A rekombináns humán erythropoietin-α fokozza a humán laphámrák sugárérzékenységét preklinikai modellben

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "A rekombináns humán erythropoietin-α fokozza a humán laphámrák sugárérzékenységét preklinikai modellben"

Átírás

1 A rekombináns humán erythropoietin-α fokozza a humán laphámrák sugárérzékenységét preklinikai modellben Eredeti közlemény Lövey József 1, Kenessey István 2, Rásó Erzsébet 2, Dobos Judit 2,4, Vágó Ágnes 3, Kásler Miklós 1, Futosi Krisztina 2, Döme Balázs 4, Tímár József 2, Tóvári József 2,5 Országos Onkológiai Intézet, 1 Sugárterápiás, 2 Tumor Progressziós Osztály, 3 Központi Laboratórium, 4 Országos Korányi TBC és Pulmonológiai Intézet, 5 Semmelweis Egyetem I. sz. Patológiai és Kísérleti Rákkutató Intézet, Budapest Tumoros betegekben gyakran alakul ki anémia, amelyet különbözô rekombináns erythropoietinek (rhuepo-k) segítségével próbálnak korrigálni. A legújabb vizsgálatok azt mutatják, hogy az erythroid progenitor sejtek mellett a tumor- és endotheliális sejtek is expresszálnak erythropoietin-receptort (EPOR), ezáltal a rhuepo hatással lehet ezen sejtek funkcióira is. Munkánkban a rhuepoα-nak a sugárkezelés eredményességét befolyásoló hatásait vizsgáltuk EPOR+ humán laphámrák (A431) xenograft modellben. A tumort hordozó SCID egereket rhuepoα-val kezeltük humán-ekvivalens dózisban (150 IU/kg, három alkalommal hetente) a tumor oltását követôen. A xenograftokat a 14. napon besugaraztuk (5 Gy, amikor a tumor mérete elérte az mm 3 -t), majd a 22. napon megmértük a kialakult daganatok tömegét. A kísérletek alatt figyelemmel kísértük a rhuepoα általános hatásait, tekintettel a hemoglobinszintre, a tumor-asszociált erekre és a xenograftok HIF-1α-expressziójára. A rhuepoα-val és besugárzással kezelt A431 sejtek proliferációját, apoptózisát és kolóniaképzô képességét in vitro módszerekkel is vizsgáltuk. In vitro a rhuepoα-kezelés önmagában nem módosította az EPOR+ A431 sejtek proliferációját, viszont fokozta a sugárkezelés hatását az apoptózisra és a kolóniaképzô képességre. In vivo a rhuepoα-kezelés kompenzálta a tumor-indukált anémiát SCID egerekben és csökkentette a tumorális HIF-1α-expressziót, viszont nem volt hatással a tumor növekedésére. Mindeközben, a rhuepoα-kezelés szignifikánsan (p<0,05) növelte a sugárterápia hatékonyságát in vivo, a tumorerek roncsolásának fokozása révén. Megállapíthatjuk, hogy a rhuepoα-kezelés a daganat sugárterápiájának hatékonyságát nemcsak az általános hypoxia és a tumorális HIF-1α-expresszió csökkentésével módosíthatja, hanem a tumorerek nagyobb mérvû roncsolódásán keresztül is. Magyar Onkológia: 51:53 61, 2007 According to recent data erythropoietin receptor (EPOR) is expressed not only by bone marrow erythroid progenitors but by endothelial- and cancer cells and it was suggested that erythropoietin (EPO) may affect their functions as well. We have analyzed the effects of recombinant human erythropoietin-α?(rhuepoα) on radiation sensitivity of EPOR+ human epidermoid carcinoma (A431) xenograft model. In vivo rhuepoα treatment was started after tumor cell inoculation into SCID mice. 5 Gy irradiation was performed on day 14, the effect of which was measured on day 22. Hemoglobin level, tumor-associated microvessels and HIF-1α expression of the xenograft were monitored during the experiment. rhuepoα administration prevented the development of tumorinduced anemia of SCID mice and reduced the level of HIF-1α expression of the xenograft tumor without affecting tumor growth. We have found that rhuepoα treatment significantly increased the efficacy of antitumor effect of irradiation which was partly mediated by complex effects on tumorassociated microvessels. In vitro rhuepoα did not affect proliferation of A431 cells but enhanced the antiproliferative and proapoptotic effects of irradiation. We concluded that rhuepoα administration positively modulated the antitumoral effects of irradiation at least by two pathways, decreasing systemic hypoxia resulting in decreased tumoral HIF-1α expression and enhancing direct effects on tumor-associated microvessels. Lövey J, Kenessey I, Rásó E, Dobos J, Vágó Á, Kásler M, Futosi K, Döme B, Tímár J, Tóvári J. Human recombinant erythropoietin-α increases the efficacy of irradiation in preclinical model. Hungarian Oncology 51:53 61, 2007 Közlésre érkezett: január 22. Elfogadva: március 7. Levelezési cím: Dr Tóvári József, Országos Onkológiai Intézet, 1122 Budapest, Ráth György u Telefon: , Fax: , A kísérletek a következô pályázatok támogatási keretein belül folytak: Oktatási Minisztérium NKFP-1a , valamint OTKA D és F MagyAR ONKOLÓGUSOK Társasága Magyar Onkológia 51. évfolyam 1. szám

2 Bevezetés Az anémia gyakran elôforduló jelenség daganatos betegek esetében; csökkenti az életminôséget és a kezelés kedvezôtlen kimenetelét okozhatja (8, 13, 38). Számtalan különbözô erythropoietikus hatóanyagot használnak a hemoglobinszint javítására (7, 35, 36), azonban ellentmondásos kísérleti és klinikai adatok állnak rendelkezésre a rekombináns humán erythropoietinek (rhuepo-k) alkalmazásával kapcsolatban. Sugár- vagy sugár- és kemoterápiában részesülô különbözô eredetû daganatos betegek rhuepo-kezelése vegyes eredményeket adott a kezelés kimenetele szempontjából: az EPO anémiát korrigáló és életminôséget javító hatása nem kérdéses emlô-, fej-nyaki-, illetve méhnyakrákban szenvedô betegek esetében, azonban a teljes túlélés nem javult (14, 18, 39), bár a méhnyakrákra vonatkozó adatok újabb vizsgálatokat igényelnek (6). Ugyanakkor petefészekés nyelôcsôdaganatok rhuepo-kezelésekor a teljes túlélésben javulás mutatkozott (26, 31). Az ellentmondásos eredményeknek köszönhetôen a legújabb áttekintô munkák arra a következésre jutottak, hogy a rhuepo-kezelés hatása a daganatos betegek túlélésére legalábbis bizonytalan. Számos kísérleti és klinikai eredmény gyûlt össze a tumorsejtek EPO-receptor- (EPOR) expressziójáról (1, 3), és az ezzel együttjáró fokozott daganatsejt-proliferációról, tumornövekedésrôl (4, 45). Mindemellett jól ismert, hogy az anémia és különösen a tumorszövetek hypoxiája csökkenti a kemo- és sugárterápia hatékonyságát (42). Számos adat azt mutatja, hogy szoros összefüggés van a hemoglobinszint és a daganatkezelés hatékonysága között: magasabb hemoglobinszint a tumor jobb oxigenációjához vezet, mely nagyobb mennyiségû aktivált szabadgyök képzôdését eredményezi a besugarazás után (12, 29, 43). Néhány adat azonban arra utal, hogy a tumorsejtektôl függetlenül, a tumoros erek sugárérzékenysége is lényeges eleme a sugárterápiának (24, 28). A besugárzás fokozza a hypoxia-indukálható faktor-1α-t (HIF-1α), mely a vaszkuláris endotheliális növekedési faktor (VEGF) és más angiogén faktorok overexpresszióját vonja maga után, ezáltal hozza létre az endotheliális sejtek fokozott sugárrezisztenciáját (11). Preklinikai vizsgálatokban VEGF-receptor-gátlószerek adása a sugárkezelés alatt fokozta a tumorkontrollt (46). Az eredmények alapján feltételezhetô, hogy a tumor érrendszere nemcsak a tumorszövet ellátásában kulcsfontosságú, hanem a sugárterápia eredményességét is befolyásolja. Jól ismert, hogy a rhuepo hatással van az endotheliális sejtek proliferációjára, apoptózisára és migrációjára, valamint hogy a rhuepo a VEGFhez hasonló hatású angiogenikus faktor (2, 17, 33). Korábban kimutattuk, hogy a rhuepoα adása preklinikai xenograft modellekben szignifikánsan növelte a tumor-asszociált endotheliális sejtek proliferációs indexét és a CD31-pozitív intratumorális erek méretét. A megnövekedett érfelszín emelte a tumorszövet perfúzióját, amely fokozta a kemoterápiás szerek daganatellenes hatásait (41). Jelen vizsgálatunkban a rhuepoα sugárkezelés eredményességét befolyásoló hatásait elemeztük in vitro és in vivo A431 humán laphámkarcinóma sejtvonalon és -xenografton. Anyag és módszer Sejtvonal A431 humán laphámkarcinóma-sejteket 5% foetalis borjúsavót tartalmazó DMEM médiumban (Sigma Chemical Co., St. Louis, MO) tartottuk fenn 37 o C-on 5% CO 2 -tartalom mellett. Tumorsejtek áramlási citometriája A sejtekbôl egysejtszuszpenziót készítettünk EDTA-val (Sigma), háromszor átmostuk szérummentes DMEM-mel, majd fixáltuk 20 percig metanollal. A fixálás után a sejteket blokkoltuk 3% BSA/PBS-sel (Sigma) 30 percig, aztán inkubáltuk anti-humán EPOR monoklonális antitesttel (1:20 PBS-ben, R&D Systems, Minneapolis, MN) vagy kontroll egér IgG2b antitesttel (Sigma). A kötôdött elsôdleges antitestet RPE-vel konjugált kecske anti-egér Ig-vel mutattuk ki (1:10 PBS-ben, DakoCytomation, Glostrup, Dánia). A jelölt sejtek fluoreszcenciáját CyFlow SLGreen áramlási citométerrel mértük (Partec, Münster, Németország) és a pozitív sejteket %-ban adtuk meg. Minden egyes kísérleti pontot három párhuzamosban teszteltük, és a kísérleteket legalább három alkalommal megismételtük. In vitro proliferációs teszt Kétezer A431 sejtet tettünk lyukanként 96 lyukú szövettenyésztô edénybe (Greiner, Frickenhausen, Németország) 5% szérumot tartalmazó médiumban, majd 24 órával késôbb humán rekombináns erythropoietin-α-val (rhuepoα, epoetinum alpha, Jannsen-Cilag, Shaffhausen, Svájc) kezeltük különbözô koncentrációkban (0,1, 1, 10 IU/ml) 72 órán keresztül 200 µl médiumban. A sugárkezelés sejtproliferációra gyakorolt hatásának detektálásához a szövettenyésztô edényeket besugároztuk (1,85 Gy/perc, összességében 5 Gy) 200 kv, 15 ma erôsségû terápiás röntgensugárzással (THX 250, Medicor, Budapest) 0,5 mm Cu filter használatával 6 párhuzamos lyukban. 48 órás inkubációt követôen 20 µl 5 mg/ml koncentrációjú metil-tiazol-tetrazólium-bromidot (MTT, Sigma) adtunk a sejtmédiumhoz 4 órára, 37 o C-on, majd a médiumot eltávolítottuk és a tetrazólium-kristályokat 100 µl DMSO-ban (Sigma) feloldottuk. Az abszorbanciát 570 nm-en ELISA Microplate Reader (Bio-Rad, Hercules, CA) segítségével mértük. Kolóniaképzô túlélési vizsgálat A431 tumorsejteket ( /lyuk, egyenként hozzávetôlegesen túlélô kolóniát hoznak létre a sugárkezelést követôen) 6 lyukú szövettenyésztô edényekbe (Greiner) juttattunk széru- 54 Magyar Onkológia 51. évfolyam 1. szám 2007 MagyAR ONKOLÓGUSOK Társasága

3 mot tartalmazó DMEM médiumban, és rhuepoα különbözô koncentrációival kezeltük (0,1, 1, 10 IU/ml). A sejteket 24 órával késôbb besugaraztuk (5 Gy) a rhuepoα-t tartalmazó médiumban, majd az edényeket 2 hétig 37 o C-on inkubáltuk. A kolóniákat 6 párhuzamos lyukban metanollal fixáltuk, Giemsa-val (Chroma, Köngen, Németország) megfestettük, és sztereomikroszkóp (MSZ5600, A. Krüss Optronic GmbH, Hamburg, Németország) alatt megszámláltuk. Az apoptotikus frakció detektálása A rhuepo-kezelt és besugarazott tumorsejteket 48 órás inkubáció után 0,02%-os EDTA segítségével felszedtük, PBS-sel átmostuk, majd 70%-os etanollal fixáltuk. A propidiumjodiddal és RNázzal (Cystain PI Absolute T, Partec, Németország) végzett 2 órás inkubációs periódus után meghatároztuk a sejtekben a DNS mennyiségét áramlási citométerrel (CyFlow, Partec). Az apoptotikus sejtek arányát a szub-g1 frakció mutatta ki, melyet FlowMax szoftver segítségével elemeztünk. A tumorxenograftok létrehozása A xenograftokat egysejtszuszpenziós oldatként 10 6 tumorsejt/0,1 ml szérummentes DMEM oldatban nôstény SCID egerek hátába történô szubkután oltással hoztuk létre. Minden állatkísérletet az Országos Onkológiai Intézet Állatgondozási és -Kezelési Bizottsága által jóváhagyott standardok és eljárások szerint végeztünk el. Hemoglobinszint mérése SCID egerekben Az egereket intraperitoneálisan Nembutal (Serva, Heidelberg, Németország) adásával elaltattuk, majd a szívbôl vért vettünk (a 8., 15., 18., 19. és 22. napon). A friss vért üvegcsövekben tartottuk 3,8% nátrium-citrát oldatban (citrát:vér arány=1:10 v/v). A mintákat 15 percig 4000 rpmen centrifugáltuk, és a hemoglobinszintet SYSMEX SF 3000 hematológiai mûszerrel határoztuk meg. In vivo EPO-kezelés és a tumorok besugárzása A tumort hordozó egereket rhuepoα-val kezeltük humán-ekvivalens dózisban (150 IU/kg fiziológiás sóoldatban, 0,1 ml végtérfogatban), heti 3 alkalommal intraperitoneálisan a tumoroltás utáni elsô naptól a sugárkezelés megkezdéséig (14. nap), amikor a tumor térfogata már elérte az mm 3 -t. Az állatokat altatás után rögzítettük, és a daganatot egy 1 cm 2 -es kör alakú terület középpontjába állítottuk. Egyszeri 5 Gy röntgensugárdózist alkalmaztunk lokálisan, egyenként létrehozott led árnyékolással, 200 kv, 15 ma-es terápiás röntgensugárforrás használata mellett (THX 250, Medicor, Budapest), 0,5 mm Cu filter alkalmazásával, 1,85 Gy/min dózisrátával. 8 napos inkubációt követôen az állatokat Nembutallal túlaltattuk és az eltávolított tumorok súlyát lemértük. A tumorerek immuncitokémiás vizsgálata A szubkután nôtt tumorokat összegyûjtöttük, formalinban fixáltuk és paraffinba ágyaztuk. Az immunhisztokémiai vizsgálatokhoz 5-7 µm vastagságú deparaffinált metszeteket használtunk. A metszeteket poliklonális nyúl anti-humán Factor VIII antitesttel (hígítás 1:20, Becton Dickinson Bioscience, San Jose, CA) inkubáltuk, amit biotinált anti-nyúl IgG és streptavidin-konjugált tormaperoxidáz (Vector Laboratories, Burlingame, CA) követett. Az ereket DAB kromogénnel tettük láthatóvá, a szövetszeleteket hematoxilinnel háttérfestettük. Metszetenként öt, egyenként 300x400 µm méretû élô tumorterületet fényképeztünk le és elemeztünk mikroszkóp alatt. A Factor-VIII+ erek morfológiáját 5-5 tumor 5 különbözô területén vizsgáltuk. Az érfal pericitáit anti-simaizomaktin antitesttel (SMA, DakoCytomation) történô immunhisztokémiai jelöléssel, AEC kromogénnel azonosítottuk. RNS-izolálás és reverz transzkripció A fagyasztva homogenizált mintákból a gyártó (TRI Reagent TM, Sigma) által megadott protokoll szerint össz-rns-t izoláltunk. A reverz transzkripciónál 2 µg tisztított RNS-hez 1 µl (10 mm) dntpmixet (Finnzyme, Espoo, Finnország), illetve 1 µl random primer-oligo dt-keveréket (mindkettô végkoncentrációja 2,5 µm) adtunk, és ezt az elegyet 10 percig 70ºC-on inkubáltuk. Szobahômérsékletre történt hûtés után a reakcióelegyhez mintánként 2 µl 10x M-MLV reverz transzkriptáz puffert (Sigma), 1 µl M-MLV reverz transzkriptázt (200 NE/µl, Sigma), 0,5 µl RNáz-inhibitort (40 NE/µl, Promega) és 6,5 µl DEPC-kezelt vizet adtunk. 37ºC-on 50 percig történt a reverz transzkripció, majd az enzimet 85ºC-on 10 percig inaktiváltuk. Az átírás megtörténtét (RT+ minták) és a DNS-szennyezôdés kizárását (RT- minta) β-aktin primerekkel (1. táblázat) végzett PCR segítségével ellenôriztük. Negatív kontrollként DEPC-kezelt víz szolgált. Primer jele (Génbank ID) Szekvencia (5-3 ) (lokalizáció) Termék β-aktin sense TCT GGC ACC ACA CCT TCT AC ( ) (gi: ) antisense CTC CTT AAT GTC ACG CAC GAT TTC ( ) 387 bp EPOR sense CATCAATGAAGTAGTGCTCCTAGAC ( ) (gi: ) antisense CCT CGT AGC GGA TGT GAG AC ( ) 131 bp HIF-1α sense AACTTCTGGATGCTGGTGATT ( ) (gi: ) antisense TGTTCATAGTTCTTCCTCGGC ( ) 339 bp 1. táblázat. A PCR reakciókban alkalmazott primerek ERYTHROPOIETIN-α HATÁSA A SUGÁRKEZELÉSRE Magyar Onkológia 51. évfolyam 1. szám

4 1. ábra. Az EPO-receptor expressziójának kimutatása mrns- és fehérje-szinten. (a) Az EPO-receptor (EPOR) detektálása RT- PCR segítségével. A humán-specifikus primerpár egy 131 bp nagyságú terméket amplifikált az A431 sejtekbôl (2-5) és a tumorxenograftokból (6-9) egyaránt. A primer specificitását mutatja, hogy sem egér izomból (10), sem egér bôrbôl (11) nem történt amplifikáció. Negatív kontroll: 12. (b) Az EPOR protein kimutatása áramlási citometriával; az eredményeket a pozitív sejtek százalékában fejeztük ki. Az EPOR expressziójának igazolása PCR segítségével A fenti átírásból származó cdns 2 µl-ébôl kiindulva végeztük a PCR-t. A 25 µl végtérfogatú reakcióelegy az EPOR-specifikus primereken (1. táblázat; végkoncentráció: 1 µm) kívül 2,5 µl 1,5 mm Mg 2+ - koncentrációjú PCR-puffert (DyNAzyme TM, Finnzyme), 2 µl dntp-mixet (2,5 mm, Finnzyme) és 0,4 µl DNS-polimerázt (2 NE/µl, DyNazyme TM, Finnzyme) tartalmazott. A PCR-feltételek a következôk voltak: 95ºC-on 2 percig történô aktiválást követôen 35 ciklus 94ºC 1 perc, 55ºC 1 perc, 72ºC 2 perc, amit egy 72ºC-on 10 percig tartó extenziós lépés követett. A PCR-terméket 2%-os agarózgélen választottuk szét, majd az eredményét etidiumbromiddal történt festést követôen a Gel Doc 2000 (Bio-Rad) rendszer segítségével dokumentáltuk. a b Number R FL1-Height epo FITC 1:10 --> HIF-1α-expresszió relatív mennyiségének mérése valósidejû PCR segítségével Az expresszált HIF-1α relatív mennyiségének meghatározását real-time PCR (MyiQ TM Single Color Real-Time PCR Detection System, Bio-Rad icycler) méréssel végeztük el. A 25 µl-es végtérfogatú reakcióelegy 12,5 µl 2x iq SYBR Green Supermix-et (Bio-Rad), 200 nm végkoncentrációban primereket (1. táblázat) és 11,5 µl hígított, a fenti átírásból származó cdns-t tartalmazott. A PCR-feltételek a következôk voltak: itaq DNSpolimeráz aktiválását (3 perc, 95 C) követôen 50 ciklus 95 C 30 mp, 55 C 30 mp, 72 C 1 perc lépésekkel. Pozitív kontrollként a hígítási sort is adó K562 humán leukémia sejtekbôl származó cdns szolgált, míg a negatív kontroll itt is a minták hígítására használt víz volt. Minden mintán mindkét PCR reakcióban (HIF-1α és β-aktin) 3-3 párhuzamos mérést végeztünk. A PCR-termékeket (autentikus termékméret alapján történô igazolásra) 2%-os agarózgélen megfuttattuk, majd etidium-bromiddal festettük. A felvétel rögzítését számítógéppel összekapcsolt Gel Doc 2000 (Bio- Rad) segítségével végeztük el. A HIF-1α relatív kiindulási mennyiségét K562 sejtekbôl származó cdns hígítási sorának (1x- 625x) HIF-1α PCR reakciója alapján nyert görbe, illetve a saját β-aktin-expresszióra történt normalizálás alapján végeztük el (az utóbbi alapja ugyanazon K562 cdns hígítási sor β-aktin PCR reakciója). A három párhuzamos mintán nyert mérési eredményt átlagoltuk. A minták HIF-1αexpressziójának egymáshoz viszonyított relatív arányát az eredménytáblázatban úgy számítottuk ki, hogy a legalacsonyabb expressziójú vonal mennyiségét vettük 1-nek, és a többi vonal normalizált kiindulási értékét ennek normalizált kiindulási mennyiségével osztottuk el. A PCR-termékek szekvenciájának meghatározása Valamennyi PCR-termék autentikus voltát szekvenálással igazoltuk. A PCR-termékeket az agaróz gélbôl High Pure PCR Product Purification Kit (Roche, Mannheim, Németország) segítségével nyertük vissza tiszta formában, majd a bázissorrendet ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) segítségével határoztuk meg. Statisztikai elemzés Az in vitro kísérletekbôl és morfometrikus vizsgálatokból származó adatok összehasonlítása Student s t-teszt, míg az in vivo adatok elemzése a Mann-Whitney U-teszt alkalmazásával történt. A 0,05-nál kisebb p értéket tekintettük szignifikánsnak. Minden statisztikai elemzéshez CSTAT statisztikai programot használtunk. Eredmények Az EPO-receptor expressziója A431 sejtekben Az EPOR expresszióját mrns szintjének meghatározásával mutattuk ki RT-PCR technika segítségével mind az in vitro növekvô humán A431 sejtekben, mind az in vivo xenograft tumorokban. Az EPOR-ra specifikus primerpár mind a sejtvonalban, mind a xenograft tumorban a várt 131 bp hosszúságú terméket adta (1a. ábra), ezzel szemben az egér szövetekben (izom, bôr) nem történt amplifikáció, jelezve a primerek humán-specificitását. Az immuncitokémiai vizsgálatok azt mutatták, hogy az A431 sejtek több mint 50%-a expresszálja az EPOR fehérjét (1b. ábra). A rhuepoα in vitro hatása a tumorsejtek proliferációjára és a sugárkezelés eredményességére Bár az A431 sejtek kifejezték az EPOR-t, a rhuepoα-val 0,1-10 IU/ml dózistartományban 56 Magyar Onkológia 51. évfolyam 1. szám 2007 MagyAR ONKOLÓGUSOK Társasága

5 Napok a tumoroltás után Hemoglobin (g/dl) Kontroll 11,6±1,1 11,6±0,7 11,4±0,4 11,4±1,2 11,3±0,2 A431 11,3±0,5 10,9±0,6 10,4±0,5 10,1±0,5 A431 + rhuepo12,3±0,9 13,0±0,5* 12,4±0,4* 12,5±0,5* Átlag±SD (n=3), *p<0,05 a tumoros kontrollhoz viszonyítva 2. táblázat. A rhuepokezelés hatása a hemoglobinszintre A431 tumorxenograftok növekedése során 72 órán keresztül végzett kezelés nem mutatott szignifikáns hatást a sejtproliferációra (az adatot nem mutatjuk). A tumorsejtek besugarazása 5 Gy-vel 25,32%-kal csökkentette az élô sejtek számát 48 óra alatt. A rhuepo-kezelés (0,1-10 IU/ml) és a sugárkezelés (5 Gy) együttes alkalmazása további (<20%-nyi) proliferációgátlást eredményezett (2a. ábra). A rhuepoα hatása a tumorsejtek apoptózisára és kolóniaképzô képességére in vitro A rhuepoα-kezelés önmagában nem befolyásolta az apoptózist (a kontroll mintákban 1,6±0,3% volt az apoptotikus sejtek aránya, míg a rhuepokezeltekben 1,5±0,4%), viszont szignifikánsan (p<0,01) megnövelte az apoptotikus sejtfrakció mennyiségét a besugárzott tumorsejtekben. A sugárkezelés (5 Gy) önmagában ötszörös (8,4±2,1%), míg a rhuepoα-val (1 IU/ml, 48 óra) kombinálva közel 11-szeres (16,4±2,3%) növekedést eredményezett az apoptotikus sejtek arányában. Az A431 sejtek hosszú távú túlélésének tanulmányozása a kolóniaképzés vizsgálatával történt. Azt találtuk, hogy a rhuepoα koncentrációfüggôen (0, IU/ml koncentrációban) megnövelte a sugárkezelés hatását in vitro (2b. ábra). A sugárkezelés 60%-os csökkenést idézett elô a daganatsejtek klonogén túlélésében, melyet szignifikánsan tovább erôsített (8%, 30%, ill. 49%) a rhuepo-kezelés. A rhuepoα hatása a tumort hordozó SCID egerek hemoglobinszintjére A növekvô A431 xenograft anémiát idézett elô (hemoglobinszint <11 g/dl) a SCID egerekben a tumorsejtek szubkután történô beoltását követô 15. naptól (2. táblázat). Intraperitoneálisan rhuepo-t adtunk az egereknek humán-ekvivalens dózisban (150 IU/kg, 3 alkalommal hetente), az elsô naptól a kísérlet végéig (22. nap), mely csökkentette a tumor-indukált anémiát (2. táblázat, p<0,05). A rhuepoα hatása a HIF-1α mrns-szintjére A tumorális (humán daganatsejtek és a tumorstroma) HIF-1α expresszióját mrns-szintjének (339 bp hosszúságú termék) mérésével határoztuk meg a tumorxenograftokban az oltást követô 22. napon real-time PCR-rel. Az adatok azt mutatják, hogy a kontroll tumorokban a HIF-1α mrns-expressziója szignifikánsan magasabb volt (3,5-szörös), mint az rhuepoα-kezeltekben (3. ábra). 2. ábra. rhuepoα-kezelés hatása besugarazott tumorsejtek proliferációjára és kolóniaképzô képességére in vitro (a) rhuepoα-val kezelt A431 sejtek proliferációja egyszeri 5 Gy dózisú besugarazás után. *p<0,05 az egyedüli besugarazáshoz viszonyítva. (b) Besugarazott A431 sejtek hosszú távú (14 nap) kolóniaképzô képességének vizsgálata rhuepoαkezelés után. Átlag±SD, n=6; *p<0,01 az egyedüli besugarazáshoz viszonyítva a A kontroll százaléka b A kontroll százaléka Kontroll Kontroll 0,1 rhuepo 0,1 rhuepo * (IU/ml) 1 * (IU/ml) 3. ábra. Humán HIF-1α gén expressziója A431 tumorxenograftokban. A HIF-1α gén expresszióját real-time PCR-rel detektáltuk. A rhuepoα-kezelés szignifikánsan csökkentette a HIF-1α-produkciót. Átlag±SD, n=5; *p<0,05 a kontrollhoz viszonyítva Relatív expresszió Kontroll 1 rhuepo * 10 * 10 ERYTHROPOIETIN-α HATÁSA A SUGÁRKEZELÉSRE Magyar Onkológia 51. évfolyam 1. szám

6 A rhuepoα hatása a sugárkezelés antitumorális aktivitására in vivo A rhuepoα adása in vivo humán-ekvivalens dózisban nem volt szignifikáns hatással az A431 tumorxenograftok növekedésére (kontroll tumortömeg: 59,2±8,1 mg, rhuepoα-kezelt: 59,0±8,0 mg). A tumorok az oltást követô 14. napon 5 Gyes egyszeri besugárzást kaptak, mikor átlagos méretük elérte az mm 3 -t. Míg a sugárkezelés önmagában is szignifikáns gátlást eredményezett a tumor növekedésében (35,4±4,6 mg, p<0,01), addig a rhuepo-kezelés ezt a hatást szignifikánsan fokozta (24,2±5,3 mg, p<0,05). A rhuepo-kezelés és a sugárkezelés hatása a tumorok vérereire Az A431 tumorxenograftokban lévô mikrokapillárisokat humán poliklonális anti-von Willebrand faktor antitesttel jelöltük paraffinba ágyazott metszeteken morfometriai vizsgálatok céljából. Korábbi eredményeink szerint (41) a rhuepoαkezelt A431 xenograftokban az intratumorális mikrokapillárisok megnagyobbodtak, és az erek szabálytalan formát öltöttek (4a,b. ábra). A pericita-borítás, melyet simaizomaktin-immunhisztokémiával mutattunk ki, diszkontinuussá vált a tumorasszociált erek körül (4c,d. ábra). Az átlagos pericita-borítás morfometriai analízise több mint 30%-os csökkenést (p<0,05) jelzett. Összehasonlítva a kontroll tumorokkal, a sugárkezelés nagyobb érroncsolást végzett az élô tumorterületen belül a rhuepoα-val kezelt állatokban (5a, b. ábra). Az abnormális alakú, szétroncsolt tumorasszociált erek aránya több mint 50%-os volt a rhuepo-kezelt és besugarazott xenograftokban, szemben a kizárólag sugárkezelést kapott csoporttal, ahol ez 30%-nak adódott (5. ábra táblázata). Diszkusszió A hypoxia a szolid tumorok jellemzôje, és független prognosztikus faktorként szerepel a kedvezôtlen sugárkezelés kimenetelében és a túlélésben (13). Daganatos betegek esetében gyakran alkalmaznak különbözô rhuepo-kat a csökkent hemoglobinszint javítására. Az anémia hagyományos tüneteinek és ennek következtében az életminôségnek a javítása mellett (22) egy újabb észszerû oka van a rhuepo-k használatának: erôsítik a sugár- és/vagy kemoterápia hatékonyságát 4. ábra. rhuepoα-kezelés hatása a tumoros erekre A431 humán tumor xenograftban. Az ereket von Willebrand faktor elleni antitesttel jelöltük besugarazás elôtt a kezeletlen (a) és az rhuepoα-kezelt állatokban (b). Nyilak: nagyobb átmérôjû erek a rhuepoα-kezelt tumorokban; 200x nagyítás. c, d: Immunofluoreszcens jelölés az erek pericitaborításának kimutatására (simaizomaktin, piros) a kezeletlen (c) és az rhuepoα-kezelt állatokban (d) 22 napos xenograftokban (400x nagyítás). A folyamatos pericita-borítás megszakadt (nyilak) az rhuepoα-kezelt A431 tumorokban. a b c d 58 Magyar Onkológia 51. évfolyam 1. szám 2007 MagyAR ONKOLÓGUSOK Társasága

7 (23). Sajnálatos módon azonban az rhuepokezelések hatásairól szóló klinikai adatok ellentmondásosak. Számos pozitív eredmény (17, 37, 40) mellett az adatok egy jelentôs része azt jelzi, hogy a kezelés kimenetelére a rhuepo-knak kedvezôtlen hatása van (14, 21). Az ellentmondásosság egyik fô oka a tumorsejtek EPO-receptorexpressziója lehet. Egyes tumortípusok feltehetôen EPO-t, valamint EPO-receptort is expresszálnak (1, 3), ezért ez a citokin-szignálrendszer esetleg felelôssé tehetô a daganat növekedéséért (4, 45). Más vizsgálatok szerint a rhuepo-kezelés nincs hatással a tumorsejtek proliferációjára vagy in vivo növekedésére még az EPOR-t expresszáló tumorsejtek esetében sem (19, 25). In vitro és in vivo kísérleteinkben humán laphámrák-sejtvonal- (A431) és xenograft modellt használtunk. Ezek a daganatsejtek mrns- és protein szinten is kifejezik az EPOR-t. Humán-ekvivalens dózisban (1 IU/ml, vagy 150 IU/kg intraperitoneálisan 3 alkalommal hetente) adva a rhuepoα nem volt hatással a sejtproliferációra in vitro vagy a tumornövekedésre in vivo. A korábbiakban használt HT25 humán vastagbél-karcinóma sejtvonallal azonos eredményre jutottunk (41), alátámasztva mások adatait, miszerint nincs direkt összefüggés a tumorsejtekben meglévô EPOR és a rhuepoα adásánál néhány esetben tapasztalt fokozott proliferáció között (1, 4). A klinikai és preklinikai adatok arra engednek következtetni, hogy az EPO-k pozitív hatással vannak valamennyi tumorsejttípus esetén a sugárkezelés hatékonyságára, mely a tumor fokozott oxigenizációjára vezethetô vissza. Számos korábbi eredmény szerint a hemoglobinszintnek kulcsszerepe van a sikeres sugárterápiában (20, 32). SCID egerekben az A431 tumorxenograftok növekedése során a hemoglobinszint csökkent a tumorhordozó állatokban, hasonlóan a humán körülményekhez, a rhuepoα adása humán-ekvivalens dózisban azonban meggátolta ezt a csökkenést. A rhuepoα-kezelés az A431 xenograftok felerôsödött sugárérzékenységéhez vezetett, és a csupán besugárzást kapott egerekhez képest szignifikánsan kisebb tumorméretet eredményezett. A rhuepoα-kezelés jótékony hatása a sugárkezelésre in vitro is kimutatható volt. Az A431 sejtek in vitro rhuepoα-kezelése befolyással volt a besugárzás hatására, amely független volt az oxigenizációtól. A rhuepoα adása (1 IU/ml) kissé növelte a sugárkezelés (5 Gy) proliferációgátló hatását, szignifikánsan emelte az apoptotikus frakció mennyiségét és csökkentette az A431 sejtek kolóniaképzô kapacitását a besugárzást követôen. Ezeket a hatásokat in vitro kísérletekbôl ismertük meg, és részben magyarázhatják a rhuepo és a sugárterápia additív hatását in vivo, amikor a csupán besugarazottakhoz képest kisebb tumorokat észleltünk. Korábban eredményeink azt mutatták, hogy a rhuepoα adásával preklinikai modellekben szignifikánsan nôtt a tumorasszociált erek proliferációs indexe, mely nagyobb intratumorális erekhez vezetett. A megnövekedett érfelszín javulást eredményezett a kemoterápiás szerek tumorsejtekhez történô szállításában és fokozta azok antitumorális hatásait (41). Korábbi tanulmányok azt sugallják, hogy a rhuepoα adása javítja az oxigenizációt az élô tumortömegben, függetlenül a hemoglobinszinttôl (5), így a tumor oxigenizáltsága növekedik a fokozott tumorperfúzióval. Jól ismert, hogy az endotheliális sejtek EPOR-t expresszálnak, és a rhuepo befolyásolja a proliferációjukat, apoptózisukat és migrációjukat (2, 33). Sôt, a VEGF-hez hasonlóan a rhuepoα is egy angiogenikus faktor (17). Ahogy azt korábban már leírták, a sugárkezelés tumorellenes mechanizmusában kulcsfaktor az anti-angiogenikus ha- 5. ábra. rhuepoα-kezelés és a besugarazás hatása a tumoros erekre A431 tumorxenograftban. Az ereket von Willebrand faktor elleni antitesttel jelöltük besugarazás után a kezeletlen (a) és a rhuepoα-kezelt állatokban (b). Nyilak: roncsolt erek a besugarazás után (200x nagyítás). Táblázat: a roncsolt erek mennyiségi kiértékelésének eredménye; *p<0,05 a kontrollhoz, **p<0,05 az egyedüli besugarazáshoz viszonyítva a b Kontroll rhuepoα Sugárkezelés Sugárkezelés + rhuepoα A roncsolt erek százaléka 4,3±0,3 6,6±0,4 30,0±8,7* 52,4±8,8** ERYTHROPOIETIN-α HATÁSA A SUGÁRKEZELÉSRE Magyar Onkológia 51. évfolyam 1. szám

8 tás (24, 28). Jelen vizsgálatunkban bemutattuk, hogy a sugárkezelés nagy hatással van a tumorerekre. A rhuepoα-kezelt állatokban az élô tumormasszában az erek kitágulnak, a kontrollhoz képest az átlagos érátmérô szignifikánsan megnô. Ezek az EPO-aktivált erek abnormális alakot vesznek föl, az endotheliális sejtek több rétegben helyezkednek el, míg a pericita-borítás diszkontinuussá válik. Kimutattuk, hogy a rhuepoα-módosított erek nagyobb hatásfokkal roncsolódtak a besugárzás révén. Ez az eredmény alátámasztja mások munkáját, miszerint az exogén rhuepo-k fokozzák az endotheliális sejtek sugárérzékenységét, növelve apoptózisukat (10, 30). Mások kimutatták, hogy a VEGF-receptor tirozinkinázaktivitásának gátlása fokozza a besugarazott erek érzékenységét, mikor az erek perfúziója és a tumor oxigenizáltsága megnövekedik (15, 44, 46). Másrészt, jól ismert, hogy a VEGF-expresszió a HIF szabályozása alatt áll (6). Korábban bemutattuk, hogy mind a gazdaszervezet, mind a tumor VEGF-expressziója szignifikánsan csökkent a rhuepoα-kezelt xenograftokban a kontrollhoz képest (41). Jelenlegi eredményeink azt jelzik, hogy a HIF-1α felelôs lehet a csökkent VEGF-expresszióért, miután a HIF-1α génexpressziója szintén csökkent sugárterápia elôtt a rhuepo-kezelt állatokban. Néhány adat arra utal, hogy szoros korreláció van a HIF-1α-expresszió és a tumorprogresszió között (16), és a HIF-1-regulált citokinek fokozzák az endothelsejtek sugárrezisztenciáját is (28). A besugarazást követô HIF-1-aktiváció gátlásával továbbá szignifikánsan nôtt a tumorok sugárérzékenysége az érpusztulás révén (28). Korábbi, illetve jelen munkánkban bemutattuk, hogy a rhuepoα, mint erôs angiogenikus faktor, szignifikánsan tágultabb ereket eredményezett az élô tumortömegen belül az endothelsejtek proliferációjának növelésével. Ugyanakkor a HIF-1α expressziója csökkent, amely csökkent VEGF-expressziót okozott, és ez az endothelsejtek fokozott sugárézékenységét eredményezte. Ezek a besugárzás elôtti változások a tumor regressziójához vezettek a sugárkezeléssel kombinált terápiában. Az eredmények arra utalnak, hogy a rhuepoα-kezelés legalább kétféle hatással van a tumorokra: az egyik, hogy képes csökkenteni a hypoxiát, amely önmagában is kedvezôtlen jele a prognózisnak; a másik, hogy növeli az endotheliális sejtek proliferációját, ezzel javítja az erek sugárérzékenységét és a tumorszövet oxigénnel, illetve kemoterápiás szerekkel történô perfúzióját. Preklinikai adataink megerôsítik korábbi eredményeinket, miszerint a rhuepoα hatása a tumorstromára módosítja a daganatok terápiás érzékenységét. A rhuepoα-kezelés egyéb kiegészítô eljárásokkal (anti-angiogenezis, hypoxia-indukált génterápia (34), anti-hif-1α) kiegészítve hasznos lehet a hagyományos kemo- és/vagy sugárterápia hatékonyságának fokozására. Természetesen e kérdések megválaszolásához további preklinikai és klinikai vizsgálatok szükségesek. Köszönetnyilvánítás Köszönetet mondunk Parragné Derecskei Katalinnak és Sinka Andrásnénak a kísérletek kivitelezésében nyújtott technikai segítségükért, valamint Dr. Ladányi Andreának a kézirat kritikus áttanulmányozásáért. Irodalom 1. Acs G, Acs P, Beckwith SM, et al. Erythropoietin and erythropoietin receptor expression in human cancer. Cancer Res 61: , Anagnostou A, Lee ES, Kessimian N, et al. Erythropoietin has a mitogenic and positive chemotactic effect on endothelial cells. Proc Natl Acad Sci USA 87: , Arcasoy MO, Jiang X, Haroon ZA. Expression of erythropoietin receptor splice variants in human cancer. Biochem Biophys Res Commun 307: , Batra S, Perelman N, Luck LR, et al. Pediatric tumor cells express erythropoietin and a functional erythropoietin receptor that promotes angiogenesis and tumor cell survival. Lab Invest 83: , Blackwell KL, Kirkpatrik JP, Snyder SA, et al. Human recombinant erythropoietin significantly improves tumor oxygenation independent of its effects on hemoglobin. Cancer Res 63: , Blohmer JU, Wurschmidt U, Petry G. 6th interim analysis of a prospective, randomized, open and controlled AGO- and NOGGO-intergroup study: Sequential adjuvant chemo-radiotherapy with vs. without epoetin alfa for patients with high risk cervical cancer. Proc Am Soc Clin Oncol 22:447, Bohlius J, Wilson J, Seidenfeld J, et al. Recombinant human erythropoietins and cancer patients: updated meta-analysis of 57 studies including 9353 patients. J Natl Cancer Inst 98: , Caro JJ, Salas M, Ward A, Goss G. Anemia as an independent prognostic factor for survival in patients with cancer. Cancer 91: , Forsythe JA, Jiang BH, Iyer NV, et al. Activation of vascular endothelial growth factor gene transcription by hypoxia inducible factor 1. Mol Cell Biol 23: , Garcia-Baross M, Paris F, Cordon-Cardo C, et al. Tumor response to radiotherapy regulated by endothelial cell apoptosis. Science 300: , Gorski DH, Beckett MA, Jaskowiak NT, et al. Blockage of the vascular endothelial growth factor stress response increases the antitumor effects of ionizing radiation. Cancer Res 59: , Hall EH. Ed. Radiobiology for the Radiologist, 4th ed. Philadelphia, PA, Lippincott, Harris AL. Hypoxia a key regulatory factor in tumour growth. Nat Rev Cancer 2:38-47, Henke M, Laszing R, Rube C, et al. Erythropoietin to treat head and neck cancer patients with anaemia undergoing radiotherapy: randomized, double-blind, placebo-controlled trial. Lancet 36: , Huber PE, Bischof M, Jenne J, et al. Trimodal cancer treatment: beneficial effects of combined antiangiogenesis, radiation and chemotherapy. Cancer Res 65: , Ishikawa H, Sakurai H, Hasegawa M, et al. Expression of hypoxia-inducible factor 1alpha predicts metastasis-free survival after radiation therapy alone in stage IIIB cervical squamous cell carcinoma. Int J Radiat Oncol Biol Phys 60: , Jaquet K, Krause K, Tawakol-Khodai M, et al. Erythropoietin and VEGF exhibit equal angiogenic potential. Microvasc Res 64: , Kirkpatrick JP, Hardee ME, Snyder SA, et al. The effect of darbepoetin alfa on growth, oxygenation and radioresponsiveness of a breast adenocarcinoma. Radiat Res 165: , LaMontagne KR, Butler J, Marshall DJ, et al. Recombinant epoetins do not stimulate tumor growth in erythro- 60 Magyar Onkológia 51. évfolyam 1. szám 2007 MagyAR ONKOLÓGUSOK Társasága

9 poietin receptor-positive breast carcinoma models. Mol Cancer Ther 5: , Laveys RS. Clinical trial experience using erythropoietin during radiation therapy. Strahlenther Onkol 174(Suppl 4):24-30, Leyland-Jones B. Breast cancer trial with erythropoietin terminated unexpectedly. Lancet Oncol 4: , Littlewood TJ, Nortier J, Rapoport B, et al. Epoetin alfa corrects anemia and improves quality of life in patients with hematologic malignancies receiving non-platinum chemotherapy. Hematol Oncol 21: , Littlewood TJ. The impact of hemoglobin levels on treatment outcomes in patients with cancer. Semin Oncol 28:49-53, Lövey J, Lukits J, Remenár E, et al. Antiangiogenic effects of radiotherapy but not initial microvessel density predict survival in inoperable oropharyngeal squamous cell carcinoma. Strahlenther Onkol 182: , Ludwig H. rhuepo and treatment outcomes: the preclinical experience. Oncologist 9:48-54, Marinaccio M, Mele E, Giotta F. Pretreatment normalization of mild anemia with epoetin alfa: impact on the outcome in epithelial ovarian cancer patients. Proc Am Soc Clin Oncol 22:486, Mittelman M, Neumann D, Peled A, et al. Erythropoietin induces tumor regression and antitumor immune responses in murine myeloma models. Proc Natl Acad Sci USA 98: , Moeller BJ, Cao Y, Li CY, Dewhirst MW. Radiation activates HIF-1 to regulate vascular radiosensitivity in tumors: role of reoxygenation, free radicals, and stress granules. Cancer Cell 5: , Molls M, Stadler P, Becker A, et al. Relevance of oxygen in radiation oncology. Mechanism of action, correlation to low hemoglobin levels. Strahlenther Onkol 74(Suppl 4):13-16, Paris F, Fuks Z, Kang A, et al. Endothelial apoptosis as the primary lesion initiating intestinal radiation damage in mice. Science 293: , Rades D, Tribius S, Yekebas EF, et al. Epoetin alfa improves survival after chemoradiation for stage III esophageal cancer: final results of a prospective observational study. Int J Radiat Oncol Biol Phys 65: , Reichel O, Panzer M, Wimmer Ch, et al. Prognostic implications of hemoglobin levels before and after surgery as well as before and after radiotherapy for head and neck tumors. Eur Arch Otorhinolaryngol 260: , Ribatti D, Marzullo A, Nico B, et al. Human erythropoietin induces a pro-angiogenic phenotype in cultured endothelial cells and stimulates neovascularization in vivo. Blood 93: , Scott SD, Greco O. Radiation and hypoxia inducible gene therapy system. Cancer Metastasis Rev 23: , Spivak JL. Recombinant human erythropoietin and the anemia of cancer. Blood 84: , Stasi R, Amadori S, Littlewood TJ, et al. Management of cancer-related anemia with erythropoietic agents: doubts, certainties, and concerns. Oncologist 10: , Stüben G, Pöttgen C, Knuhmann K, et al. Erythropoietin restores the anaemia-induced reduction in radiosensitivity of experimental human tumors in nude mice. Int J Radiat Oncol Biol Phys 55: , Tchekmedyian NS. Anaemia in cancer patients: significance, epidemiology, and current therapy. Oncology 1:17-24, Temkin SM, Hellmann M, Serur E, et al. Erythropoietin administration during primary treatment for locally advanced cervical carcinoma is associated with poor response to radiation. Int J Gynecol Cancer 16: , Thews O, Kelleher DK, Vaupel P. Erythropoietin restores the anemia-induced reduction in cyclophosphamide cytotoxicity in rat tumors. Cancer Res 61: , Tóvári J, Gilly R, Rásó E, et al. Recombinant human erythropoietin alpha targets intratumoral blood vessels improving chemotherapy in human xenograft models. Cancer Res 65: , Vaupel P, Kelleher DK, Höckel M. Oxygenation status of malignant tumors: pathogenesis of hypoxia and significance for tumor therapy. Semin Oncol 28:29-35, Vaupel P, Thews O, Hoeckel M. Treatment resistance of solid tumors. Med Oncol 18: , Winkler F, Kozin SV, Tong RT, et al. Kinetics of vascular normalization by VEGFR2 blockade governs brain tumor response to radiation: role of oxygenation, angiopoietin-1, and matrix metalloproteinases. Cancer Cell 6: , Yasuda Y, Musha T, Tanaka H, et al. Inhibition of erythropoietin signaling destroys xenografts of ovarian and uterine cancers in nude mice. Br J Cancer 84: , Zips D, Eichler W, Geyer P, et al. Enhanced susceptibility of irradiated tumor vessels to vascular endothelial growth factor receptor tyrosine kinase inhibition. Cancer Res 65: , 2005 ERYTHROPOIETIN-α HATÁSA A SUGÁRKEZELÉSRE Magyar Onkológia 51. évfolyam 1. szám

eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program

eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program Agydaganatok sugárterápia iránti érzékenységének növelése génterápiás eljárásokkal Doktori tézisek Szatmári Tünde Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Sugárterápia Program Doktori

Részletesebben

Chapter 10 Hungarian Summary. Az onkológiai gyógyszerfejlesztés eredetileg DNS-károsodást indukáló vegyületekre

Chapter 10 Hungarian Summary. Az onkológiai gyógyszerfejlesztés eredetileg DNS-károsodást indukáló vegyületekre 10 Összefoglaló Összefoglaló Az onkológiai gyógyszerfejlesztés eredetileg DNS-károsodást indukáló vegyületekre összpontosított, melyek az osztódó rákos sejteket célozzák meg. Jelenleg, nagy hangsúly fektetődik

Részletesebben

Epithelialis-mesenchymalis átmenet vastagbél daganatokban

Epithelialis-mesenchymalis átmenet vastagbél daganatokban Epithelialis-mesenchymalis átmenet vastagbél daganatokban Éles Klára Országos Onkológiai Intézet Sebészi és Molekuláris Daganatpatológiai Centrum Budapest, 2010. 12. 03. Epithelialis-mesenchymalis átmenet

Részletesebben

II./3.3.2 fejezet:. A daganatok célzott kezelése

II./3.3.2 fejezet:. A daganatok célzott kezelése II./3.3.2 fejezet:. A daganatok célzott kezelése Kopper László A fejezet célja, hogy megismerje a hallgató a célzott terápiák lehetőségeit és a fejlesztés lényeges lépéseit. A fejezet teljesítését követően

Részletesebben

Az angiogenezis gátlásának szerepe a vastagbél- és végbélrák kezelésében

Az angiogenezis gátlásának szerepe a vastagbél- és végbélrák kezelésében Az angiogenezis gátlásának szerepe a vastagbél- és végbélrák kezelésében Eredeti közlemény Bodoky György Fôvárosi Szent László és Szent István Kórház, Onkológiai Osztály, Budapest A szolid daganatok korszerû

Részletesebben

A csontvelői eredetű haem-és lymphangiogén endothel progenitor sejtek szerepe tüdőrákokban. Doktori tézisek. Dr. Bogos Krisztina

A csontvelői eredetű haem-és lymphangiogén endothel progenitor sejtek szerepe tüdőrákokban. Doktori tézisek. Dr. Bogos Krisztina A csontvelői eredetű haem-és lymphangiogén endothel progenitor sejtek szerepe tüdőrákokban Doktori tézisek Dr. Bogos Krisztina Semmelweis Egyetem Klinikai Orvostudományok Doktori Iskola Pulmonológia program

Részletesebben

Az Oxidatív stressz hatása a PIBF receptor alegységek összeszerelődésére.

Az Oxidatív stressz hatása a PIBF receptor alegységek összeszerelődésére. Újabban világossá vált, hogy a Progesterone-induced blocking factor (PIBF) amely a progesteron számos immunológiai hatását közvetíti, nem csupán a lymphocytákban és terhességgel asszociált szövetekben,

Részletesebben

Két kevéssé ismert humán ABCG fehérje expressziója és funkcionális vizsgálata: ABCG1 és ABCG4 jellemzése

Két kevéssé ismert humán ABCG fehérje expressziója és funkcionális vizsgálata: ABCG1 és ABCG4 jellemzése Két kevéssé ismert humán ABCG fehérje expressziója és funkcionális vizsgálata: ABCG1 és ABCG4 jellemzése Doktori tézisek Dr. Cserepes Judit Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola

Részletesebben

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,

Részletesebben

A hem-oxigenáz/vegf rendszer indukciója nőgyógyászati tumorokban. Óvári László

A hem-oxigenáz/vegf rendszer indukciója nőgyógyászati tumorokban. Óvári László A hem-oxigenáz/vegf rendszer indukciója nőgyógyászati tumorokban Óvári László HO-1, CO,VEGF biokémia rendszer Gyulladások Sebgyógyulás Placentáció HO-1, VEGF-onkológia-irodalom HO-1 nagy mértékében expresszálódik

Részletesebben

E4 A Gyermekkori szervezett lakossági emlőszűrések hatása az emlőműtétek

E4 A Gyermekkori szervezett lakossági emlőszűrések hatása az emlőműtétek 08.30-09.30 09.00-10.30 Pátria terem 2005. november 10. csütörtök E1 MEGNYITÓ E2 1.Nemzeti Üléselnökök: Rákkontroll Kovács Attila, Program Csonka I. Csaba, Ottó Szabolcs E3 Kásler Ottó jellegzetességei,

Részletesebben

A sugárkezelés hatására létrejött érdenzitás-változás a terápia eredményességének prediktora mesopharynxrák esetében

A sugárkezelés hatására létrejött érdenzitás-változás a terápia eredményességének prediktora mesopharynxrák esetében A sugárkezelés hatására létrejött érdenzitás-változás a terápia eredményességének prediktora mesopharynxrák esetében Eredeti közlemény Lövey József 1, Lukits Júlia 2, Remenár Éva 3, Koronczay Krisztina

Részletesebben

Fehérjeglikoziláció az endoplazmás retikulumban mint lehetséges daganatellenes támadáspont

Fehérjeglikoziláció az endoplazmás retikulumban mint lehetséges daganatellenes támadáspont Fehérjeglikoziláció az endoplazmás retikulumban mint lehetséges daganatellenes támadáspont Doktori tézisek Dr. Konta Laura Éva Semmelweis Egyetem Molekuláris Orvostudományok Tudományági Doktori Iskola

Részletesebben

67. Pathologus Kongresszus

67. Pathologus Kongresszus A kemoirradiáció okozta oncocytás átalakulás szövettani, immunhisztokémiai, ultrastruktúrális jellemzői és lehetséges prognosztikus jelentősége rectum adenocarcinomákban 67. Pathologus Kongresszus Bogner

Részletesebben

Her2 fehérje overexpresszió gyomorrákokban: Hazai tapasztalatok

Her2 fehérje overexpresszió gyomorrákokban: Hazai tapasztalatok Her2 fehérje overexpresszió gyomorrákokban: Hazai tapasztalatok Dr. Lotz Gábor, Dr. Szirtes Ildikó, Dr. Kiss András Prof. Tímár József, Prof. Kulka Janina Semmelweis Egyetem II. Pathologiai Intézet - Exophyticus

Részletesebben

Xenobiotikum transzporterek vizsgálata humán keratinocitákban és bőrben

Xenobiotikum transzporterek vizsgálata humán keratinocitákban és bőrben DOKTORI (PHD) ÉRTEKEZÉS TÉZISEI Xenobiotikum transzporterek vizsgálata humán keratinocitákban és bőrben Bebes Attila Témavezető: Dr. Széll Márta tudományos tanácsadó Szegedi Tudományegyetem Bőrgyógyászati

Részletesebben

Tapasztalataink súlyos pikkelysömör adalimumab kezelésével* Adalimumab treatment of severe psoriasis

Tapasztalataink súlyos pikkelysömör adalimumab kezelésével* Adalimumab treatment of severe psoriasis BÔRGYÓGYÁSZATI ÉS VENEROLÓGIAI SZEMLE 85. ÉVF. 6. 283 288. Szegedi Tudományegyetem, Általános Orvostudományi Kar, Szent-Györgyi Albert Klinikai Központ, Bôrgyógyászati és Allergológiai Klinika (igazgató:

Részletesebben

DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA

DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA DOKTORI ÉRTEKEZÉS TÉZISEI AZ OPPORTUNISTA HUMÁNPATOGÉN CANDIDA PARAPSILOSIS ÉLESZTŐGOMBA ELLENI TERMÉSZETES ÉS ADAPTÍV IMMUNVÁLASZ VIZSGÁLATA TÓTH ADÉL TÉMAVEZETŐ: DR. GÁCSER ATTILA TUDOMÁNYOS FŐMUNKATÁRS

Részletesebben

Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ

Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ Dr Csőszi Tibor Hetenyi G. Kórház, Onkológiai Központ Azért, mert a kemoterápia bizonyított módon fokozza a gyógyulás esélyét! A kemoterápiának az a célja, hogy az esetleg, vagy biztosan visszamaradt daganatsejtek

Részletesebben

A corneális stromahomály (haze) kialakulásának biokémiai háttere photorefraktív lézerkezelést követően

A corneális stromahomály (haze) kialakulásának biokémiai háttere photorefraktív lézerkezelést követően A corneális stromahomály (haze) kialakulásának biokémiai háttere photorefraktív lézerkezelést követően Vállalt feladatok a) A könny plazminogén aktivátor aktivitás (PAA) - nak, valamint plazminogén aktivátor

Részletesebben

RÉSZLETES BESZÁMOLÓ Az OTKA által támogatott konzorcium működésében az Uzsoki utcai Kórház feladata a szövetminták gyűjtése, előzetes feldolgozása, ill. a betegek utánkövetése, valamint az utánkövétésre

Részletesebben

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6

mintasepcifikus mikrokapilláris elektroforézis Lab-on-Chip elektroforézis / elektrokinetikus elven DNS, RNS, mirns 12, fehérje 10, sejtes minta 6 Agilent 2100 Bioanalyzer mikrokapilláris gélelektroforézis rendszer G2943CA 2100 Bioanalyzer system forgalmazó: Kromat Kft. 1112 Budapest Péterhegyi u. 98. t:36 (1) 248-2110 www.kromat.hu bio@kromat.hu

Részletesebben

Dr. Fröhlich Georgina

Dr. Fröhlich Georgina Sugárbiol rbiológia Dr. Fröhlich Georgina Országos Onkológiai Intézet Sugárterápiás Központ Budapest Ionizáló sugárzások a gyógyításban ELTE TTK, Budapest Az ionizáló sugárzás biológiai hatásai - determinisztikus

Részletesebben

http://www.rimm.dote.hu Tumor immunológia

http://www.rimm.dote.hu Tumor immunológia http://www.rimm.dote.hu Tumor immunológia A tumorok és az immunrendszer kapcsolatai Tumorspecifikus és tumorasszociált antigének A tumor sejteket ölő sejtek és mechanizmusok Az immunológiai felügyelet

Részletesebben

Nem-szteroid gyulladásgátlók alkalmazása az 5- fluorouracil hatékonyságának növelésére kísérletes rendszerekben. Réti Andrea

Nem-szteroid gyulladásgátlók alkalmazása az 5- fluorouracil hatékonyságának növelésére kísérletes rendszerekben. Réti Andrea Nem-szteroid gyulladásgátlók alkalmazása az 5- fluorouracil hatékonyságának növelésére kísérletes rendszerekben Doktori értekezés tézisei Réti Andrea Országos Onkológiai Intézet Semmelweis Egyetem Doktori

Részletesebben

PUBLICATIONS. doctorandus: Júlia Vízkeleti

PUBLICATIONS. doctorandus: Júlia Vízkeleti PUBLICATIONS doctorandus: Júlia Vízkeleti Articles in the subject of the dissertation: 1. Vízkeleti J., Vereczkey I., Fröhlich G., Varga S., Horváth K., Pulay T., Pete I.,,Kásler M., Polgár C.: Pathologic

Részletesebben

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001

Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 Nemzeti Kutatási és Fejlesztési Program 1. Főirány: Életminőség javítása Nemzeti Onkológiai Kutatás-Fejlesztési Konzorcium a daganatos halálozás csökkentésére 1/48/2001 3. Részjelentés: 2003. November

Részletesebben

Kétféle antitest egyidejû alkalmazása az elôrehaladott colorectalis rák terápiájában

Kétféle antitest egyidejû alkalmazása az elôrehaladott colorectalis rák terápiájában 5. ÉVFOLYAM, 2. SZÁM 2009. ÁPRILIS JOURNAL OF CLINICAL ONCOLOGY SZERKESZTÔSÉGI KÖZLEMÉNY Kétféle antitest egyidejû alkalmazása az elôrehaladott colorectalis rák terápiájában Charles D. Blanke Division

Részletesebben

Az anti-apoptózis mechanizmus vizsgálata agyi ischaemia/hypoxia modellekben

Az anti-apoptózis mechanizmus vizsgálata agyi ischaemia/hypoxia modellekben OTKA T-037887 zárójelentés Az anti-apoptózis mechanizmus vizsgálata agyi ischaemia/hypoxia modellekben Az ischaemias stroke-ot követően az elzáródott ér ellátási területének centrumában percek, órák alatt

Részletesebben

10. Tumorok kialakulása, tumor ellenes immunmechanizusok

10. Tumorok kialakulása, tumor ellenes immunmechanizusok 10. Tumorok kialakulása, tumor ellenes immunmechanizusok Kacskovics Imre Biológiai Intézet Immunológiai Tanszék 2016. április 27. TUMOR Tumor (neoplázia): növekedési kontroll (immunosurveillance) alól

Részletesebben

ANTICANCER RESEARCH [Rákkutatás]

ANTICANCER RESEARCH [Rákkutatás] ANTICANCER RESEARCH [Rákkutatás] Nemzetközi rákkutatási és rákgyógyászati folyóirat Az MGN-3/Biobran rizskorpából kivont módosított arabinoxilán in vitro növeli a metasztatikus emlőráksejtek érzékenységét

Részletesebben

Áramlási citometria 2011. / 4. Immunológiai és Biotechnológiai Intézet PTE KK

Áramlási citometria 2011. / 4. Immunológiai és Biotechnológiai Intézet PTE KK Áramlási citometria 2011. / 4 Immunológiai és Biotechnológiai Intézet PTE KK Az áramlási citometria elve Az áramlási citometria ( Flow cytometria ) sejtek gyors, multiparaméteres vizsgálatára alkalmas

Részletesebben

a legérzékenyebb markerkombináció emlôdaganatoknál

a legérzékenyebb markerkombináció emlôdaganatoknál TPA és CA 15-3 a legérzékenyebb markerkombináció emlôdaganatoknál Bevezetés Az emlôrák a leggyakoribb rosszindulatú betegség nôknél. Elôfordulásának gyakorisága 100.000 személybôl átlagosan 60 eset (1)

Részletesebben

A kolorektális rákok KRAS-mutációs státuszának hatása az Avastin-terápia hatékonyságára

A kolorektális rákok KRAS-mutációs státuszának hatása az Avastin-terápia hatékonyságára Eredeti közlemény 99 A kolorektális rákok KRAS-mutációs státuszának hatása az Avastin-terápia hatékonyságára Hegedűs Zita 1, Barbai Tamás 1, Tátrai Péter 1, Hegedűs Balázs 1, Kiss András 1, Rásó Erzsébet

Részletesebben

Glikohisztokémiai és mikrovaszkularizációs prognosztikai faktorok tüd rákban. Doktori (Ph.D) értekezés tézisei. Készítette:

Glikohisztokémiai és mikrovaszkularizációs prognosztikai faktorok tüd rákban. Doktori (Ph.D) értekezés tézisei. Készítette: Glikohisztokémiai és mikrovaszkularizációs prognosztikai faktorok tüd rákban Doktori (Ph.D) értekezés tézisei Készítette: Dr. Sz ke Tamás Szegedi Tudományegyetem Általános Orvostudományi Kar Sebészeti

Részletesebben

Terápiarezisztencia-fehérjéket kódoló mrns kvantitatív kimutatása PCRtechnikával. nyirokcsomójában

Terápiarezisztencia-fehérjéket kódoló mrns kvantitatív kimutatása PCRtechnikával. nyirokcsomójában Terápiarezisztencia-fehérjéket kódoló mrns kvantitatív kimutatása PCRtechnikával lymphomás kutyák nyirokcsomójában Sunyál Orsolya V. évfolyam Témavezetık: Dr. Vajdovich Péter Szabó Bernadett SZIE-ÁOTK

Részletesebben

A zoledronsav klinikai és preklinikai. Dr. Nagykálnai Tamás Magyar Szenológiai Társaság Kongresszusa Balatonfüred 2009. október 9.-10.

A zoledronsav klinikai és preklinikai. Dr. Nagykálnai Tamás Magyar Szenológiai Társaság Kongresszusa Balatonfüred 2009. október 9.-10. A zoledronsav klinikai és preklinikai evidenciái az emlőrák kezelésében Dr. Nagykálnai Tamás Magyar Szenológiai Társaság Kongresszusa Balatonfüred 2009. október 9.-10. Kísérleti modellekben antitumoros

Részletesebben

A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban

A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban BEVEZETÉS ÉS A KUTATÁS CÉLJA A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban (LCPUFA), mint az arachidonsav

Részletesebben

Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata

Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata Multidrog rezisztens tumorsejtek szelektív eliminálására képes vegyületek azonosítása és in vitro vizsgálata Doktori értekezés tézisei Türk Dóra Témavezető: Dr. Szakács Gergely MTA TTK ENZIMOLÓGIAI INTÉZET

Részletesebben

ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL

ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL ZÁRÓJELENTÉS 2004-2007 A MOLEKULÁRIS ONKOGENEZIS MECHANIZMUSAI GYAKORI DAGANATOKBAN C. PÁLYÁZAT TELJESÍTÉSÉRŐL EREDMÉNYEK Munkacsoportunk úttörő szerepet játszott a molekuláris onkológiai (onkogenetikai)

Részletesebben

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A TM vizsgálatok alapkérdései A vizsgálatok célja, információértéke? Az alkalmazás területei? Hogyan válasszuk ki az alkalmazott

Részletesebben

Géneltérések biológiai szerepe és prognosztikai jelentősége humán malignus melanomákban

Géneltérések biológiai szerepe és prognosztikai jelentősége humán malignus melanomákban 268 Doktori tézisek Géneltérések biológiai szerepe és prognosztikai jelentősége humán malignus melanomákban Vízkeleti Laura Debreceni Egyetem, Egészségtudományok Doktori Iskola, Debrecen Témavezető: Prof.

Részletesebben

Egészséges élet, aktív öregedés

Egészséges élet, aktív öregedés Tudományos Trilaterális Szimpózium a 32 éves együttműködés alkalmából Egészséges élet, aktív öregedés 2015. június 12. -13. Semmelweis Szalon 2015. június 12. péntek 10.30 Prof. Dr. Molnár Mária Judit,

Részletesebben

A sugárterápia hatása a daganatellenes immunválaszra

A sugárterápia hatása a daganatellenes immunválaszra 46 ÖSSZEFOGLALÓ KÖZLEMÉNY A sugárterápia hatása a daganatellenes immunválaszra A sugárterápia és az immunterápia optimális kombinálásának lehetőségei LUMNICZKY KATALIN, SÁFRÁNY GÉZA Országos Közegészségügyi

Részletesebben

Onkológiai betegek és az oszteoporózis

Onkológiai betegek és az oszteoporózis Onkológiai betegek és az oszteoporózis Dr. Nusser Nóra Zsigmondy Vilmos Harkányi Gyógyfürdőkórház (2011.) Oszteoporózis (OP) jelentősége Az első törésig tünetmentes! Az 50 év feletti nők 50%-ának, férfiak

Részletesebben

I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS

I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS I. MELLÉKLET ALKALMAZÁSI ELŐÍRÁS 1 1. A GYÓGYSZER MEGNEVEZÉSE Eporatio 1000 NE /0,5 ml oldatos injekció előretöltött fecskendőben 2. MINŐSÉGI ÉS MENNYISÉGI ÖSSZETÉTEL Előretöltött fecskendőnként 1000 nemzetközi

Részletesebben

A tüdődaganatos betegek kemoterápia okozta anémiájának kezelése

A tüdődaganatos betegek kemoterápia okozta anémiájának kezelése Összefoglaló közlemény 39 A tüdődaganatos betegek kemoterápia okozta anémiájának kezelése Gálffy Gabriella Semmelweis Egyetem, Pulmonológiai Klinika, udapest Daganatos betegek körében gyakori szövődmény

Részletesebben

A PROTEIN KINÁZ C IZOENZIMEK SZEREPE HUMÁN HaCaT KERATINOCYTÁK SEJTM KÖDÉSEINEK SZABÁLYOZÁSÁBAN

A PROTEIN KINÁZ C IZOENZIMEK SZEREPE HUMÁN HaCaT KERATINOCYTÁK SEJTM KÖDÉSEINEK SZABÁLYOZÁSÁBAN EGYETEMI DOKTORI (Ph.D.) ÉRTEKEZÉS TÉZISEI A PROTEIN KINÁZ C IZOENZIMEK SZEREPE HUMÁN HaCaT KERATINOCYTÁK SEJTM KÖDÉSEINEK SZABÁLYOZÁSÁBAN Papp Helga DEBRECENI EGYETEM ORVOS-ÉS EGÉSZSÉGTUDOMÁNYI CENTRUM

Részletesebben

Platina bázisú kemoterápia hatása különböző biomarkerek expressziójára tüdőrákokban

Platina bázisú kemoterápia hatása különböző biomarkerek expressziójára tüdőrákokban Platina bázisú kemoterápia hatása különböző biomarkerek expressziójára tüdőrákokban Pápay J. 1, Sápi Z. 1 Gyulai M. 5, Egri G. 2, Szende B. 1, Tímár J. 4 Moldvay J. 3 1: Semmelweis Egyetem, I.sz.Patológiai

Részletesebben

Immunológiai módszerek a klinikai kutatásban

Immunológiai módszerek a klinikai kutatásban Immunológiai módszerek a klinikai kutatásban 7. előadás Immunizálás. Poliklonális és monoklonális ellenanyag előállítása, tisztítása, alkalmazása Az antigén (haptén + hordozó) sokféle specificitású ellenanyag

Részletesebben

Szakmai zárójelentés

Szakmai zárójelentés Szakmai zárójelentés A témavezető neve: dr. Antus Balázs A téma címe: A bronchiolitis obliterans szindróma pathomechanizmusa OTKA nyilvántartási szám: F 046526 Kutatási időtartam: 2004-2008. A kutatási

Részletesebben

A daganatos betegségekhez társuló anémiák okai és kezelési lehetôségei

A daganatos betegségekhez társuló anémiák okai és kezelési lehetôségei A daganatos betegségekhez társuló anémiák okai és kezelési lehetôségei Gyógyszergyári Borbényi Zita Szegedi Tudományegyetem, Általános Orvostudományi Kar, II. sz. Belgyógyászati Klinika és Kardiológiai

Részletesebben

A HER2-negatív emlőrák kezelési stratégiái

A HER2-negatív emlőrák kezelési stratégiái A HER2-negatív emlőrák kezelési stratégiái Dr. Landherr László Uzsoki Utcai Kórház Magyar Szenológiai Társaság Tudományos Fóruma - 2012 Klinikai igények Az eredetileg rosszabb prognózisú HER2-pozitív emlőrák

Részletesebben

A tüdő adenocarcinomák szubklasszifikációja. Dr. Szőke János Molekuláris Patológiai Osztály Budapest, 2008 december 5.

A tüdő adenocarcinomák szubklasszifikációja. Dr. Szőke János Molekuláris Patológiai Osztály Budapest, 2008 december 5. A tüdő adenocarcinomák szubklasszifikációja Dr. Szőke János Molekuláris Patológiai Osztály Budapest, 2008 december 5. Háttér A tüdő ACA heterogén tumor csoport és a jelenlegi klasszifikáció elsősorban

Részletesebben

Az Egészségügyi Minisztérium módszertani levele Immunhisztokémiai és immuncitokémiai módszerek alkalmazása a patológiában

Az Egészségügyi Minisztérium módszertani levele Immunhisztokémiai és immuncitokémiai módszerek alkalmazása a patológiában 1 Az Egészségügyi Minisztérium módszertani levele Immunhisztokémiai és immuncitokémiai módszerek alkalmazása a patológiában Készítette: Az Országos Pathologiai Intézet és a Pathologus Szakmai Kollégium

Részletesebben

BELGYÓGYÁSZAT. Factor V.Leiden genotípus súlyos, poplitealis restenosissal járó atherosclerosisban

BELGYÓGYÁSZAT. Factor V.Leiden genotípus súlyos, poplitealis restenosissal járó atherosclerosisban BELGYÓGYÁSZAT Factor V.Leiden genotípus súlyos, poplitealis restenosissal járó atherosclerosisban Írta: DR. VALLUS GÁBOR, DR. DLUSTUS BÉLA, DR. NAGY BÁLINT, DR. PAPP ZOLTÁN, DR. ROMICS LÁSZLÓ, DR. KARÁDI

Részletesebben

Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán

Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán Szövettan kérdései Ami a terápiát meghatározza és ami segíti Dr. Sápi Zoltán 1.Számú Patológiai és Kísérleti Rákkutató Intézet Diagnózis (definitív): benignus, malignus, intermedier malignitás, borderline

Részletesebben

Funkcionális töréskezelés a IV-V. metacarpus diaphysis töréseinek ellátásában

Funkcionális töréskezelés a IV-V. metacarpus diaphysis töréseinek ellátásában A Pécsi Orvostudományi Egyetem Balesetsebészeti és Kézsebészeti Klinikájának közleménye Funkcionális töréskezelés a IV-V. metacarpus diaphysis töréseinek ellátásában DR. TÓTH FERENC, DR. NYÁRÁDY JÓZSEF,

Részletesebben

Katasztrófális antifoszfolipid szindróma

Katasztrófális antifoszfolipid szindróma Katasztrófális antifoszfolipid szindróma Gadó Klára Semmelweis Egyetem, I.sz. Belgyógyászati Klinika Antifoszfolipid szindróma Artériás és vénás thrombosis Habituális vetélés apl antitest jelenléte Mi

Részletesebben

Egyetemi doktori (Ph.D.) értekezés tézisei

Egyetemi doktori (Ph.D.) értekezés tézisei Egyetemi doktori (Ph.D.) értekezés tézisei Oxidatív stressz hatása a poli(adp-ribóz) metabolizmusra és a kalcium homeosztázisra humán keratinocita és egér makrofág sejtvonalakban Bakondi Edina Témavezet

Részletesebben

San Antonio Breast Cancer Symposium. Dr. Tőkés Tímea

San Antonio Breast Cancer Symposium. Dr. Tőkés Tímea San Antonio Breast Cancer Symposium Dr. Tőkés Tímea San Antonio, Texas, USA Henry B. Gonzalez Convention Center December 10-14, 2013 SABCS 2013 Több, mint 7500 résztvevő, több, mint 70 országból Továbbképzések,

Részletesebben

Publications: 4. Nagykálnai T, Landherr L, Németh GY: Recidiváló epipharynx tumorok lokális rádiumkezelése. Fül-Orr-Gégegyógyászat 31: 97-101, 1985.

Publications: 4. Nagykálnai T, Landherr L, Németh GY: Recidiváló epipharynx tumorok lokális rádiumkezelése. Fül-Orr-Gégegyógyászat 31: 97-101, 1985. 1 Publications: 1. Landherr L, Siminszky M, Patonay P, Patyánik M, Stumpf J. Bucca tumoros betegeink 3 és 5 éves túlélési eredményei 285 kezelt esetnél. MFE Szájsebészeti Szekció Kongresszusának gyűjteményes

Részletesebben

Eredményes temozolamid kezelés 2 esete glioblasztómás betegeknél

Eredményes temozolamid kezelés 2 esete glioblasztómás betegeknél Eredményes temozolamid kezelés 2 esete glioblasztómás betegeknél Dr. Mangel László 1,2, Prof. Dr. Dóczi Tamás 3, Dr. Balogh Zsolt 4, Dr. Lövey József 2, Dr. Sipos László 5 Pécsi Tudományegyetem, Onkoterápiás

Részletesebben

Őssejtkezelés kardiovaszkuláris kórképekben

Őssejtkezelés kardiovaszkuláris kórképekben Őssejtkezelés kardiovaszkuláris kórképekben Papp Zoltán Debreceni Egyetem Kardiológiai Intézet Klinikai Fiziológiai Tanszék Megmenthető a károsodott szív őssejtekkel? Funkcionális változások az öregedő

Részletesebben

Új lehetőségek az immunadszorpciós kezelésben. III. Terápiás Aferezis Konferencia, Debrecen Bielik Norbert

Új lehetőségek az immunadszorpciós kezelésben. III. Terápiás Aferezis Konferencia, Debrecen Bielik Norbert Új lehetőségek az immunadszorpciós kezelésben III. Terápiás Aferezis Konferencia, Debrecen Bielik Norbert TheraSorb aferézis rendszer teljes megoldást kínál a következő applikációkra: Immunadszorpció (totál

Részletesebben

A prokalcitonin prognosztikai értéke

A prokalcitonin prognosztikai értéke A prokalcitonin prognosztikai értéke az első 24 órában Dr. Tánczos Krisztián SZTE Aneszteziológiai és Intenzív Terápiás Intézet Carlet et al. Antimicrobial Resistance and Infection Control 2012, 1:11 Carlet

Részletesebben

Gége- és hypopharyngealis rákok jellemzése

Gége- és hypopharyngealis rákok jellemzése Gége- és hypopharyngealis rákok jellemzése Tumorméret és vaszkularizáció Eredeti Lukits Júlia 1 *, Döme Balázs 1,2, Juhász Attila 3, Paku Sándor 2, Tímár József 1,2, Répássy Gábor 4 1 Országos Onkológiai

Részletesebben

Tumorprogresszió és előrejelzése. Statisztikák. Statisztika - USA Megbetegedés / 10 leggyakoribb (2012)

Tumorprogresszió és előrejelzése. Statisztikák. Statisztika - USA Megbetegedés / 10 leggyakoribb (2012) Tumorprogresszió és előrejelzése 1. Statisztikák 2. Kezelési protokollok 3. Jövő 4. Teszt írása Megbetegedés / 1 leggyakoribb (212) Statisztikák Forrás: CA Halálozás / 1 leggyakoribb (212) Statisztika

Részletesebben

OncotypeDX és más genetikai tesztek emlőrákban és azon túl. Dr. Nagy Zoltán Med Gen-Sol Kft.

OncotypeDX és más genetikai tesztek emlőrákban és azon túl. Dr. Nagy Zoltán Med Gen-Sol Kft. OncotypeDX és más genetikai tesztek emlőrákban és azon túl Dr. Nagy Zoltán Med Gen-Sol Kft. 2 A betegek leggyakoribb kérdései! Kiújul a betegségem?! Kell kemoterápiát kapnom?! A beteg és környezete életét,

Részletesebben

Biomolekuláris nanotechnológia. Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium

Biomolekuláris nanotechnológia. Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium Biomolekuláris nanotechnológia Vonderviszt Ferenc PE MÜKKI Bio-Nanorendszerek Laboratórium Az élő szervezetek példája azt mutatja, hogy a fehérjék és nukleinsavak kiválóan alkalmasak önszerveződő molekuláris

Részletesebben

TERÁPIÁS PROBLÉMÁK ONKOPLASZTIKAI MŰTÉTEK UTÁN A SUGÁRTERAPEUTA SZEMSZÖGÉBŐL. Dr. Takácsi-Nagy Zoltán

TERÁPIÁS PROBLÉMÁK ONKOPLASZTIKAI MŰTÉTEK UTÁN A SUGÁRTERAPEUTA SZEMSZÖGÉBŐL. Dr. Takácsi-Nagy Zoltán TERÁPIÁS PROBLÉMÁK ONKOPLASZTIKAI MŰTÉTEK UTÁN A SUGÁRTERAPEUTA SZEMSZÖGÉBŐL Dr. Takácsi-Nagy Zoltán REKONSTRUKCIÓ ÉS SUGÁRKEZELÉS REKONSTRUKCIÓ OKAI: PSZICHOLÓGIAI ESZTÉTIKAI SUGÁRTERÁPIA OKAI: LOKÁLIS

Részletesebben

NK72595. Rosszindulatú daganatok ereződésének mintázata és molekuláris mechanizmusa

NK72595. Rosszindulatú daganatok ereződésének mintázata és molekuláris mechanizmusa Rosszindulatú daganatok ereződésének mintázata és molekuláris mechanizmusa Bevezetés A daganat-indukált angiogenezisről alkotott kép az elmúlt egy évtizedben jelentősen fejlődött és mára világossá vált

Részletesebben

Szerven belül egyenetlen dóziseloszlások és az LNT-modell

Szerven belül egyenetlen dóziseloszlások és az LNT-modell Szerven belül egyenetlen dózseloszlások és az LNT-modell Madas Balázs Gergely, Balásházy Imre MTA Energatudomány Kutatóközpont XXXVIII. Sugárvédelm Továbbképző Tanfolyam Hunguest Hotel Béke 2013. áprls

Részletesebben

A KAR-2, egy antimitotikus ágens egyedi farmakológiájának atomi és molekuláris alapjai

A KAR-2, egy antimitotikus ágens egyedi farmakológiájának atomi és molekuláris alapjai A KAR-2, egy antimitotikus ágens egyedi farmakológiájának atomi és molekuláris alapjai A doktori értekezés tézisei Horváth István Eötvös Loránd Tudományegyetem Biológia Doktori Iskola (A Doktori Iskola

Részletesebben

Sugárterápia minőségbiztosításának alapelvei Dr. Szabó Imre (DE OEC Onkológiai Intézet)

Sugárterápia minőségbiztosításának alapelvei Dr. Szabó Imre (DE OEC Onkológiai Intézet) Sugárterápia minőségbiztosításának alapelvei Dr. Szabó Imre (DE OEC Onkológiai Intézet) I. Irányelvek WHO 1988: Mindazon tevékenység, amely biztosítja a céltérfogatra leadott megfelelő sugárdózist az ép

Részletesebben

Füle Tibor. Humán papillómavírus a méhnyakrákokban és a környező szövetekben. Témavezető: Dr. Kovalszky Ilona

Füle Tibor. Humán papillómavírus a méhnyakrákokban és a környező szövetekben. Témavezető: Dr. Kovalszky Ilona Ph.D. ÉRTEKEZÉS TÉZISEI Humán papillómavírus a méhnyakrákokban és a környező szövetekben Füle Tibor Témavezető: Dr. Kovalszky Ilona Semmelweis Egyetem I. sz. Patológiai és Kísérleti Rákkutató Intézet 2005

Részletesebben

Jelátviteli folyamatok vizsgálata neutrofil granulocitákban és az autoimmun ízületi gyulladás kialakulásában

Jelátviteli folyamatok vizsgálata neutrofil granulocitákban és az autoimmun ízületi gyulladás kialakulásában Jelátviteli folyamatok vizsgálata neutrofil granulocitákban és az autoimmun ízületi gyulladás kialakulásában Doktori tézisek Dr. Németh Tamás Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola

Részletesebben

A tüdőrák agyi metasztázisainak komplex kezelése az onkopulmonológus szemszögéből

A tüdőrák agyi metasztázisainak komplex kezelése az onkopulmonológus szemszögéből A tüdőrák agyi metasztázisainak komplex kezelése az onkopulmonológus szemszögéből Ostoros Gyula Országos Korányi TBC és Pulmonológiai Intézet 2007. október 6. Az onkológia jelenlegi legnagyobb kihívása

Részletesebben

Új diagnosztikus és terápiás lehetőségek a glioblastoma multiforme kezelésében

Új diagnosztikus és terápiás lehetőségek a glioblastoma multiforme kezelésében New diagnostic and therapeutical possibilities in the treatment of glioblastoma multiforme Új diagnosztikus és terápiás lehetőségek a glioblastoma multiforme kezelésében Ph.D. Thesis Ph.D Tézisek Dr. Bellyeiné

Részletesebben

20 éves a Mamma Klinika

20 éves a Mamma Klinika 20 éves a Mamma Klinika A sejtdiagnosztika modern eszközei a diagnosztikában és terápiában dr Járay Balázs, dr Székely Eszter Medserv Kft, Semmelweis Egyetem II. Patológiai Intézet Budapest 1 22196 betegből

Részletesebben

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában

Molekuláris genetikai vizsgáló. módszerek az immundefektusok. diagnosztikájában Molekuláris genetikai vizsgáló módszerek az immundefektusok diagnosztikájában Primer immundefektusok A primer immundeficiencia ritka, veleszületett, monogénes öröklődésű immunhiányos állapot. Családi halmozódást

Részletesebben

A kemoterápiás kezelések új, költséghatékony ellátást támogató finanszírozási rendszerének kialakítása Magyarországon

A kemoterápiás kezelések új, költséghatékony ellátást támogató finanszírozási rendszerének kialakítása Magyarországon A kemoterápiás kezelések új, költséghatékony ellátást támogató finanszírozási rendszerének kialakítása Magyarországon Dózsa Csaba, Budapesti Corvinus Egyetem Kiss Zsolt, Nagy Júlia, Kerekesné Ketzer Éva,

Részletesebben

Fiatal férfi beteg sikeres kombinált neurointervenciós idegsebészeti-sugársebészet

Fiatal férfi beteg sikeres kombinált neurointervenciós idegsebészeti-sugársebészet A carotisarteria szűkületének javasolt ellátási módját alapvetően befolyásolja, ha a szűkület mindkét oldalon szignifikáns mértékű, ha a szűkület oka előzetes nyaki besugárzás, illetve ha a betegnek intracranialis

Részletesebben

EGFR-tirozinkináz-inhibitorok alkalmazása tüdőrákban: szenzitivitás és rezisztencia

EGFR-tirozinkináz-inhibitorok alkalmazása tüdőrákban: szenzitivitás és rezisztencia 38 Gyógyszergyári közlemény EGFR-tirozinkináz-inhibitorok alkalmazása tüdőrákban: szenzitivitás és rezisztencia Moldvay Judit 1, Peták István 2,3 1 Semmelweis Egyetem Pulmonológiai Klinika, 2 Semmelweis

Részletesebben

Az Ames teszt (Salmonella/S9) a nemzetközi hatóságok által a kémiai anyagok minősítéséhez előírt vizsgálat, amellyel az esetleges genotoxikus hatás

Az Ames teszt (Salmonella/S9) a nemzetközi hatóságok által a kémiai anyagok minősítéséhez előírt vizsgálat, amellyel az esetleges genotoxikus hatás Az Ames teszt (Salmonella/S9) a nemzetközi hatóságok által a kémiai anyagok minősítéséhez előírt vizsgálat, amellyel az esetleges genotoxikus hatás kockázatát mérik fel. Annak érdekében, hogy az anyavegyületével

Részletesebben

előállítva. Kínai hörcsög ovárium (CHO) sejtvonalban, rekombináns DNS technológiával

előállítva. Kínai hörcsög ovárium (CHO) sejtvonalban, rekombináns DNS technológiával 1. A GYÓGYSZER MEGNEVEZÉSE Silapo 1000 NE/0,3 ml oldatos injekció előretöltött fecskendőben 2. MINŐSÉGI ÉS MENNYISÉGI ÖSSZETÉTEL 1 darab előretöltött fecskendőben tárolt 0,3 ml injekciós oldat 1000 nemzetközi

Részletesebben

Sebész szerepe az axilla ellátásában Mersich Tamás Uzsoki utcai Kórház Sebészeti-onkosebészeti Osztály 2014. május 24. Kecskemét Bevezetés A nyirokcsomók sebészi eltávolítása felel a legtöbb szövődményért

Részletesebben

Kis dózis, nagy dilemma

Kis dózis, nagy dilemma Kis dózis, nagy dilemma Farkas Árpád, Balásházy Imre, Madas Balázs Gergely, Szőke István XXXVII. Sugárvédelmi Továbbképző Tanfolyam, 2012. április 24-26. Hajdúszoboszló Mi számít kis dózisnak? Atombomba

Részletesebben

MULTIDROG REZISZTENCIA IN VIVO KIMUTATÁSA PETEFÉSZEK TUMOROKBAN MOLEKULÁRIS LEKÉPEZÉSSEL

MULTIDROG REZISZTENCIA IN VIVO KIMUTATÁSA PETEFÉSZEK TUMOROKBAN MOLEKULÁRIS LEKÉPEZÉSSEL MULTIDROG REZISZTENCIA IN VIVO KIMUTATÁSA PETEFÉSZEK TUMOROKBAN MOLEKULÁRIS LEKÉPEZÉSSEL Dr. Krasznai Zoárd Tibor Debreceni Egyetem OEC Szülészeti és Nőgyógyászati Klinika Debrecen, 2011. 10.17. Bevezetés

Részletesebben

Az ABCG2 multidrog transzporter fehérje szerkezetének és működésének vizsgálata

Az ABCG2 multidrog transzporter fehérje szerkezetének és működésének vizsgálata Az ABCG2 multidrog transzporter fehérje szerkezetének és működésének Kutatási előzmények Az ABC transzporter membránfehérjék az ATP elhasítása (ATPáz aktivitás) révén nyerik az energiát az általuk végzett

Részletesebben

Krónikus veseelégtelenséghez társuló, tünetekkel járó anaemia kezelése felnőtt és gyermekgyógyászati betegek esetén:

Krónikus veseelégtelenséghez társuló, tünetekkel járó anaemia kezelése felnőtt és gyermekgyógyászati betegek esetén: 1. A GYÓGYSZER MEGNEVEZÉSE Binocrit 1000 NE/0,5 ml oldatos injekció előretöltött fecskendőben 2. MINŐSÉGI ÉS MENNYISÉGI ÖSSZETÉTEL Az oldat milliliterenként 2000 NE alfa epoetint* tartalmaz, amely 16,8

Részletesebben

sikeresnek bizonyult, és ami a legfontosabb az onkoterápiában, hogy a vegyület nem toxikus, ezért igen magas dózissal is eredményesn alkalmazható.

sikeresnek bizonyult, és ami a legfontosabb az onkoterápiában, hogy a vegyület nem toxikus, ezért igen magas dózissal is eredményesn alkalmazható. Turmeric Live Extract 30db A teljes kurkuma kivonat hatásának rövid jellemzése A Turmeric Live Extract bonyolult, számos eltérő molekulát tartalmazó összetett hatóanyag. A turmeron/ol különböző formáit,

Részletesebben

Bevezetés. 2. Rhinitises/asthmás betegek kiemelése 880 dolgozót (695 beköltözot és 185 oslakost) kérdoív alapján emeltem ki ipari populációból Pakson.

Bevezetés. 2. Rhinitises/asthmás betegek kiemelése 880 dolgozót (695 beköltözot és 185 oslakost) kérdoív alapján emeltem ki ipari populációból Pakson. Bevezetés Inhalatív úton a légutakba jutó anyagok sora eredményez az arra érzékeny szervezetben kóros, megváltozott és specifikus légúti rendellenességet. A légúti allergia globális egészségügyi problémát

Részletesebben

Készítette: Balog Eszter Témavezetők: dr. Baska-Vincze Boglárka Dr. Szenci Ottó

Készítette: Balog Eszter Témavezetők: dr. Baska-Vincze Boglárka Dr. Szenci Ottó Készítette: Balog Eszter Témavezetők: dr. Baska-Vincze Boglárka Dr. Szenci Ottó Bevezetés A szívfrekvencia és a szívfrekvencia-változékonyság fontos mérőszámai a magzati jóllétnek (fetal wellbeing) Szívfrekvencia-változékonyság

Részletesebben

A disszertációban leírtakkal kapcsolatban észrevételeimet és kérdéseimet a szövegben való előfordulás sorrendjében teszem meg.

A disszertációban leírtakkal kapcsolatban észrevételeimet és kérdéseimet a szövegben való előfordulás sorrendjében teszem meg. OPPONENSI VÉLEMÉNY Hegedűs Attila: A csonthéjas gyümölcsök antioxidáns hatásában megnyilvánuló genetikai variabilitás jellemzése c. akadémiai doktori értekezéséről Az értekezésben Hegedűs Attila sok éves

Részletesebben

Fotoszenzibilizátorok felhalmozódásának nyomonkövetése és mennyiségi

Fotoszenzibilizátorok felhalmozódásának nyomonkövetése és mennyiségi Ph.D. Értekezés Tézisei Fotoszenzibilizátorok felhalmozódásának nyomonkövetése és mennyiségi szerkezet hatás összefüggései Vanyúr Rozália Témavezető: Dr. Héberger Károly Konzulens: Dr. Jakus Judit MTA

Részletesebben

Új terápiás lehetőségek helyzete. Dr. Varga Norbert Heim Pál Gyermekkórház Toxikológia és Anyagcsere Osztály

Új terápiás lehetőségek helyzete. Dr. Varga Norbert Heim Pál Gyermekkórház Toxikológia és Anyagcsere Osztály Új terápiás lehetőségek helyzete Dr. Varga Norbert Heim Pál Gyermekkórház Toxikológia és Anyagcsere Osztály Mucopolysaccharidosisok MPS I (Hurler-Scheie) Jelenleg elérhető oki terápiák Enzimpótló kezelés

Részletesebben

Publication list. List of papers published in extenso. Other publications

Publication list. List of papers published in extenso. Other publications Publication list List of papers published in extenso 1. Horváth K, Gődény M: Képalkotó vizsgálatok a nőgyógyászati daganatok stádium meghatározásában. Magyar Radiológia 2004; 78(6):284-292. 2. Horváth

Részletesebben

CONFIRM anti-estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody

CONFIRM anti-estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody CONFIRM anti-estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody 790-4324 50 790-4325 250 FELHASZNÁLÁSI TERÜLET 1. ábra. CONFIRM anti-er (SP1) festés lobuláris emlőcarcinómában. Ez az antitest

Részletesebben