelkezett a C és D típusú toxinokkal szemben, míg az E, A és F típusokkal szemben 33-42%-uk. A B típusú toxin esetében ez az érték csak 22% volt. A prérifarkasok 14-57%-a rendelkezett szérumneutralizációs ellenanyagokkal az A, C, D, E típusú toxinokkal szemben, de nem voltak antitestjeik a B és F típusokkal szemben. Bizonyos dögevı állatok tehát ismeretlen természető szerzett immunitás révén védettek. A fenti eredmények alapján felmerül, hogy a vérükben keringı ellenanyagok védhetik 27

28 ıket, de a védelemnek nem ez lehet az egyedüli mechanizmusa. KALMBACH /1939/ azt találta, hogy a pulykakeselyők nagymértékben rezisztensek parenterálisan adott botulinum toxinokkal szemben. Ezt a megállapítást PATES /1967/ erısítette meg, aki a rezisztenciát nem tudta a vérben levı ellenanyagoknak vagy nem specifikus detoxikáló anyagoknak, esetleg a keringésbıl eltőnt toxin hiányának tulajdonítani. COHEN /1970/ szerint a keselyők A típusú toxinnal szembeni toleranciája a paraszimpatikus idegvégzıdések rezisztenciájával magyarázható. Nem ismeretes, hogy vajon az antitest-termelés az elfogyasztott preformált toxinra, vagy a keselyők béltraktusában növekvı Clostridium botulinum által termelt toxinra alakul-e ki válaszul. A kísérletben a baktérium kitenyésztésére irányuló vizsgálatok negatív eredménnyel zárultak. Az antitoxin jelenléte más fajokban aligha magyarázható szerzett rezisztenciával. Az egyik lehetséges feltételezés szerint a szeropozitív madarak és emlısök életük korai szakaszában toxinhatásnak voltak kitéve, amikor a rezisztencia ismeretlen okból magas lehetett. SUGIYAMA /1977/ közölte, hogy újszülött egér béltraktusában a Clostridium botulinum könnyen tenyészthetı, de az állaton a toxintermelés ellenére sem fedezhetık fel a botulizmus tünetei. Humán újszülöttekrıl is ismert, hogy tolerálják az intestinalis Clostridium botulinum fertızést, bár közülük néhány klinikai tüneteket mutat /OHISHI és mtsai., 1979/ Madár-botulizmus Történet, elıfordulás A kacsákat és egyéb vízimadarakat érintı botulizmus évenkénti kitöréseirıl az 1900-as évek elsı felétıl kezdıdıen jelentek meg publikációk, melyek Kanada és az Egyesült Államok nyugati államainak vizes élıhelyein fordultak elı /HOBMAIER, 1932/. A megbetegedés akkoriban nyugati kacsa-betegség néven volt ismert, melyrıl úgy gondolták, hogy nagy koncentrációban jelen levı lúgos sók által kiváltott vegyi toxikózis. A betegség etiológiája csak az elsı leírások után 20 évvel tisztázódott. Észak-Amerikán kívül a vadmadarakat érintı elsı megbetegedésekrıl 1934-ben Ausztráliából /PULLAR, 1934/, 1957-ben a Szovjetúnióból /KUZNETZOV, 1992/, majd 1963-ban Svédországból /JENSEN PRICE, 1987/, röviddel késıbb pedig Dániából (1965), Nagy-Britanniából (1969) és Hollandiából (1970) számoltak be. 28

29 Megerısített eseteket jelentettek Dél-Afrikából (1965), Új-Zélandról (1971), Japánból (1973), Argentínából (1979) és Brazíliából is (1981). Mára a C típusú botulizmust a világ legkevesebb 28 országában, az Antarktisz kivételével minden földrészen diagnosztizálták /ROCKE, 2006/. Ezek a kitörések gyakran több százezer, esetenként egy millió madár életét követelték (3. táblázat). 3. táblázat. Az egyednél nagyobb mértékő elhullással járó, C típusú madárbotulizmus kitörések (ROCKE /2006/ nyomán). Helyszín Idıpont Becsült elhullás Utah és Kalifornia, USA 1910 > Malheur-tó, Oregon, USA Nagy Sós-tó, Utah, USA Tulare-medence, Kalifornia, USA Tule-tó, Kalifornia, USA Kalifornia, USA Montana, USA Nagy Sós-tó, Utah, USA Kaszpi-tenger, az egykori Szovjetúnió Pakowki-tó, Alberta, Kanada Whitewater-tó, Manitoba, Kanada Old Wives-tó, Saskatchewan, Kanada Nagy Sós-tó, Utah, USA Kóroktan, járványtan A botulizmus által megbetegített madárfajok száma igen nagy: KALMBACH és GUNDERSON /1934/ 69 fajt sorolnak fel, amelyek 21 rendszertani családba tartoznak, ROCKE /2006/ azonban már 264 fajról és 39 családról tesz említést, melyek közül 22-ben találhatók vízimadarak. Legérzékenyebbek a kacsafélék (Anatidae), az érintett, hazánkban is honos fajok közül a nyílfarkú réce, böjti réce, tıkés réce, kanalas réce említhetı meg, de érzékenyek a sirályok, szárcsák, gulipánok, kormoránok is /BARTHA SZTOJKOV, 1978/. A londoni, St. James s Park-beli kitörésben, melynek során több mint 400 madár pusztult el, a megbetegedés legalább 21 fajt, fıleg kacsákat érintett /KEYMER és mtsai., 1972/. REILLY és BOROFF a témában mérföldkınek számító, 1967-ben lefolytatott kísérleteik során igazolták, hogy a vízimadarak botulizmusának fı kórokozója a C típusú Clostridium botulinum C 1 toxin-termelı C α szubtípusa, bár a Michigan-tó partján 29

30 élı vöcskök és sirályok botulizmusáért E típusú kórokozó volt felelıs, pelikánokban pedig D típusú baktérium okozta megbetegedésekrıl számoltak be. Bár a botulizmus nem fertızı eredető betegség, lefolyása nagyban hasonlít azokéhoz. Ebben nagy szerepet játszanak az érintett területen található, toxintartalmú madártetemek, illetve azok a megbetegedett, legyengült egyedek, amelyek csipkedésével a még egészséges madarak szintén toxint vehetnek fel (bıvebben lásd a és a fejezetben) Kórfejlıdés, tünetek Amint az a 2.4. fejezetben részletesen olvasható, a megbetegedést a szájon át felvett toxin okozza, a neuromuszkuláris szinapszisokban gátolva az acetil-kolin felszabadulását. Ebbıl fakadóan a madár-botulizmus legjellemzıbb tünete a mozgásképtelenség; az állatok szárnya lóg, fejüket jellegzetesen, petyhüdten tartják (limberneck vagy limp neck (puha nyak); 2. kép), erıs könnyezés tapasztalható, a pislogóhártya bénult, rendellenes pupillamozgások figyelhetık meg, a kloáka nyílásából nagy mennyiségő, vízszerő ürülék távozik /BARTHA SZTOJKOV, 1978/. 2. kép. Limberneck vagy limp neck a madár-botulizmus egyik jellegzetes tünete (LEIGHTON /2000/; fotó: WOBESER). 30

31 KURAZONO és mtsai. /1987/ kísérletileg bizonyították, hogy csirkékben és fácánokban az egyes toxintípusok közül kizárólag C 2 okoz folyadék-felhalmozódást és nyálkahártya-elhalásokat a bélben, ezzel nagymértékben elısegítve a hasmenés kialakulását Kórbonctan, kórjelzés A madár-botulizmusban elhullott madarak kórboncolása során szerzett hazai és nemzetközi tapasztalatok egybevágnak a tekintetben, hogy a heveny szívgyengeségre utaló nagyvérköri pangáson kívül elváltozást általában nem lehet megállapítani ( fejezet). A parenchymás szervek, valamint a központi idegrendszer kórszövettani vizsgálata szintén negatív eredményre vezet /BARTHA SZTOJKOV, 1978/. A megbetegedés kórjelzésének jelenlegi egyetlen elfogadott módszere a toxinkimutatás, amelyet egyéb, molekuláris biológiai illetve immunológiai alapú vizsgálatokkal lehet kiegészíteni (2.6. fejezet) Gyógykezelés, megelızés A megbetegedett madarak kezelésében az elveszített folyadék pótlása kulcsfontosságú. Az állatok ugyanis részben az izombénulásból fakadó nyelési nehézség, részben a hasmenés folytán igen gyorsan kiszáradnak. Ebbıl következıen vérük koncentráltabbá válik, ez pedig szívbénuláshoz, s a madarak elhullásához vezet /BARTHA SZTOJKOV, 1978/. A hazai tapasztalatok alapján, a kondíció javítására, az ivóvízzel mindenképp érdemes fehérjekoncentrátumot adni, amelyet késıbb már darabos táplálékkal is ki lehet váltani ( fejezet). Tenyésztett állományokban, megelızés céljából hazánkban is használják az eredetileg nyércek immunizálására kifejlesztett, C illetve D típusú toxoidot tartalmazó vakcinát (Botumink, USA). Ennek alkalmazásakor azonban figyelembe kell venni, hogy az állatokat két ízben kell beoltani a szükséges védettség kialakulásához. Könnyen belátható, hogy a gyakran hatalmas, nyílt területeken, nagy számban élı vadmadarak ily módon történı védelme a finanszírozás nehézségei mellett gyakorlatilag is kivitelezhetetlen. 31

32 Humán kórtani jelentıség Amint az a fejezetben már említésre került, a C típusú botulizmus humán kórtani jelentısége ellentétben más (A, B, E, F) toxintípusokéval igen csekély. Ezt a kijelentést az a tény is bizonyítja, hogy napjainkig mindössze egyetlen, toxinkimutatással is megerısített eset került publikálásra /OGUMA és mtsai., 1990/, amelyben a C típus szerepe volt igazolható Környezeti faktorok szerepe a madár-botulizmus megbetegedésekben Ahhoz, hogy egy adott élıhelyen madár-botulizmus kitörések forduljanak elı, számos elıfeltételnek kell teljesülnie. Az ebben a témakörben végzett vizsgálatok jó néhány ilyen faktor szerepét erısítették meg, vagy vetették el. A jelenleg ismert elképzelések három fı elméletre vezethetık vissza: 1) az ún. iszapágy-elmélet szerint a nyári, csapadékszegény idıszakban a tavak vízszintje lecsökken, így a víz könnyebben átmelegszik. A felmelegedı, oxigénszegény víz és a bomló vízi növényzetbıl származó szerves anyag kedvezı feltételeket teremt a spórák kicsírázásához és a vegetatív alakok toxintermeléséhez, mely tömeges vízimadár-pusztulásokhoz vezet /HAAGSMA és mtsai., 1972/; 2) tavaszi áradások alkalmával az elárasztott terület víz alá került növényzete, ezek és az elpusztult állatok bomlásából következı anaerob körülmények, illetve az iszapban vagy a kérdéses területen elıforduló spórák jelentik a kitörések forrását, a spóra-hordozóként szereplı talajlakó, vagy talajjal táplálkozó élılények mellett / mikrokörnyezet-elmélet ; BELL és mtsai., 1955/; 3) a talajból felvett spóra a madarak bélcsatornájába kerül, s azok bármilyen okból történı pusztulását követıen kicsírázik, a dögökben, mint fertızési forrásokban nagy mennyiségő toxint termelve. Ebben az esetben ellentétben az elızı kettıvel a spóráknak nem kell jelen lenniük a helyszínen, hiszen azokat a madarak testükben vagy ürülékükkel szállítják a kitörés helyszínére. Részben ezzel magyarázható madár-botulizmus fellépése olyan területeken is, ahol korábban efféle megbetegedésekre nem volt példa / madártetem-elmélet ; ROSEN, 1971; SMITH és mtsai., 1975/. 32

33 Jól látható, hogy az elméletek a környezeti igények tekintetében nem különböznek ez érthetı is, hiszen a kórokozó fejlıdése (és ezzel együtt toxintemelése) elengedhetetlen a megbetegedések létrejötte szempontjából. A kitörések kialakulásában valószínősíthetıen szerepet játszó egyéb faktorokról a 3. ábra tájékoztat. 3. ábra. A madár-botulizmus kitörések kialakulására ható biotikus és abiotikus környezeti tényezık (WESTPHAL /1991/ nyomán, módosítva). 33

34 Ezzel együtt érdemes felhívni a figyelmet arra az érdekes tényre, hogy megbetegedések olyan esetekben is elıfordulnak, amikor ezt a környezeti feltételek alapján egyáltalán nem várnánk, és elmaradhatnak e faktorok legoptimálisabb megléte esetén is /ROCKE és mtsai., 1999/. A vízhımérséklet, ph, sótartalom, redoxpotenciál és gerinctelen biomassza befolyásolja a madár-botulizmus fellépését /ROCKE és mtsai., 1999; ROCKE SAMUEL, 1999/, de néhány faktor nem különbözik következetesen a kitörések által érintett és az azoktól mentes élıhelyeken /ROCKE és mtsai., 1999/, így más, eddig ismeretlen tényezık szerepével is számolni kell. Amint azt WOBESER /1987/ kiemelte, nincs a környezeti tényezıknek olyan egyszerő együttállása, ami az összes kitöréssel összefüggésbe hozható, de meghatározta azt az öt feltételt, amely ebbıl a szempontból kulcsfontosságú. Ezek a spórák megléte, a Clostridium botulinum szaporodásához szükséges környezeti feltételek, a baktériumok specifikus bakteriofággal történı fertızıdése, a lehetséges áldozat toxinfelvétele illetve a baktériumok és a toxin megfelelı vektorok által történı szétterjesztése. A továbbiakban e faktorok részletesebb bemutatása következik Spórák MEYER és DUBOVSKY /1922/ úttörı jelentıségő, a Clostridium botulinum különféle toxintípusú törzseinek kimutatását célzó talajtani vizsgálatait késıbb számtalan másik követte, s ezek végkövetkeztetései mind-mind arra mutattak, hogy a C típusú Clostridium botulinum világszerte elterjedt a különféle vizes élıhelyeken (4. táblázat). Ezt a baktérium spóraképzı tulajdonsága nagyban elısegíti, amely formában védett körülmények között akár a szél, akár a madarak közvetítésével nagy távolságokat tehet meg, újabb területeket kolonizálva /lásd madártetem-elmélet : ROSEN, 1971; SMITH és mtsai., 1975/. A Clostridium botulinum spóraképzésre nagymértékben hajlamos. Spórái ovoid alakúak, rendszerint szubterminálisak, ritkábban centrálisak, viszont a spóraérés idıszakában terminálisak. Méretük 0,6-1,0 x 1,2-1,4 µm között váltakozik /SEGNER - SCHMIDT, 1971/ (3. kép). Egyes törzsek spórái (például az E, a nem proteolitikus B és F típusú spórák) rendelkeznek exospóriummal, míg mások (ilyenek az A, a proteolitikus B, C, D és F típusú törzsek spórái) nem. Az E típusú spórák felületén jellegzetes függelékek is megfigyelhetık. 34

35 Ellenállnak a sugárzásnak, az UV fénynek, az alkoholoknak, fenolnak és a kvaterner ammóniavegyületeknek; viszonylag érzékenyek a hipokloritokra, az etilén-oxidra és a formaldehidre /SMITH, 1987/. 3. kép. A típusú Clostridium botulinum sejt hosszmetszete, a benne fejlıdı spórával. (A C típusú spórák nem rendelkeznek exospóriummal ( E ill. nyilak)). CY : citoplazma; OC : külsı spóraköpeny; IC : belsı spóraköpeny; CX : kortex. A segédvonal hossza 0,2 µm (STEVENSON VAUGHN, 1972). Érdekes módon a C 2 toxin termelése kizárólag a sporuláció idején figyelhetı meg, s a legmagasabb toxintiter a legtöbb spórát képzı tenyészetekben mérhetı /NAKAMURA és mtsai., 1978/. A toxint a spóraköpenybıl vonták ki, ami azt sugallja, hogy az talán része a spóra struktúrfehérjéinek /YAMAKAWA és mtsai., 1983/. A feldolgozott hazai és nemzetközi irodalom alapján a spóraképzés és a toxintermelés összefüggései tárgykörében egyéb publikációk nem láttak napvilágot, bár a téma érdekessége további kutatásokat tenne indokolttá. A spórás formájú baktérium negatív környezeti hatásokkal szembeni nagyfokú ellenálló képességét bizonyítja SEGNER és SCHMIDT /1971/ kísérlete is, melyben a szerzık tengeri és szárazföldi eredető, C típusú Clostridium botulinum spórák hıtőrését vizsgálták. Eredményeikbıl kitőnik, hogy a szárazföldi törzsek hıtőrése nagyobb, mint tengeri társaiké : az elıbbi csoport tagjai között 1,0 percig tartó, 120 C-os hıkezelést követıen is maradtak túlélık, míg az utóbbiak csak 1,2 percig tartó, 104 C-os hıkezelést voltak képesek elviselni. Általánosságban elmondható, hogy a szárazföldi és 35

36 a tengeri C típusú törzsek hıtőrésének mértéke az A, a proteolitikus B illetve az E típusú spóráké között helyezkedik el. 4. táblázat. A Clostridium botulinum C típusának vizes élıhelyek talajában történı elıfordulása (WOBESER és mtsai. /1987/ nyomán, módosítva). Helyszín A vizes élıhely típusa Pozitív (toxintartalmú) / össz mintaszám Hivatkozás Botswana Édesvíz 1 / 8 SMITH /1982/ Anglia London Édesvíz 12 / 69 SMITH - MORYSON /1975/ Norfolk Broads Nem meghatározott sótartalom 23 / 45 BORLAND és mtsai. /1977/ Különféle Édes- és sós víz 14 / 379 SMITH és mtsai. /1982/ Mersey Estuary Brakkvíz 19 / 98 WOBESER és mtsai. /1987/ Franciaország Camargue Édesvíz 0 / 44 SMITH - MORYSON /1977/ Hollandia Édesvíz (botulizmusos terület) 184 /237 WOBESER és mtsai. /1987/ Édesvíz (nem botulizmusos terület) 6 / 141 WOBESER és mtsai. /1987/ Indonézia Édesvíz 1 / 50 HAQ - SUKADI /1981/ Sós víz 2 / 46 HAQ - SUKADI /1981/ Írország Édes- és sós víz 0 / 55 SMITH és mtsai. /1978/ Japán Édesvíz 129 / 230 SERIKAWA és mtsai. /1977/ Nakagawa folyó "Iszap" 42 / 108 ITOH és mtsai. /1978/ Mauritius Édesvíz 5 / 17 SMITH /1982/ Nigéria Édesvíz 5 / 18 SMITH /1982/ Skócia Edinburgh Édesvíz 0 / 7 SMITH - MORYSON /1975/ Különféle Édes- és sós víz 2 / 77 SMITH és mtsai. /1978/ Egyesült Államok Kalifornia, É-Dakota Nem meghatározott sótartalom (nem botulizmusos terület) 5 /4* WILLIAMSON és mtsai. /1999/ Florida Foszfátbánya-tavak 26 / 467 MARION és mtsai. /1983/ Wales Édes- és sós víz 2 / 43 SMITH és mtsai. /1978/ Ausztria Sós víz 121 / 90* ZECHMEISTER és mtsai. /2005/ *Toxinkimutatás helyett a toxintermelés génjének kimutatása. A kimutatási technika eltérései ellenére HAAGSMA /1973/, SMITH MORYSON /1975/ és WOBESER és mtsai. /1987/ eredményei megegyeznek abban, hogy a Clostridium botulinum C típusának elıfordulási aránya a botulizmusos illetve nem botulizmusos vizes élıhelyek talajában 11-17:1 (5,9-9,1%) /WOBESER és mtsai., 1987/. Más tanulmányok alapján (lásd 4. táblázat) általánosságban elmondható, hogy a nem botulizmusos területekrıl származó minták 1-5%-a pozitív C típusú spórák jelenlétére nézve. A talaj és az iszap kémiai és biológiai természete szükségszerően sokféle, s MEYER /1956/ hangsúlyozta, hogy a Clostridium botulinum kimutatásának esetleges 36

37 sikertelensége nem bizonyítja az organizmus hiányát amely kijelentés a hagyományos módszerek esetében a mai napig helytálló. MEYER /1956/ szerint a C, D, E típusok kimutatásának kudarca a korai kutatásokban valószínőleg a minták elızetes túlmelegítésének következménye volt. Úgy gondolta, hogy ıt is egy kivételesen nagy véletlen segítette a kaliforniai mintáiból kimutatott 30%-os eredményhez. WOBESER és mtsai. /1987/ szerint a toxin kimutatásának esetleges negatív volta szintén nem bizonyítja, hogy a baktérium nincs jelen egy adott élıhelyen. WOBESER és mtsai. /1987/ hangsúlyozzák, hogy kísérleteikben 10-bıl 8 minta bizonyult pozitívnak olyan mocsarak vizsgálata során, melyek néhány éve kiszáradtak, egy pedig olyan élıhelyrıl származott, ahol már 11 éve nem tapasztaltak madárbotulizmust. Összefoglalva tehát a C típusú Clostridium botulinum spórák széles körő elterjedtsége és nagyfokú ellenálló képessége a kitörések szempontjából veszélyeztetetté tesz minden olyan vizes élıhelyet, ahol valaha madár-botulizmus fordult elı, azonban megfelelı feltételek mellett lehetıvé teszi a madarak megbetegedését olyan területeken is, ahonnan korábban még nem jelentettek ilyen eseteket A C típusú Clostridium botulinum szaporodásának környezeti feltételei Levegı- és vízhımérséklet Mivel a C típusú Clostridium botulinum szaporodásának alsó határa 15 C /KEYMER és mtsai., 1972/, optimuma pedig C között van /POPOFF, 1995/, a kellıen magas levegı- és vízhımérséklet elengedhetetlenül fontos a baktérium szaporodása és toxinképzése szempontjából. A felmelegedı víz oxigénszegénnyé válik (lásd késıbb), amely további kedvezı feltételeket teremt a kórokozó fejlıdése szempontjából (anaerob körülmények, halpusztulás /CSABA, 1996/). Sok esetben feltőnı korreláció tapasztalható a madár-botulizmus kitörések és a forró, száraz nyarak, illetve tartósan magas hımérséklető periódusok között /pl. PULLAR, 1934; LEHOCZKINÉ, 1959; BLAKER, 1967; FEILER KÖHLER, 1977; ONO és mtsai., 1982; HÄLTERLEIN HEINZE, 1983; REICHHOLF, 1983; GRÜLL és mtsai., 1987; HAAGSMA, 1987; NIESS, 1987; SMITH, 1987/. Az elsı esetek mindig egy forró idıszak alatt vagy közvetlenül utána jelentkeznek, de a további történésekre az alacsony levegıhımérséklet (a késı ıszi megbetegedések kivételével) már nincs gátló 37

38 hatással /FEILER KÖHLER, 1977; HÄLTERLEIN HEINZE, 1983; REICHHOLF, 1983; GRÜLL és mtsai., 1987/. A legnagyobb mortalitás általában július és szeptember hónapok között figyelhetı meg /WESTPHAL, 1991/. Ha a napi átlagos vízhımérséklet 20 C, vagy annál magasabb, a madártetemekben 22,7- szer nagyobb valószínőséggel fejlıdnek toxintartalmú légyálcák, mint 20 C alatt. A növekvı vízhımérséklettel a lárvák fejlıdése szignifikánsan felgyorsul, s így hamarabb válnak elérhetıvé a még egészséges madarak számára /SOOS WOBESER, 2006/. Ezek fényében zavarba ejtı lehet a megbetegedések késı ıszi, téli vagy kora tavaszi jelentkezése, hiszen ilyen esetekben a környezeti jellemzık látszólag teljesen ellentmondanak a nyári periódusokban tapasztalhatókénak. A megoldás a toxin áttelelésében keresendı: HUBÁLEK és HALOUZKA /1988/ kísérletei során a toxin +5 C-on 6 hónap után, míg -20 C-on több mint 5 év után érte el a 99%-os inaktiválódási határt. GRAHAM és SMITH /1978/ májusától, félig természetes körülmények között inkubált C típusú Clostridium botulinum tartalmú iszapmintáiban a toxin 344 nap múltán, egy teljes téli periódust átvészelve is stabil maradt. A toxin téli rezervoárjaiként különféle gerinctelenek, többek között egyes légy fajok (Lucilia sericata, Calliphora vomitoria, Fannia canicularis, Phaenicia sericata, Lucilia illustris) és redıs szúnyogok (Ptychopteridae) lárvái, pióca fajok (Hirundinidae) és a közönséges víziászka (Asellus aquaticus), említhetık meg /HUBÁLEK HALOUZKA, 1991/. Hasonló késı ıszi - téli - kora tavaszi toxinforrást jelentenek a botulizmusban elpusztult madarak tetemei, részben a szöveteikben feldúsult toxin, részben a tetemekben védett körülményekre lelı légyálcák okán, melyekrıl közismert, hogy igen nagy mennyiségő toxint képesek felhalmozni /WOBESER és mtsai., 1983/. A légyálcák megfelelı körülmények között, diapauzált prepupális lárvákként akár C-on is áttelelhetnek /DAVIES, 1929; RING, 1972; BLOCK és mtsai., 1988/. A vízben elpusztult madarak tetemeibıl kifejlıdı nyüvek lesüllyedve az iszapban hosszú ideig közel érintetlenül fennmaradhatnak (131 nap; novembertıl márciusig), s tíz ilyen lárva elegendı toxint tartalmaz ahhoz, hogy tavasszal elpusztítson egy madarat /HUBÁLEK HALOUZKA, 1991/. Ezt a lehetıséget támasztják alá azok a megfigyelések is, melyek szerint a tavaszi kitörésekben megbetegedett fajok az ún. bukó récékhez tartoznak (búbos réce - Aythya affinis, kontyos réce - Aythya fuligula), amelyek az iszapból szerzik táplálékukat /HUBÁLEK HALOUZKA, 1988; WOBESER és mtsai., 1983/. 38

39 Azt a korábban általánosan elfogadott elméletet, amely szerint a légyálcák toxicitása a bebábozódással megszőnik /HAAGSMA és mtsai., 1972; DUNCAN JENSEN, 1976; WOBESER és mtsai., 1983/, HUBÁLEK és HALOUZKA /1991/ egy ben bekövetkezett kitörés vizsgálata során sikeresen cáfolta meg. A hővösebb periódusokban elıforduló megbetegedések további kiváltó oka lehet a hıszennyezés, például atomerımővek hőtıvizének természetes vizekbe történı kijuttatása /KÖHLER és mtsai., 1977; HAAGSMA, 1987/. Mivel ezek a területek télen is jégmentesek, ott nem ritkán nagy tömegben győlnek össze különbözı fajú vízimadarak Szervesanyag-tartalom Az egyes vizes élıhelyeken különféle okokból felszaporodó bomló növényi vagy állati szervezetek bıséges tápanyagforrást, e mellett védett, anaerob rezervoárt jelentenek a Clostridium botulinum számára. Madár-botulizmus kitörések helyszínein gyakran tapasztalható a szokottnál magasabb szervesanyag-tartalom /ROCKE SAMUEL, 1999; KÖHLER és mtsai., 1977; BARTHA SZTOJKOV, 1978/, amely többek között származhat hal- és madárpusztulásból /BALL és mtsai., 1998/, mélyebben fekvı területek növényzetének nagyobb esızések vagy hóolvadás következtében történı elöntésébıl /BARTHA SZTOJKOV, 1978/ illetve humán tevékenységbıl is (pl. elégtelenül tisztított szennyvíz bevezetése /WESTPHAL, 1991/, vízszintszabályozás /ROCKE és mtsai., 1999; SANDLER és mtsai., 1993/, vadásztavak létesítése /BARTHA SZTOJKOV, 1978/) ph, redoxpotenciál, sótartalom (vezetıképesség), oldott oxigén-szint Bár SEGNER és mtsai. /1971b/ úgy találták, a C típusú Clostridium botulinum szárazföldi törzsei még 5,62-es ph-jú közegben is képesek voltak szaporodni, a baktériumokról általánosan elmondható, hogy szaporodási ph optimumuk a semleges, vagy gyengén lúgos tartományokba esik. Ezt támasztják alá BARTHA és SZTOJKOV /1978/ megfigyelései is, akik nagyszámú irodalmi adatra hivatkozva jelentik ki: a megbetegedések által érintett területeken a víz kémhatása rendszerint lúgos. ROCKE és SAMUEL /1999/ 32, botulizmusos és nem botulizmusos vizes élıhely-párt összehasonlítva arra a következtetésre jutott, hogy nı a botulizmus kialakulásának 39

40 veszélye, ha a víz ph-ja 7,5 és 9,0 közötti, a redoxpotenciál negatív és a vízhımérséklet 20 C-nál magasabb. A kockázat csökken, ha a redoxpotenciál nı (+100 mv feletti), a vízhımérséklet C, a ph 7,5-nél alacsonyabb vagy 9,0-nél magasabb, a sótartalom pedig kisebb, mint 2,0 ppt. Ennek ellenére madár-botulizmus megbetegedések az átlagosnál magasabb sótartalmú élıhelyeken is elıfordulhatnak /GRÜLL és mtsai., 1987; ZECHMEISTER és mtsai., 2005/, s ezt mi sem bizonyítja jobban annál, mint hogy a C típusú Clostridium botulinum törzsek egy részét tengeri üledékbıl izolálták. A SEGNER és mtsai. /1971b/ által vizsgált szárazföldi és tengeri eredető, C típusú Clostridium botulinum törzsek maximális sótőrése igen magas, sorrendben 2%-os (2,0x10 7 ppt) illetve 2,5%-os (2,5x10 7 ppt) értéket mutatott. WOBESER és mtsai. /1987/ úgy találták, hogy azok az élıhelyek, ahonnan sikerült C típusú botulinum toxint kimutatni, magasabb sótartalmúak voltak (átl. vezetıképesség = 3463 ± 4108 µs/cm), mint azok, amelyek a toxin jelenlétére negatívnak bizonyultak (átl. vezetıképesség = 1799 ± 1280 µs/cm), bár a különbség nem volt szignifikáns júliusában 14 botulizmusos területet megmintázva az átlagos vezetıképesség 2670 µs/cm-nek adódott ( µs/cm) /WOBESER, 1988/. SHAW 1929-ben számolt be arról, hogy a botulizmusban megbetegedett madarak plazma-klorid szintje megemelkedik. COOCH /1964/ feltevése szerint a sós vizet ivó állatok a botulinum toxin szubletális dózisától pusztulnak el, a sómirigy nem megfelelı mőködése, ebbıl következıen pedig a plazma ozmolaritásának szabályozási képtelensége miatt. Az elmélet ésszerőnek tőnik annak fényében, hogy a madarak sómirigyét az acetil-kolin stimulálja /HOKIN HOKIN, 1959/, a botulinum toxin pedig gátolja az acetil-kolin felszabadulását /SIMPSON, 1984/. Ebbıl kiindulva WOBESER /1988/ botulinum toxinnal fertızött madarakkal botulizmusos területeken mért vezetıképességő ( µs/cm) vízmintákat itatva vizsgálta a sós víz és a botulizmus tüneteinek súlyossága közti kapcsolatot. Bár az eredmények alapján relatíve kicsi additív vagy szinergista hatást figyelt meg, a toxin-sómirigy kapcsolatot mégsem tartja elvetendınek. A ph-t tekintve ROCKE és SAMUEL /1999/ illetve SEGNER és mtsai. /1971b/ eredményeit támasztják alá WOBESER és mtsai. /1987/ megfigyelései is. A szerzık által mért legalacsonyabb, 6-os ph-val 6 élıhely rendelkezett, melyek közül 4-ben 40

41 mutatták ki a Clostridium botulinum C típusú toxinját, míg a toxin-pozitív területeken mért legmagasabb ph 9-nek adódott. Ezzel együtt ROCKE és mtsai. /1999/ nem tapasztaltak jelentıs eltérést botulizmusos és nem botulizmusos területeken illetve idıszakokban mért iszap és víz ph-értékek között. Bár a Clostridium botulinum obligát anaerob faj, s így joggal hihetnénk, hogy egy alacsonyabb redoxpotenciálú közegben gyorsabb szaporodásra képes, in vitro kísérletek alapján /SMOOT PIERSON, 1979/ úgy tőnik, oxigénmentes környezetben a redoxpotenciál magában nem, csak más faktorokkal (pl. sótartalom, ph) együttesen hathat limitáló tényezıként a baktérium szaporodására. ROCKE és mtsai. /1999/ úgy gondolják, a madár-botulizmus kitörések és a redoxpotenciál között talán indirekt kapcsolat áll fenn, a vizes élıhelyeken elıforduló egyéb mikrobák kompetitív, vagy akár szinergista viselkedésének köszönhetıen. Az 1970-es évek elején felerısödı madár-botulizmus esetek gyakran az emberi hatásra kialakuló vízterhelésre, -szennyezésre is visszavezethetık. A Clostridium botulinum szaporodásához oxigénszegény és tápanyagban gazdag környezetre van szükség, ez pedig az eutrofizált vizekre nagyon jellemzı. Ennek fényében nem meglepı, hogy Közép-Európában a madár-botulizmus kitörések korrelálnak az erıs eutrofizációval /WESTPHAL, 1991/. Úgy gondolhatnánk, a víz oldott oxigén-tartalma a megbetegedések során minden esetben csökken, néhány alkalommal azonban a mérések épp ennek ellenkezıjét bizonyították: KEYMER és mtsai. /1972/ illetve MARION és kollégái /1983/ botulizmusos területeket megmintázva a víz oxigén-ellátottságát megfelelınek találták. Ennek fényében kérdésessé vált, hogy az oldott oxigén-tartalom csökkenése magában növeli a megbetegedések kockázatát Gerinctelen biomassza ROCKE és mtsai. /1999/ kitöréses területeken, illetve a megbetegedések idıszakában nagyobb mennyiségő totál és iszaplakó gerinctelen biomasszát mértek, mint a botulizmus által nem érintett területeken vagy idıszakokban, s úgy találták, hogy ez a faktor kedvez a madár-botulizmus megbetegedéseknek. Korábbi megfigyelések, melyek szerint az iszapban élı gerinctelenek populációs csúcsát követı, valószínőleg az oxigénhiány következtében bekövetkezı hirtelen pusztulása megfelelı szubsztrátot 41

42 teremtett a bakteriális szaporodás, majd a toxinképzés számára, szintén megerısíteni látszanak e kijelentést /JENSEN ALLEN, 1960/ Egyéb mikroorganizmusok gátló hatása A C típusú Clostridium botulinum új élıhelyeken történı kolonizációját és további populációdinamikáját különféle gátló hatású mikroszervezetek jelenléte is befolyásolhatja /MOULTON és mtsai., 1976/. GRAHAM /1978/ 105 iszapmintát inokulált C típusú Clostridium botulinum baktériumokkal, s 28 napos inkubálást követıen a minták több mint 50%-ából sikertelenül próbálta visszaizolálni azokat. Ezekbıl a mintákból különbözı Bacillus-fajokat tenyésztett ki, amelyek in vitro körülmények között bakteriocin-termelınek bizonyultak a baktérium C típusával szemben. SANDLER és mtsai. /1998/ különféle vizes élıhelyekrıl származó 1600 üledékminta 32%-ából izoláltak aerob (élıhelyenként átlagosan 12%), illetve fakultatív vagy obligát anaerob mikroorganizmusokat (élıhelyenként átlagosan 23%), köztük Bacillus-, Streptococcus-, Clostridium-fajokat és sugárgombákat. Ezzel együtt a szerzık úgy vélik, hogy az általuk megmintázott területeken a szaporodást gátló mikrobák nem befolyásolták szignifikánsan a Clostridium botulinum populációkat Fágok Bár fágokat a Clostridium botulinum négy csoportja közül háromban (I-III.; lásd 1. táblázat) azonosítottak, a toxintermeléssel csak a III. csoportban hozhatók összefüggésbe /EKLUND és mtsai., 1989; SUNAGAWA INOUE, 1992/. A C és D típusú Clostridium botulinum toxintermelése specifikus, pszeudolizogén, konvertáló (átalakító) bakteriofágok jelenlétéhez kötött (4. ábra, 4. kép) /EKLUND és mtsai., 1971; EKLUND és mtsai., 1972; INOUE IIDA, 1970; INOUE IIDA, 1971/. Mivel a madár-botulizmus megbetegedések kialakulásában a toxin szerepe kulcsfontosságú, a toxinogenezist kiváltó bakteriofágok szerepe hasonlóan jelentıs. Pszeudolizogén (más néven instabil lizogén) fágok esetében a gazda-fág kapcsolat instabil, és a fág könnyen eltőnik a gazdasejtbıl. A fág - gyakran spontán - elvesztése egyben a toxintermelı képesség elvesztését is jelenti, de egyben érzékenyebbé is teszi a baktériumot az esetleges újrafertızıdésre. Toxintermelı törzsek passzálásával nyert, atoxikus Clostridium botulinum baktériumok fágokkal történı újrafertızése a toxinogén tulajdonság visszatérését eredményezi, 42

43 azonban bakteriofágok hiányában az atoxicitás stabil és permanens állapot. A fágvesztés in vitro körülmények között hıkezelés, ultraibolya-sugárzás, akridin-oranzs vagy fág-specifikus antiszérum hatására is bekövetkezik /EKLUND és mtsai., 1971; EKLUND és mtsai., 1972/. 4. ábra. A Clostridium fágok morfológiája. A C és D típusokkal a CEβ jelő faj rokonítható (ACKERMANN DUBOW /1987/ illetve ACKERMANN /1974/ nyomán, módosítva). Toxint nem termelı, Clostridium botulinum-hoz hasonló Clostridium-okat gyakran izolálnak a környezetbıl; toxintermelı kultúrák pedig laboratóriumban, különösen többszöri passzálást követıen, atoxikussá tudnak válni. Ezek a tapasztalatok egyaránt arra utalnak, hogy a fág nem kapcsolódik stabilan a gazda kromoszómájához. /HUNTER POXTON, 2002/ Érdekes módon, a C és D típusú Clostridium botulinum-törzsek között ún. interkonverzió is felléphet, melyet a természetben a pszeudolizogén állapot segíthet elı /EKLUND POYSKY, 1974; HUNTER POXTON, 2002/: az atoxikus törzseket a C és D típusú fágok egyaránt megfertızhetik. Ennek eredményeképp a C és D típusú törzsek háromféle toxint termelhetnek: C-t, C 2 -t és D-t. 43

44 4. kép. A Clostridium botulinum C és D típusának fágjai: 1) 3C tox+, 2) 4C tox+, 3) 1D tox+, 4) 2D tox X-os nagyítás. A segédvonal hossza 50 nm (EKLUND POYSKY, 1974). JANSEN /1971/ számolt be arról, hogy egy C α típusú törzs C, C 2 és D típusú toxint termelt, míg egy C β típusú törzs csak C 2 -t, egy D típusú törzs pedig C és D típusú toxinokat. Késıbb kimutatták, hogy néhány D típusú törzs C 2 toxint is képes szintetizálni /EKLUND POYSKY, 1972/. A jelenség molekuláris biológiai hátterét MORIISHI és mtsai. /1996a, 1996b/ vizsgálták, míg a C típusú fág genomját és a pszeudolizogenitás molekuláris mechanizmusát SAKAGUCHI és kollégái /2005/ térképezték fel. TAKEDA és kutatócsoportja /2005/ madár-botulizmus esetek kapcsán izolált Clostridium botulinum törzsek neurotoxin-génjének elemzése során arra a 44

45 megállapításra jutott, amely szerint az kétharmad részben a C típusú, míg egyharmad részben a D típusú neurotoxin génjébıl épül fel ban HAUSER és mtsai. bebizonyították, hogy a C 3 toxin termelésének génje is egyaránt megtalálható a C és D típusú fágokon. HARIHARAN és MITCHELL /1976/ szerint az egyes C típusú Clostridium botulinum törzsek toxigenitásában fellelhetı különbségek a fágok által indukált lízis eltérı mértékére vezethetık vissza, ennek teljessége viszont megfelelı környezeti feltételeket (hımérséket, ionkoncentráció, ph stb.) igényel. E kijelentés alapján, az egyes élıhelyeken vizsgált környezeti paraméterek szerepe még inkább felértékelıdik, hiszen a baktériumok mellett a bakteriofágok környezeti igényei is befolyásolhatják a madárbotulizmus megbetegedések elıfordulását és mértékét A lehetséges áldozat toxinfelvétele Ha a baktérium az iszapban is elkezd szaporodni, a toxin ott is feldúsulhat. A vízben, botulizmusban elpusztult madarak tetemébıl származó, a fenékre lesüllyedı légyálcák is magukkal vihetik, majd bomlásuk során szennyezhetik az iszapot a toxinnal. A madárdögök nagymértékben toxikussá váló szöveteibıl szintén kioldódhat a toxin az azokat körülvevı vízbe. HUBÁLEK és HALOUZKA /1991/ 8 LD 50 /ml toxinmennyiséget mértek egy olyan vízmintában, melyet egy madártetemtıl 1 méterre győjtöttek, azonban az 5 méterrıl, vagy annál távolabbról származó minták (víz, iszap és gerinctelenek) már nem tartalmaztak toxint. A toxin legfıbb forrását a légyálcák és egyéb gerinctelenek (pl. piócák, szúnyoglárvák, víziászkák) jelentik, amelyekre nézve a toxin hatástalan, így az nagymértékben dúsulhat fel bennük, egyebek mellett létrehozva az ún. tetem-lárva (carcass-maggot) ciklust illetve a késı ıszi téli kora tavaszi kitöréseket (lásd késıbb). A dögökbıl kifejlıdı légyálcák igen nagy veszélyt jelentenek az egyes madárpopulációkra nézve, hiszen azokat az állatok elıszeretettel fogyasztják (5., 6. kép). A helyzetet tovább súlyosbítja, hogy a megbetegedett, és így lelassult, elgyengült madarakat fajtársaik gyakran csipkedik, ezzel felvéve a véráramukba került toxint. 45

46 A baktériumok és a toxin szétterjesztése A kanadai Nicholson s sziget fácántartó telepén történt sorozatos kitörések kapcsán FISH és mtsai. /1967/ jegyezték meg, hogy ha az elpusztult madarakat nem győjtötték be idıben, hamarosan a szigeten igen gyakori Lucilia illustris lárvái fejlıdtek ki bennük, s nem ritkán további olyan madár tetemét találták körülöttük, amelyek ezeket a légyálcákat fogyasztották el a bennük felhalmozódott C típusú toxinnal együtt. 5. kép. Madár-botulizmusban elpusztult kacsa tetemén kifejlıdött légyálcák tömege a megbetegedés újabb forrásai (LEIGHTON /2000/; fotó: BOLLINGER). A fácánok csillapíthatatlan étvággyal csipegetik fel a lárvákat, otthagyva minden más táplálékot. Egy nap leforgása alatt egy fácán akár nyüvek százait is bekebelezheti, de ezek közül nem egészen tíz darab elegendı lehet egy madár elpusztításához /BOROFF REILLY, 1962/. A szerzık az eset helyszínérıl származó légyálcákat egészséges fácánokkal megetetve sikeresen hozták létre a botulizmus jellegzetes tüneteit. A madártetemeken található légyálcák akár egér LD 50 /g toxint is tartalmazhatnak /DUNCAN JENSEN, 1976/. A C típusú botulinum toxin vízimadarakra vonatkoztatott LD 50 értéke becslések szerint LD 50 /ttkg /ROCKE és mtsai., 2000/, így akár egyetlen toxikus légyálca elfogyasztása is végzetes következményekkel járhat. 46

47 A legtöbb vízimadár közvetlenül nem fogyaszt gerincesek tetemébıl, nem úgy a rajtuk kifejlıdı légyálcákból. Így a vízimadarak botulizmusa a tetem-lárva cikluson keresztül - gyakran válik önfenntartóvá, ismerve azt a tényt, hogy a toxikus lárvák játsszák a legnagyobb szerepet a hatalmas egyedszámot érintı madárpusztulások létrejöttében /WOBESER, 1997/. 6. kép. Az elfogyasztott toxin-tartalmú légyálcáktól elpusztult nyílfarkú récék. A képen látható lárvák 1g-ja egér elpusztítására képes (LEIGHTON /2000/; fotó: WOBESER). A tetem-lárva ciklust számos faktor befolyásolja, többek között a légy-sőrőség és környezeti feltételek, mint például a hımérséklet és a szélsebesség, melyek elısegítik a legyek peterakását, a lárvák fejlıdését és a tetemekbıl történı szétterjedését /REED ROCKE, 1992; WOBESER és mtsai., 1997/. Ezzel együtt, a legkritikusabb tényezı a toxinogén tetemek sőrősége olyan dögöké, amelyek Clostridium botulinum spórákat 47

48 tartalmaznak, s ezek vegetatív formává alakulva toxint termelnek /REED ROCKE, 1992/. DUNCAN és JENSEN /1976/ vizsgálatai alapján a lárvákkal borított madártetemek 85-90%-a tartalmazott toxikus légyálcákat, míg egy másik tanulmány szerint ez az arány 29-69% között változik /REED ROCKE, 1992/. Bár nem minden tetem válik lárvákkal fertızötté, vagy bocsát ki toxikus lárvákat, azok a tényezık, amelyek csökkentik a toxikus tetemek hozzáférhetıségét egy adott élıhelyen, úgymint a dögevı ragadozók jelenléte vagy a tetemek összegyőjtése, csökkenthetik a vízimadarak botulinum toxinnal szembeni kitettségét /ROCKE, 2006/. REED és ROCKE /1992/ szerint spórás formájú baktériumot hordozhat a vizes élıhelyeken fellelhetı élılények zöme, beleértve a gerincteleneket, például különféle vízi rovarokat, puhatestőeket és rákokat és sok gerincest, többek között madarakat és halakat. NOL és mtsai. /2004/ három egymást követı évben végzett vizsgálatai arra mutattak, hogy a botulizmus szempontjából endémiás, Dél-kaliforniai Salton Sea területén élı tilapia-k (Oreochromis mossambicus) béltartalma 1-9%-ban tartalmazta a C típusú botulinum toxin termeléséért felelıs gént. Kedvezıtlen környezeti feltételek mellett (például alacsony oldott oxigén-tartalom, kék- vagy zöldalga-virágzás) esetlegesen fellépı halpusztulások során a haltetemekben levı spórák könnyen fejlıdésnek indulhatnak, s a dögök a madártetemekhez hasonlóan nagy mennyiségő botulinum toxin forrásai lehetnek. SMITH és TURNER /1989/ azonos kiindulási mennyiségő, C típusú Clostridium botulinum spórát inkubáltak egér-, madár-és haltetemekben, azt vizsgálva, hogy az egyes gerinces fajok milyen mértékben képesek elısegíteni a baktériumok toxigenezisét. A legmagasabb toxintitert az egértetemekben mérték, majd a madár- és a haltetemek következtek. Ezzel együtt kísérletileg is bizonyították, hogy a haltetemek megfelelı rezervoárt jelenthetnek a botulizmus kórokozói számára. Bár a halakból közvetlen toxinkimutatás nem történt, mégis elgondolkodtató az a tény, amely szerint a hal- és (botulizmus kapcsán elıforduló) madárpusztulások a Kis-Balaton területén néha egy idıben jelentkeznek /CSABA, 1996/. Amint az korábban már említésre került, a madártetemek mellett a baktérium spóráinak egyes élıhelyek között történı átvitelével az élı egyedek is szerepet játszanak a C típusú Clostridium botulinum terjesztésében /ROSEN, 1971; SMITH és mtsai., 1975/. 48

49 Egyéb faktorok A melegebb idıszakokban egyes fonalas kékalga-fajok által okozott vízvirágzás és a madár-botulizmus kitörések közötti összefüggés számos kutatás tárgyát képezte. Az Erie- és Huron-tavon rendszeresen jelentkezı megbetegedésekkel egyidejőleg több ízben jelentettek Anabaena, Aphanizomenon és Microcystis-fajok által kiváltott masszív kékalga-virágzást /BRITTAIN és mtsai., 2000/. Egy londoni kitörés kapcsán az Oscillatoria agardhii kékalgafaj jelenlétérıl számoltak be KEYMER és mtsai. /1972/, melynek toxicitása madarakon nem igazolódott, egértoxikus volta azonban igen. KÖHLER és mtsai. /1977/ szintén kék algával túlszaporodott öblöket jelöltek meg az 1975-ös, Berlin környéki madárpusztulások helyszíneiként. MURPHY és mtsai. /2000/ mutattak rá arra, hogy bár a botulizmus és a toxikus kékalgák közti kapcsolat bizonytalan, a microcystin-termelı fajok érzékenyebbé tehetik a madarakat a megbetegedéssel szemben. A Kis-Balaton területén a korábban felsorolt fajok szintén képviseltetik magukat, gyakran okozva nyári vízvirágzásokat /MÁTYÁS, 1996/. WOO és mtsai. /2010/ egy 93 madarat érintı Dél-koreai kitörés során hét elhullott tıkés récébıl mutattak ki peszticideket (diazinont és forátot), két foltoscsırő récébıl (Anas poecilorhyncha) pedig madárinfluenza vírust, melyek szintén érzékenyíthették az állatokat. A növényvédı szerek a vízi élılények elpusztításán keresztül a szervesanyagtartalom emelkedéséhez is hozzájárulhattak, ezzel növelve a megbetegedés kialakulásának kockázatát. Nem nehéz belátni, hogy a madarak sőrősége szintén befolyásolhatja a madárbotulizmus kitörések létrejöttét és annak mértékét. Ha egy élıhely eltartó-képességét megközelíti, vagy meghaladja az ott fellelhetı madarak száma, a megbetegedés, járványszerő jellegébıl adódóan jóval könnyebben, gyorsabban és nagyobb mértékben tizedelheti meg a jelen lévı madárpopulációt. A több madár potenciálisan több madárdögöt is jelent, s bár a kitöréseket elindító elsıdleges szubsztrát máig ismeretlen, az általánosan elfogadott nézet szerint azt az elpusztult madarak tetemei jelentik /WESTPHAL, 1991; REED ROCKE, 1992; EVELSIZER, 2003; SOOS WOBESER, 2006/. Ezért a bármilyen okból elhullott madarak begyőjtése kulcsfontosságú a madár-botulizmus megbetegedések megelızése, vagy a fertızési lánc (tetem-lárva ciklus) megszakítása érdekében /SOOS WOBESER, 2006; EVELSIZER, és mtsai., 2010/. 49

50 Madár-botulizmus Magyarországon Bár hazánkban a botulizmus több más országgal ellentétben az intenzív tartású broilerekben nem okoz gondot, a természetes élıhelyeken élı, illetve ahhoz hasonló körülmények között tartott fácánok és vízimadarak esetében több ezres egyedszámot érintı pusztulásokat, s ezzel igen jelentıs gazdasági károkat idéz elı. Magyarországon a LEHOCZKINÉ által dokumentált elsı estet, amely 1959-ben, a Szeged környéki Fehér-tó természetvédelmi területen jelentkezett, az 1960-as évek elejétıl továbbiak követték. Ellentétben az irodalmi adatokkal, a megbetegedések nem vízi vadmadarak között, hanem halastavakon tartott házikacsa-állományokban fordultak elı. Erre az idıszakra esett egy új termelési ág, a halastavi kacsatenyésztés kezdete, amely tenyésztési forma Európában egyedülálló volt. Ez a tartási mód abban állt, hogy a vízfelület nagyságától függıen több ezer kacsa négyhetes korában kikerült a halastavakra, ahol a vízen úszó önetetıkbıl táplálkoztak, és gyakorlatilag csak éjszakára húzódtak ki a partra, vagyis a vadmadarakhoz igen hasonló körülmények között éltek. A kihelyezést kora tavasztól nyár végéig állandóan ismételték. A pozitívumokat az alacsony munkaerı- illetve állóeszköz-befektetésben látták, és abban bíztak, hogy a halak és a kacsák együttes tartása további kölcsönös elınyöket fog biztosítani. Valószínő, hogy az ilyen célra igénybe vett tavakon már akkoriban elıfordult a betegség a vadkacsák között, arányai azonban kisebbek voltak. A vadmadarak megbetegedésének felfedezése elmaradt, talán azért is, mert a szervezett környezet- és természetvédelemre korábban még nem fordítottak kellı figyelmet. Már az 1960-as években történtek vizsgálatok, amelyek a betegség kóreredetét kívánták tisztázni, azonban ezek nem jártak eredménnyel. Japán szerzık cikkeinek hatására felmerült a kék algák, illetve a kék-zöld algák toxinjának szerepe is, de a toxikológiai vizsgálatok ezt nem igazolták: a betegség jelentkezésekor az érintett tavakból vett víz- valamint iszapminták itatása, illetve megetetése egészséges állatokkal soha nem okozott mérgezést. Így a hazai szakmai nyelvben a tavi bénulás kifejezés terjedt el, ami a kóroktan pontos tisztázásáig a halastavakon tartott kacsák között elıforduló, jellegzetes klinikai képben megnyilvánuló betegséget jelölte. A megbetegedés kezdetben csak bizonyos körzetekben jelentkezett, nevezetesen a Tiszántúlon, majd az évek során lassan megjelent a Duna-Tisza közén és a Dunántúl néhány halastaván is. Azokon a tavakon, ahol elıfordult, azután gyakorta lépett fel, mindig nyár végén, augusztus-szeptember hónapban, de a melegebb nyarú években már 50

51 júliusban is. A veszteség egy-egy érintett állományban nem ritkán az 50%-ot is meghaladta /BARTHA SZTOJKOV, 1978/. Az elhullások megelızésére különféle gyakorlati módszereket próbáltak alkalmazni, mérsékelt sikerrel. Ezek egyike volt, hogy a vízfelületen motorcsónakkal jártak, a hullámzás fokozásával átlevegıztetve azt. Kísérleteztek azzal is, hogy a sekéllyé vált partszegélyt, ahol az alacsony vízmagasság miatt a víz felmelegedése különösen nagymértékő, kimélyítsék, a kacsák partra jutását pedig stégek kialakításával próbálták megkönnyíteni. Minthogy az eredmény legtöbbször elmaradt, a még egészséges egyedeket a partra kellett kihajtani, befogni, takarmánnyal és vízzel ellátni, ami több ezres állományok esetén nem könnyő feladat, különösen miután az állatok tetemes része már mozgásában korlátozott /BARTHA SZTOJKOV, 1978/. A továbbiakban ismertetésre kerülı hazai esetek kapcsán is érdemes megfigyelni, hogy a környezeti tényezık a korábban leírtakkal összhangban miként segítették elı a megbetegedések létrejöttét, illetve idı- és térbeli kiterjedését. A mai Kiskunsági Nemzeti Parkhoz tartozó Péteri-tóról augusztusában jelezték, hogy nagyszámú mozgásképtelen vadkacsát és egyéb vízimadarat látnak; a vízben és a környezı nádasban pedig számos madártetem található. A szerzık helyszíni vizsgálataik során megállapították, hogy a tó partszegélye az eredetihez viszonyítva mintegy méterrel beljebb húzódott, s a vízszint csak cm magas volt. A part közelében sok tıkés réce és cigányréce ült az iszapban, jellegzetes paralitikus testtartásban. A parton számos vízimadár-hulla volt látható. A járvány mintegy három hétig tartott, ez idı alatt becslések szerint mintegy 900 különbözı víziszárnyas, zömmel kacsafélék hullottak el /BARTHA SZTOJKOV, 1978/. A laboratóriumi vizsgálatra került 12 réce és 1 gulipán tetem kórboncolása során a heveny szívgyengeségre utaló nagyvérköri pangáson kívül elváltozást nem lehetett megállapítani. Hasonlóképp negatív eredménnyel zárult a parenchymás szervek (lép, máj, vesék), valamint a központi idegrendszer kórszövettani vizsgálata és a bakteriológiai vizsgálatok is /BARTHA SZTOJKOV, 1978/. A második eset a Balaton déli partján, egy gazdaság vadásztavára kihelyezett vadkacsák között fordult elı, ugyancsak 1977-ben. Ezek korábban mély fekvéső, mezıgazdasági 51

52 mővelésbe vont területek voltak. A tavakat úgy alakították ki, hogy a növényi vegetációt egyszerően vízzel elárasztották. A betegség itt 4 év óta ismételten jelentkezett, az elhullás 1976-ban 3000 körüli volt /BARTHA SZTOJKOV, 1978/. Minthogy az adott élıhelyen madár-botulizmus a korábbi években is elıfordult, számítani lehetett a járványra és ezért 1977-ben a szerzık rendszeresen mérették a levegı és a víz hımérsékletét. A megbetegedések itt is augusztusban jelentkeztek, amikor a víz hımérséklete már mintegy 30 napja tartósan 20 C felett volt. A klinikai kép és a 26 vadkacsát érintı kórbonctani észlelések a Péteri-tavi járványban tapasztaltakhoz hasonlóak voltak /BARTHA SZTOJKOV, 1978/. Botulinum toxin kimutatása céljából a Péteri-tavi esetbıl hat, míg az utóbbi járvány kapcsán négy beteg vadkacsa vérsavójából és izomszuszpenziójából készített vizes kivonattal történt kísérleti egéroltás és in vitro toxinsemlegesítési vizsgálat. A vizsgálati anyagokat ip. oltották kifejlett egerekbe. Az antitoxinok szovjet gyártmányúak voltak. Az in vitro semlegesítést a vizsgálati anyag és az antitoxin 37 C-on 30 percig történı inkubációjával végezték. Mind a Péteritavi, mind a Balaton környéki esetben a beteg madarak vérsavója (a Péteri-tavinál izomszuszpenziója is) toxikus volt. A toxinhatást C típusú antitoxinnal a neutralizációs teszt keretében semlegesíteni lehetett. Az A és B típusú antitoxin nem védte az állatokat /BARTHA SZTOJKOV, 1978/. Mindkét területrıl származó iszap- és vízmintákat is vizsgáltak hasonló technikával, de toxint egyikbıl sem sikerült kimutatni. Amikor azonban az iszapmintákat folyékony táptalajon, anaerob módon tenyésztették hét napig, a baktériummentes felülúszó olyan mennyiségben tartalmazott botulinum toxint, hogy azt a szokásos mennyiségő antitoxinnal nem lehetett semlegesíteni. A szőrlet 1000-szeres hígításával végezve a próbákat a védetlen állatok elpusztultak, a C típusú antitoxinnal védettek fele, míg a C, A és B típusú antitoxinnal kombináltan védett madarak mindegyike életben maradt. Ez arra utal, hogy az iszapmintákban A és/vagy B típusú Clostridium botulinum spórák is voltak /BARTHA SZTOJKOV, 1978/. A balatoni gazdaság tavain a járvány 1978 nyarán megismétlıdött. Az elvégzett toxinkimutatási vizsgálatok és neutralizációs tesztek ez alkalommal is a C típusú botulinum toxin szerepét igazolták /BARTHA- SZTOJKOV, 1978/. 52

53 Madár-botulizmus a Kis-Balatonon A Fenékpuszta és Balatonhídvég közti vízfelületet elıször a Balaton 1833-ban készült térképe nevezi Kis-Balatonnak. Erre az idıre az egykori balatoni öböl nyilván már annyira eltérı jellegő volt a Balaton egyéb vízfelületeitıl, hogy megkülönböztetése indokolttá vált. Ekkortájt a Zala Balatonhídvég alatt beleveszett a nádasokkal és szabad vízfelületekkel tarkított mocsárba, így a vize a természetes mocsárvilágon át kellıen megszőrve jutott a Balatonba. Az 1960-as évekig tartó szabályozási munkák következtében azonban a Kis-Balaton és a környezı berkek vízminıségvédı funkciója megszőnt. Ehhez járultak különbözı civilizációs ártalmak: a vízgyőjtın folyó intenzív mezıgazdasági kemizálás, a fokozódó urbanizáció, a Balaton-üdülıterület rohamos fejlıdése és terjedése, az infrastruktúra hiányosságai, melyek együttesen a Balatonba jutó vizek minıségének jelentıs romlását okozták. Ennek elsı látványos jele a Keszthelyi-öbölben 1966-ban megfigyelt vízvirágzás volt. A kutatási eredmények alapján bebizonyosodott, hogy az eutrofizációért a nagy mennyiségben jelen levı tápanyagok (foszfor, nitrogén stb.) és egyéb hordalékok felelısek. A Balaton vízutánpótlásának 45 %-át a vízgyőjtı felérıl, az összes terhelés kb. felét kitevı tápanyaggal, hordalékkal ( t) együtt a Zala folyó szállítja a Keszthelyi-öbölbe, ami az öböl sajátos áramlási viszonyai miatt nagyrészt ott is marad. Ennek szem elıtt tartásával készítette el a Nyugat-dunántúli Környezetvédelmi és Vízügyi Igazgatóság a Kis-Balaton Vízvédelmi Rendszer (KBVR) koncepciótervét, melynek alapgondolata az volt, hogy a hajdan öbölként, illetve mocsárként létezett Zala-völgy ismételt elárasztásával kialakuló mocsaras-nádas terület a Zala folyón érkezı tápanyagokat feldolgozza. A világon egyedülálló vízvédelmi rendszerrel az eddig a Balatonban fıleg a Keszthelyi-öbölben lejátszódó folyamatokat a Balaton elé, a Zala folyó alsó szakaszán kialakításra került KBVR területére helyezték át. Ez a megoldás a mintegy 200 évvel korábbi, természetes állapothoz hasonló viszonyokat hoz létre. A Kis-Balaton Vízvédelmi Rendszer I. üteme (Hídvégi-tó) 1985 óta üzemel. Ennek tározójából egy mőtárgyon át jut a Zala vize a II. ütem (Fenéki-tó) területére. A Zala-folyó természetes völgyében, Balatonhídvég és a Zala-torkolat közti területen létesül a Kis-Balaton Vízvédelmi Rendszer II. ütemének tározója, melynek kivitelezése 53

54 1984-ben kezdıdött. Pénzügyi okok miatt a munkálatok nem követték az elıre meghatározott ütemet, ezért a Balaton vízminıségének érdekében szükségmegoldás született. Ennek során 1992-ben elızetesen elárasztásra került egy 16 km 2 -nyi terület. A megtisztított, alacsonyabb tápanyag-tartalmú víz innen egy mőtárgyon keresztül jut a Zala-folyóba, majd a Balatonba (5. ábra) /NYUDUVIZIG, 2003/. A Kis-Balaton egyedülálló madártani és természetvédelmi jelentıségő vizes élıhely, melyet 1951-ben nyilvánítottak védetté óta tájvédelmi körzet, 1997-tıl a Balatonfelvidéki Nemzeti Park része. A védett, illetve fokozottan védett madárfajok tucatjainak otthont adó terület 1979-ben, a Ramsari Egyezmény keretén belül felkerült a nemzetközi jelentıségő vadvizek listájára. Bár madár-botulizmus szempontjából a Kis-Balaton gyakorlatilag endémiásnak tekinthetı, s a megbetegedések nem ritkán egymást követı években is felléptek a területen, az 1996 és 2006 közötti idıszakban például teljesen megszőntek (5. táblázat). A továbbiakban az 1993-ban bekövetkezett, részletesen dokumentált kitörés bemutatása következik. A környezeti faktorok szerepét ebben az esetben is érdemes megfigyelni. A KBVR II. ütemének 1992 ıszén történt részleges elárasztása során a vízszint cm-t emelkedett, s a vízborítás alá került növénytársulások (magassásosok) bomlásnak indultak, eközben pedig nagy mennyiségő fehérje szabadult fel. Csapadék nem hullott, a Zala vízutánpótlása is le volt zárva. A növények bomlása, az alacsony vízállás, a meleg anaerob feltételeket teremtett, s ez kedvezett a Clostridium botulinum elszaporodásának. (A toxint késıbb az Országos Állategészségügyi Intézet a különbözı fajú madarakból vett vérsavó és a tetemekbıl vett légyálcák laboratóriumi vizsgálatával kimutatta.) Az elsı megbetegedett egyedeket június 22-én fedezték fel az Ingói-csatornán. Ettıl kezdıdıen a pusztulás intenzitása nagymértékben függött az idıjárástól. Hővösebb napokon, csapadék hullása után lecsökkent; meleg, kánikulai periódusokban megnıtt. Augusztusban a botulizmus kiterjedt az I. ütem területére is. Itt a sekély, növénymentes iszapzátonyokon az 5-10 cm-es vízborításnál a hımérséklet alkalmanként elérte a 40 Cot is. Bár kiterjedésre nézve az I. ütemen lényegesen nagyobb terület kedvezett a botulizmus elterjedésének, az elhullás mértéke mégis kisebb volt (az elpusztult

55 madárból 192 hullott el itt). A pusztulás véglegesen csak az ıszi lehőlés és a jelentıs csapadék-utánpótlás után szőnt meg. 5. ábra. A KBVR I. és II. ütemének elhelyezkedése, illetve néhány madár-botulizmus kitörés helyszíne (ZLINSZKY /1997/ nyomán). A kis-balatoni megfigyelések szerint a madarak utolsó erejükkel valamilyen védett helyre (szigetre, töltésoldalba) kivergıdve pusztulnak el. Az elhullott példányok 90%-ban ilyen helyeken fordultak elı. Nyílt vízen, nádasban (a korábban ismertetett két esettel ellentétben) viszonylag ritkán találtak madártetemeket. Szerencsés lett volna, ha nagy mennyiségő friss, oxigéndús vizet tudnak juttatni a területre, de ez ilyen nagyságrendben sajnos nem volt kivitelezhetı. Az I. ütem 55

56 területérıl lehetett volna ugyan vizet leengedni, ez esetben viszont ott szaporodott volna el a baktérium. Július végén kisebb mennyiségő vizet mégis leengedtek a I. tározóról a II. ütem területére. Sajnálatos módon a várt hatás elmaradt. 5. táblázat. Madár-botulizmus megbetegedések elıfordulása a Kis-Balaton területén, 1977 és 2007 között (MAGYARI; szóbeli közlés). A kitörés Elpusztult idıpontja madarak száma Megjegyzés 1977 kb tisztítatlan szennyvíz átemelése 1978 kb. 50 tisztítatlan szennyvíz átemelése az I. ütem elárasztása; rothadó növényzet a II. ütem részleges elárasztása; pusztuló magassásosok lásd az elızı évet tisztítatlan szennyvíz*; pusztuló magassásosok > 150** bőzös, opálos víz; H 2 S-termelı baktériumok elszaporodása 2007 kb. 10 rövid ideig tartó kitörés; megbetegedési gócpontok hiánya *A sármelléki szovjet laktanya tisztítatlan szennyvize évtizedeken át ide került **E mellett a töltésoldalban, 150 m hosszan hevertek madártetemek A C típusú antitoxin beszerzése és a megbetegedett állatokba történı bejuttatása is akadályokba ütközött. Preventív megelızési módszerként a fertızési gócot jelentı és viszonylag jól behatárolható, 2 km 2 -nyi területtıl (Ingói-csatorna és környéke) megpróbálták távol tartani a madarakat oly módon, hogy egy-két naponta, lehetıleg nagy zajjal (motorcsónakkal) többen mozogtak a területen, de az eljárás csak részben volt hatásos. A megbetegedett állatokat folyamatosan begyőjtötték, hiszen a területen maradó tetemek további fertızési gócokat hoztak volna létre. Az elpusztult egyedeket a balatonmagyaródi dögkútba szállították. A beteg, de még élı példányokat részben a Közép-Dunántúli Természetvédelmi Igazgatóság fenékpusztai csónakházánál kialakított segélyhelyen, részben a Magyar Madártani és Természetvédelmi Egyesület Zala megyei helyi csoportja által mőködtetett fenékpusztai győrőzıtáborban ápolták. A kezelés a következıkbıl állt: a begyőjtött madarakat megitatták. Mivel a megbetegedésbıl adódóan nyelési reflexük nem váltódott ki, nyelıcsövükön vékony gumicsövet bocsátottak le, melynek végére fecskendıt erısítettek. Elsı néhány alkalommal a kondíció javítására fehérjekoncentrátumot alkalmaztak, óvatosan, az esetleges félrenyelés veszélyét szem elıtt tartva. A madarak, állapotuktól függıen 1-2 óra, illetve 1 nap múlva már darabos táplálékot is kaptak. 56

57 A réceféléket, ludakat és szárcsákat vízben áztatott kukoricával tömték meg. Elıször 4-5 szemet kaptak, majd folyamatosan növelték a mennyiséget. A tömést óvatosan kellett végrehajtani, vigyázva arra, nehogy a táplálék a légcsıbe jusson, majd a szemeket óvatosan behúzni a begybe. Az áztatóvízbe kevés sót és étolajat tettek. A cankóféléket elıször szintén fehérjekoncentrátummal itatták, majd apróra vágott gilisztával etették meg ıket. Ideális módszer lett volna a pépesítés. A gémfélék apró halakat kaptak. A stressz miatt az elsı napokban kiöklendezték ıket. Ezt megakadályozandó, győrőt helyeztek el a nyakukon. A módszer nem vált be, mert a madarak igyekeztek megszabadulni tıle, s csırük állandóan beleakadt. Ehelyett a csır végét ragasztószalaggal áttekerték, majd azt az emésztés végeztével eltávolították. A gyógyuló madarakat ládákban helyezték el, ügyelve arra, hogy egy-egy ládába maximum 4 állat kerüljön, ezzel kerülve el, hogy egymást zavarják. Ideiglenes szállásaikba tálcákat tettek, melyeket tiszta vízzel töltöttek fel, s kukoricát, búzát és békalencsét szórtak bele. A fenti módszerrel a madarak állapotától függıen 3-6 nap alatt el lehetett érni a tünetmentességet, s a 151 élve begyőjtött állatból 77-et (51%) sikerült meggyógyítani. Az egészséges egyedeket győrőzés után olyan területeken engedték szabadon, ahol a megbetegedés veszélye már nem állt fenn. Ennek ellenére szerencsés volna a botulizmusból felépült madarakat a járvány végéig erre alkalmas röpdében tartani, hiszen ezek az egyedek újra megfertızıdhetnek /HORVÁTH és mtsai., 1994/. A magyarországi madár-botulizmus esetek közül az Árpádhalmi Vadgazdaságban történt, májusi kitörés jelentkezett a legkorábban. Azévben az aszályos tavaszt hirtelen kánikula követte. Az 1979 és 1991 közötti 12 éves periódusban lezajlott hazai kitörések idıpontjainak vizsgálata az alábbi eredményekhez vezetett: 8 évben tapasztaltak megbetegedéseket a július 10-e és 31-e, míg 4 évben az augusztus 1-je és 21-e közti 3 hetes intervallumban. Ebben az idıszakban a legkorábbi esetrıl június 3-án (1989), míg a legkésıbbirıl október 5-én (1987) számoltak be /SZTOJKOV; szóbeli közlés/. 57

58 2.6. A baktérium illetve toxinja jelenlétének kimutatása A madár-botulizmus in vitro diagnosztizálása során felhasznált módszerek szinte kivétel nélkül a humán botulizmus megbetegedések kapcsán kifejlesztett technikák átvételével és továbbfejlesztésével jöttek létre. A baktérium kimutatását annak lassúsága és nehézsége miatt a gyakorlatban ritkán alkalmazzák, ezért inkább a toxintermelés képességének detektálásán alapuló metódusok terjedtek el. Ezek jobbára molekuláris biológiai illetve immunológiai alapokon nyugszanak. A megbízhatóság növelése érdekében az egyes technikákat sok esetben egymással kombinálva alkalmazzák. A továbbiakban a leggyakrabban használt módszerek áttekintése következik Egéroltás (mouse bioassay) Jelenleg az egyetlen standard módszernek tekinthetı, széles körben elfogadott és alkalmazott metódus a botulinum toxin kimutatására /ARNON és mtsai., 2001; FERREIRA és mtsai., 2003; BARR és mtsai., 2005/, legyen szó akár humán-, akár madár-botulizmus megbetegedésekrıl. A vizsgálat során a kísérletbe vont egereket ip. oltják be a kérdéses mintákkal. Ezt követıen az egerek egyik csoportját egyedenként különbözı szerotípusú monovalens botulinum antitoxinokkal védik, majd mindkét csoport egyedeit megfigyelik. Ha egy adott minta a minimális letális dózisnál nagyobb mennyiségben tartalmaz botulinum toxint, az ellenanyaggal nem védett egereken kifejlıdnek a botulizmus tünetei, majd az állatok elpusztulnak. Hasonló sorsra jutnak az eltérı szerotípusú antitoxinnal kezelt egerek is, a megfelelı típusú ellenanyagot kapott állatok azonban megbetegedés nélkül vészelik át a kísérletet. Ha a pozitív mintában nagy mennyiségben van jelen botulinum toxin, a tünetek általában 8 órán belül megjelennek. Alacsonyabb toxintiter esetén azonban a klinikai tünetek jóval lassabban fejlıdnek ki, így a negatív eredmény kimondása elıtt az egereket 4 napon át megfigyelés alatt kell tartani. A módszer legnagyobb elınye érzékenysége; hátrányai közt a viszonylagos lassúság, a nagyszámú kísérleti állat elpusztítása, a speciális állatházak igénye és az állatoltás, mint veszélyforrás említhetık meg /BARR és mtsai., 2005/. 58

59 ELISA (Enzyme-Linked Immunosorbent Assay) Az ELISA-teszt, mint az egéroltás in vitro alternatívája, szintén immunológiai alapokon nyugszik. E vizsgálatok valójában olyan, szilárd fázison lejátszódó színreakciók, ahol a reagensek mőanyag felülethez vannak kötve, és a reakció enzimmel kapcsolt antitest segítségével követhetı nyomon. A szakirodalom direkt és indirekt ELISA-eljárásokat különböztet meg. A direkt eljárásnál az enzimet az antitesthez kapcsolják, míg az indirekt módszer esetén az enzim olyan molekulához kapcsolódik, amely az antitestet felismeri. Mindkét csoporton belül többféle változat lehetséges /KFDT, 2008/. Az ELISA gyorsabb, mint az egéroltás, érzékenységérıl azonban erısen megoszlanak a vélemények. Több kutatócsoport szerint /THOMAS, 1991; FERREIRA és mtsai., 2003; FERREIRA és mtsai., 2004/ általában kevésbé szenzitív, s ezért jelenleg inkább elızetes, screening módszerként alkalmazzák, melynek eredményeit egéroltással is szükséges megerısíteni. Más szerzık azonban humán- /DEZFULIAN és mtsai., 1984/ és madár-botulizmus megbetegedések vizsgálata során /ROCKE és mtsai., 1998; ZECHMEISTER és mtsai., 2002; ZECHMEISTER és mtsai., 2005; TRAMPEL és mtsai., 2005/ ennek épp az ellenkezıjét tapasztalták Molekuláris biológiai technikák PCR (Polymerase Chain Reaction) Napjainkban a különféle toxintípusú Clostridium botulinum baktériumok kimutatására felhasználható, polimeráz láncreakción alapuló molekuláris biológiai technikák igen nagy népszerőségnek örvendenek /SZABO és mtsai., 1993; KAKINUMA és mtsai., 1997; LINDSTRÖM és mtsai., 2001; AKBULUT és mtsai., 2004; NOL és mtsai., 2004; PRÉVOT és mtsai., 2007/. Ez a C típusú kórokozók által létrehozott madár-botulizmus megbetegedések kapcsán sincs másként /WILLIAMSON és mtsai., 1999; ZECHMEISTER és mtsai., 2002; ZECHMEISTER és mtsai., 2005; TRAMPEL és mtsai., 2005; OCEPEK és mtsai., 2007; FRANCIOSA és mtsai., 1996; LINDBERG és mtsai., 2010/. Mivel a betegség tüneteit kizárólag toxintermelı baktériumtörzsek képesek kiváltani, e reakciók mindegyike a Clostridium botulinum neurotoxin-termelés génjének egy-egy adott szakaszára specifikus primerek felhasználásán alapul, 59

60 függetlenül attól, hogy a kérdéses gén a bakteriális kromoszómán, esetleg egyéb elemen (plazmidon vagy bakteriofágon) kódolódik. Az ún. real-time (valós idejő) PCR módszer alkalmazása során a termék(ek) mennyiségi elemzése minden ciklusban megtörténik, így láthatóvá válik a reakció kinetikája, ami informatívabb, mint a hagyományos PCR esetén a reakciótermék mennyisége a végpontban (telített reakció). Az a ciklusszám, amelynél (az ún. áttörési vagy áthajlási pontban (crossing point)) a szignál eléri a logaritmikus PCR fázist, a target DNS (RNS) kiindulási mennyiségének függvénye. Ennek ismeretében lehetıvé válik a target nukleinsav kiindulási mennyiségének pontos mérése /BME/. A továbbiakban a real-time PCR technika bıvebb bemutatása következik, az értekezésben található molekuláris biológiai vizsgálatok során használt LightCycler System mőködésén keresztül. A LightCycler egy fotométerrel kombinált gyors thermocycler, melyben a főtés és hőtés szabályozása forró és hideg levegı váltakozó alkalmazásával történik. A hıátadó közeg alacsony tömege miatt ezzel az eljárással rendkívül nagy hıátadási sebesség érhetı el (20 C/sec). A rendszer ugyanakkor reakcióedényként bórszilikát kapillárisokat használ, melyekben a nagy felszín/térfogat arány miatt igen hatékony a hıátadás. Az alkalmazott hıátadó közeg és a bórszilikát kapillárisok együttesen teszik lehetıvé az ultra-gyors ciklusváltásokat. Ebbıl adódóan a LightCycler teljesítménye eléri a PCR ciklust perc alatt, detektálást is beleértve! A bórszilikát kapillárisok egyidejőleg szignál-győjtı optikai elemként is szolgálnak, a száloptikához hasonlóan vezetve és a kapilláris hegyére koncentrálva a reakció során keletkezı fényjeleket, lehetıvé téve a mikrotérfogatú minták fluoreszcens monitorozásához elegendı fénykibocsátást. A minták a mintatárcsába kerülnek, mely 32 kapillárist képes egyszerre befogadni. A mintatárcsa a mintabetöltéshez a mőszerbıl kiemelhetı. A LightCycler System tartozéka egy felhasználóbarát szoftverrel ellátott PC is, ami biztosítja az analízis egyszerő és pontos kivitelezését. A hıciklusok alatt az egyes kapillárisokban lezajló reakció monitorozása on-line úgy történhet meg, hogy egy preciziós léptetı motor a (zárt) kapillárist, adott idıközönként, a mintatárcsa elforgatásával, pontosan a fluoriméter optikája fölé juttatja, a fluoreszcencia mérése céljából. 60

61 A fluoriméterben egy LED fényforrás (470 nm) valamint három ( nm) szőrı található, multiplex detektálást téve lehetıvé. A szoftver minden mérési pontban valós idıben jeleníti meg a fluoreszcens jeleket. A mintából érkezı jelek mérése tehát olyankor történik, amikor a kapilláris az optikai egység fölé kerül. A hıciklusok alatt a fluoreszcencia minden kapillárisban ciklusonként mérhetı, a mért értékek a képernyın azonnal megjelennek és minden ciklus után tovább íródnak (kinetikus görbe). Az így keletkezı adatokat a számítógép a további elemzéshez tárolja. A rendszer alkalmas szinte az összes, ún. real-time detektálási technológia felhasználására, így például SYBR Green, FRET (Fluoresence Resonance Energy Transfer), TaqMan, Molecular Beacon, Scorpion alkalmazások is futtathatóak rajta. A SYBR Green I festék az etidium bromidhoz hasonlóan interkalálódó molekula, amely a dupla szálú (ds) DNS-hez kötıdik az amplifikáló elegyben. Bekötıdve, adott monokróm fénnyel indukálva 530 nm hullámhosszúságú fényt emittál. Az ebbıl keletkezı mérhetı fluoreszcens jel nagysága a PCR folyamán felszaporodó dsdns mennyiségével arányosan növekszik. A real-time mennyiségi meghatározás érdekében a fluoreszcencia mérése minden ciklusban megtörténik. Optimalizálásra kiválóan megfelel, s mivel nem igényel extra próbákat, relatív olcsósága miatt igen népszerő. A LightCycler System segítségével olvadáspont-analízis is végezhetı a keletkezett PCR termékek elemzésére. Minden DNS fragmentumra jellemzı az olvadáspontja (Tm), mely definíciószerően az a hımérséklet, melyen az adott DNS fragmens 50%-a egyszálú. Az olvadáspontot leginkább befolyásoló tényezık: a fragmens G+C tartalma, valamint hossza. A LightCycler készülék a hımérséklet celsius-fokonkénti emelése közben képes folyamatosan monitorozni a keletkezı fluoreszcenciát. Amikor a kapillárisban a hımérséklet eléri a vizsgált fragmens Tm értékét, a fluoreszcencia emisszió hirtelen csökkenni kezd, az alkalmazott fluoreszcens technikától függıen vagy azért, mert a (duplaszál-specifikus) SYBR Green I leválik az amplikonról, vagy azért, mert a hibridizációs próbák az amplikonról leolvadva már nincsenek többé energiaátadásra alkalmas közelségben. Az olvadáspont-analízis egyebek mellett felhasználható a keletkezett termékek megkülönböztetésére, mivel a rövidebb termékek (pl. primer-dimerek) Tm értéke 61

62 alacsonyabb, mint a specifikus fragmensé, illetve ezek azonosítására, termékspecifikus Tm értékek kimérését követıen /BME/. Az Invitrogen (USA) által kifejlesztett, ún. LUX (Light Upon extension) primerek új megközelítéső, fluoreszcens detektálási mechanizmuson alapuló real-time PCR reakciók elvégzését teszik lehetıvé. A LUX rendszerben minden primer-pár egy, a 3 végéhez közel (a 2. vagy 3. nukleotidon) fluorofórral jelölt, fluorogén primerbıl, illetve egy megfelelı, jelöletlen primerbıl áll. A fluorogén primer 5 végén egy rövid, 6-8 nukleotidból álló farki rész található. Az ennek segítségével létrejövı másodlagos hairpin-struktúra biztosítja a fluorofór optimális kioltását (quenching). Amikor a primer a PCR reakció során a kettıs szálú DNS termékkel kapcsolatba kerül, a fluorofór kioltódása megszőnik, ezzel akár tízszeres fluoreszcens jel-növekedést eredményezve (6. ábra) /PRIMERDIGITAL.COM, 2011/. 6. ábra. A LUX primer-alapú detektálási rendszer alapjai relatív fluoreszcencia a primer térszerkezetének függvényében (INVITROGEN HOME PAGE /2011/). A LUX primer-rendszer érzékenysége vetekszik a kettıs jelöléső próbákat alkalmazó platformokéval (pl. TaqMan, Molecular Beacon), ára az egyszeres jelölésbıl adódóan alacsonyabb, specificitása azonban némileg elmarad azokétól, ugyanezen okból kifolyólag. Mivel a SYBR Green I minden kettıs szálú DNS termékhez kapcsolódik, specificitása alacsonyabb a LUX rendszerénél, amely egyben érzékenyebb meghatározást is lehetıvé tesz. Költségeit, alkalmazásának egyszerőségét illetve olvadáspont-analízissel történı összekapcsolhatóságát tekintve azonban az utóbbi két módszer között nincs jelentıs különbség. Mindezek ellenére, a madár-botulizmus diagnosztikájában LUX primer-rendszeren alapuló metódus még nem került 62

63 publikálásra. Mi több, egészen a közelmúltig maga a real-time PCR sem szerepelt a kimutatási módszerek között. LINDBERG és mtsai ben publikálták az elsı, BoNT/C gén-specifikus reakciókon alapuló kísérleteiket, melyek egyben a BoNTC/D kiméra szekvenciák detektálására is alkalmasak. Érdekes módon a három, általuk tanulmányozott svédországi eset egyikében sem a kizárólag C típusú, hanem éppen a C/D mozaik toxin szerepe volt igazolható. E tény figyelembe vételével a jövıbeli kutatásokat hazánkban is érdemes volna ebbe az irányba kiterjeszteni Ribotipizálás Az élılények filogenetikai rendszerezésében már évtizedek óta használt kis riboszóma alegység 16S RNS-ét kódoló gén vizsgálata a Clostridium botulinum egyes toxintípusainak elkülönítésében is a kutatók segítségére lehet /HIELM és mtsai., 1999; SKINNER és mtsai., 2000; POURSHABAN és mtsai., 2002; POURSHAFIE és mtsai., 2005/. E mellett alkalmas olyan, a Clostridium botulinum-tól eltérı Clostridium-fajok azonosítására is, amelyek képesek botulinum toxint termelni (ilyenek például a Clostridium butyricum és a Clostridium baratii /HALL és mtsai., 1985; McCROSKEY és mtsai., 1991; TRETHON és mtsai., 1995; TSUKAMOTO és mtsai., 2002/) Biokémiai tesztek A klasszikus biokémiai alapú vizsgálatok során az egyes mikroorganizmusok azonosítása enzimkészletük feltérképezésével végezhetı el. E kísérletek folyamán a tiszta tenyészetben levı mikrobákat különbözı szubsztrátokat leggyakrabban szénhidrátokat tartalmazó közegekbe oltják, majd az eredményeket általában színváltozás alapján értékelik. Ugyancsak diagnosztikus értékőek lehetnek a mikrobák életfolyamatai során keletkezı különféle anyagcseretermékek, például az indol, az acetil-metil-karbinol (acetoin), az ammónia vagy a kén-hidrogén. A sokszor hıérzékeny szubsztrát-oldatok körülményes elkészítése felgyorsította olyan gyorstesztek megszületését, melyekben elıre elkészített kiindulási anyagok segítik a kutatók munkáját. 63

64 API Az API 20 A rendszer (biomérieux SA, Franciaország) 21 teszt gyors és egyszerő elvégzését teszi lehetıvé, anaerob mikroorganizmusok biokémiai azonosításához. A dehidratált szubsztrátoknak a vizsgálni kívánt mikroorganizmus szuszpenziójával történı beoltását, majd a 24 órás, meghatározott körülmények között történı inkubálást, illetve a szükséges reagensek hozzáadását követıen az eredmények színváltozás alapján értékelhetık. A meglevık mellett egyéb vizsgálatokat (telep- és mikroszkópos morfológia, Gram-festés stb.) szükséges elvégezni, és az azokból levonható következtetéseket az azonosítás megerısítéséhez vagy kiegészítéséhez kell felhasználni. Az API Rapid ID 32 A az API 20 A-val alapjaiban megegyezı, de annál gyorsabb azonosítást tesz lehetıvé: a vizsgált anaerob tenyészetek 32-féle biokémiai jellemzıje már 4 órás, meghatározott körülmények között történı inkubálást, illetve a megfelelı reagensek hozzáadását követıen leolvasható a tesztcsíkról RapID ANA II A RapID ANA II rendszer (Innovative Diagnostics Systems, USA) szintén hagyományos és kromogén szubsztrátok segítségével teszi lehetıvé a vizsgált mikroorganizmus azonosítását, a beoltást, majd a meghatározott feltételek mellett történı inkubálást követı 4-5 óra elteltével, a szükséges reagensek hozzáadása után. Az eredmények értékelése, csakúgy, mint a korábbi tesztcsíkok esetében vizuálisan, vagy spektrofotométerrel történik. Bár a fent ismertetett biokémiai azonosító rendszerek valóban gyors és meglehetısen egyszerő alternatívát jelenthetnek más technikákhoz képest, a különféle toxintípusú Clostridium botulinum illetve egyéb Clostridium-fajok ily módon történı azonosításának megbízhatósága többek szerint erısen kétséges /BRETT, 1998; LINDSTRÖM és mtsai., 1999/. Ezért talán a legszerencsésebb azokat egyéb módszerek segítségével már azonosított Clostridium botulinum törzsek biokémiai vizsgálatához felhasználni. 64

65 3. ANYAG ÉS MÓDSZER 3.1. A környezeti tényezık statisztikai vizsgálata Amint arról korábban már szó esett, a C típusú Clostridium botulinum szaporodására, és ezen keresztül a madár-botulizmus kitörések kialakulására bizonyos környezeti feltételek serkentıleg hathatnak. A dolgozat egyik célja e tényezık szerepének vizsgálata a Kis-Balaton területén bekövetkezett megbetegedésekben. Ehhez a Nyugatdunántúli Környezetvédelmi és Vízügyi Igazgatóság (NYUDUVIZIG) Keszthelyi Üzemmérnöksége által rendszeresen győjtött vízminıségi adatok, illetve a Keszthelyi Meteorológiai Állomás napi idıjárási adatai kerültek felhasználásra. A korábbi kitörések helyszíneinek figyelembe vételével (5. ábra) a Kis-Balaton teljes területe alacsony (AK) illetve magas kockázatú (MK) régiókra lett felosztva, melyekben a NYUDUVIZIG stabil mintavételi pontjai közül 5-5 került kiválasztásra (7. ábra). 7. ábra. Magas ( ) és alacsony ( ) kockázatú mintavételi pontok elhelyezkedése a Kis- Balaton területén. 65

66 A vizsgálatok során e stabil mintavételi pontok vízminıségi paramétereinek (vízhımérséklet, ph, vezetıképesség, oldott oxigén- és szervesanyag-tartalom) a NYUDUVIZIG Keszthelyi Üzemmérnöksége által heti-kétheti gyakorisággal győjtött adatai kerültek kiértékelésre, 5-5 magas (madárpusztulással járó; MK) illetve alacsony kockázatú (elhullással nem járó; AK) évben (6. táblázat). Mivel a megbetegedések legtöbbször június és szeptember hónapok között fordultak elı, az elemzés alá vont intervallumok minden évben ehhez igazodtak. A mintavételi helyek és az évek kombinációjával négy csoport került kialakításra (7. táblázat). 6. táblázat. A vizsgált magas (MK) és alacsony kockázatú (AK) évek. Vizsgált Kockázat Elpusztult évek MK AK madarak száma > 150* *E mellett a töltésoldalban, 150 m hosszan hevertek madártetemek 7. táblázat. A vizsgált mintavételi helyek és évek kombinációjával létrejött csoportok. Csoport Mintavételi pontok Vizsgált évek 1) MK pontok - MK évek 6, 9, 10, 202, , 1994, 1995, 1996, ) MK pontok - AK évek 6, 9, 10, 202, , 1998, 1999, 2000, ) AK pontok - MK évek 4, 7, 205, 210, z , 1994, 1995, 1996, ) AK pontok - AK évek 4, 7, 205, 210, z , 1998, 1999, 2000, 2001 Az egyes csoportok statisztikai analízise az SPSS 16.0 statisztikai programcsomag segítségével, egytényezıs varianciaanalízis, kétmintás párosított t-próba és diszkriminancia analízis felhasználásával valósult meg. A vizsgálatok menetérıl a 8. ábra tájékoztat. Az ugyanezen évek azonos periódusaiból származó meteorológiai adatok (napi minimum-, maximum- és középhımérséklet illetve napi csapadékösszeg) kiértékelése szintén egytényezıs varianciaanalízis és kétmintás párosított t-próba segítségével történt. 66

67 A forrásadatok, az SPSS statisztikai programcsomag próbaverziójának elérhetısége illetve a statisztikai számítások a mellékelt CD-n találhatók. A diszkriminancia analízis vázlatos menete a függelékben olvasható. 8. ábra. Az egyes csoportok statisztikai elemzésének vázlata A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, PCR reakcióval Nested PCR reakció WILLIAMSON és mtsai. /1999/ alapján A vizsgálatokhoz kapcsolódó mintavételek a Kis-Balaton területének öt, a madárbotulizmus szempontjából magas kockázatú pontján történtek. Az üledék felsı 10 cmébıl, kézi iszapmintavevı segítségével g került begyőjtésre, majd 4-5 órán belül -20 C-on történı fagyasztásra. A totál DNS kivonása a minták 0,25 g-jából, a golyósmalom elvén alapuló, így mechanikai feltárást is végzı PowerSoil DNS izoláló kit (MoBio, USA) felhasználásával történt, a gyártó javaslatai szerint. A szóban forgó kit nagy elınye, hogy a DNS kivonás során megköti azokat a talajban elıforduló 67

68 humuszanyagokat (pl. huminsav, fulvonsav), amelyek máskülönben gátolnák a PCR reakciók lefolytatását. Az alább ismertetésre kerülı polimeráz láncreakciók a BoNT/C 1 -gén egy 225 bp mérető szakaszának amplifikációját célozták. A 20 µl végtérfogatú PCR reakcióelegyek az alábbi összetevıket tartalmazták: 2 µl 10x PCR puffert (1x: 50 mm KCl, 1,5 mm MgCl 2, 10 mm Tris-HCl [ph 8.8] és 0,1% Triton X-100; Finnzymes, Finnország), 2,0 mm-t az egyes dntp-kbıl, 20 pm-t az egyes primerekbıl (Metabion, Németország), 0,4 U DynaZyme DNS polimerázt (Finnzymes, Finnország) és 20 ng DNS templátot. A reakciók 0,2 ml-es, vékony falú polipropilén PCR csövekben (AHN, Németország), DNS thermal cycler (RoboCycler; Stratagene, USA) segítségével kerültek lejátszásra, nested reakciók során a kezdı PCR termék 2 µl-ének felhasználásával. A kezdı illetve nested PCR reakciók amplifikációs profilját a függelék tartalmazza. A BoNT/C 1 -gén specifikus primerek a leírtakkal megegyezı formában és kombinációkban kerültek alkalmazásra, melyek szekvenciái ugyancsak a függelékben találhatók. Pozitív kontrollként a C típusú Clostridium botulinum 468-as, illetve 2145-ös törzsei szolgáltak (források: T. E. Rocke és J. L. Williamson, USGS National Wildlife Health Center, Madison, Wis, USA (468); F. Gessler, Georg August University of Goettingen, Institute for Applied Biotechnology in the Tropics, Göttingen, Németország (2145)). A keletkezett PCR termékek elkülönítése 1,5%-os agaróz gél-elektroforézissel történt, 0,5x-es TBE pufferben (HU25; Scie-Plas, Egyesült Királyság). Ezt a termékek 20 percig tartó festése követte etidium-bromid oldatban, majd vizualizálásuk és fényképezésük, géldokumentációs rendszer felhasználásával (Gene Genius Bio Imaging System; Syngene, Egyesült Királyság). A minták begyőjtésével egyidıben két tıkés réce pusztult el a Kis-Balaton területén, nem sokkal azután, hogy felépültek a madár-botulizmusból. Vakbéltartalmuk feldolgozása az elızıekben leírtak szerint ugyancsak megtörtént. Ezzel párhuzamosan valamennyi üledék- és vakbéltartalom minta 4 napig tartó tenyésztésnek lett alávetve, Schaedler táplevesben (Scharlau, Spanyolország), 30 C-on, anaerob körülmények között. A tenyésztést megelızıen a minták egyik része 70 C-os vízfürdıben 15 percig tartó hıkezelésen esett át, a vegetatív sejtek elpusztítása céljából. 68

69 A tenyésztést követıen a hıkezelt és hıkezeletlen minták Schaedler agar lemezekre lettek szélesztve (Scharlau Chemie, Spanyolország), majd 3 napig 30 C-on anaerob körülmények között kerültek inkubálásra. Az agarlemezekrıl izolált telepek feldolgozása a tenyésztés nélküli minták esetében ismertetett metodika szerint történt Hagyományos PCR reakció FRANCIOSA és mtsai. /1996/ alapján A módszer vizsgálatához felhasznált DNS izolátumok a korábban említett, tenyésztett és tenyésztés nélküli, hıkezelt illetve hıkezeletlen üledék- és vakbéltartalom-mintákból származtak. Az 50 µl végtérfogatú PCR reakcióelegyek összetétele megegyezett a FRANCIOSA és mtsai. /1996/ által leírtakéval, egy különbséggel: esetünkben a PCR puffer 1% Triton X-100-at is tartalmazott, a MgCl 2 mellett. A reakcióelegyek alkotórészei: 10x PCR puffer (1x: 50 mm KCl, 1,5 mm MgCl 2, 10 mm Tris-HCl [ph 8.8] és 0,1% Triton X-100; Finnzymes, Finnország), 200 µm az egyes dntp-kbıl, 1 µm az egyes primerekbıl (Metabion, Németország), 0,4 U DynaZyme DNS polimeráz (Finnzymes, Finnország) és 2 µl DNS templát. A reakciók 0,2 ml-es, vékony falú polipropilén PCR csövekben (AHN, Németország), DNS thermal cycler (RoboCycler; Stratagene, USA) segítségével kerültek lejátszásra. A változatlan formában átvett amplifikációs profilt, illetve a BoNT/C 1 -gén jelenlétére utaló, 615 bp mérető PCR terméket eredményezı primerek szekvenciáit a függelék tartalmazza. Csakúgy, mint korábban, pozitív kontrollként a C típusú Clostridium botulinum 468-as, illetve 2145-ös törzsei szolgáltak. A keletkezett PCR termékek elkülönítése ugyancsak 1,5%-os agaróz gélelektroforézissel történt, 0,5x-es TBE pufferben (HU25; Scie-Plas, Egyesült Királyság). Ezt a termékek 20 percig tartó festése követte etidium-bromid oldatban, majd vizualizálásuk és fényképezésük, géldokumentációs rendszer felhasználásával (Gene Genius Bio Imaging System; Syngene, Egyesült Királyság) Módosított real-time PCR reakció, FRANCIOSA és mtsai. /1996/ alapján A FRANCIOSA és mtsai. /1996/ által publikált hagyományos PCR metódus vizsgálata során szerzett pozitív tapasztalatok vezettek real-time környezetbe történı átültetésének kísérletéhez. Ennek keretében a hagyományos PCR reakciók során felhasznált primerek 69

70 kerültek alkalmazásra, ebben az esetben azonban egy LightCycler 1.5 készülékre optimalizált, SYBR Green I alapú real-time rendszerben, olvadáspont-analízissel kiegészítve. A LightCycler FastStart DNA Master SYBR Green I kit (Roche, Németország) felhasználásával összeállított, 20 µl végtérfogatú PCR reakcióelegyek a következı reagensekbıl álltak: 2 µl reakciópuffer (ez egyben tartalmazza az enzimet és a dntp-t is), 2,4 µl MgCl 2, 2 µl az egyes primerekbıl (20 pm végkoncentrációban), 9,6 µl PCRvíz illetve 2 µl DNS templát. Annak érdekében, hogy a reakciók során a lehetı legkevesebb nemspecifikus termék keletkezzen, mind a reakcióelegy összetétele, mind a reakció profilja optimalizálási lépéseken esett át. Ezek során a kapcsolódási (annealing) hımérséklet, illetve a MgCl 2 és a primerek koncentrációjának aprólékos és szisztematikus változtatása történt meg. Az optimalizálást követıen kialakult, a célnak leginkább megfelelı PCR profil a függelékben olvasható. A módszer specificitásának vizsgálata 16, humán patogén baktériumfaj DNS-ének bevonásával történt, amelyek a következık voltak: Clostridium difficile, Clostridium perfringens, Pseudomonas aeruginosa, Klebsiella pneumoniae, Campylobacter jejuni, Escherichia coli O157:H7, Bacillus anthracis, Bacillus subtilis, Bacillus thuringiensis, Streptococcus pyogenes, Streptococcus pneumoniae, Enterococcus faecium, Staphylococcus aureus, Corynebacterium diphteriae, Neisseria meningitidis és Legionella pneumophila. Az egyes DNS-ek részben az Országos Epidemiológiai Központ, részben a Magyar Honvédség győjteményébıl származtak. A fenti módszert alkalmazva a Kis-Balaton területérıl származó iszapminták ugyancsak feldolgozásra kerültek. A totál DNS kivonása a minták 0,25 g-jából, PowerSoil DNS izoláló kit (MoBio, USA) felhasználásával történt, a gyártó javaslatai szerint. Pozitív kontrollként minden esetben a C típusú Clostridium botulinum 2145-ös, illetve 2279-es törzsei szolgáltak (forrás: F. Gessler, Georg August University of Goettingen, Institute for Applied Biotechnology in the Tropics, Göttingen, Németország). A metódus érzékenységének meghatározása e két kontroll törzs DNS-ébıl készített, öt tagú (10 1 x 10 5 x) hígítási sor olvadáspont-analízisével történt, a TAPONEN és mtsai. /2009/ által leírt összefüggés segítségével. A szóban forgó DNS-ek kiindulási koncentrációjának meghatározásához NanoDrop ND-2000 spektrofotométer (Thermo Scientific, USA) került felhasználásra. 70

71 A PCR reakciók során keletkezett termékek elkülönítése chip-elektroforézissel, Agilent 2100 Bioanalyzer készülék (Agilent, USA) segítségével került lefolytatásra Lux primer-alapú real-time PCR reakciók A C. botulinum BoNT/C 1 génjére specifikus LUX primerek megtervezése az Invitrogen D-LUX primertervezı programjával (http://escience.invitrogen.com/lux/index.jsp) történt. Az eredmények Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primerblast/) illetve Oligo Analyzer programok (http://www.softpedia.com/get/science- CAD/Oligo-Analyzer.shtml) segítségével lefolytatott visszaellenırzését követıen, a primerek GC arányának és olvadáspontjának közelítése vált szükségessé. Ennek érdekében, a fent említett programok felhasználásával, némileg módosított primerek kerültek megtervezésre, majd legyártásra (Kromat, Magyarország). A reverse, fluorogén primer szintetizálására a LUX mintájára, FAM (foszforamidit) fluorofórral jelölve került sor, míg a forward primer jelöletlen maradt. A D-LUX program által tervezett illetve a módosított primerek szekvenciái a függelékben találhatók. A LightCycler 1.5 készüléken lefuttatott real-time PCR reakciók 20 µl végtérfogatú reakcióelegyeinek összetétele (a kezdeti sikertelenséget tapasztalva) folyamatosan változtatásra, finomításra került csakúgy, mint maguk a PCR protokollok. Az optimalizálás részleteit a függelék tartalmazza. A reakciómixhez felhasznált összetevık a következık voltak: PicoMaxx High Fidelity PCR System ez egyben tartalmazza a 2,5 U/µl koncentrációjú enzimet és a 10x-es reakciópuffert is (Agilent, USA), MgCl 2 (Thermo Scientific, USA), dntp (Fermentas, USA), BSA (10%; Calbiochem, USA), forward és reverse primerek, illetve PCR víz (AccuGENE; Lonza, Svájc). A vizsgálatok során pozitív kontrollként a C típusú Clostridium botulinum 2145-ös és 2279-es törzsei szolgáltak. 71

72 3.3. A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, tenyésztéssel E munka célja C típusú, toxintermelı Clostridium botulinum törzsek izolálása volt, a Kis-Balaton területének különbözı pontjairól származó iszapmintákból, klasszikus mikrobiológiai módszerek felhasználásával. Az egyes iszapokból egyenként kb. 3,5 g nedves tömegő mintarészlet került bemérésre 10-10, egyenként 5 ml DRCM-et vagy Holmann táplevest tartalmazó csıbe. A csövek paraffinnal történı lezárását követıen 70 C-on, 15 percig tartó hıkezelés következett vízfürdıben, a vegetatív formájú baktériumok elpusztítása céljából, majd órán át tartó inkubálás, 37 C hımérsékleten. Ezt követıen a mintákból egyenként 50 µl szélesztése történt FeCl 3 -dal kiegészített, módosított McClung-Toabe EYA illetve CCFA táptalajok felszínére, majd a lemezek anaerob edényben (Merck, Németország) történı inkubálása következett 37 C-on, 48 órán át, aerob kontroll alkalmazása mellett. A módosított EYA összetételét a függelék tartalmazza. A lecitináz és lipáz pozitivitást mutató telepek TPGY táplevesben kerültek inkubálásra, 37 C-on, 48 órán át. Az egyes telepek és az azokat létrehozó mikrobák telepmikroszkóp illetve fáziskontraszt mikroszkóp segítségével történı morfológiai vizsgálatára az inkubálást követıen került sor. A hemolízis vizsgálatára a TPGY táplevesben nevelt tenyészetekbıl egyenként 50 µl szélesztése történt meg, 3% birkavért tartalmazó Columbia véresagarra, anaerob feltételek mellett tenyésztve, 37 C-on, 48 órán át, aerob kontroll alkalmazása mellett. A β-hemolízist mutató telepek felszaporítása 37 C-on, 24 órán át tartott TPGY illetve Holmann táplevesben, majd ezek vizsgálata következett API 20A gyorsteszt (biomérieux, Franciaország), illetve a FRANCIOSA és mtsai. /1996/ által kidolgozott, BoNT/C 1 gén-specifikus PCR reakció segítségével. 72

73 4. EREDMÉNYEK 4.1. A környezeti tényezık statisztikai vizsgálata Vízminıségi adatok Bár egyik vízminıségi paraméter esetében sem volt felfedezhetı szignifikáns különbség abban az esetben, ha egytényezıs varianciaanalízis segítségével azok vizsgálata együtt történt (8. táblázat), a kétmintás párosított t-próbák szignifikáns (P<0,05) különbséget mutattak a vízhımérsékletben, ph-ban, az oldott oxigén- és a szervesanyag-tartalomban a MK mintavételi helyek MK évek és a MK mintavételi helyek AK évek között (1. és 2. csoport), illetve a ph-ban, az oldott oxigén- és a szervesanyag-tartalomban az AK mintavételi helyek MK évek és az AK mintavételi helyek AK évek között (3. és 4. csoport; 9. táblázat), ha a mintavételi pontok vizsgálata külön-külön zajlott. A 9. táblázat adatai ugyanakkor arra is rávilágítanak, hogy az eredmények nem mindig korrelálnak a madár-botulizmus kitörésekkel. Annak ellenére, hogy az oldott oxigéntartalom értékek két esetben szignifikánsan (P<0,05) magasabbak voltak a MK, mint az AK mintavételi ponton, egy esetben ennek épp a fordítottja jelentkezett. A szervesanyag-tartalom értékek a 3-ból csak 2 esetben voltak szignifikánsan magasabbak a MK, mint az AK mintavételi ponton. Meglepı módon, szignifikánsan alacsonyabb vízhımérsékleti érték adódott egy MK mintavételi ponton, mint az AK párjánál, és 5- bıl 5 MK ponton szignifikánsan alacsonyabb ph értékek mutatkoztak, mint AK párjaikon. Ezzel együtt, az utóbbiak még mindig a magas kockázatú, ph 7,5-9,0 intervallumban mozogtak /ROCKE, 2006/. A további kombinációk (1.-3., 2.-4., és csoport) esetében a várakozásnak megfelelıen a kétmintás párosított t-próbák valamennyi esetben szignifikáns különbséget mutattak, egy kivétellel: a 2. és 3. csoport közti vezetıképességgel. 8. táblázat. Szignifikancia-értékek a vízminıségi paraméterek egytényezıs varianciaanalízise során. Paraméter F-érték Szignifikancia vízhımérséklet 0,758 0,534 ph 0,700 0,566 vezetıképesség 2,067 0,145 oldott oxigén-tartalom 0,230 0,874 szervesanyag-tartalom 2,050 0,147 73

74 9. táblázat. Szignifikáns (P<0,05) különbséget mutató vízminıségi paraméterek az illetve a csoport között. Összehasonlított Mintavételi Vízhımérséklet Oldott oxigén Szerves anyag ph csoportok pontok ( C) (mg/l) (mg/l) 1. csoport; 2. csoport 9 89,00; 127,10 1. csoport; 2. csoport 202 7,71; 8,37 2,45; 6,29 1. csoport; 2. csoport ,40; 20,30 7,58; 7,97 3. csoport; 4. csoport 205 7,62; 8,06 0,97; 1,55 65,30; 22,20 3. csoport; 4. csoport 210 7,64; 7,94 51,90; 41,90 3. csoport; 4. csoport z27 7,95; 8,17 2,11; 1,38 Mivel az egytényezıs varianciaanalízis csupán a paraméterek elkülönült vizsgálatát teszi lehetıvé, azok együttes elemzése diszkriminancia analízis segítségével történt. A predikciós értékek a kezdeti csoportosítás (7. táblázat) helyességét együttesen 70,1%-ban igazolták (egyenként 58,5% illetve 11,6%; 10. táblázat). Amint azt a diszkrimináló függvények megmutatták, a kezdetben csoportosított mintavételi pontok 80,0%-ban (16/20) helyesen kerültek az 1., 2., 3. vagy 4. csoportba (11. táblázat), ekképpen erısítve meg a korábban feltételezett kapcsolatot a madár-botulizmus kitörések és a mintavételi helyek vízminıségi jellemzıi között. A fennmaradó esetekben egyéb, eddig nem vizsgált faktorok (pl. vízszint-ingadozások, áramlási viszonyok, növényborítottság, a vegetáció faji összetétele) szerepével is számolni kell. Az egyes csoportok diszkrimináló függvények szerinti elkülönülését a 9. ábra mutatja. 10. táblázat. A diszkrimináló függvények jellemzıi. Diszkrimináló fgv.-ek (DF) Sajátérték (λ) Kanonikus korreláció (r=λ/(1+λ)) Predikció % (λr2/σλ) Kumulatív % A predikció szignifikanciája (P<0,05) DF1 3,514 0,882 58,5 58,5 DF2 1,056 0,717 11,6 70,1 DF3 0,099 0,301 0,2 70,3 11. táblázat. A kezdeti illetve a diszkriminancia analízisen alapuló csoportosítás összehasonlítása. Kezdeti csoportosítás A predikált csoportok összetétele Összesen

75 9. ábra. Az egyes csoportok elkülönülése a diszkrimináló függvények által Meteorológiai adatok Bár szignifikáns különbségek nem adódtak az AK és MK évek június és szeptember közti idıszaka napi minimum-, maximum- és középhımérsékleteinek egytényezıs varianciaanalízissel történı összevetése során, a legalább 15 C minimum hımérséklető napok száma szignifikánsan (P<0,05) magasabb volt a MK, mint az AK években. Ez az eredmény mindenképp figyelemre méltó annak tükrében, hogy a C típusú Clostridium botulinum minimális szaporodási hımérséklete KEYMER és mtsai. /1972/ szerint épp 15 C. A legalább 30 C maximum hımérséklető illetve legalább 25 C középhımérséklető napok száma ugyancsak magasabb értéket mutatott a MK, mint az AK években, de ezek a különbségek nem bizonyultak szignifikánsnak. Érdekes módon, a legalább kétnapos és 30 C maximum hımérséklető periódusok száma magasabb volt az AK, mint a MK években, bár a különbség nem volt szignifikáns, a periódusok átlagos hossza pedig nagyobbnak mutatkozott a MK, mint az AK években. A konkrét értékekrıl a 12. táblázat tájékoztat. 75

76 12. táblázat. A vizsgált hımérsékleti paraméterek konkrét értékei. A vizsgált paraméter MK évek AK évek Szignifikancia (P<0,05) A napi minimum hım.-ek átlaga ( C) 13,16 12,85 A napi maximum hım.-ek átlaga ( C) 24,86 24,94 A napi középhım.-ek átlaga ( C) 18,90 18,95 A legalább 15 C minimum hım.-ő napok száma A legalább 30 C maximum hım.-ő napok száma A legalább 25 C átlaghım.-ő napok száma A minimum kétnapos, legalább 30 C max. hım.-ő periódusok száma A legalább 30 C maximum hım.-ő periódusok átlagos hossza (nap) 5,07 3,67 Minden elızetes várakozással ellentétben, a madár-botulizmus megbetegedések kialakulása szempontjából kedvezıbb csapadék-értékek minden esetben az AK évekhez kapcsolódtak: a napi csapadékösszeg egytényezıs varianciaanalízise során a MK évek (nem szignifikánsan) magasabb értéket mutattak, a száraz (csapadék nélküli) napok száma pedig szignifikánsan magasabb volt az AK, mint a MK években. Kétmintás párosított t-próbákat alkalmazva, a legalább kétnapos száraz periódusok száma és átlagos hossza szintén az AK évek fölényét mutatta, bár ezek a különbségek nem bizonyultak szignifikánsnak (13. táblázat). 13. táblázat. A vizsgált csapadék-eloszlási paraméterek konkrét értékei. A vizsgált paraméter MK évek AK évek Szignifikancia (P<0,05) A napi csapadékösszegek átlaga (mm) 2,32 2,26 A száraz (csapadékmentes) napok száma A legalább kétnapos száraz periódusok száma A legalább kétnapos száraz periódusok átlagos hossza (nap) 4,91 5, A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, PCR reakcióval Nested PCR reakció WILLIAMSON és mtsai. /1999/ alapján A tenyésztés nélküli vizsgálatok kapcsán hét-hét minta (5 üledék és 2 vakbéltartalom; hıkezelve illetve hıkezelés nélkül) feldolgozása történt meg, a BoNT/C 1 gén jelenlétére nézve, 390 reakció során. A jellegzetes, 225 bp mérető amplifikációs termék egy hıkezelt illetve egy hıkezeletlen üledékmintában volt megtalálható (10. ábra). Amint azt a PCR reakciók mutatták, a tenyésztési és izolációs procedúrát követıen három minta tartalmazta a kérdéses DNS fragmentumot (11. ábra). Az elkülönített termékek 76

77 16S rdns analízise, amely az Eötvös Loránd Tudományegyetem Természettudományi Kar Mikrobiológiai Tanszékén került lefolytatásra, mindhárom törzset Escherichia coliként azonosította (12. ábra; 14., 15., 16. táblázat). 10. ábra. A Kis-Balaton iszapjából izolált, BoNT/C 1 gén jelenlétét bizonyító, 225 bp mérető fragmentumok (tenyésztés nélküli PCR). 11. ábra. A kis-balaton iszapjából izolált, BoNT/C 1 gén jelenlétét bizonyító, 225 bp mérető fragmentumok (tenyésztést követı PCR). 77

78 12. ábra. 225 bp mérető DNS fragmentumok, C típusú C. botulinum kontroll törzsekbıl és a fals pozitivitást mutató izolátumokból elkülönítve (1: 100 bp DNS létra; 2: C. botulinum 468; 3: C. botulinum 2145; 4, 5, 6: Escherichia coli). 14. táblázat. A 16S rdns szekvenálások eredményei (a tíz legvalószínőbb találat): ZÉ 1 (4-es minta). 15. táblázat. A 16S rdns szekvenálások eredményei (a tíz legvalószínőbb találat): ZÉ 2A (5-ös minta). 78

79 16. táblázat. A 16S rdns szekvenálások eredményei (a tíz legvalószínőbb találat): ZÉ 3B (6-os minta) Hagyományos PCR reakció FRANCIOSA és mtsai. /1996/ alapján A többféle mintatípust érintı, 58 mérést magába foglaló vizsgálat során a WILLIAMSON és mtsai. /1999/ módszerével kapott, a BoNT/C 1 gén jelenlétére nézve negatív eredményeket e metódus is megerısítette, egy lényeges különbséggel: a korábban tapasztalt fals pozitív reakciók minden esetben negatívnak bizonyultak Módosított real-time PCR reakció, FRANCIOSA és mtsai. /1996/ alapján Mivel a C típusú Clostridium botulinum genomjának szekvenálása jelenleg is folyik, a különféle adatbázisokban csak részleges, ún. shotgun-szekvenciák találhatók. A módszer érzékenységének meghatározásához mindössze a SEBAIHIA és mtsai. /2007/ által publikált, A típusú Clostridium botulinum Hall törzsének (ATCC 3502) teljes genom-szekvenciája állt rendelkezésre. Ez, a bp mérető kromoszóma került kiegészítésre a BoNT/C 1 -termelésért felelıs 4463 bp mérető génnel, melynek szekvenciáját HAUSER és mtsai. /1990/ írták le. A további számítások lefolytatásához az ily módon bp-nak adódó genom-méret szolgált alapul. Az érzékenység vizsgálata céljából a C típusú Clostridium botulinum 2145-ös és es törzseinek DNS-ébıl öttagú ( x-es), tovafutó hígítási sor került elkészítésre. Az ezek PCR vizsgálata során létrejött amplifikációs görbéket, illetve az azokhoz tartozó crossing point értékeket a ábrák mutatják. 79

80 13. ábra. A 2145-ös C. botulinum kontroll törzsbıl kivont DNS különbözı hígításainak amplifikációs görbéi és crossing point értékei. 14. ábra. A 2279-es C. botulinum kontroll törzsbıl kivont DNS különbözı hígításainak amplifikációs görbéi és crossing point értékei. Amint az a ábrákon látható, a 2145-ös törzs DNS-e egészen a 10 4 x-es hígításig kimutatható, míg a 2279-es törzs esetében a kimutathatóság határa a 10 3 x-os hígítás. A szóban forgó DNS-ek kiindulási koncentrációja sorrendben 46,5 illetve 29,1 ng/µl nek adódott. Mivel egy-egy reakcióhoz 2 µl templát került felhasználásra, a kimutatási határ a 2145-ös törzsnél 9,3 pg, a 2279-es törzsnél pedig 58,2 pg DNS. Az érzékenység meghatározásához a TAPONEN és mtsai. /2009/ által leírt összefüggés szolgált alapul: 80

81 , ahol: n: a célszekvencia kópiáinak száma µl-enként (kópia/ µl), N A : Avogadro-állandó (mol -1 ) {6,023x10 23 }, m: a target DNS tömege a reakcióelegyben (g) {2145: 9,13x10-12 ; 2279: 5,82x10-11 } M w : 1 bp átlagos moláris tömege (g/mol) {kettıs szálú DNS esetén kb. 660}, L: a target DNS hossza (bp) {jelen esetben } A rendelkezésre álló adatok alapján elvégzett számítások szerint a továbbfejlesztett realtime módszer kimutatási határa mindössze 0,0802 genom-ekvivalens (C. botulinum 2145) illetve 1,2 genom-ekvivalens (C. botulinum 2279), szemben a FRANCIOSA és mtsai. /1996/ által leírt hagyományos PCR reakció 15 spórás értékével. 15. ábra. A 2145-ös és 2279-es C. botulinum kontroll törzsekbıl kivont DNS különbözı hígításainak olvadáspont-analízise. 81

82 16. ábra. A 2145-ös C. botulinum kontroll törzsekbıl kivont DNS különbözı hígításainak olvadáspont-analízise. 82

83 17. ábra. A 2279-es C. botulinum kontroll törzsekbıl kivont DNS különbözı hígításainak olvadáspont-analízise. A módszer olvadáspont-analízissel történı specificitás-vizsgálata során bebizonyosodott, hogy a kísérletbe vont fajok egyike sem rendelkezik a C típusú Clostridium botulinum-ra jellemzı melting görbével. Az elektroferogramok értékelése ugyancsak megerısítette a metódus specifikus voltát. A konkrét eredményekrıl a ábra, illetve a 17. táblázat számol be. 83

84 18. ábra. A specificitás-vizsgálat során kapott olvadáspont-görbék. 17. táblázat. Az olvadáspont-analízishez kapcsolódó pontos melting értékek. A minta száma A vizsgált kórokozó faja Olvadáspont ( C) 1. Clostridium botulinum ,82 2. Clostridium botulinum ,69 3. Clostridium difficile 81,78 4. Clostridium perfringens 81,43 5. Pseudomonas aeruginosa 87,84 6. Klebsiella pneumoniae 96,54 7. Campylobacter jejuni 82,09 8. Escherichia coli O157:H7 87,92 9. Bacillus anthracis 87, Bacillus subtilis 87, Bacillus thuringiensis 83, Streptococcus pyogenes 82, Streptococcus pneumoniae 84, Enterococcus faecium 89, Staphylococcus aureus 81, Corynebacterium diphteriae 91, Neisseria meningitidis 85, Legionella pneumophila 83, Negatív kontroll 81,91 84

85 19. ábra. A specificitás-vizsgálathoz kapcsolódó elektroferogramok. A felsı, vízszintes sorban található számokhoz tartozó minták a következık: 1) Clostridium botulinum 2145, 2) Clostridium botulinum 2279, 3) Clostridium difficile, 4) Clostridium 85

86 perfringens, 5) Pseudomonas aeruginosa, 6) Klebsiella pneumoniae, 7) Campylobacter jejuni, 8) Escherichia coli O157:H7, 9) Bacillus anthracis, 10) Bacillus subtilis, 11) Bacillus thuringiensis, 12) Streptococcus pyogenes, 13) Streptococcus pneumoniae, 14) Enterococcus faecium, 15) Staphylococcus aureus, 16) Corynebacterium diphteriae, 17) Neisseria meningitidis, 18) Legionella pneumophila, 19) Negatív kontroll. A Kis-Balaton területérıl származó 175 iszapminta DNS-ének feldolgozása során sem az olvadáspont-analízis, sem az azt követı chip-elektroforézis nem utalt C típusú Clostridium botulinum jelenlétére. Érdekes módon, a vizsgálatok egy részében az irodalomban közölt, 615 bp mérető termékhez képest a kontroll törzsek néhány tíz bp eltérést mutattak. Ezzel együtt, az elektroferogramok értékelhetıségét ez a (módszer jellegébıl adódó) eltérés jelentısen nem befolyásolta Lux primer-alapú real-time PCR reakciók Bár a LUX primerek tervezése során rendelkezésre álló adatok a BoNT/C 1 gén-specifikus reakciók sikeres lezajlásával kecsegtettek, a gyakorlat sajnos mégsem igazolta a kezdeti optimizmust. Értékelhetı eredmények a PCR profil egyes elemeinek és a reakcióelegy összetételének szisztematikus változtatásával, finomításával sem születtek A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, tenyésztéssel Bár a klasszikus mikrobiológiai vizsgálatok során több olyan baktériumtörzset sikerült izolálni, amely morfológiailag (akár mikroszkóposan, akár makroszkóposan) illetve fıbb biokémiai tulajdonságait tekintve ráillett a Clostridium botulinum C típusára (obligát anaerob, nem proteolitikus, lecitináz és lipáz aktív, β-hemolizáló lásd 2. táblázat), sem az API 20A-val nyert szénhidrát-fermentációs mintázatok, sem a BoNT/C 1 gén-specifikus PCR reakciók nem erısítették meg a toxintermelı, C típusú Clostridium botulinum jelenlétét. Elıbbi vizsgálatok a következı mikrobákat azonosították: C. perfringens, C. paraputrificum, C. sordellii és C. cadaveris. 86

87 5. KÖVETKEZTETÉSEK, JAVASLATOK 5.1. A környezeti tényezık statisztikai vizsgálata A vizsgált idıszakok vízminıségi és meteorológiai adatainak elemzése hazánkban is megerısíteni látszik a korábbi nemzetközi tapasztalatokat. Bár néhány esetben sikerült statisztikailag megalapozott eltérésekre bukkanni a madár-botulizmus szempontjából alacsony illetve magas kockázatú években, máskor a megbetegedések a látszólag legkedvezıbb feltételek együttállása esetén is elmaradtak, ugyanakkor a legmostohább körülmények között is felléptek. Annak ellenére, hogy a meteorológiai adatok a legtöbb esetben sokkal könnyebben győjthetık és hozzáférhetık, mint egy adott élıhely vízminıségi paraméterei, a vizsgálati eredmények alapján önmagukban kevésbé megbízhatóan használhatók a kitörések környezeti szempontból történı igazolására, illetve elırejelzésére A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, PCR reakcióval Nested PCR reakció WILLIAMSON és mtsai. /1999/ alapján A tény, hogy egy adott DNS fragmentum a cél organizmustól eltérı (mikro)organizmusokban is fellelhetı, mindenképpen különös figyelmet érdemel, fıként akkor, ha mint ebben az esetben egy screening módszerrıl van szó. A fenti tapasztalatok figyelembe vételével kijelenthetı, hogy a szóban forgó BoNT/C 1 génspecifikus PCR metódus önmagában nem alkalmazható a madár-botulizmus etiológiai megerısítésére. E technika további módszerekkel (például egéroltás, ELISA, 16S rdns szekvenálás) kombinálva megbízhatóbb eredményeket adhat. Sajnálatos módon csak kisszámú közlemény olvasható e PCR alapú metódus más módszerekkel történı összevetésével kapcsolatban. ZECHMEISTER és mtsai. /2002; 2005/ jóval több üledék- és ürülékmintát találtak pozitívnak a fent ismertetett, BoNT/C 1 gén-specifikus, tenyésztés nélküli és tenyésztést követı PCR-rel, mint ELISA-val vagy egéroltással (az összes minta 75%-a, 83%-a, 56%-a illetve 53%-a, sorrendben). Olyan, jelentısnek tartott faktorok mellett, mint a felhasznált módszer érzékenysége, a BoNT/C 1 gén bevitelére alkalmas Clostridium illetve egyéb mikrobafajok jelenléte, az 87

88 esetleges fals pozitív eredményeket adó fakultatív vagy szigorú anaerob mikrobák is befolyásolhatják e vizsgálatok eredményeit Hagyományos PCR reakció FRANCIOSA és mtsai. /1996/ alapján Kísérleteinkben a módszer a nested technikánál könnyebben és gyorsabban kivitelezhetınek mutatkozott, emellett nagy elınyeként említhetı meg, hogy az utóbbi metódus kapcsán tapasztalt fals pozitív reakciók sem jelentkeztek. Mindezek alapján úgy tőnik, e módszer a madár-botulizmus megbetegedések diagnosztikájában nagyobb biztonsággal használható Módosított real-time PCR reakció, FRANCIOSA és mtsai. /1996/ alapján A módszer egyik legfıbb elınye gyorsaságában rejlik: a real-time környezetbe átültetett mérés mindössze harmad annyi ideig tart, mint az eredeti reakció: elıbbi 68 percet vesz igénybe (a melting analízist is beleértve), szemben a hagyományos reakció 205 perces idıtartamával. Mivel a megbízhatóan mőködı olvadáspont-analízis szükségtelenné teszi a gél-elektroforézis elvégzését, e lépés elhagyásával további idıt (és költséget) takaríthatunk meg. A PCR reakciók során felhasznált LightCycler FastStart DNA Master SYBR Green I kit összetétele a rekcióelegy összeállítását még egyszerőbbé és gyorsabbá teszi, hiszen a reakciópuffer már tartalmazza az enzimet és a dntp-t is. Egyetlen hátrányát viszonylag magas ára jelenti, ezért az ennek helyettesítésére használható, megfelelı minıségő kitek keresése jelenleg is folyik. A módszer érzékenységét befolyásoló genom-méret addig sajnos csak becsülhetı, amíg a C típusú Clostridium botulinum teljes genom-szekvenciája feltárásra nem kerül. A rendelkezésre álló adatok alapján elvégzett számítások a FRANCIOSA és mtsai. /1996/ által leírt hagyományos PCR reakció kimutatási határhoz képest legalább tízszeres érzékenység-emelkedést mutatnak a továbbfejlesztett real-time metódus esetében. Bár az értékelhetıséget jelentısen nem befolyásolja, a chip-elektroforézis során a publikált és jelen dolgozatban néhány esetben tapasztalt termék-hossz beli eltérés feltárására a kérdéses fragmentumok szekvenálása mindenképp megnyugtató volna; az erre irányuló vizsgálatok folyamatban vannak. 88

89 Lux primer-alapú real-time PCR reakciók Talán a tervezés során elıre vetített eredmények és a késıbbi alkalmazhatóság között tapasztalt éles ellentét az oka, hogy a LUX primerek használata más real-time rendszerekével összehasonlítva kevésbé elterjedt. Tény, hogy a BoNT/C 1 gén viszonylagos rövidsége és nukleotid-sorrendje nem segíti elı a legmegfelelıbb indító szekvenciák létrehozását. Ennek figyelembevételével a LUX primer rendszer alkalmazhatóságát a jelölés sikerességének, illetve a tervezés egyes lépéseinek még gondosabb ellenırzésével érdemes volna tovább vizsgálni, akár egy új cél-gén keresésének árán is A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, tenyésztéssel A hagyományos, tenyésztéses izolálási módszer alkalmazásáról a feldolgozott nemzetközi irodalomban alig esik említés (pl. FRANCIOSA és mtsai. /1996/). Utóbbi esetben a munka madár-botulizmus kitörések során győjtött mintákon került lefolytatásra, ezért a kórokozó nagymértékő felszaporodása révén annak megtalálási valószínősége is jelentısen megnıtt. Amennyiben, mint jelen dolgozat esetében is, az így idızített mintavételek nem megoldhatók, a talaj (illetve iszap) legtöbbször népes Clostridium-flórájából igen nagy próbatételt jelent egy adott faj elkülönítése. OCEPEK és mtsai. /2007/ eredményei szintén ezt a tényt erısítik meg. Bár a szerzık több olyan Clostridium-fajt (C. botulinum/c. sporogenes, C. glycolicum, C. sporogenes, C. perfringens, C. subterminale és C. hastiforme) izoláltak, melyek részben API 20Aval nyert biokémiai tulajdonságai megegyeztek a Clostridium botulinum C típusáéval, a BoNT/C 1 gén-specifikus PCR reakciók ezekben az esetekben sem utaltak toxintermelésre. A kísérletek alapjául szolgáló iszapminták csak a megbetegedéseket követı évben kerültek begyőjtésre, ugyanakkor egy, a madár-botulizmus kitörés során elhullott tıkés récébıl a kórokozó elkülönítése sikeresen megtörtént. Ebbıl adódóan a kutatócsoport a feldolgozott minta típusát, a mikrobák felszaporodásának lehetıségét (akár a madártetemekben, akár a talajban/iszapban), illetve ehhez kapcsolódóan a mintagyőjtés idejét az izolálás eredményessége szempontjából alapvetı fontosságúnak tekinti. 89

90 A korábban említett hátrányokhoz társulva sajnos mindmáig nem létezik olyan szelektív táptalaj, amely a C típusú (illetve egyéb, nem proteolitikus) Clostridium botulinum törzsek könnyebb izolálását tenné lehetıvé. Bár az A, B, F és G típusú, proteolitikus törzsek vizsgálatára a CBI és BSM agarok elterjedten használtak, ezek trimetoprimtartalma a nem proteolitikus mikrobák szaporodását gátolja /VU, 2006/. Részben a fent felsorolt indokokból fakadóan, az izolálás és identifikálás nagy szakmai gyakorlatot igénylı feladatait a rutin diagnosztikában szinte minden esetben elhagyják, helyette a toxinkimutatást, esetleg molekuláris biológiai technikákat alkalmazva. Ezzel együtt az efféle vizsgálatok az egyes Clostridium botulinum törzsek biokémiai tulajdonságainak megismeréséhez, illetve összehasonlításához elengedhetetlenül fontosak volnának a megfelelı, egységes vizsgálati metodika kidolgozását követıen 5.4. Javaslatok a madár-botulizmus megbetegedések megelızése illetve kártételének csökkentése érdekében A madár-botulizmussal kapcsolatba kerülı állattartók illetve természetvédelmi és egyéb szakemberek számára a saját vizsgálatok és a szakirodalmi tapasztalatok alapján a következı intézkedések javasolhatók a megbetegedések létrejöttének kiküszöbölésére és azok negatív hatásainak csökkentésére: a. A madár-botulizmus gyanújának felmerülését követıen a lehetı leghamarabb meg kell kezdeni az érintett állományok lehajtását a fertızött terület(ek)rıl, biztosítva a madarak elzárását, táplálékkal illetve ivóvízzel történı ellátását. Mivel természetes élıhelyeken ennek kivitelezésére általában nincs lehetıség, ezekben az esetekben a fertızési gócpontoktól való folyamatos távol tartással (pl. motorcsónakkal történı közlekedés) hasonló eredmény érhetı el. b. Amennyiben a kérdéses területen madártetemek találhatók, úgy azokat haladéktalanul és rendszeresen el kell távolítani és meg kell semmisíteni, hiszen az elhullott madarak további fertızési forrást jelentenek. A beteg, legyengült állatokat fajtársaik 90

91 elıszeretettel csipkedik, eközben toxint véve fel azok véráramából. Ezért a megbetegedett madarakat mindenképpen el kell különíteni, s lehetıség szerint gondoskodni kell gyógykezelésükrıl. c. A sekély, könnyen felmelegedı (és így oxigénszegénnyé váló) viző parti sávokat és egyéb, alacsony vízborítottságú területeket meder- és partszegély-rendezéssel ki kell mélyíteni. Amennyiben az állattartó telepen elárasztással kívánnak tavakat létrehozni, annak megkezdése elıtt a növényzetet maradéktalanul ki kell irtani. d. A madár-botulizmus kitörések fertızı betegségekhez hasonló lefolyása miatt az állattartó telepeken az állományméretek gondos megválasztása javasolt. Természetes élıhelyeken törekedni kell annak elkerülésére, hogy egy adott területen túl sok madár zsúfolódjon össze. e. Az állattartó telepeken a vízfelszínen elhelyezett etetık helyét folyamatosan változtatni kell, a táplálékból származó szervesanyag-utánpótlás megszüntetésére. Emellett rendszeresen el kell végezni az itatók vizének ellenırzését, s azok talajjal történı szennyezıdése esetén a vizet haladéktalanul le kell cserélni. f. Bár tenyésztett állományokban lehetıség van a madarak vakcinával történı védelmére, természetes élıhelyeken ennek alkalmazása a hatalmas anyagi terhek és a nagy kiterjedéső területek okán - sajnos gyakorlatilag kizárt. 91

92 6. ÖSSZEFOGLALÁS Munkánk során hazánkban elsıként mutattunk ki statisztikailag is igazolható összefüggéseket néhány környezeti paraméter (levegı- és vízhımérséklet, ph, oldott oxigén- és szervesanyag-tartalom) és a madár-botulizmus fellépése között a Kis-Balaton területén, ahol e megbetegedés rendszeresen elıfordul. További eredményeink megerısítik azokat a nemzetközi irodalomban publikált következtetéseket, melyek szerint bár a vízhımérséklet, ph, sótartalom, redoxpotenciál és gerinctelen biomassza befolyásolja a madár-botulizmus kitörések kialakulását /ROCKE és mtsai., 1999; ROCKE SAMUEL, 1999/, néhány faktor mégsem különbözik következetesen a megbetegedések által érintett és az azoktól mentes élıhelyeken /ROCKE és mtsai., 1999/. E tapasztalatokból kiindulva a jövıben más, eddig ismeretlen tényezık szerepének vizsgálata is indokolt lehet. A kórokozó klasszikus mikrobiológiai módszerek segítségével, a Kis-Balaton magas megbetegedési kockázatot jelentı pontjairól származó iszapmintákból történı kimutatása kapcsán több, Clostridium botulinum-ra emlékeztetı Clostridium-fajt különítettünk el, ezek további vizsgálata azonban nem utalt botulinum toxin termelésére. Szerencsés lett volna a mintavételeket konkrét kitörésekhez kapcsolódóan elvégezni, erre azonban esetünkben nem nyílt lehetıség. OCEPEK és mtsai. /2007/ szintén a mintavételek idızítésének fontosságára hívták fel a figyelmet, miután egy, a madár-botulizmusban elhullott tıkés récébıl a baktérium elkülönítését sikeresen elvégezték, ugyanakkor az azt követı évben, iszapmintákból sikertelenül próbálták meg izolálni a kórokozót. A C típusú, neurotoxin-termelı Clostridium botulinum mikrobák jelenlétének iszapmintákból, molekuláris biológiai módszerekkel történı detektálása céljából néhány, a nemzetközi irodalomban fellelhetı metódus alkalmazhatóságát vizsgáltuk, Magyarországon elsıként. A minták szintén a Kis-Balaton madár-botulizmus szempontjából magas megbetegedési kockázatú pontjairól kerültek begyőjtésre. A WILLIAMSON és mtsai. /1999/ által leírt nested PCR technika alkalmazása során fals pozitív eredményeket kaptunk. Az elkülönített termékek 16S rdns analízise Escherichia coli organizmusok jelenlétét igazolta, így a fent említett módszer megbízhatósága kérdésessé vált. 92

93 Tapasztalataink alapján a FRANCIOSA és mtsai. /1996/ által publikált hagyományos PCR metódus az elızınél egyszerőbbnek és érzékenyebbnek bizonyult. Így ennek alapjait felhasználva elsıként dolgoztunk ki egy olyan, olvadáspont-analízissel kiegészített, LightCycler-alapú real-time PCR módszert, amely jellegénél fogva még egyszerőbben, gyorsabban és nagyobb érzékenységgel képes a C típusú, neurotoxintermelı Clostridium botulinum jelenlétének kimutatására. Mindezek mellett kísérletet tettünk egy általunk tervezett, hairpin-struktúrájú primer-pár segítségével lefolytatható real-time PCR reakció kidolgozására is, amely madárbotulizmus esetek kapcsán ezideig nem került publikálásra. Kutatásaink eredményeképpen, a már meglévı technikák mellett az általunk továbbfejlesztett real-time procedúra egy újabb eszköz lehet a megbetegedések hátterének pontosabb feltárásában. 93

94 7. FELHASZNÁLT IRODALOM ACKERMANN, H.-W. /1974/: La classification des bactériophages de Bacillus et Clostridium. Panthol. Biol., pp. ACKERMANN, H.-W. DUBOW, M. S. /1987/: Viruses of Prokaryotes, Vol. II.: Natural Groups of Bacteriophages. CRC Press, Boca Raton, California pp. AKBULUT, D. GRANT, K. A. MCLAUCHLIN, J. /2004/: Development and application of Real-Time PCR assays to detect fragments of the Clostridium botulinum types A, B, and E neurotoxin genes for investigation of human foodborne and infant botulism. Foodborne Pathog. Dis., pp. ARNON, S. S. SCHECHTER, R. INGLESBY, T. V. HENDERSON, D. A. BARTLETT, J. G. ASCHER, M. S. EITZEN, E. FINE, A. D. HAUER, J. LAYTON, M. LILLIBRIDGE, S. OSTERHOLM, M. T. O'TOOLE T. PARKER, G. PERL, T. M. RUSSELL, P. K. SWERDLOW, D. L. TONAT, K. /2001/: Botulinum Toxin as a Biological Weapon: Medical and Public Health Management. JAMA, pp. BALL, G. T. BOLLINGER, M. CONLY, B. MACFARLANE, B. MURKIN, H. MURPHY, T. PYBUS, M. J. ROCKE, T. SAMUEL, M. SHARP, D. WOBESER, G. /1998/: Report to the Prairie Habitat Joint Venture by the working group on avian botulism. Canadian Cooperative Wildlife Health Centre, Saskatoon, Saskatchewan, Canada. BARR, J. R. MOURA, H. BOYER, A. E. WOOLFITT, A. R. KALB, S. R. PAVLOPOULOS, A. MCWILLIAMS, L. G. SCHMIDT, J. G. MARTINEZ, R. A. ASHLEY, D. L. /2005/: Botulinum neurotoxin detection and differentiation by mass spectrometry. Emerg. Infect. Dis., 11. ( ) BARTHA, T. SZTOJKOV, V. /1978/: Botulizmus járványos elıfordulása víziszárnyasoknál. Egészségtudomány, pp. 94

95 BELL, J. SCIPLE, G. HUBERT, A. /1955/: A microenvironment concept of the epizoology of avian botulism. J. Wild. Man., pp. BENFENATI, F. VALTORTA, F. /1995/: Neuroexocytosis. Curr. Top. Microbiol. Immunol., pp. BENGSTON, I. A. /1922/: Preliminary note on a toxin-producing anaerobe isolated from the larvae of Lucilia caesar. Public Health Rep., pp. BERGEY S MANUAL OF DETERMINATIVE BACTERIOLOGY, 8 th edition /1974/. Co-editors: BUCHANAN, R. E. GIBBONS, N. E. The Williams & Wilkins Company, Baltimore pp. BLAKER, D. /1967/: An outbreak of botulinus poisoning among waterbirds. The Ostrich, p. BLOCK, W. ERZINCLIOGLU, Y. Z. WORLAND, M. R. /1988/: Survival of freezing in Calliphora larvae. Cryo-Lett., pp. BME (BUDAPESTI MŐSZAKI EGYETEM) /2011/: A PCR technika és alkalmazási területei. hnika%20%e9s%20alkalmaz%e1si%20ter%fcletei2.pdf ( ) BORLAND, E. D. MORYSON, C. J. SMITH, G. R. /1977/: Avian botulism and the high prevalence of Clostridium botulinum in the Norfolk Broads. Vet. Rec., pp. BOROFF, D. REILLY, J. /1962/: Studies of the toxin of Clostridium botulinum. Int. Arch. Allergy, pp. BRETT, M. M. /1998/: Evaluation of the use of the biomerieux Rapid ID32 A for the identification of Clostridium botulinum. Lett. Appl. Microbiol., pp. BRITTAIN, S. M. WANG, J. BABCOCK-JACKSON, L. CARMICHAEL, W. W. RINEHART, K. L. CULVER, D. A. /2000/: Isolation and characterisation of microcystins, 95

96 cyclic heptapeptide hepatotoxins from a Lake Erie strain of Microcystis aeruginosa. J. Great Lakes Res., pp. COHEN, G. /1970/: Studies on the resistance of roosters and vultures to type A botulinal toxin. Ph. D. dissertation; The Florida State University, College of Arts and Sciences. COOCH, F. G. /1964/: A preliminary study of the survival value of a functional salt gland in prairie Anatidae. Auk, pp. CSABA, GY. /1996/: Halpusztulások vizsgálata a Kis-Balatonon ( ). 2. Kis- Balaton Ankét, (Összefoglaló értékelés a KBVR közötti kutatási eredményeirıl.) Pannon Agrártudományi Egyetem SZTIK Nyomdája, Keszthely pp. DAVIES, W. M. /1929/: Hibernation of Lucilia sericata (Mg.). Nature (London), pp. DEZFULIAN, M. HATHEWAY, C. L. YOLKEN, R. H. BARTLETT, J. G. /1984/: Enzymelinked immunosorbent assay for detection of Clostridium botulinum type A and type B toxins in stool samples of infants with botulism. J. Clin. Microbiol., pp. DUNCAN, R. M. JENSEN, W. I. /1976/: A relationship between avian carcasses and living invertebrates in the epizootiology of avian botulism. J. Wildl. Dis., pp. EKLUND, M. POYSKY, F. /1972/: Activation of a toxic component of Clostridium botulinum types C and D by tripsin. Appl. Microbiol., pp. EKLUND, M. W. POYSKY, F. T. REED, S. M. SMITH, C. A. /1971/: Bacteriophage and the toxicity of Clostridium botulinum type C. Science, pp. EKLUND, M. W. POYSKY, F. T. REED, S. M. /1972/: Bacteriophage and the toxicity of Clostridium botulinum type D. Nature New Biol., pp. 96

97 EKLUND, M. W. POYSKY, F. T. /1974/: Interconversion of Type C and D Strains of Clostridium botulinum by Specific Bacteriophages. Appl. Microbiol., pp. EKLUND, M. W. POYSKY, F. T. HABIG, W. H. /1989/: Bacteriophages and plasmids of Clostridium botulinum and Clostridium tetani and their relationship to production of toxins. In: SIMPSON, L. L. (ed.): Botulinum Neurotoxin and Tetanus Toxin. Academic Press, London pp. EVELSIZER, D. D. /2003/: Management of avian botulism and survival of molting mallards. Dissertation, University of Saskatchewan, Saskatoon, Saskatchewan, Canada. EVELSIZER, D. D. CLARK, R. G. BOLLINGER, T. K. /2010/: Relationships between local carcass density and risk of mortality in molting mallards during avian botulism outbreaks. J Wildl Dis., pp. FEILER, M. KÖHLER, B. /1977/: Massensterben von Wasservögeln durch Botulismus auf der Potsdamer Havel im Sommer Der Falke, pp. FERREIRA, J. MASLANKA, S. JOHNSON, E. GOODNOUGH, M. /2003/: Detection of botulinal neurotoxins A, B, E, and F by amplified enzyme-linked immunosorbent assay: collaborative study. J. AOAC Int., pp. FERREIRA, J. L. ELIASBERG, S. J. EDMONDS, P. HARRISON, M. A. /2004/: Comparison of the mouse bioassay and enzyme-linked immunosorbent assay procedures for the detection of type A botulinal toxin in food. J Food Prot., pp. FISH, N. MITCHELL, W. BARNUM, D. /1967/: A report of a natural outbreak of botulism in pheasants. Can. Vet. J., pp. FRANCIOSA, G. FENICIA, L. CALDIANI, C. AURELI, P. /1996/: PCR for detection of Clostridium botulinum type C in avian and environmental samples. J. Clin. Microbiol., pp. 97

98 GAÁL, M. /2004/: A biometria számítógépes alkalmazásai a környezeti és agrártudományokban. Aula Kiadó, Budapest pp. GARRITY, G. M. BELL, J. A. LILBURN, T. G. /2004/: Taxonomic Outline of the Prokaryotes. Bergey s Manual of Systematic Bacteriology, Second Edition, Release 5.0. Springer-Verlag, New York. 24, pp. DOI: /bergeysputline GRAHAM, J. M. /1978/: Inhibition of Clostridium botulinum type C by bacteria isolated from mud. J. Appl. Bacteriol., pp. GRAHAM, J. M. SMITH, G. R. /1978/: Avian botulism in winter and spring and the stability of Clostridium botulinum type C toxin. Vet. Rec., pp. GRÜLL, A. RAUER, G. SAGMEISTER, H. /1987/: Ökologische Untersuchungen am Wasservogel-Botulismus im Seewinkel (Neusiedlerseegebiet). Arbeitsgemeinschaft Gesamtkonzept Neusiedler See Forschungsprojekt BC 7a Botulismus Endbericht GULYÁS, M. NÉMETH, ZS. RODLER, M. SIMON, J. NOVOTNY, T. /1998/: A botulizmus kialakulásának környezeti feltételei és a megelızés lehetıségei. Egészségtudomány, pp. HAAGSMA, J. /1973/: Die Etiologie En Epidemiologie Van Botulismus Bij Vatervogels In Nederland. Proefschrift; Faculteit der Diergeneeskunde, Rijksuniversiteit, Utrecht, Netherland pp. HAAGSMA, J. /1987/: Avian botulism in the Netherlands. In: EKLUND, M. W. AND DOWELL, V. R. (eds.): Avian Botulism: An International Perspective. Charles C. Thomas, Springfield, Illinois pp. HAAGSMA, J. OVER, H. J. SMITH, T. HOEKSTRA, J. /1972/: Botulism in waterfowl in the Netherlands in Neth. J. Vet. Sci., pp. 98

99 HALL, J. D. MCCROSKEY, L. M. PINCOMB, B. J. HATHEWAY, C. L. /1985/: Isolation of an organism resembling Clostridium barati which produces type F botulinal toxin from an infant with botulism. J. Clin. Microbiol., pp. HAQ, I. SUKADI, F. /1981/: Incidence of Clostridium botulinum in coastal and inland areas of west Java. Jap. J. Med. Sci. Biol., pp. HARIHARAN, H. MITCHELL, W. R. /1976/: Observations on Bacteriophages of Clostridium botulinum Type C Isolates from Different Sources and the Role of Certain Phages in Toxigenicity. Appl. Environ. Microbiol., pp. HATHEWAY, C. L. /1990/: Toxigenic clostridia. Clin. Microbiol. Rev., pp. HAUSER, D. EKLUND, M. W. KURAZONO, H. BINZ, T. NIEMANN, H. GILL, D. M. BOQUET, P. POPOFF, M. R. /1990/: Nucleotide sequence of Clostridium botulinum C1 neurotoxin. Nucl. Acids Res., p. HAUSER, D. GIBERT, M. EKLUND, M. W. BOQUET, P. POPOFF, M. R. /1993/: Comparative analysis of C3 and botulinal neurotoxin genes and their environment in Clostridium botulinum types C and D. J. Bacteriol., pp. HÄLTERLEIN, B. HEINZE, G. /1983/: Massensterben von Vögeln durch Botulismus. Ber. Dtsch. Sekt. Int. Rat. Vogelschutz, pp. HIELM, S. BJÖRKROTH, J. HYYTIÄ, E. KORKEALA, H. /1999/: Ribotyping as an identification tool for Clostridium botulinum strains causing human botulism. Int. J. Food Microbiol., pp. HOBMAIER, M. /1932/: Conditions and control of botulism (duck disease) in waterfowl. Calif. Fish and Game, pp. HOKIN, L. E. HOKIN, M. R. /1959/: Evidence for phosphaditic acid as the sodium carrier. Nature (London), pp. 99

100 HOLEMAN, L. /1970/: The ecology and natural history of Clostridium botulinum. J. Wildl. Dis., pp. HORVÁTH, J. LELKES, A. FUTÓ, E. LAKATOS, J. /1994/: Botulizmus okozta madárpusztulások a Kis-Balatonon. Aquila, , pp. HUBÁLEK, Z. HALOUZKA, J. /1988/: Thermal sensitivity of Clostridium botulinum type C toxin. Epidem. Inf., pp. HUBÁLEK, Z. HALOUZKA, J. /1991/: Persistence of Clostridium botulinum type C toxin in blow fly (Calliphoridae) larvae as a possible cause of avian botulism in spring. J. Wildl. Dis., pp. HUNTER, L. POXTON, I. /2002/: Clostridium botulinum types C and D and the closely related Clostridium novyi. Rev. Med. Microbiol., pp. HUSS, H. /1980/: Distribution of Clostridium botulinum. Appl. Environ. Microbiol., pp. INOUE, K. IIDA, H. /1970/: Conversion to toxigenicity in Clostridium botulinum type C. Jap. J. Microbiol., pp. INOUE, K. IIDA, H. /1971/: Phage conversion of toxigenicity on Clostridium botulinum types C and D. Jap. J. Med. Sci., pp. ITOH, T. SAITO, K. INABA, M. SAKAI, S. /1978/: Demonstration of type C Clostridium botulinum from sludges and fresh-water fish in the River Nakagawa in Tokyo. Ann. Rep. Tokyo Metr. Res. Lab. P. H., pp. INVITROGEN HOME PAGE /2011/: D-LUX Gene Expression Assays c-acid-amplification-and-expression-profiling/qrt-pcr/qpcr/d-lux-assays.html? CID=fl-lux ( ) 100

101 JANSEN, B. /1971/: The toxic antigenic factors produced by Clostridium botulinum types C and D. Onderstepoort J. Vet. Res., pp. JENSEN, W. I. ALLEN, J. P. /1960/: A possible relationship between aquatic invertebrates and avian botulism. Trans. N. Am. Wildl. Nat. Res. Conf., pp. JENSEN, W. PRICE, J. /1987/: The global importance of type C botulism in wild birds. In.: EKLUND, M. DOVELL, V., Jr. (eds.): Avian Botulism: An International Perspective. CC Thomas, Springfield, Illinois pp. KAKINUMA, H. MARUYAMA, H. YAMAKAWA, K. NAKAMURA, S. TAKAHASHI, H. /1997/: Application of nested polymerase chain reaction for the rapid diagnosis of infant botulism type B. Acta Paediatr. Jpn., pp. KALMBACH, E. /1939/: American vultures and the toxin of Clostridium botulinum. J. Am. Vet. Med. Assoc., pp. KALMBACH, E. GUNDERSON, M. /1934/: Western Duck Sickness: a Form of Botulism. USDA Tech. Bull., p. KERNER, J. /1822/: Das Fettgift oder die Fettsäure und ihre Wirkungen auf den tierischen Organismus. Ein Beytrag zur Untersuchung des in verdorbenen Würsten giftig wirkenden Stoffes. Cotta, Stuttgart und Tübingen p. KEYMER, I. F. SMITH, G. R. ROBERTS, T. A. HEANEY, S. I. HIBBERD, D. J. /1972/: Botulism as a factor in waterfowl mortality at St. James's Park, London. Vet Rec., pp. KFDT (KEMPELEN FARKAS DIGITÁLIS TANKÖNYVTÁR) /2008/: ELISA-módszerek. ( ) KÖHLER, B. FEILER, M. FRIEDRICHS, F. BÖTTCHER, E. /1977/: Ausbruch von Botulismus bei Wasservögeln. Monatschefte für Veterinärmedizin, pp. 101

102 KURAZONO, H. HOSOKAWA, M. MATSUDA, H. SAKAGUCHI, G. /1987/: Fluid accumulation in the ligated intestinal loop and histopathological changes of the intestinal mucosa caused by Clostridium botulinum C 2 toxin in the pheasant and chicken. Res. Vet. Sci., pp. KUZNETZOV, E. A. /1992/: Botulism in wild waterfowl in the USSR. In: Diseases and Parasites of Wild Animals. Ministry of Ecology and Natural Resources of Russia, Moscow pp. LEHOCZKINÉ PERÉNYI K. /1959/: A botulismus. Magyar Állatorvosok Lapja, pp. LEIGHTON, F. A. /2000/: Type C botulism in birds. ( ) LINDBERG, A. SKARIN, H. KNUTSSON, R. BLOMQVIST, G. BÅVERUD, V. /2010/: Real-time PCR for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering a chimeric C/D sequence Application on outbreaks of botulism in poultry. Vet. Microbiol., pp. LINDSTRÖM, M. K. JANKOLA, H. M. HIELM, S. HYYTIÄ, E. K. KORKEALA, H. J. /1999/: Identification of Clostridium botulinum with API 20 A, Rapid ID 32 A and RapID ANA II. FEMS Immunol. Med. Microbiol., pp. LINDSTRÖM, M. KETO, R. MARKKULA, A. NEVAS, M. HIELM, S. KORKEALA, H. /2001/: Multiplex PCR assay for detection and identification of Clostridium botulinum types A, B, E, and F in food and fecal material. Appl. Environ. Microbiol., pp. MAKSYMOWYCH, A. SIMPSON, L. /1998/: Binding and transcytosis of botulinum neurotoxin by polarised human colon carcinoma cells. J. Biol. Chem., pp. 102

103 MARION, W. R. O MEARA, T. E. RIDDLE, G. D. BERKHOFF, H. A. /1983/: Prevalence of Clostridium botulinum type C in substrates of phosphate-mine settling ponds and implications for epizootics of avian botulism. J. Wildl. Dis., pp. MÁTYÁS, K. /1996/: A Kis-Balaton Vízvédelmi Rendszer fitoplankton vizsgálatának eredményei között. 2. Kis-Balaton Ankét, (Összefoglaló értékelés a KBVR közötti kutatási eredményeirıl.) Pannon Agrártudományi Egyetem SZTIK Nyomdája, Keszthely pp. MCCROSKEY, L. M. HATHEWAY, C. L. WOODRUFF, B. A. GREENBERG, J. A. JURGENSON, P. /1991/: Type F botulism due to neurotoxigenic Clostridium baratii from an unknown source in an adult. J. Clin. Microbiol., pp. MEYER, K. /1956/: The status of botulism as a world health problem. Bull. World Health Organ., pp. MEYER, K. DUBOVSKY, B. /1922/: The distribution of the spores of B. botulinus in the United States. J. Infect. Dis., pp. MORIISHI, K. KOURA, M. FUJII, N. FUJINAGA, Y. INOUE, K. SYUTO, B. OGUMA, K. /1996a/: Molecular cloning of the Gene Encoding the Mosaic Neurotoxin, Composed of Parts of Botulinum Neurotoxin Types C1 and D, and PCR Detection of This Gene from Clostridium botulinum Type C Organisms. Appl. Environ. Microbiol., pp. MORIISHI, K. KOURA, M. ABE, N. FUJII, N. FUJINAGA, Y. INOUE, K. OGUMA, K. /1996b/: Mosaic structures of neurotoxins produced from Clostridium botulinum types C and D organisms. Biochim. Biophys. Act., pp. MOULTON, D. W. JENSEN, W. I. LOW, J. B. /1976/: Avian botulism epizootiology on sewage oxidation ponds in Utah. J. Wildl. Man., pp. 103

104 MURPHY, T. LAWSON, A. NALEWAJKO, C. MURKIN, H. ROSS, L. OGUMA, K. MCINTYRE, T. /2000/: Algal toxins Initiators of avian botulism? Environ. Toxicol., pp. NAKAMURA, S. SERIKAWA, T. YAMAKAWA, K. NISHIDA, S. KOZAKI, S. SAKAGUCHI, G. /1978/: Sporulation and C2 toxin production by Clostridium botulinum type C strains producing no C1 toxin. Microbiol. Immunol., pp. NAKAMURA, S. KIMURA, I. YAMAKAWA, K. NISHIDA, S. /1983/: Taxonomic relationships among Clostridium novyi types A and B, Clostridium haemolyticum and Clostridium botulinum type C. J. Gen. Microbiol., pp. NIESS, H. /1987/: Gefahren für den Entenbesatz Vier Jahre Botulismus auf der Alster. Wild und Hund, pp. NIKODÉMUSZ, I. CSABA, K. ORMAY, L. /1960/: Laboratóriumi vizsgálatokkal igazolt botulizmus. Orvosi Hetilap, pp. NOL, P. ROCKE, T. E. GROSS, K. YUILL, T. E. /2004/: Prevalence of neurotoxic Clostridium botulinum type C in the gastrointestinal tracts of tilapia (Oreochromis mossambicus) in the Salton Sea. J. Wildl. Dis., pp. NYUDUVIZIG (NYUGAT-DUNÁNTÚLI KÖRNYEZETVÉDELMI ÉS VÍZÜGYI IGAZGATÓSÁG) /2003/: a Kis-Balaton honlapja. ( ) OCEPEK, M. HARI, A. KRT, B. PATE, M. ZDOVC, I. /2007/: Detection of Clostridium botulinum type C in an aquatic area a year after an outbreak of botulism in waterfowl using conventional and molecular methods. IJEP, pp. OGUMA, K. SYUTO, B. IIDA, H. KUBO, S. /1980/: Antigenic similarity of toxins produced by Clostridium botulinum type C and D strains. Infect. Immun., pp. 104

105 OGUMA, K. YAMAGUCHI, T. SUDOU, K. YOKOSAWA, N. FUJIKAWA, Y. /1986/: Biochemical Classification of Clostridium botulinum type C and D Strains and Their Nontoxigenic Derivatives. Appl. Environ. Mivrobiol., pp. OGUMA, K. YOKOTA, K. HAYASHI, S. TAKESHI, K. KUMAGAI, M. ITOH, N. TACHI, N. CHIBA, S. /1990/: Infant botulism due to Clostridium botulinum type C toxin. Lancet, pp. OHISHI, I. SAKAGUCHI, G. RIEMANN, H. BEHYMER, D. HURVELL, B. /1979/: Antibodies to Clostridium botulinum toxins in free-living birds and mammals. J. Wildl. Dis., pp. OHISHI, I. IWASAKI, M. SAKAGUCHI, G. /1980/: Purification and characterization of two components of botulinum C 2 toxin. Infect. Immun., pp. OHISHI, I. SAKAGUCHI, G. /1982/: Production of C 2 toxin by Clostridium botulinum types C and D as determined by its vascular permeability activity. Infect. Immun., pp. ONO, T. AZUMA, R. KATO, T. TAKEUCHI, S. SUTO, T. /1982/: Outbreaks of type C botulism in waterfowl in Japan. Nat. Inst. Anim. Health Q (Yatabe), pp. PATES, A. /1967/: The documentation of avian resistance to botulism. Yearly report to the United States Army Medical Research and Development Command. PESTRONK, A. /2008/: Neuromuscular home page. ( ) POPOFF, M. /1995/: Ecology of neurotoxigenic Clostridia. Curr. Top. Microbiol. Immunol., pp. POURSHAFIE, M. VAHDANI, P. POPOFF, M. /2005/: Genotyping Clostridium botulinum toxinotype A isolates from patients using amplified rdna restriction analysis. J. Med. Microbiol., pp. 105

106 POURSHABAN, M. FRANCIOSA, G. FENICIA, L. AURELI, P. /2002/: Taxonomic identity of type E botulinum toxin-producing Clostridium butyricum strains by sequencing of a short 16S rdna region. FEMS Microbiol. Lett., pp. PRÉVOT, V. TWEEPENNINCKX F. VAN NEROM, E. LINDEN, A. CONTENT, J. KIMPE, A. /2007/: Optimization of polymerase chain reaction for detection of Clostridium botulinum type C and D in bovine samples. Zoon. Pub. Health, pp. PRIMERDIGITAL.COM /2011/: Design and properties of LUX (fluorogenic) PCR primers. ( ) PULLAR, E. /1934/: Enzootic botulism amongst wild birds. Austr. Vet. J., pp. REED, T. M. ROCKE, T. E. /1992/: The role of avian carcasses in botulism epizootics. Wildl. Soc. Bull., pp. REICHHOLF, J. /1983/: Ausbrüche von Enten-Botulismus im Sommer 1982 in Bayern. Anz. Orn. Ges. Bayern, pp. REILLY, J. BOROFF, D. /1967/: Botulism in a Tidal Estuary in New Jersey. Bull. Wildl. Dis. Assoc., pp. RING, R. A. /1972/: Relationship between diapause and super-cooling in the blowfly, Lucilia sericata (Mg.). Can. J. Zool., pp. ROCKE, T. /1983/: Clostridium botulinum. In: GYLES, C. THOEN, C. (eds.): Pathogenesis of Bacterial Infections in Animals. Iowa State University Press, Ames, Iowa pp. 106

107 ROCKE, T. E. /2006/: The global importance of avian botulism. In: BOERE, G. C. GALBRAITH, C. A. STROUD, D. A. (eds.): Waterbirds around the world. The Stationery Office, Edinburgh, UK pp. ROCKE, T. E. SMITH, S. R. NASHOLD, S. W. /1998/: Preliminary evaluation of a simple in vitro test for the diagnosis of type C avian botulism in wild birds. J. Wildl. Dis., pp. ROCKE, T. E., JR. EULISS, N. H. SAMUEL, M. D. /1999/: Environmental characteristics associated with the occurrence of avian botulism in wetlands of a Northern California refuge. J. Wildl. Man., pp. ROCKE, T. E., JR. SAMUEL, M. D. /1999/: Water and sediment characteristics associated with avian botulism outbreaks in wetlands. J. Wildl. Man., pp. ROCKE, T. E. SAMUEL, M. D. SWIFT, P. K. YARRIS, G. S. /2000/: Efficacy of a type C botulism vaccine in green-winged teal. J. Wildl. Dis., pp. ROSEN, M. /1971/: Botulism. In: DAVIS, J. ANDERSON, R. KARSTAD, L. TRAINER, D. (eds.): Infectious and Parasitis Diseases of Wild Birds. Iowa State University Press, Ames, Iowa pp. SAKAGUCHI, Y. HAYASHI, T. KUROKAWA, K. NAKAYAMA, K. OSHIMA, K. FUJINAGA, Y. OHNISHI, M. OHTSUBO, E. HATTORI, M. OGUMA, K. /2005/: The genome sequence of Clostridium botulinum type C neurotoxin-converting phage and the molecular mechanisms of unstable lysogeny. PNAS, pp. SALYERS, A. WHITT, D. /1994/: Bacterial pathogenesis: a molecular approach. ASM Press, Washington, D. C pp. SANDLER, R. J. ROCKE, T. E. SAMUEL, M. D. YUILL, T. M. /1993/: Seasonal Prevalence of Clostridium botulinum Type C in Sediments of a Northern California Wetland. J. Wildl. Dis., pp. 107

108 SANDLER, R. J. ROCKE, T. E. YUILL, T. M. /1998/: The Inhibition of Clostridium botulinum Type C by Other Bacteria in Wetland Sediments. J. Wildl. Dis., pp. SEBAIHIA, M. PECK, M. W. MINTON, N. P. THOMSON, N. R. HOLDEN, M. T. G. MITCHELL, W. J. CARTER, A. T. BENTLEY, S. D. MASON, D. R. CROSSMANN, L. PAUL, C. J. IVENS, A. WELLS-BENNIK, M. H. J. DAVIS, I. J. CERDEÑO-TÁRRAGA, A. M. CHURCHER, C. QUAIL, M. A. CHILLINGWORTH, T. FELTWELL, T. FRASER, A. GOODHEAD, I. HANCE, Z. JAGELS, K. LARKE, N. MADDISON, M. MOULE, S. MUNGALL, K. NORBERTCZAK, H. RABBINOWITSCH, E. SANDERS, M. SIMMONDS, M. WHITE, B. WHITHEAD, S. PARKHILL, J. /2007/: Genome sequence of a proteolytic (Group I) Clostridium botulinum strain Hall A and comparative analysis of the clostridial genomes. Gen. Res., pp. SEDDON, H. E. /1922/: Bulbar paralysis in cattle due to the action of a toxicogenic bacillus, with a discussion on the relationship of the condition to forage poisoning (botulism). J. Comp. Pathol. Therap., pp. SEGNER, W. SCHMIDT, C. /1971/: Heat Resistance of Spores of Marine and Terrestrial Strains of Clostridium botulinum Type C. Appl. Microbiol., pp. SEGNER, W. SCHMIDT, C. BOLTZ, J. /1971a/: Enrichment, Isolation and Cultural Caharacteristics of Marine Strains of Clostridium botulinum Type C. Appl. Microbiol., pp. SEGNER, W. SCHMIDT, C. BOLTZ, J. /1971b/: Minimal Growth Temperature, Sodium Chloride Tolerance, ph Sensitivity, and Toxin Production of Marine and Terrestrial Strains of Clostridium botulinum Type C. Appl. Microbiol., pp. SEKINE, A. FUJIWARA, M. NARUMIYA, S. /1989/: Asparagine residue in the rho gene product is the modification site for botulinum ADP-ribosyltransferase. J. Biol. Chem pp. 108

109 SERIKAWA, T. NAKAMURA, S. NISHIDA, S. /1977/: Distribution of Clostridium botulinum type C in Ishikawa Prefecture, and applicability of agglutination to identification of non-toxigenic isolates of Clostridium botulinum type C. Microbiol. Immunol., pp. SHAW, P. A. /1929/: Duck disease studies. 1. Blood analysis in diseased birds. Proc. Soc. Exp. Biol. Med., pp. SIMPSON, L. L. /1984/: Molecular basis for the pharmacological actions of Clostridium botulinum type C 2 toxin. J. Pharm. Exp. Ther., pp. SKINNER, G. E. GENDEL, S. M. FINGERHUT, G. A. SOLOMON, H. A. ULASZEK, J. /2000/: Differentiation between types and strains of Clostridium botulinum by riboprinting. J. Food Prot pp. SMITH, G. R. /1982/: Botulism in waterfowl. Symp. Zool. Soc. Lond., pp. SMITH, G. R. /1987/: Botulism in water birds and its relation to comparative medicine. In: EKLUND, M. W. and DOWELL, V. R. (eds.): Avian Botulism: An International Perspective. Charles C. Thomas, Springfield, Illinois pp. SMITH, G. R. HIME, J. M. KEYMER, I. F. GRAHAM, J. M. OLNEY, P. J. S. BRAMBELL, M. R. /1975/: Botulism in captive birds fed commercially-bred maggots. Vet. Rec., pp. SMITH, G. R. MORYSON, C. J. /1975/: Clostridium botulinum in the lakes and waterways of London. J. Hyg. (Camb.), pp. SMITH, G. R. MORYSON, C. J. /1977/: A comparison of the distribution of Clostridium botulinum in soil and in lake mud. J. Hyg. (Camb.), pp. SMITH, G. R. MILLIGAN, R. A. MORYSON, C. J. /1978/: Clostridium botulinum in aquatic environments in Great Britain and Ireland. J. Hyg. (Camb.), pp. 109

110 SMITH, G. R. OLIPHANT, J. C. WHITE, W. R. /1982/: Clostridium botulinum type C in the Mersey estuary. J. Hyg. (Camb.), pp. SMITH, G. R. TURNER, A. /1989/: The production of Clostridium botulinum toxin in mammalian, avian and piscine carrion. Epidem. Inf., pp. SMITH, L. DS SUGIYAMA, H. /1988/: The natural occurrence of Clostridium botulinum. In: BALOWS, A. (ed.): Botulism: the organism, its toxins, the disease, 2 nd edition. Charles C. Thomas, Springfield, Illinois pp. SMOOT, L. A. PIERSON, M. D. /1979/: Effect of oxidation-reduction potential on the outgrowth and chemical inhibition of Clostridium botulinum 10755A spores. J. Food Sci., pp. SOOS, C. WOBESER, G. /2006/: Identification of Primary Substrate in the Initiation of Avian Botulism Outbreaks. J. Wildl. Man., pp. STEVENSON, K. E. VAUGHN, R. H. /1972/: Exosporium Formation in Sporulating Cells of Clostridium botulinum 78A. J. Bacteriol., pp. SUGIYAMA, H. /1977/: Presentation at the Interagency Botulism Research Coordinating Committee Meeting. Bear River Research Station, Brigham City, Utah. SUNAGAWA, H. INOUE, K. /1992/: Biological and biophysical characteristics of phages isolated from Clostridium botulinum type C and D strains, and physicochemical properties of the phage DNAs. J. Vet. Med. Sci., pp. SYUTO, B. KUBO, S. /1977/: Isolation and molecular size of Clostridium botulinum type C toxin. Appl. Environ. Microbiol., pp. SZABO, E. A. PEMBERTON, J. M. DESMARCHELIER, P. M. /1993/: Detection of the Genes Encoding Botulinum Neurotoxin Types A to E by the Polymerase Chain Reaction. Appl. Environ. Microbiol., pp. 110

111 TAKEDA, M. TSUKAMOTO, K. KOHDA, T. MATSUI, M., - MUKAMOTO, M. KOZAKI, S. /2005/: Characterization of the neurotoxin produced by isolates associated with avian botulism. Avian Dis., pp. TAPONEN, S. SALMIKIVI, L. SIMOJOKI, H. KOSKINEN, M. T. PYÖRÄLÄ, S. /2009/: Real-time polymerase chain reaction-based identification of bacteria in milk samples from bovine clinical mastitis with no growth in conventional culturing. J. Dairy Sci., pp. THOMAS, R. J. /1991/: Detection of Clostridium botulinum types C and D toxin by ELISA. Aust. Vet. J., pp. TOPLEY AND WILSON S PRINCIPLES OF BACTERIOLOGY, VIROLOGY AND IMMUNITY, 8 th edition, vol. 3.: Bacterial diseases /1990/. PARKER, M. T. COLLIER, L. H.(general eds.); SMITH, G. R. EASMAN, C. S. F. (vol. 3. eds.). B. C. Decker Inc., Philadelphia p. TRAMPEL, D. W. SMITH, S. R. ROCKE, T. E. /2005/: Toxicoinfectious botulism in commercial caponized chickens. Avian Dis., pp. TRETHON, A. BUDAI, J. HERENDI, Á. SZABÓ, V. GÉCZY, M. /1995/: Csecsemıkori botulizmus. Orvosi Hetilap, pp. TSUKAMOTO, K. MUKAMOTO, M. KOHDA, T. IHARA H. WANG X. MAEGAWA, T. NAKAMURA, S. KARASAWA, T. KOZAKI, S. /2002/: Characterization of Clostridium butyricum neurotoxin associated with food-borne botulism. Microb. Pathog., pp. VAN ERMENGEM, E. /1897/: Ueber einen neuen anäeroben Bacillus und seine Beziehungen zum Botulismus. Z. Hyg. Infekt., pp. VÁRNAGY L. BUDAI P. /1995/: Agrárkémiai higiénia. Mezıgazdasági vegyi anyagok egészség- és méregtana. Mezıgazda Kiadó, Budapest pp. 111

112 VU, T. L. A. /2006/: Incidence of Clostridium botulinum Spores in Honey and Infant Food Samples Collected from Vietnam and Germany. Ph. D. dissertation; Georg- August-University, Göttingen, Institute of Agronomy and Animal Production in the Tropics and Subtropics. ( ) WESTPHAL, U. /1991/: Botulismus bei Vögeln. AULA-Verlag GmbH, Wiesbaden pp. WILLIAMSON, J. L. ROCKE, T. E. AIKEN, J. M. /1999/: In Situ Detection of the Clostridium botulinum Type C 1 Toxin Gene in Wetland Sediments with a Nested PCR Assay. Appl. Environ. Microbiol., pp. WOBESER, G. A. /1987/: Control of botulism in wild birds. In: EKLUND, M. W. and DOWELL, V. R. (eds.): Avian Botulism: An International Perspective. Charles C. Thomas, Springfield, Illinois pp. WOBESER, G. /1988/: Effects of botulism on ducks drinking saline water. J. Wildl. Dis., pp. WOBESER, G. A. /1997/: Avian botulism another perspective. J. Wildl. Dis., pp. WOBESER, G. RAINNIE, D. J. SMITH-WINDSOR, T. B. BOGDAN, G. /1983/: Avian botulism during late autumn and early spring in Saskatchewan. J. Wildl. Dis., pp. WOBESER, G. MARSDEN, S. MACFARLANE, R. J. /1987/: Occurrence of toxigenic Clostridium botulinum type C in the soil of wetlands in Saskatchewan. J. Wildl. Dis., pp. WOBESER, G. BAPTISTE, K. CLARK, E. G. DEYO, A. W. /1997/: Type C botulism in cattle in association with a botulism die-off in waterfowl in Saskatchewan. Can. Vet. J., p. 112

113 WOO, G. H. KIM, H. Y. BAE, Y. C. JEAN, Y. H. YOON, S. S. BAK, E. J. HWANG, E. K. JOO, Y. S. /2010/: Outbreak of botulism (Clostridium botulinum type C) in wild waterfowl: Seoul, Korea. J Wildl Dis., pp. YAMAKAWA, K. NISHIDA, S. NAKAMURA, S. /1983/: C2 toxicity in extract of Clostridium botulinum type C spores. Infect. Immun., pp. ZECHMEISTER, T. C. FARNLEITNER, A. H. ROCKE, T. E. PITTNER, F. ROSENGARTEN, R. MACH, R. L. HERZIG A. KIRSCHNER, A. K. T. /2002/: PCR and ELISA - in vitro alternatives to the mouse-bioassay for assessing the botulinumneurotoxin-c1 production potential in environmental samples? ALTEX, 19. (Suppl.), pp. ZECHMEISTER, T. C. KIRSCHNER, A. K. T. FUCHSBERGER, M. GRUBER, S. G. SÜß, B. ROSENGARTEN, R. PITTNER, F. MACH, R. L. HERZIG A. FARNLEITNER, A. H. /2005/: Prevalence of Botulinum Neurotoxin C1 and its Corresponding Gene in Environmental Samples from Low and High Risk Avian Botulism Areas. ALTEX, pp. ZLINSZKY, SZ. /1997/: Madárbotulizmus a Kis-Balaton területén (szakdolgozat). ELTE Tanárképzı Fıiskolai Kar, biológia-kémia szakpár. 113

114 8. TÉZISPONTOK 8.1. Tézispontok magyarul a. A Kis-Balaton területérıl, madár-botulizmus szempontjából alacsony (elhullással nem járó) illetve magas kockázatú (botulizmusos) évekbıl származó vízminıségi és meteorológiai adatok értékelése során szignifikáns (P<0,05) kapcsolatot mutattunk ki néhány paraméter (levegı- és vízhımérséklet, ph, oldott oxigén- és szervesanyagtartalom) és a betegség megjelenése között. b. A WILLIAMSON és mtsai. /1999/ által leírt nested PCR módszer alkalmazása során fals pozitív eredményeket kaptunk. Az elkülönített termékek 16S rdns analízise Escherichia coli organizmusok jelenlétét igazolta. c. A FRANCIOSA és mtsai. /1996/ által publikált, hagyományos PCR módszert továbbfejlesztve, azt LightCycler-alapú real-time PCR metódussá alakítottuk át. A technikát olvadáspont-analízissel is kiegészítve a kiindulási módszer méginkább leegyszerősödött, felgyorsult, ugyanakkor érzékenyebbé vált. d. Tapasztalataink alapján elvégeztük a korábban ismertetett molekuláris biológiai módszerek madár-botulizmus megbetegedések diagnosztikájában történı alkalmazhatóságának összehasonlító vizsgálatát. 114

115 8.2. Thesis statement a. In some cases, significant (P<0.05) differences were found between several environmental factors (air- and water temperature, ph, water-soluble oxygen and organic matter content) and the occurrence of avian botulism outbreaks. The values of these parameters were recorded periodically in high (HR) and low (LR) avian botulism risk areas of Lake Kis-Balaton. Data derived from both HR and LR years (with or without documented botulism-caused avian losses) were processed. b. False positive results were detected in the course of nested PCR work according to Williamson et al. /1999/. 16S rdna analysis of the separated PCR products verified the presence of Escherichia coli organisms. c. The conventional PCR method described by Franciosa et al. /1996/ was upgraded to a LightCycler-based real-time technique including melting analysis to get a faster, more simple and sensitive reaction. d. In the light of the results, applicability of these molecular techniques in diagnosis of avian botulism cases was also investigated. 115

116 9. AZ ÉRTEKEZÉS TÉMAKÖRÉBEN MEGJELENT PUBLIKÁCIÓK, ELİADÁSOK Referált szakfolyóiratban megjelent közlemények BABINSZKY, G. MÉSZÁROS, Á. GULYÁS, M. CSITÁRI, G. /2006/: Immunohistochemistry-based mouse model for the detection of Clostridium botulinum type B toxin in animal tissues could it be used to demonstrate type C and to diagnose avian botulism? G. for Agric., 16., pp. BABINSZKY, G. CSITÁRI, G. JÓZSA, S. /2008/: Observations on environmental factors in connection with avian botulism outbreaks in a Hungarian wetland habitat. Acta Microbiol. et Immunol. Hung., 55., pp. BABINSZKY, G. /2009/: Madár-botulizmus: hazai és nemzetközi vonatkozások. Ornis Hung., , pp. BABINSZKY, G. CSITÁRI, G. GULYÁS, M. E. /2011/: The environmental background of type C avian botulism outbreaks in wetlands. Aquila (közlésre elfogadva) Az értekezés témakörében megtartott elıadások BABINSZKY, G. /2003/: A madár-botulizmus immunhisztokémiai vizsgálata évi Intézményi Tudományos Diákköri Konferencia, Keszthely. 42. p. BABINSZKY, G. /2004/: A madár-botulizmus immunhisztokémiai vizsgálata. IX. Országos Felsıoktatási Környezettudományi Diákkonferencia; Eötvös Lóránd Tudományegyetem, Budapest. 32. p. BABINSZKY, G. /2004/: A madár-botulizmus elıfordulása és kimutatása Magyarországon. X. Ifjúsági Tudományos Fórum, Keszthely. CD kiadvány. BABINSZKY, G. CSITÁRI, G. GULYÁS, M. /2004/: Madár botulizmus diagnosztizálása immunhisztokémiai módszerrel. XLVI. Geogikon Napok, Keszthely (CD kiadvány, ISBN ). 116

117 BABINSZKY, G. /2005/: A madár-botulizmus immunhisztokémiai vizsgálata évi Országos Tudományos Diákköri Konferencia, Szarvas. 91. p. BABINSZKY, G. /2005/: A madár-botulizmus története Magyarországon. A Romániai Magyar Doktorandusok és Fiatal Kutatók Országos Szövetsége VI. Országos Konferenciája, Kolozsvár. 28. p. BABINSZKY, G. CSITÁRI, G. TÓTH, SZ. PÁL, L. DUBLECZ, K. /2005/: Takarmánykiegészítık hatása broilerek vakbéltartalmának mikroflórájára. XI. Ifjúsági Tudományos Fórum, Keszthely. CD kiadvány. Konferencia összefoglalók GULYÁS, M. NÉMETH, ZS. BABINSZKY, G. MAJOR, P. RODLER, M. CSITÁRI, G. /2005/: Morphological, biochemical and cultural properties of Hungarian Clostridium botulinum strains. Acta Microbiol. Immunol. Hung., 52. (Suppl.), 51. p. BABINSZKY, G. CSITÁRI, G. JÓZSA, S. /2008/: The first findings on the effect of several environmental factors to the occurrence of avian botulism outbreaks in a Hungarian wetland habitat. Clostridium botulinum Epidemiology, Diagnosis, Genetics, Control and Prevention, Helsinki, Finland. 65. p. BABINSZKY, G. CSITÁRI, G. JÓZSA, S. /2008/: Különféle vízminıségi paraméterek és a madár-botulizmus kitörések közti kapcsolat vizsgálata a Kis-Balaton területén. 50. Jubileumi Georgikon Napok, Keszthely (CD-kiadvány, ISBN ). Egyéb, nem az értekezés témakörében megjelent publikációk DUBLECZ, K. BARTOS, Á. PÁL, L. WÁGNER, L. BÁNYAI, A. TÓTH, SZ. BABINSZKY, G. /2004/: Modification the fatty acid composition of different tissues in broiler chicks. XII. World s Poultry Congress, Istanbul, Turkey p. KESERŐ, M. BUDAI, P. VÁRNAGY, L. BABINSZKY, G. /2004/: Növényvédı szerek méreghatásának vizsgálata házityúk embriókon. XIV. Keszthelyi Növényvédelmi 117

118 Fórum. 80. p. KESERŐ, M. BUDAI, P. VÁRNAGY, L. SZABÓ, R. JUHÁSZ, É. BABINSZKY, G. /2004/: Teratogenicity study of some pesticides in chicken embryos. 56th International Symposium on Crop Protection. Ghent, Belgium p. KESERŐ, M. BUDAI, P. VÁRNAGY, L. SZABÓ, R. JUHÁSZ, É. BABINSZKY, G. PONGRÁCZ, A. /2004/: Teratogenicity study of some pesticides in chicken embryos. Comm. Appl. Biol. Sci., Ghent Univ., 69., pp. PÁL, L. BARTOS, Á. BÁNYAI, A. BABINSZKY, G. DUBLECZ, K. /2004/: A tökmagolaj alkalmazásának lehetıségei. Baromfiágazat, 1., pp. BABINSZKY, G. CSITÁRI, G. TÓTH, SZ. WÁGNER, L. PÁL, L. DUBLECZ, K. /2005/: Effect of different feed additives on the caecal microflora of broiler chickens. Proceedings of the 15th European symposium on Poultry Nutrition, Balatonfüred, Hungary pp. CERNÁK, I. FEHÉR, E. BABINSZKY, G. WOLF, I. POLGÁR, ZS. ALFÖLDI, Z. TALLER, J. /2005/: Development of RAPD markers linked to a new Ry sto locus in potato. 16th EAPR Conference, Bilbao, Spain p. CERNÁK, I. FEHÉR, E. BABINSZKY, G. WOLF, I. POLGÁR, ZS. ALFÖLDI, Z. TALLER, J. /2005/: Egy Solanum stoloniferum eredető immunitás gén molekuláris markerezése a burgonyában. A Romániai Magyar Doktorandusok és Fiatal Kutatók Országos Szövetsége VI. Országos Konferenciája, Kolozsvár. 30. p. CERNÁK, I. FEHÉR, E. BABINSZKY, G. WOLF, I. POLGÁR, ZS. ALFÖLDI, Z. TALLER, J. /2005/: Molekuláris rezisztencianemesítés a Georgikonban II. Az Ry sto lókuszhoz kapcsolt RAPD markerek detektálása a burgonyában. XI. Növénynemesítési Tudományos Napok, Budapest. 50. p. GULYÁS, M. E. NÉMETH, ZS. BABINSZKY, G. KEREKES, J. MAJOR, P. CSITÁRI, 118

119 G. /2006/: Detection of vancomycin resistant Gram positives from environmental samples. Acta Microbiol. Immunol. Hung., 53. (Suppl.), pp. TÓTH, SZ. DUBLECZ, K. BARTOS, Á. PÁL, L. BÁNYAI, A. BABINSZKY, G. /2006/: Növényi eredető hozamfokozók hatása brojler csirkék termelési eredményeire. XII. Ifjúsági Tudományos Fórum, Keszthely. CD kiadvány. CERNÁK, I. TALLER, J. WOLF, I. FEHÉR, E. BABINSZKY, G. ALFÖLDI, Z. CSANÁDI, G. POLGÁR, ZS. /2008/: Analysis of the applicability of molecular markers linked to the PVY extreme resistance gene Ry sto, and the identification of new markers. Acta Biol. Hung., 59., pp. 119

120 10. FÜGGELÉK A diszkriminancia analízis vázlatos menete, GAÁL /2004/ alapján Adatbevitel: 4 csoport: 1) botulizmusos terület, botulizmusos idıszak ( a jelő mintavételi helyek) 2) botulizmusos terület, nem botulizmusos idıszak ( b jelő mv. helyek) 3) nem botulizmusos terület, botulizmusos idıszak ( c jelő mv. helyek) 4) nem botulizmusos terület, nem botulizmusos idıszak ( d jelő mv. helyek) (A táblázatban az egyes paraméterek június és szeptember hónapok közti idıszakban mért értékeinek számtani átlagai szerepelnek). Azt vizsgáljuk, hogy az eredeti csoportok statisztikai szempontok alapján is ugyanígy különülnek-e el. 120

121 További beállítások: - Statistics: - Descriptives: - Means (csoportonkénti átlag és szórás számítása a változókra), - Univariate ANOVAs (változónként egytényezıs varianciaanalízis a csoportok várható értékének egyezésére) - Function Coefficients: - Fisher s (standardizált együtthatókat számol a diszkrimináló függvényekhez, konstans tag nincs) - Classify: - Prior Probabilities (az újrabesorolásnál számolt valószínőségeknél azonos vagy különbözı elemszámú csoportokat vegyen figyelembe): Compute from group sizes - Display: - Plots: - Casewise results (minden elemre megadja az eredeti csoportot, a várt csoportot és néhány statisztikát), - Summary table (összefoglaló táblázat az eredeti és a diszkrimináló függvények alapján várható besorolásról) - Combined-groups (az elsı két diszkrimináló függvény szerint kirajzolja az összes csoportot egy ábrába) 121

122 Csoportstatisztikák: Minden csoportra változóként megadja az átlagot, szórást és az elemszámot. A csoportok egyezése (ANOVA): Minden változóra elvégez egy egytényezıs varianciaanalízist a csoportátlagok egyezésére vonatkozóan (H 0 : megegyeznek). A szignifikancia szint alapján egyik vízminıségi paramétert tekintve sincs különbség a csoportok között 95%-os megbízhatósági szinten. 122

123 Analysis 1 Summary of Canonical Discriminant Functions A diszkrimináló függvények vizsgálata: A vizsgálatban 4 csoport (m) és 5 változó (N) szerepel, ezért egy háromdimenziós tér lesz a diszkrimináns tér, amelyre a megfigyeléseket vetítjük, és ehhez három diszkrimináló függvényt használhatunk. A sajátértékek alapján az elsı diszkrimináló függvény a variancia 75,3%-át tudja magyarázni, a második 22,6%-ot, a harmadik már csak 2,1%-ot, tehát a csoportok szétválasztásában csak az elsı kettınek van szerepe. A diszkrimináns hatás (mennyire hatásosan választják szét a csoportokat a függvények) vizsgálatára a Wilks-féle lambda értéket használják, vagy a χ 2 próbát. Az értékek alapján az 1-3 függvény együttesen szignifikáns (jó szétválasztó), még a 2-3 is, de önmagában a harmadik nem jelentıs. A diszkrimináló függvények az eredeti változók lineáris kombinációjaként állnak elı, ezek együtthatóit tartalmazza a táblázat. Pl. az elsı függvény y= -2,951x 1 2,149x 2 + 0,248x 3 + 5,097x 4 + 0,091x 5 formában írható fel, ahol x 1, x 2, x 3, x 4, x 5 az eredeti változókat jelentik a táblázatban megadott sorrendben. 123

124 A csoportok vizsgálata: Összehasonlíthatjuk az eredeti besorolást a diszkrimináló függvények segítségével létrehozható besorolással. Ha a kétféle besorolás között az eltérés kicsi, akkor az eredeti besorolás a felhasznált változókkal jól magyarázható. A táblázatban a Case number oszlop mutatja a mintavételi helyeket az adatállományban található sorrend szerint, az Actual Group jelenti az eredeti besorolást (1: botulizmusos terület, botulizmusos idıszak; 2: botulizmusos terület, nem botulizmusos idıszak; 3: nem botulizmusos terület, botulizmusos idıszak; 4: nem botulizmusos terület, nem botulizmusos idıszak), a Predicted Group pedig a diszkrimináló függvények általi besorolást. A kétféle besorolás a **-gal jelzett négy mintavételi pont (2, 15, 17, 19) esetén nem egyezik meg. A besorolásokról a program egy összefoglaló táblázatot is készít, amit soronként kell olvasni. A felsı részében a megfigyelések száma szerint mutatja a besorolásokat, az alsó részben százalékosan. A kétféle csoportosítás eltérései itt is nyomon követhetık: az 1-es csoport egy tagja inkább a 2-es csoportba, a 3-as csoport egy tagja inkább a 4-es 124

125 csoportba, míg a 4-es csoport egy tagja inkább a 2-es, egy tagja pedig inkább a 3-as csoportba tartozna a diszkrimináló függvények szerint. A táblázat alján látható, hogy összességében 80,0%-ban volt helyes az eredeti csoportosítás. A csoportok kirajzoltathatók az elsı két diszkrimináló függvény alapján is. Több függvény esetén is mindig az elsı kettı a legjobban szétválasztó, tehát ezek szerint érdemes vizsgálni a csoportok szétválását. 125

126 10.2. A C típusú Clostridium botulinum kimutatása Kis-balatoni iszapmintákból, PCR reakcióval Nested PCR reakció WILLIAMSON és mtsai. /1999/ alapján A kezdı reakció PCR-profilja: hımérséklet idıtartam ciklusszám 94 C 1 perc 1 95 C 1 perc 55 C 1 perc C 2 perc 72 C 10 perc 1 A nested reakció PCR-profilja: hımérséklet idıtartam ciklusszám 94 C 1 perc 1 95 C 1 perc 55 C 1 perc C 2 perc 72 C 10 perc 1 A reakciók során felhasznált primerek szekvenciái: irány primer* szekvencia Sense ToxC384 5' 384 AAACCTCCTCGAGTTACAAGCCC 406 3' ToxC625 5' 625 CTAGACAAGGTAACAACTGGGTTA 648 3' Antisense ToxC850R 5' 850 GAAAATCTACCCTCTCCTACATCA 827 3' ToxC1049R 5' 1049 AATAAGGTCTATAGTTGGACCTCC ' *A primerek neve egyben a 468-as törzs BoNT/C 1 génjén való elhelyezkedésüket is jelöli (GeneBank accession no. X ) Hagyományos PCR reakció FRANCIOSA és mtsai. /1996/ alapján A reakció PCR-profilja: hımérséklet idıtartam ciklusszám 95 C 10 perc 1 95 C 1 perc 50 C 1 perc C 4 perc 60 C 15 perc 1 126

127 A reakciók során felhasznált primerek szekvenciái: Sense irány CI primer szekvencia* 5' GCGGCACAAGAAGGATTTG ' Antisense CII 5' CGCCGTAACCGGAGTATAT ' *A C típusú fág genomjában való elhelyezkedésükkel együtt (GeneBank accession no. NC_ ). A 468-as törzs esetében (X ): ; bp között Módosított real-time PCR reakció, FRANCIOSA és mtsai. /1996/ alapján A reakció PCR-profilja: hımérséklet idıtartam ciklusszám 95 C 10 perc 1 95 C 5 másodperc 55 C 20 másodperc C 35 másodperc Az ezt követı olvadáspont-analízis menete: hımérséklet idıtartam megjegyzés 95 C 5 másodperc 40 C 30 másodperc 95 C-ig 0,1 C/s-onként folyamatos jelgyőjtés 40 C 30 másodperc cooling 127

128 Lux primer-alapú real-time PCR reakciók Az Invitrogen D-LUX tervezı programjának eredményei: A leginkább megfelelınek bizonyult primer-párt zöld keret jelöli. A GC arány és az olvadáspont értékek közelítése a forward primer utolsó A-jének elhagyását tette szükségessé: primer szekvencia (5' - 3') hossz Tm GC (nukleotid) ( C) (%) R eredeti CATAAAAGACTTGATTCTCTCCCG 24 68,0 41,7 F eredeti GCCATAAAGCAATAGATGGTAGATCA 26 72,0 38,5 R módosított CATAAAAGACTTGATTCTCTCCCG 24 68,0 41,7 F módosított GCCATAAAGCAATAGATGGTAGATC 25 70,0 40,0 128

BOTULIZMUS ELLENI VÉDŐOLTÁS HATÉKONYSÁGÁNAK VIZSGÁLATA LOVAK FŰBETEGSÉGÉNEK MEGELŐZÉSÉBEN. Kutasi Orsolya DVM, PhD, dipeceim

BOTULIZMUS ELLENI VÉDŐOLTÁS HATÉKONYSÁGÁNAK VIZSGÁLATA LOVAK FŰBETEGSÉGÉNEK MEGELŐZÉSÉBEN. Kutasi Orsolya DVM, PhD, dipeceim BOTULIZMUS ELLENI VÉDŐOLTÁS HATÉKONYSÁGÁNAK VIZSGÁLATA LOVAK FŰBETEGSÉGÉNEK MEGELŐZÉSÉBEN Kutasi Orsolya DVM, PhD, dipeceim Mi a fűbetegség? polyneuropathia, ami elsősorban a gyomor-bél traktus beidegzését

Részletesebben

A FUSARIUM ÉS A MIKOTOXINOK (Mit kell tudnia a gabonatermelınek és feldolgozónak?)

A FUSARIUM ÉS A MIKOTOXINOK (Mit kell tudnia a gabonatermelınek és feldolgozónak?) A FUSARIUM ÉS A MIKOTOXINOK (Mit kell tudnia a gabonatermelınek és feldolgozónak?) Lásztity Radomír Budapesti Mőszaki és Gazdaságtudományi Egyetem, Alkalmazott Biotechnológiai és Élelmiszertudományi Tanszék

Részletesebben

Elıterjesztés Békés Város Képviselı-testülete 2008. szeptember 30-i ülésére

Elıterjesztés Békés Város Képviselı-testülete 2008. szeptember 30-i ülésére Tárgy: Beszámoló Békés Város 2007. évi környezeti állapotáról Elıkészítette: Gál András osztályvezetı Ilyés Péter környezetvédelmi referens Mőszaki Osztály Véleményezı Pénzügyi Bizottság, bizottság: Szociális

Részletesebben

A malacok fontosabb felnevelési betegségei

A malacok fontosabb felnevelési betegségei A malacok fontosabb felnevelési betegségei Varga János egyetemi tanár az MTA tagja Szent István Egyetem Állatorvos-tudományi Kar Mikrobiológia és Járványtan Tanszék 1581 Budapest, 146 Pf. 22. A szopós

Részletesebben

PANNON EGYETEM GEORGIKON KAR

PANNON EGYETEM GEORGIKON KAR PANNON EGYETEM GEORGIKON KAR ÁLLAT- ÉS AGRÁR KÖRNYEZET-TUDOMÁNYI DOKTORI ISKOLA Környezettudományok Tudományág Iskolavezetı: Dr. habil. Anda Angéla Az MTA doktora Témavezetı: Dr. habil. Anda Angéla Az

Részletesebben

A projekt rövidítve: NANOSTER A projekt idıtartama: 2009. október 2012. december

A projekt rövidítve: NANOSTER A projekt idıtartama: 2009. október 2012. december A projekt címe: Egészségre ártalmatlan sterilizáló rendszer kifejlesztése A projekt rövidítve: NANOSTER A projekt idıtartama: 2009. október 2012. december A konzorcium vezetıje: A konzorcium tagjai: A

Részletesebben

Kiadó: Baranya Természeti Értékeiért Alapítvány. Szöveg: Bank László. Lektor: Dr. Szép Tibor. Nyomda: Borgisz-Print Kft.

Kiadó: Baranya Természeti Értékeiért Alapítvány. Szöveg: Bank László. Lektor: Dr. Szép Tibor. Nyomda: Borgisz-Print Kft. Baranya Természeti Értékeiért Alapítvány FECSKEVÉDELMI PROGRAM www.baranyamadar.hu A TERMÉSZET SZOLGÁLATÁBAN İszi fecskegyülekezés (Fotó: Losonczi Lajos) Kiadó: Baranya Természeti Értékeiért Alapítvány

Részletesebben

A BIOTERRORIZMUS TÖRTÉNETE

A BIOTERRORIZMUS TÖRTÉNETE A BIOTERRORIZMUS TÖRTÉNETE 14.-15. SZÁZAD 1340. Észak Franciaország: döglött lovak és más állatok 1346. Krimi félsziget pestissel fertızött tetemek 1422. Karlstein, Bohémia - oszlásnak indult tetemek Pizarro

Részletesebben

14-469/2/2006. elıterjesztés 1. sz. melléklete. KOMPETENCIAMÉRÉS a fıvárosban

14-469/2/2006. elıterjesztés 1. sz. melléklete. KOMPETENCIAMÉRÉS a fıvárosban KOMPETENCIAMÉRÉS a fıvárosban 2005 1 Tartalom 1. Bevezetés. 3 2. Iskolatípusok szerinti teljesítmények.... 6 2. 1 Szakiskolák 6 2. 2 Szakközépiskolák. 9 2. 3 Gimnáziumok 11 2. 4 Összehasonlítások... 12

Részletesebben

Madár-botulizmus: hazai és nemzetközi vonatkozások

Madár-botulizmus: hazai és nemzetközi vonatkozások Ornis Hungarica (2009) 17-18: 21-32. Madár-botulizmus: hazai és nemzetközi vonatkozások Babinszky Gergely Babinszky, G. 2009. Avian botulism: Hungarian and international aspects. Ornis Hung. 17-18: 21-32.

Részletesebben

Madár-botulizmus vizsgálata a Kis-Balaton területén

Madár-botulizmus vizsgálata a Kis-Balaton területén PANNON EGYETEM GEORGIKON MEZİGAZDASÁGTUDOMÁNYI KAR KESZTHELY ÁLLAT- ÉS AGRÁRKÖRNYEZET-TUDOMÁNYI DOKTORI ISKOLA DOKTORI (PhD) ÉRTEKEZÉS TÉZISEI Madár-botulizmus vizsgálata a Kis-Balaton területén Készítette:

Részletesebben

Derzsy betegség. Kacsapestis. Kacsapestis. Vízi szárnyasok fontosabb kórképeinek áttekintése korosztályok szerint. Elıfordulás 1-4 hetes ludak

Derzsy betegség. Kacsapestis. Kacsapestis. Vízi szárnyasok fontosabb kórképeinek áttekintése korosztályok szerint. Elıfordulás 1-4 hetes ludak Vízi szárnyasok fontosabb kórképeinek áttekintése korosztályok szerint Derzsy betegség Madárinfluenza Anatipestifer betegség Sertésorbánc Vesekokcidiosis Angolkór Tüdımycosis Baromfi kolera Borreliosis

Részletesebben

A. AZ ÉGHAJLATI RENDSZER ÉS AZ ÉGHAJLATI VÁLTOZÉKONYSÁG

A. AZ ÉGHAJLATI RENDSZER ÉS AZ ÉGHAJLATI VÁLTOZÉKONYSÁG Bevezetés Napjainkban a klimatológia fontossága rendkívüli módon megnövekedett. Ennek oka a légkör megnövekedett szén-dioxid tartalma és ennek következménye, a lehetséges éghajlatváltozás. Változó éghajlat

Részletesebben

SPÓRAKÉPZİ BAKTÉRIUMOK ANAEROB BAKTÉRIUMOK. Anderlik P.

SPÓRAKÉPZİ BAKTÉRIUMOK ANAEROB BAKTÉRIUMOK. Anderlik P. SPÓRAKÉPZİ BAKTÉRIUMOK ANAEROB BAKTÉRIUMOK Anderlik P. 2008 1 Gram pozitív, spórak raképzı, pálcák aerob : Bacillus anaerob: Clostridium extotoxin talajspórás 2 1 3 4 2 Bacillus anthracis Tüdıantrax!!!

Részletesebben

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel

Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Patogén mikroorganizmusok vizsgálata molekuláris biológiai módszerekkel Rohonczy Kata, Zoller Linda, Fodor Andrea, Tabajdiné, dr. Pintér Vera FoodMicro Kft. Célkitűzés Élelmiszerekben és takarmányokban

Részletesebben

Matematikai alapok és valószínőségszámítás. Középértékek és szóródási mutatók

Matematikai alapok és valószínőségszámítás. Középértékek és szóródási mutatók Matematikai alapok és valószínőségszámítás Középértékek és szóródási mutatók Középértékek A leíró statisztikák talán leggyakrabban használt csoportját a középértékek jelentik. Legkönnyebben mint az adathalmaz

Részletesebben

A JÖVİ NEMZEDÉKEK ORSZÁGGYŐLÉSI BIZTOSÁNAK ÁLLÁSFOGLALÁSA a lápok védelmének egyes jogi és ökológiai kérdéseirıl

A JÖVİ NEMZEDÉKEK ORSZÁGGYŐLÉSI BIZTOSÁNAK ÁLLÁSFOGLALÁSA a lápok védelmének egyes jogi és ökológiai kérdéseirıl JÖVİ NEMZEDÉKEK ORSZÁGGYŐLÉSI BIZTOSA 1051 Budapest, Nádor u. 22. 1387 Budapest, Pf. 40.Telefon: 475-7100 Fax: 269-1615 A JÖVİ NEMZEDÉKEK ORSZÁGGYŐLÉSI BIZTOSÁNAK ÁLLÁSFOGLALÁSA a lápok védelmének egyes

Részletesebben

1. 4. tételek. 1., A kórbonctan tárgya, feladata, vizsgáló módszerei

1. 4. tételek. 1., A kórbonctan tárgya, feladata, vizsgáló módszerei 1. 4. tételek 1., A kórbonctan tárgya, feladata, vizsgáló módszerei 1. A kórbonctan tárgya, feladata és vizsgáló módszerei 2. A kórbonctani és egyes kiegészítı diagnosztikai vizsgálatra szánt anyagok győjtésének

Részletesebben

Koreografált gimnasztikai mozgássorok elsajátításának és reprodukálásának vizsgálata

Koreografált gimnasztikai mozgássorok elsajátításának és reprodukálásának vizsgálata Koreografált gimnasztikai mozgássorok elsajátításának és reprodukálásának vizsgálata Doktori tézisek Fügedi Balázs Semmelweis Egyetem, Testnevelési és Sporttudományi Kar (TF) Sporttudományi Doktori Iskola

Részletesebben

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű

Részletesebben

SZENT ISTVÁN EGYETEM, Gödöllı. Gazdálkodás- és Szervezéstudományok Doktori Iskola. Doktori (PhD) értekezés

SZENT ISTVÁN EGYETEM, Gödöllı. Gazdálkodás- és Szervezéstudományok Doktori Iskola. Doktori (PhD) értekezés SZENT ISTVÁN EGYETEM, Gödöllı Gazdálkodás- és Szervezéstudományok Doktori Iskola Doktori (PhD) értekezés A TERMELİI ÉRTÉKESÍTİ SZERVEZETEK (TÉSZ) LEHETİSÉGEI A ZÖLDSÉG-GYÜMÖLCS TERMELİK KOORDINÁLÁSÁBAN

Részletesebben

Technológiai módszeregyüttes, az optimális biotechnológiához tartozó paraméterek: KABA, Kutricamajor

Technológiai módszeregyüttes, az optimális biotechnológiához tartozó paraméterek: KABA, Kutricamajor Technológiai módszeregyüttes, az optimális biotechnológiához tartozó paraméterek: KABA, Kutricamajor TECHNOLÓGIAI MÓDSZEREGYÜTTES, AZ OPTIMÁLIS BIOTECHNOLÓGIÁHOZ TARTOZÓ PARAMÉTEREK: KABA, KUTRICAMAJOR...

Részletesebben

TELEPÜLÉSI SZENNYVÍZISZAP HASZNOSÍTÁSÁNAK LEHETİSÉGEI 3.

TELEPÜLÉSI SZENNYVÍZISZAP HASZNOSÍTÁSÁNAK LEHETİSÉGEI 3. TELEPÜLÉSI SZENNYVÍZISZAP HASZNOSÍTÁSÁNAK LEHETİSÉGEI 3. 1 2. 1. 4. JELENLEGI HELYZET A települési szennyvíziszap Magyarországi mennyisége évente megközelítıen 700.000 tonna Ennek 25-30%-a szárazanyag

Részletesebben

Az élelmiszerek mikrobiális ökológiája. Mohácsiné dr. Farkas Csilla

Az élelmiszerek mikrobiális ökológiája. Mohácsiné dr. Farkas Csilla Az élelmiszerek mikrobiális ökológiája Mohácsiné dr. Farkas Csilla Az élelmiszerek mikroökológiai tényezői Szennyeződés forrásai és közvetítői A mikroorganizmusok belső tulajdosnágai Belső tényezők (az

Részletesebben

A BAKTÉRIUMOK SZAPORODÁSA

A BAKTÉRIUMOK SZAPORODÁSA 5. előadás A BAKTÉRIUMOK SZAPORODÁSA Növekedés: a baktérium új anyagokat vesz fe a környezetből, ezeket asszimilálja megnő a sejt térfogata Amikor a sejt térfogat és felület közti arány megváltozik sejtosztódás

Részletesebben

VIZEINK VÉDELME (A BÜKKI NEMZETI PARK IGAZGATÓSÁG MŐKÖDÉSI TERÜLETÉN)

VIZEINK VÉDELME (A BÜKKI NEMZETI PARK IGAZGATÓSÁG MŐKÖDÉSI TERÜLETÉN) VIZEINK VÉDELME (A BÜKKI NEMZETI PARK IGAZGATÓSÁG MŐKÖDÉSI TERÜLETÉN) Századunk elsı évtizedében szélsıséges klimatikus viszonyokat tapasztaltunk. Szembesültünk a meteorológiai tényezık (pl. csapadék,

Részletesebben

DEBRECENI EGYETEM AGRÁR- ÉS MŐSZAKI TUDOMÁNYOK CENTRUMA AGRÁRGAZDASÁGI ÉS VIDÉKFEJLESZTÉSI KAR VÁLLALATGAZDASÁGTANI ÉS MARKETING TANSZÉK

DEBRECENI EGYETEM AGRÁR- ÉS MŐSZAKI TUDOMÁNYOK CENTRUMA AGRÁRGAZDASÁGI ÉS VIDÉKFEJLESZTÉSI KAR VÁLLALATGAZDASÁGTANI ÉS MARKETING TANSZÉK DEBRECENI EGYETEM AGRÁR- ÉS MŐSZAKI TUDOMÁNYOK CENTRUMA AGRÁRGAZDASÁGI ÉS VIDÉKFEJLESZTÉSI KAR VÁLLALATGAZDASÁGTANI ÉS MARKETING TANSZÉK IHRIG KÁROLY GAZDÁLKODÁS- ÉS SZERVEZÉSTUDOMÁNYOK DOKTORI ISKOLA

Részletesebben

A projekt rövidítve: NANOSTER A projekt időtartama: 2009. október 2012. december

A projekt rövidítve: NANOSTER A projekt időtartama: 2009. október 2012. december A projekt címe: Egészségre ártalmatlan sterilizáló rendszer kifejlesztése A projekt rövidítve: NANOSTER A projekt időtartama: 2009. október 2012. december A konzorcium vezetője: A konzorcium tagjai: A

Részletesebben

Trópusi övezet meleg mérsékelt öv Legforróbb kontinens : Trópusi övezet mindhárom öve megtalálható:

Trópusi övezet meleg mérsékelt öv Legforróbb kontinens : Trópusi övezet mindhárom öve megtalálható: Trópusi övezet meleg mérsékelt öv Legforróbb kontinens : Területének 95%-a trópusi övezetben Magas napállás miatt legtöbb melegmennyiség Trópusi övezet mindhárom öve megtalálható: Egyenlítıi,átmeneti,

Részletesebben

BALATONFÖLDVÁRI TÖBBCÉLÚ KISTÉRSÉGI TÁRSULÁS KÖZOKTATÁSI ESÉLYEGYENLİSÉGI PROGRAMJA

BALATONFÖLDVÁRI TÖBBCÉLÚ KISTÉRSÉGI TÁRSULÁS KÖZOKTATÁSI ESÉLYEGYENLİSÉGI PROGRAMJA BALATONFÖLDVÁRI TÖBBCÉLÚ KISTÉRSÉGI TÁRSULÁS KÖZOKTATÁSI ESÉLYEGYENLİSÉGI PROGRAMJA 2008. Q u a l y - C o O k t a t á s i T a n á c s a d ó 1141 Budapest, Fogarasi út 111. Tel. fax: (1) 239-1460; (1) 451-0391;

Részletesebben

I. Szennyvizekben, szennyezett talajokban a biológiai oxigénigény mérése

I. Szennyvizekben, szennyezett talajokban a biológiai oxigénigény mérése Talajok, természetes vizek, szennyvizek állapotának felmérése, a szennyezett területek tisztulási folyamatának nyomonkövetése Talajok, vizek minıségének meghatározása fizikai, kémiai, biológai vizsgálatok

Részletesebben

Dengue-láz. Dr. Szabó György Pócsmegyer

Dengue-láz. Dr. Szabó György Pócsmegyer Dengue-láz Dr. Szabó György Pócsmegyer Történelem Az ókori Kínában leírták. 1906-ban igazolták, hogy szúnyog terjeszti a betegséget. 1907-ben igazolták, hogy vírus. A II. világháború után kezdett megvadulni

Részletesebben

2.6.16. VIZSGÁLATOK IDEGEN KÓROKOZÓKRA HUMÁN ÉLŐVÍRUS-VAKCINÁKBAN

2.6.16. VIZSGÁLATOK IDEGEN KÓROKOZÓKRA HUMÁN ÉLŐVÍRUS-VAKCINÁKBAN 2.6.16. Vizsgálatok idegen kórokozókra Ph.Hg.VIII. - Ph.Eur.7.0 1 2.6.16. VIZSGÁLATOK IDEGEN KÓROKOZÓKRA HUMÁN ÉLŐVÍRUS-VAKCINÁKBAN 01/2011:20616 Azokhoz a vizsgálatokhoz, amelyekhez a vírust előzőleg

Részletesebben

KISTELEPÜLÉSEK TÉRBEN ÉS IDİBEN 1

KISTELEPÜLÉSEK TÉRBEN ÉS IDİBEN 1 KISTELEPÜLÉSEK TÉRBEN ÉS IDİBEN 1 Fleischer Tamás 1. BEVEZETÉS A hetvenes évek derekán az addigi "tanyakérdést" követıen átterelıdött a figyelem a kistelepülésekre: mondhatnánk - már ami a közleményeket

Részletesebben

Salmonella vizsgálatok és salmonella helyzet. Dr.Lebhardt Károly M.A.H.Food-Controll Kft

Salmonella vizsgálatok és salmonella helyzet. Dr.Lebhardt Károly M.A.H.Food-Controll Kft Salmonella vizsgálatok és salmonella helyzet Dr.Lebhardt Károly M.A.H.Food-Controll Kft Salmonellák bemutatása Enterobacteriaceae családba tartozó Gramnegatív pálcák, körülcsillósak, aktívan mozognak (kivéve

Részletesebben

A Nemzeti Éghajlatváltozási Stratégia Környezeti Vizsgálata (NÉS SKV)

A Nemzeti Éghajlatváltozási Stratégia Környezeti Vizsgálata (NÉS SKV) A Nemzeti Éghajlatváltozási Stratégia Környezeti Vizsgálata (NÉS SKV) Készült a Környezetvédelmi és Vízügyi Minisztérium Zöld Forrás támogatásával Ökológiai Intézet a Fenntartható Fejlıdésért Alapítvány

Részletesebben

Növekvı arzén adagokkal kezelt öntözıvíz hatása a paradicsom és a saláta növényi részenkénti arzén tartalmára és eloszlására

Növekvı arzén adagokkal kezelt öntözıvíz hatása a paradicsom és a saláta növényi részenkénti arzén tartalmára és eloszlására PANNON EGYETEM GEORGIKON KAR NÖVÉNYVÉDELMI INTÉZET NÖVÉNYTERMESZTÉSI ÉS KERTÉSZETI TUDOMÁNYOK DOKTORI ISKOLA Iskolavezető: Dr. Kocsis László, egyetemi tanár Témavezetők: Dr. Nádasyné Dr. Ihárosi Erzsébet,

Részletesebben

NÉPEGÉSZSÉGÜGYI SZAKIGAZGATÁSI SZERV

NÉPEGÉSZSÉGÜGYI SZAKIGAZGATÁSI SZERV NÉPEGÉSZSÉGÜGYI SZAKIGAZGATÁSI SZERV Iktatószám: 1035-6/2011. Tárgy: Balatonboglár, Jankovich telepi és Bólyaközi strandok fürdıvízprofil megállapítása Elıadó: Szanyi Attiláné Hivatkozási szám: Melléklet:

Részletesebben

Radon-koncentráció relatív meghatározása Készítette: Papp Ildikó

Radon-koncentráció relatív meghatározása Készítette: Papp Ildikó Radon-koncentráció relatív meghatározása Készítette: Papp Ildikó Elméleti bevezetés PANNONPALATINUS regisztrációs code PR/B10PI0221T0010NF101 A radon a 238 U bomlási sorának tagja, a periódusos rendszer

Részletesebben

SZAKDOLGOZAT. Czibere Viktória

SZAKDOLGOZAT. Czibere Viktória SZAKDOLGOZAT Czibere Viktória Debrecen 2009 Debreceni Egyetem Informatikai Kar Könyvtárinformatikai Tanszék A könyvtárhasználati ismeretek oktatásának sajátosságai különbözı életkori csoportokban Témavezetı:

Részletesebben

Riemerella anatipestifer okozta

Riemerella anatipestifer okozta Riemerella anatipestifer okozta megbetegedés pulykában Nemes Csaba PhD, Tóth Zoltán, Simonyai Erika, Makrai László PhD, Surányi Andrea, Cséplő Attila, Glávits Róbert az állatorvos-tudományok tudományok

Részletesebben

Várandós nők Streptococcus agalactiaeszűrése

Várandós nők Streptococcus agalactiaeszűrése Várandós nők Streptococcus agalactiaeszűrése MALDI-TOF MS módszerrel Pappné Ábrók Marianna, Arcson Ágnes, Urbán Edit, Deák Judit Szegedi Tudományegyetem, Általános Orvostudományi Kar Klinikai Mikrobiológiai

Részletesebben

Talaj - talajvédelem

Talaj - talajvédelem Talaj - talajvédelem A Talaj: - a levegıvel és a vízzel egyenértékő elem - a természeti és mővi környezet eleme - az anyag és energiaáramlások közege - három v. négy fázisú összetett rendszer A talaj,

Részletesebben

Foglalkozási betegségek és balesetek 1

Foglalkozási betegségek és balesetek 1 Bánóné Fleischmann Marianna Foglalkozási betegségek és balesetek 1 Foglalkozási betegségek alatt a dolgozó szervezetét hivatásos tevékenykedése közben ért ártalmak által kifejlıdı betegségeket értjük,

Részletesebben

SalmoXis 400. Mercordi BVBA, Stadsbeemd 1215, B-3545 Halen, Belgium Mercordi BV, De Noord 21, 6001 D.A. Weert, Holland www.mercordi.

SalmoXis 400. Mercordi BVBA, Stadsbeemd 1215, B-3545 Halen, Belgium Mercordi BV, De Noord 21, 6001 D.A. Weert, Holland www.mercordi. A tudományos megoldás Hatásmechanizmus SalmoXis 400. 1.egyensúlyba hozza a bélflórát szelektív gátlás révén és a mikrobiológiai aktivitás csökkentésével. 2. gondoskodik a bélbolyhok épségérıl az apoptosis

Részletesebben

Munkavédelmi helyzet a Vegyipari Ágazati Párbeszéd Bizottság területén

Munkavédelmi helyzet a Vegyipari Ágazati Párbeszéd Bizottság területén Mottó: Felelısségteljes élet és cselekvés a munkahelyeken (Fıcze Lajos) Munkavédelmi helyzet a Vegyipari Ágazati Párbeszéd Bizottság területén Vegyipari Ágazati Párbeszédbizottság Budapest 2009. május

Részletesebben

nemzetség Clostridium-nemzets 22. tétel Clostridium perfringens Clostridium perfringens Clostridium perfringens okozta enterotoxaemiák

nemzetség Clostridium-nemzets 22. tétel Clostridium perfringens Clostridium perfringens Clostridium perfringens okozta enterotoxaemiák Clostridium-nemzets nemzetség 22. tétel Clostridium perfringens okozta enterotoxaemiák Gram-pozitív anaerob viszonyok között szaporodnak spóraképzı baktériumok (a spórák kidomborítják a baktériumtestet;

Részletesebben

TÉZISEK. Közszolgáltatások térbeli elhelyezkedésének hatékonyságvizsgálata a földhivatalok példáján

TÉZISEK. Közszolgáltatások térbeli elhelyezkedésének hatékonyságvizsgálata a földhivatalok példáján Széchenyi István Egyetem Regionális és Gazdaságtudományi Doktori Iskola Budaházy György TÉZISEK Közszolgáltatások térbeli elhelyezkedésének hatékonyságvizsgálata a földhivatalok példáján Címő Doktori (PhD)

Részletesebben

A talaj szerves anyagai

A talaj szerves anyagai A talaj szerves anyagai a talajban elıfordul forduló összes szerves eredető anyagok a talaj élılényei (élı biomassza), a talajban élı növények nyek gyökérzete rzete, az elhalt növényi n nyi és állati maradványok

Részletesebben

VI. Magyar Földrajzi Konferencia 1-7

VI. Magyar Földrajzi Konferencia 1-7 Akác Andrea 1 Bányai Dóra 2 Dr. Centeri Csaba 3 TÁJVÁLTOZÁS MÉRTÉKÉNEK MEGHATÁROZÁSA A FELSİ-TARNA-VIDÉKEN BEVEZETÉS A Tarna vidéken már az elızı évszázad elején felismerték a felelıtlen erdıirtások okozta

Részletesebben

E L İ T E R J E S Z T É S

E L İ T E R J E S Z T É S AZ ELİTERJESZTÉS SORSZÁMA: 64. MELLÉKLET: 1 db TÁRGY: Javaslat Szekszárd Megyei Jogú Város Ifjúsági Koncepciójára E L İ T E R J E S Z T É S SZEKSZÁRD MEGYEI JOGÚ VÁROS ÖNKORMÁNYZATA KÖZGYŐLÉSÉNEK 2009.

Részletesebben

Immunológia I. 2. előadás. Kacskovics Imre (imre.kacskovics@ttk.elte.hu)

Immunológia I. 2. előadás. Kacskovics Imre (imre.kacskovics@ttk.elte.hu) Immunológia I. 2. előadás Kacskovics Imre (imre.kacskovics@ttk.elte.hu) Az immunválasz kialakulása A veleszületett és az adaptív immunválasz összefonódása A veleszületett immunválasz mechanizmusai A veleszületett

Részletesebben

MTA DOKTORI ÉRTEKEZÉS

MTA DOKTORI ÉRTEKEZÉS MTA DOKTORI ÉRTEKEZÉS ELLENTÉTES TÖLTÉSŐ POLIELEKTROLITOK ÉS TENZIDEK ASSZOCIÁCIÓJA Mészáros Róbert Eötvös Loránd Tudományegyetem Kémiai Intézet Budapest, 2009. december Köszönetnyilvánítás Ezúton szeretném

Részletesebben

A KÁRPÁT-MEDENCE ÉGHAJLATÁNAK ALAKÍTÓ TÉNYEZİI

A KÁRPÁT-MEDENCE ÉGHAJLATÁNAK ALAKÍTÓ TÉNYEZİI A KÁRPÁT-MEDENCE ÉGHAJLATÁNAK ALAKÍTÓ TÉNYEZİI A LEGALAPVETİBB ÉGHAJLAT-MEGHATÁROZÓ TÉNYEZİ: A FÖLDRAJZI FEKVÉS. A Kárpát-medence az északi félgömbi mérsékelt övezet középsı sávjában, a valódi mérsékelt

Részletesebben

VÍZKEZLÉS ÉS SZENNYVÍZTISZTÍTÁS

VÍZKEZLÉS ÉS SZENNYVÍZTISZTÍTÁS VÍZKEZLÉS ÉS SZENNYVÍZTISZTÍTÁS 2008. A környezetgazdálkodási mérnöki, illetve a természetvédelmi és vadgazda mérnöki alapképzési (BSc) szakok képesítési követelményeinek kidolgozása, a szakok beindítása

Részletesebben

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A TM vizsgálatok alapkérdései A vizsgálatok célja, információértéke? Az alkalmazás területei? Hogyan válasszuk ki az alkalmazott

Részletesebben

GÁZIONIZÁCIÓS DETEKTOROK VIZSGÁLATA. Mérési útmutató. Gyurkócza Csaba

GÁZIONIZÁCIÓS DETEKTOROK VIZSGÁLATA. Mérési útmutató. Gyurkócza Csaba GÁZIONIZÁCIÓS DETEKTOROK VIZSGÁLATA Mérési útmutató Gyurkócza Csaba BME NTI 1997 2 Tartalom 1. BEVEZETÉS... 3 2. ELMÉLETI ÖSSZEFOGLALÁS... 3 2.1. Töltéshordozók keletkezése (ionizáció) töltött részecskéknél...

Részletesebben

A Bacillus anthracisról. Sréterné dr. Lancz Zsuzsanna Élelmiszer- és Takarmánybiztonsági Igazgatóság

A Bacillus anthracisról. Sréterné dr. Lancz Zsuzsanna Élelmiszer- és Takarmánybiztonsági Igazgatóság A Bacillus anthracisról Sréterné dr. Lancz Zsuzsanna Élelmiszer- és Takarmánybiztonsági Igazgatóság A Bacillus anthracis A legsúlyosabb megbetegedést kérődzőkben okozza, de a legtöbb emlősfajt, beleértve

Részletesebben

Sertés újszülött kori coli hasmenése. Kórfejlődés, vakcinázás

Sertés újszülött kori coli hasmenése. Kórfejlődés, vakcinázás Sertés újszülött kori coli hasmenése Kórfejlődés, vakcinázás ETEC (enterotoxikus E. coli) Naposkori (első héten jelentkező) megbetegedésekért felelős Fontosabb antigének: Adhesinek: Pilusok, fimbriák Toxinok:

Részletesebben

Mikroorganizmusok patogenitása

Mikroorganizmusok patogenitása Mikroorganizmusok patogenitása Dr. Maráz Anna egyetemi tanár Mikrobiológia és Biotechnológia Tanszék Élelmiszertudományi Kar Budapesti Corvinus Egyetem Mikroorganizmusok kölcsönhatásai (interakciói) Szimbiózis

Részletesebben

Szürke marhától a szürke marháig Fenékpusztán *

Szürke marhától a szürke marháig Fenékpusztán * Készítette: Palkó Csaba Szürke marhától a szürke marháig Fenékpusztán * * 1. kép Bevezetés Egyedülálló nemzeti kincsünk a Balaton. (2. kép) A tó környezetében már ritka a természetes partszakasz. Az egyik

Részletesebben

A biomassza, mint energiaforrás. Mit remélhetünk, és mit nem?

A biomassza, mint energiaforrás. Mit remélhetünk, és mit nem? MTA Kémiai Kutatóközpont Anyag- és Környezetkémiai Intézet Budapest II. Pusztaszeri út 59-67 A biomassza, mint energiaforrás. Mit remélhetünk, és mit nem? Várhegyi Gábor Biomassza: Biológiai definíció:

Részletesebben

Adatgyőjtés, mérési alapok, a környezetgazdálkodás fontosabb mőszerei

Adatgyőjtés, mérési alapok, a környezetgazdálkodás fontosabb mőszerei GazdálkodásimodulGazdaságtudományismeretekI.Közgazdaságtan KÖRNYEZETGAZDÁLKODÁSIMÉRNÖKIMScTERMÉSZETVÉDELMIMÉRNÖKIMSc Tudományos kutatásmódszertani, elemzési és közlési ismeretek modul Adatgyőjtés, mérési

Részletesebben

A KENYÉRKÉSZÍTÉS FOLYAMATAI I. Dr. Gasztonyi Kálmán

A KENYÉRKÉSZÍTÉS FOLYAMATAI I. Dr. Gasztonyi Kálmán Gasztonyi Kálmán dr.: A kenyérkészítés folyamatai I. SÜTİIPAROSOK, PÉKEK: 49. évf. 2002. 3. sz. 8-14.o. A KENYÉRKÉSZÍTÉS FOLYAMATAI I. Dr. Gasztonyi Kálmán Ebben a négyrészes tanulmány-sorozatban a legfontosabb

Részletesebben

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan

A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan A basidiomycota élesztőgomba, a Filobasidium capsuligenum IFM 40078 törzse egy olyan fehérjét (FC-1 killer toxint) választ ki a tápközegbe, amely elpusztítja az opportunista patogén Cryptococcus neoformans-t.

Részletesebben

A Víz Keretirányelv hazai megvalósítása VÍZGYŐJTİ-GAZDÁLKODÁSI TERV

A Víz Keretirányelv hazai megvalósítása VÍZGYŐJTİ-GAZDÁLKODÁSI TERV A Víz Keretirányelv hazai megvalósítása VÍZGYŐJTİ-GAZDÁLKODÁSI TERV 1-13. jelő, Észak-Mezıföld és Keleti-Bakony vízgyőjtı közreadja: Vízügyi és Környezetvédelmi Központi Igazgatóság, Közép-dunántúli Környezetvédelmi

Részletesebben

Válasz Dr. Szabó Dóra intézetvezetı egyetemi docens Asszony (az MTA doktora) opponensi kérdéseire és kritikai megjegyzéseire

Válasz Dr. Szabó Dóra intézetvezetı egyetemi docens Asszony (az MTA doktora) opponensi kérdéseire és kritikai megjegyzéseire Válasz Dr. Szabó Dóra intézetvezetı egyetemi docens Asszony (az MTA doktora) opponensi kérdéseire és kritikai megjegyzéseire Tisztelt Docens Asszony! Elıször is szeretném megköszönni Önnek, hogy elvállalta

Részletesebben

HALAK OKOZTA MÉRGEZÉS 1. toxin: kis molekulaszerkezető, hıstabil gyomornedvek nem károsítják

HALAK OKOZTA MÉRGEZÉS 1. toxin: kis molekulaszerkezető, hıstabil gyomornedvek nem károsítják HALAK OKOZTA MÉRGEZÉSEK ELİADÓ DR. LEHEL JÓZSEF HALAK OKOZTA MÉRGEZÉS 1 I. MÉRGET TARTALMAZÓ HALAK MÉRGEZİ HÚSÚ toxin: kis molekulaszerkezető, hıstabil gyomornedvek nem károsítják csoport ciguatoxin, maitotoxin,

Részletesebben

AZ ÉGHAJLATI ELEMEK IDİBELI ÉS TÉRBELI VÁLTOZÁSAI MAGYARORSZÁGON A HİMÉRSÉKLET

AZ ÉGHAJLATI ELEMEK IDİBELI ÉS TÉRBELI VÁLTOZÁSAI MAGYARORSZÁGON A HİMÉRSÉKLET AZ ÉGHAJLATI ELEMEK IDİBELI ÉS TÉRBELI VÁLTOZÁSAI MAGYARORSZÁGON A HİMÉRSÉKLET A TALAJ HİMÉRSÉKLETE A talaj jelentısége a hımérséklet alakításában kiemelkedı: a sugárzást elnyelı és felmelegedı talaj hosszúhullámú

Részletesebben

Matyusz Zsolt A 2009-ES VERSENYKÉPESSÉGI ADATFELVÉTEL VÁLLALATI MINTÁJÁNAK ALAPJELLEMZİI ÉS REPREZENTATIVITÁSA

Matyusz Zsolt A 2009-ES VERSENYKÉPESSÉGI ADATFELVÉTEL VÁLLALATI MINTÁJÁNAK ALAPJELLEMZİI ÉS REPREZENTATIVITÁSA BUDAPESTI CORVINUS EGYETEM VÁLLALATGAZDASÁGTAN INTÉZET VERSENYKÉPESSÉG KUTATÓ KÖZPONT Matyusz Zsolt A 2009-ES VERSENYKÉPESSÉGI ADATFELVÉTEL VÁLLALATI MINTÁJÁNAK ALAPJELLEMZİI ÉS REPREZENTATIVITÁSA TM1.

Részletesebben

SAJTÓANYAG BEMUTATTÁK A BALATONRÓL KÉSZÜLT KUTATÁSOK EREDMÉNYEIT

SAJTÓANYAG BEMUTATTÁK A BALATONRÓL KÉSZÜLT KUTATÁSOK EREDMÉNYEIT 2013. február 13. SAJTÓANYAG BEMUTATTÁK A BALATONRÓL KÉSZÜLT KUTATÁSOK EREDMÉNYEIT A Balaton turisztikai régió kiemelt szerepet játszik a magyar turizmusban: a KSH elızetes adatai szerint 2012-ben a kereskedelmi

Részletesebben

PÉCSI TUDOMÁNYEGYETEM KÖZGAZDASÁGTUDOMÁNYI KAR REGIONÁLIS POLITIKA ÉS GAZDASÁGTAN DOKTORI ISKOLA

PÉCSI TUDOMÁNYEGYETEM KÖZGAZDASÁGTUDOMÁNYI KAR REGIONÁLIS POLITIKA ÉS GAZDASÁGTAN DOKTORI ISKOLA PÉCSI TUDOMÁNYEGYETEM KÖZGAZDASÁGTUDOMÁNYI KAR REGIONÁLIS POLITIKA ÉS GAZDASÁGTAN DOKTORI ISKOLA Iskolavezetı: Dr. Buday-Sántha Attila A TERÜLETI TURIZMUSFEJLESZTÉS LEHETİSÉGEI A SZÉKELYFÖLDÖN A doktori

Részletesebben

A víz. Szerkesztette: Vizkievicz András

A víz. Szerkesztette: Vizkievicz András A víz Szerkesztette: Vizkievicz András 1. A talajban, mint talajoldat, ami lehet: kapillárisvíz (növények által felvehetı víz), abszorbciós víz (talajkolloidok felületén megkötött víz, növények számára

Részletesebben

Campylobacter a baromfi ólban, Campylobacter az asztalunkon. Dr. Molnár Andor Állatorvos, tudományos munkatárs Pannon Egyetem, Georgikon Kar

Campylobacter a baromfi ólban, Campylobacter az asztalunkon. Dr. Molnár Andor Állatorvos, tudományos munkatárs Pannon Egyetem, Georgikon Kar Campylobacter a baromfi ólban, Campylobacter az asztalunkon Dr. Molnár Andor Állatorvos, tudományos munkatárs Pannon Egyetem, Georgikon Kar Bemutatkozás Ausztria-Magyarország határon átnyúló együttműködési

Részletesebben

Befektetés a jövıbe program. Babusik Ferenc: A 2006-2007. évben belépettek, illetve a programot 2007 ben befejezık interjúinak

Befektetés a jövıbe program. Babusik Ferenc: A 2006-2007. évben belépettek, illetve a programot 2007 ben befejezık interjúinak Befektetés a jövıbe program Babusik Ferenc: A 2006-2007. évben belépettek, illetve a programot 2007 ben befejezık interjúinak elemzése Tartalom Áttekintı adatok...3 Néhány program adat...7 Munkajövedelem,

Részletesebben

TRANSZGÉNIKUS NIKUS. GM gyapot - KÍNA. GM szója - ARGENTÍNA

TRANSZGÉNIKUS NIKUS. GM gyapot - KÍNA. GM szója - ARGENTÍNA TRANSZGÉNIKUS NIKUS NÖVÉ GM gyapot - KÍNA GM szója - ARGENTÍNA TRANSZGÉNIKUS NIKUS NÖVÉN Élelmezési probléma: mg-i i termények, élelmiszer alapanyagok károsk rosításasa (rovar, gyom, baktérium, gomba,

Részletesebben

110. A madarak nemi szerveinek kórbonctana

110. A madarak nemi szerveinek kórbonctana Madarak nıi n i nemi szerveinek felépítése 110. A madarak nemi szerveinek kórbonctana petefészek tojócsı (petevezetı) tuba (a petesejt befogadása, megtermékenyülés) magnum (fehérjetermelı szakasz) isthmus

Részletesebben

DEBRECENI EGYETEM Agrártudományi Centrum Mezıgazdaságtudományi kar Agrár-mőszaki Tanszék

DEBRECENI EGYETEM Agrártudományi Centrum Mezıgazdaságtudományi kar Agrár-mőszaki Tanszék DEBRECENI EGYETEM Agrártudományi Centrum Mezıgazdaságtudományi kar Agrár-mőszaki Tanszék INTERDISZCIPLINÁRIS AGRÁR- ÉS TERMÉSZETTUDOMÁNYOK DOKTORI ISKOLA Doktori Iskola vezetı: Prof. dr. Nagy János MTA

Részletesebben

Gram-pozitív patogén baktériumok

Gram-pozitív patogén baktériumok Gram-pozitív patogén baktériumok Mohácsiné dr. Farkas Csilla Listeria monocytogenes Mikroba jellemzők: Gram-pozitív, fakultatív anaerob 7 Listeria faj, patogén : Listeria monocytogenes 13 patogén szerotípus

Részletesebben

E-mail: mikromikomed@t-email.hu

E-mail: mikromikomed@t-email.hu A mérés célja: Végtermékként gyártott lábbeli-fertıtlenítı eszközök verifikáló dózisának igazolása (validálása), hatékonysági vizsgálat alapján. A minták elıélete Tudományosan igazolt tény, hogy az UV

Részletesebben

1. A dolgozat tárgya és célkitőzései

1. A dolgozat tárgya és célkitőzései Eötvös Loránd Tudományegyetem Bölcsészettudományi Kar Nyelvtudományi Doktori Iskola Germanisztikai Nyelvtudományi Doktori Program Juhász Márta A csolnoki nyelvjárás. Egy magyarországi német dialektus nyelvi

Részletesebben

ÉS ÁGAZATI EREDMÉNY DIFFERENCIÁLTSÁGA UDOVECZ GÁBOR dr. KERTÉSZ RÓBERT BÉLÁDI KATALIN dr.

ÉS ÁGAZATI EREDMÉNY DIFFERENCIÁLTSÁGA UDOVECZ GÁBOR dr. KERTÉSZ RÓBERT BÉLÁDI KATALIN dr. DIFFERENTIATION OF COSTS AND RETURNS IN AGRICULTURAL BRANCHES UDOVECZ, GÁBOR KERTÉSZ, RÓBERT BÉLÁDI, KATALIN Keywords: median costs and scatter, market dominating farms, investment return ratio, differentiation

Részletesebben

A vízi ökoszisztémák

A vízi ökoszisztémák A vízi ökoszisztémák Az ökoszisztéma Az ökoszisztéma, vagy más néven ökológiai rendszer olyan strukturális és funkcionális rendszer, amelyben a növények, mint szerves anyag termelők, az állatok mint fogyasztók,

Részletesebben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben

TDK lehetőségek az MTA TTK Enzimológiai Intézetben TDK lehetőségek az MTA TTK Enzimológiai Intézetben Vértessy G. Beáta egyetemi tanár TDK mind 1-3 helyezettek OTDK Pro Scientia különdíj 1 második díj Diákjaink Eredményei Zsűri különdíj 2 első díj OTDK

Részletesebben

Vezikuláris transzport

Vezikuláris transzport Molekuláris Sejtbiológia Vezikuláris transzport Dr. habil KŐHIDAI László Semmelweis Egyetem, Genetikai, Sejt- és Immunbiológiai Intézet 2005. november 3. Intracelluláris vezikul uláris transzport Kommunikáció

Részletesebben

A Munkaügyi Közvetítıi és Döntıbírói Szolgálat Szervezeti, Mőködési és Eljárási Szabályzata

A Munkaügyi Közvetítıi és Döntıbírói Szolgálat Szervezeti, Mőködési és Eljárási Szabályzata A Munkaügyi Közvetítıi és Döntıbírói Szolgálat Szervezeti, Mőködési és Eljárási Szabályzata (az Országos Érdekegyeztetı Tanács 2008. július 04. jóváhagyta) 1. / A szervezet megnevezése: Munkaügyi Közvetítıi

Részletesebben

Médiahatás-vizsgálat. A médiumok teljes mértékig átitatják mindennapi életünket. A modern társadalmakban élık számára a média megkerülhetetlen

Médiahatás-vizsgálat. A médiumok teljes mértékig átitatják mindennapi életünket. A modern társadalmakban élık számára a média megkerülhetetlen Médiahatás-vizsgálat. A médiumok teljes mértékig átitatják mindennapi életünket. A modern társadalmakban élık számára a média megkerülhetetlen szocializációs tényezıként van jelen. A kereskedelmi televíziók

Részletesebben

MAGYARORSZÁG VÍZGYŐJTİ- GAZDÁLKODÁSI TERVE

MAGYARORSZÁG VÍZGYŐJTİ- GAZDÁLKODÁSI TERVE A víz élet, gondozzuk közösen! MAGYARORSZÁG VÍZGYŐJTİ- GAZDÁLKODÁSI TERVE A 2009. december 22-én közétett A Duna-vízgyőjtı magyarországi része VÍZGYŐJTİ-GAZDÁLKODÁSI TERV dokumentumának összefoglaló, rövidített

Részletesebben

Fenntartható növekedés? A megújult lisszaboni stratégia kritikai elemzése a fenntarthatóság szempontjából

Fenntartható növekedés? A megújult lisszaboni stratégia kritikai elemzése a fenntarthatóság szempontjából Farkas B. (szerk.) 2007: A lisszaboni folyamat és Magyarország. SZTE Gazdaságtudományi Kar Közleményei 2007. JATEPress, Szeged, 217-232. o. Fenntartható növekedés? A megújult lisszaboni stratégia kritikai

Részletesebben

DAOP Humán Közösségi Infrastruktúra-fejlesztések. HBF Hungaricum Kft. és INNOV Hungaricum Kft. konzorciuma

DAOP Humán Közösségi Infrastruktúra-fejlesztések. HBF Hungaricum Kft. és INNOV Hungaricum Kft. konzorciuma Az akcióterv neve DAOP Humán Közösségi Infrastruktúra-fejlesztések Készítette HBF Hungaricum Kft. és INNOV Hungaricum Kft. konzorciuma Verziószám DAOP_HKIF_V_7.5 1. Az akcióterv ismertetése és a kontextusát

Részletesebben

Vibrio, Campylobacter, Helicobacter. Szabó Judit

Vibrio, Campylobacter, Helicobacter. Szabó Judit Vibrio, Campylobacter, Helicobacter Szabó Judit Vibrio cholerae: cholera Vibrionaceae Vibrio parahaemolyticus: tenger gyümölcsei, hasmenést okoz Vibrio vulnificus: tengerben való fürdés, súlyos bır és

Részletesebben

1. forduló 5. 6. osztály

1. forduló 5. 6. osztály forduló osztály Iskola neve: Csapattagok neve: Beküldési határidı: 201 március Hétvezér Általános Iskola A fordulóba a legalább 100 pontot elért csapatok jutnak be. NÖVÉNYISMERET Olyan jó lenne ismerni

Részletesebben

protein zsír szénhydrat zabból 77 3 % 82 4 % 73 7 % árpából. 77 0 100 0 87 0

protein zsír szénhydrat zabból 77 3 % 82 4 % 73 7 % árpából. 77 0 100 0 87 0 A korpaetetésrıl. Ha a búza- vagy rozsszemnek keresztmetszetét a górcsı alatt vizsgáljuk, elsıben is az epicarpium (külsı gyümölcshéj) felbıre (epidermise) tünik fel, mely alatt közvetlenül laposra nyomott

Részletesebben

-pl. baktériumok és gombák toxinjai, mérgező növények, mérgező állati termékek, növényvédő szerek, különböző szennyező anyagok

-pl. baktériumok és gombák toxinjai, mérgező növények, mérgező állati termékek, növényvédő szerek, különböző szennyező anyagok ÉLELEM ÚTJÁN TERJEDŐ MEGBETEGEDÉSEK = elfogyasztott ételben, italban levő mérgező hatású anyag (mikroorganizmus, mérgező növény, vegyi anyag) okoz Jellemzői: rövid lappangási idő heveny, robbanásszerű

Részletesebben

Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei

Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei Kollányi Bence: Miért nem használ internetet? A World Internet Project 2006-os felmérésének eredményei A World Internet Project magyarországi kutatása országos reprezentatív minta segítségével készül.

Részletesebben

KÉPZİMŐVÉSZETI SZAKOK PÁRHUZAMOS ÉRTÉKELÉSE

KÉPZİMŐVÉSZETI SZAKOK PÁRHUZAMOS ÉRTÉKELÉSE KÉPZİMŐVÉSZETI SZAKOK PÁRHUZAMOS ÉRTÉKELÉSE AKKREDITÁCIÓS JELENTÉS i A határozatokban foglalt szakok akkreditációjának hatálya: 2016. október 3. A Látogató Bizottság elnöke: Zwickl András mővészettörténész,

Részletesebben

A 2008/8. SZÁM TARTALMA

A 2008/8. SZÁM TARTALMA A 2008/8. SZÁM TARTALMA LÓGYÓGYÁSZAT Czimber Gy. E., Bozsaky É., Horváth D., Fekete Z.: Az eredményesség növelésének lehetıségei nem sebészi módszerrel végzett embrióátültetések esetén. Irodalmi összefoglaló

Részletesebben