OTKA Nyilvántartási szám: T ZÁRÓJELENTÉS Témavezető neve Dr. Balázs Csaba..

Méret: px
Mutatás kezdődik a ... oldaltól:

Download "OTKA Nyilvántartási szám: T037184 ZÁRÓJELENTÉS Témavezető neve Dr. Balázs Csaba.."


1 OTKA Nyilvántartási szám: T ZÁRÓJELENTÉS Témavezető neve Dr. Balázs Csaba.. A téma címe A Basedow-Graves kór immunológiai és molekuláris genetikai vizsgálata kutatás időtartama: Csatolt szakmai beszámoló 1. A szolubilis CD4 szint változása terhességben és posztpartum thyreoiditisben A poszt-partum thyreoiditis olyan szervspecifikus autoimmun megbetegedés, amelynek kialakulásában mind celluláris, mind humorális immunpatológiai faktorok szerepet játszanak. Az autoantitestek közül a pajzsmirigy peroxidáz enzim- és a thyreoglobulin elleni antitesteknek tulajdonítanak diagnosztikus jelentõséget. A poszt-partum thyreoiditis az ismételt terhesség után kiújulhat, azonban napjainkig sincsenek megbízható laboratóriumi adatok a betegség recidivájának elõre jelzésére. A vizsgálatunk célja: a szolubilis CD4 és CD8 molekulák mennyiségének meghatározása a terhesség alatt és szülést követõen azokban, akik korábban poszt-partum thyreoiditisben szenvedtek. A tanulmány további feladata volt, hogy választ adjon arra a kérdésre, hogy ezeknek a molekuláknak van-e jelentőségük a betegség recidívájának előre jelzésében. 48 beteget vontak be a vizsgálatba, akik korábbi szülésük után poszt-partum thyreoiditisben szenvedtek. A szülést követően a 48-ból 24 esetben a betegség kiújult. A 24 esetből 20-ban követték a betegek legfontosabb klinikai és immunológai laboratóriumi adatait a terhesség elsõ, második és harmadik trimeszterében, majd a szüléseket követõ elsõ, harmadik és hatodik hónapban. A szolubilis CD4-, CD8 szintek és a pajzsmirigy elleni antitestek titerének meghatározása ELISA módszerrel történt. A gyulladásos tünetek kiújulásában rizikót jelentett, ha az anya dohányzott és ha az újszülött fiú volt. A szolubilis CD4 és a szolubilis CD8 egészséges nem terhes nõkben 18,4±2,4 U/ml, ill. 363±54,6 U/ml, volt. A vizsgálat kezdetén az összes egyén euthyreosisos volt és a szérumukban pajzsmirigy elleni antitesteket nem lehetett kimutatni. Összehasonlítottuk a szolubilis CD4 és CD8 szinteket azokban az anyákban, akikben a thyreoiditis recidivált és azokban akikben nem. Azt találták, hogy a szolubilis CD8 szintekben nem volt lényeges eltérés betegek (379±59,7 U/ml) és az egészségesek (364±58,3U/ml) között. Feltünõ volt viszont, hogy azokban a terhesekben, akikben a recidiva nem következett be, a szolubilis CD4 szint a terhesség alatt szignifikánsan csökkent. Ez a csökkenés a 3. trimeszter végén volt a

2 legjelentősebb (16,5±2,1 U/ml) (p<0,001). A szülést követõen a szupprimált szolubilis CD4 szint fokozatosan normalizálódott, az 1. hónap után 19,7±2,35 U/ml, a 6. hónap végén 19,2±2,09 U/ml volt. A pajzsmirigy peroxidáz- és thyreoglobulin elleni antitestek titerének lényeges emelkedése viszont csak a szülést követõ 3. és 6. hónapokban következett be. Arra a következtetésre jutottunk, hogy a szolubilis CD4 koncentráció változása érzékeny indikátora a poszt-partum thyreoiditis recidivájának. Ezt az eredményünket szabadalomként jegyezték be az Egyesült Királyságban (GB /2004). p < 0.01 p < p < scd4 (U/ml) hó 3.hó 6.hó trimester szülés után 1. Ábra A szolubilis CD4 szint alakulása terhesség alatt és a szülést követően poszt-partum thyreoiditises és egészséges nőkben A kitöltött oszlopok a kontroll, az üresek a poszt-partum thyreoiditises nők szolubilis CD4 értékeit mutatják.

3 400 szülés antitestek titere (U/l) hónap 2. Ábra A pajzsmirigy eredetű peroxidáz (TPO) és a thyreoglobulin (Tg) elleni antitestek titerének alakulását mutatja a terhesség alatt és a szülést követően. A pontok a TPO elleni, a háromszögek a Tg elleni antitestek szintjét jelzik a recidivált posztpartum thyreoiditises betegekben. A körök és csillagok pedig a TPO és a Tg elleni antitestek titerét jelzik az egészségesekben. A nyíl a szülés időpontját mutatja. Azt is kimutattuk, hogy a PPT-ben szenvedőkben és a pajzsmirigy betegséghez társult orbitopathiás betegekben az pajzsmirigyben az Y kromoszóma lényegesen gyakoribb, mint a nem autoimmun pajzsmirigybetegekben. Az X chromosoma vörös vörös Y chromosoma zöld Az X chromosoma vörös Y kromoszóma: zöld X kromoszóma: vörös Y chromosoma kimutatása XX karitypusú anya pajzsmirigyében (FISH)

4 2. A pajzsmirigy betegséghez társult orbitopathia (endokrin ophthalmopathia) megelőzése pentoxifillinnel Prospektív, kontrollált vizsgálatunkban arra kerestek választ, hogy a pentoxifillin képes-e a pajzsmirigy betegséghez társult orbitopathia (TAO) kialakulásának megelőzésére. Ebből a célból összehasonlították a szemtünetek alakulását a metimazol+ placebóval, ill. a metimazol + pentoxifillinnel kezelt Basedow-Graves kóros betegekben. A kontroll csoportot 112 hyperthyreosisos, kezeletlen Basedow-Graves kóros beteg (átlagos életkor 44 ± 12,4 év, 83 nő és 29 férfi) képezte, akik metimazol + placebó kezelést kaptak. A pentoxifillin + metimazollal kezelt csoport szintén 112 betegből állott (átlagéletkor 47,7± 10,2 év, 83 nő és 29 férfi). A tanulmány kezdetén nem észleltünk lényeges különbséget sem a klinikai tünetekben, sem a laboratóriumi adatokban a két csoport között, ugyanakkor a pentoxifillin kezelés 6. és 12. hónapjában a középsúlyos és súlyos orbitopahtiás betegek száma lényegesen kevesebb volt. Az orbitopathia patomechanizmusában szerepet játszó kockázati tényezőket is vizsgálták. Kiderült, hogy a dohányzás önmagában, genetikai háttér nélkül is jelentősen növelte az orbitopathia kialakulásának kockázatát (OR:7,1 CI 95% 5,4-9,3, p<0,003), a dohányzás genetikai hajlammal együtt pedig tovább fokozta a szemtünetek manifesztációját, ill. progresszióját (OR: 9,2 CI 95%, 6,9-12,1, p<0,0001). A pentoxifillin kezelés kedvező preventív hatását figyelték meg mind a dohányzókban, mind azokban, akik a dohányzás mellett kedvezőtlen örökletes háttérrel is rendelkeztek (OR: 2,62 CI 95%, 1,5-3,7, p<0,001 2,12 CI 95% 1,5-3,1, p<0,001). A szerzők arra a következtetésre jutottak, hogy a 12 hónapos pentoxifillin kezelés gátolta az orbitopathia kialakulását, ill. megakadályozta súlyos, infiltratív formák manifesztációját. Ezért előnyösnek tartják a gyógyszer alkalmazását preventív céllal Basedow-Graves kóros betegekben a thyreosztatikus kezeléssel egyidőben, főként azokban, akik nem hajlandók lemondani a dohányzásról. 1. táblázat: A laboratóriumi adatok összehasonlító vizsgálata a tanulmány kezdetén és végén Kontroll csoport PTX csoport Kezelés előtt után előtt után TRAK (U/l) 7,1±0,41 3,6±0,23 8,9±0,4 2,3±0,14* FT4 (pmol/l) 4,1±0,16 1,13±0,03 4,2±0,16 1,19±0,03

5 FT3 (pmol/l) 6,5±0,23 2,23±0,07 6,3±0,48 2,29±0,14 TSH (mu/l) 0,15±0,01 2,9±0,04 0,12±0,01 3,2±0,08 * p<0.05) 2. táblázat A pentoxifillin hatása a szemtünetek kialakulásának valószínűségére ( FH= familiáris háttér,or:odds ratio Kontroll csoport OR (95%) p Dohányzó (n= 54) 7,1 (9,3-5,4) < 0,003 Dohányzó+ FH (n=39) 9,2 (6,9-12,1) < 0,001 PTX-el kezelt csoport OR (95%) p Dohányzó (n=58) 2,12 (1,5-3,1) 0,037 Dohányzó + FH (n=35) 2,62 (1,5-3,7) 3. táblázat A pentoxifillin hatása a TAO manifesztációjára a pentoxifillin kezelés 6. és 12. hónapja után Kezelés kezdete 6 hónap 12 hónap Kontroll PTX Kontroll PTX Kontroll PTX TAO jelek középsúlyos * 34 18* Súlyos ** 15 4** * = p < 0.01 ** p< 0.001

6 10 TSH-R elleni antitestek (TRAK ) IU/l * idő (hónap) 1. ábra : A TSH-R elleni antitestek szintje a kontroll és a pentoxifillinnel kezelt betegekben háromszögek = TSH-R elleni antitestek a kontroll csoportban üres négyszögek = TSH-R elleni antitestek a pentoxifillinnel kezelt csoportban * p < betegek száma idõ (hónap) 2. ábra : A TAO manifesztációja a placébó és pentoxifillinnel kezelt csoportban

7 négyszögek = betegek középsúlyos TAO-val a kontroll csoportban csillagok = betegek súlyos TAO-val a kontroll csoportban pontok = betegek középsúlyos TAO-al a pentoxifillinnel kezelt csoportban háromszögek = betegek súlyos TAO-val a pentoxifillinnel kezelt csoportban 3. TSH receptor evoluciójára, genetikai polimorfizmusára vonatkozó vizsgálataink. Kimutattuk, hogy a TSH-R magas spontán mutációs rátával rendelkezik. A jódhiányban a TSH-R főleg konstitutív típusú mutációnak száma jelentősen magasabb. A terhességben és fiatal felnőt korban adott jódpótlás lényeges a nem immun típusú TSH-R mutációk prevenciójában. A TSH-R strukturális plaszticitásának vizsgálata céljából szekvenáltuk az ember és két majom species (Macaca mulatta és a Cercopithecus aethiops) génjeit és analizáltuk az evoluciós trendeket. A két főemlős TSH-R génjei egy 764 aminosavból álló fehérjét kódolnak, amelyek 99% homologiát egymással. Ugyanakkor az ember TSH-R strukturális hasonlósága a C. aetiops esetében 97%-osnak, a M.mulatta esetében pedig 96%- osnak bizonyult. Az összehasonlító vizsgálatainkat kiterjesztettük még további 8 emlősre is. Az aminosavak szekvenciája a vizsgált 14 TSH receptorban hasonló volt. Megállapítottuk, hogy a leginkább variábilis szekvenciák az intracelluláris farki részen és a ciszteinben gazdag C részen figyelhetők meg, míg a receptor membránban lévő szakasz viszonylag konzervatív. Lényeges különbségeket találtunk az egyes fajok TSH-R-rainak glikozilációs helyeiben és számaiban. Ez egyben azt is jelenti, hogy a humán TSH-R külön epitopokkal rendelkezik, amelyek képesek a TSH-R elleni antitestek indukálására és kötésére. Vizsgálataink azt támasztották alá (elsőként az irodalomban), hogy a TSH-R elleni antitest egyedül emberben keletkezik és csak emberben okoz betegséget (BG kórt) nem a receptor mutációival, hanem azon sajátosságával áll összefüggésben, hogy képes a dimerizációra és oligomerizációra egyaránt. Table 1.The PCR primers used to amplify TSHR cdnas from Cercopithecus aethiops aethiops and Macaca mulatta Primer designation TSHR Primer Sequence (5-3 ) Strand sequence 1a TCCTTGAGTCCTTGATGTGT Sense 1b TGAGAGGCTTGTTCAGAATT Antisense 3a TTTGCAAGCGAGTTATCGGTGTA TA Sense





12 Table 2 Differences in the mature TSHR sequences between humans and old world Monkeys Residue Cercopithecidae Homo sapiens 32 Q H 63 R H 74 S N 83 L V 87 A V 101 N S 113 S N 192 I V 235 H Q 331 D G 333 G S 346 A T 389 V I 393 N S 601* Y H 727 E D 759 T M *The placement of H in this position was based on the original htshr sequence reported by Nagyama et al ( 23 ).Histidine in that position alters the basal activity of the receptor and its coupling to Gq/11, analysis of other clones by the same workers an the results of other investigators affirms a conserved Y in that position in all vertebrates. Only residues in which Homo differ from both Old World monkeys are considered. Table 2.Replacement substitutions of residues in the mature TSHR of 10 mammalian species Residue Region mull aethio homo cat dog pig Shee cow mus rat p 22 K K M K K K E E K R 23 G G G G G G R R E G 46 NCR R R R R R S R S R G 70 LLR1 H H H R R R R R L L 116 LLR3 Y Y Y Y S Y Y Y Y Y 139 LLR4 K K K G G R R R R R 169 LLR5 V V V A A A A A E E 235 LLR8 H H Q Y Y Y Y Y S S 296 CFR P L L L L L L L L L 307 CFR Q Q Q R R R R W R R 317 CFR A A A A T A A A I V 323 CFR H H H D D Y Y Y Y Y 329 CFR N N N Y Y D D del D G 330 CFR L L L L L L L L* P L

13 334 CFR I I I H H S S S* S H 337 CFR Y Y Y Y Y N Y Y* Y Y 346 CFR A A T T T T T T* S G 347 CFR H H H R D H H Q* P P 360 CFR E E E del E E E E* E E 426 TM1 L L L L* L L L L* L P 539 TM4 C C C Y* Y Y Y Y* Y Y 548 TM4 C C C C* C C C C* S S 588 TM5 T T T L* L L L L* L L 595 TM5 V V V I* I T I I* V V 617 I2 G G G G* G G G G* R R 660 TM7 K K K K* K K K K* K G 712 ICT P P P S* S S S S* C C 726 ICT H H H R* R Q P P* Q Q 738 ICT V V V D* E D D D* T T 741 ICT L L L L* L L L L* L P 743 ICT E E E E* E E G E* G G 749 ICT P P P P* P H P P* P P 751 ICT K K K K* K K Q Q* L L 755 ICT I I I I* I I T T* I I 760 ICT T T M N* N K K K* K T * Because of respective deletions (del) in residues 329 of cow and 360 of cat, all residue numerically above that position shown by the asterisk should have one subtracted. Numbering of residues is based on 764 residues in 8 mammals including 21 in the leader peptide. NCR=N-terminus cysteine -rich region, LLR= leucine rich repeats, CFR= C-flanking region, I2= second intra-cellular loop, TM= transmembrane helix, ICT= intracellular tail. Figure 2 Phylogenetic relationship between the 14 TSH receptor sequences considered in this study. Two major families are distinguished: teleosts and mammals and within the latter primates show up as a distinct clade. Clustering of other mammals: rodents, ungulates and carnivores are in keeping with speciation.

14 4. A TSH receptor elleni antitrestek meghatározása radioreceptor és ELISA módszerrel A radioreceptor és az enzim-jelzéses receptor immunoassay mérések eredményeit hasonlítottuk össz. 25 kontroll és 224 beteg szérumában. A kontroll csoport eredményeinek értékelésénél kitünt, hogy a két enzim-jelzéses kit (IASDONTRAb és a DLD) közül a DLD típusú nem korrelált az izotóp-jelzéses DYNO teszt értékekkel. Jóllehet a IASONTRAB kittel való mérésnél az értékek eltolódást mutattak a pozitív tartomány felé, de a DYNO teszttel szoros korrelációt adtak (r=0.622, P<0.001). Ez az eltolódás a referencia tartomány > 3 IU/lre emelésével jelentősen csökkenthető volt. 121 TRAK (DYNO teszt) pozitiív mintából 86 mindhárom tesztben pozitív volt. Az ELISA módszerek specificitása a DYNO teszt TRAK értékeihez viszinyítva a IASONTRAb-nál 60.7 % és a DLD-nél 50.9 %. A szenzitivitás a IASONTRAb-nál 72.7 % és a DLD-nél 90.9 %. Összegzésként megállapítható, hogy a kompetitív radioreceptor technikával szemben az ELISA módszer előnyösebb (1.2 ábra). 1.ábra

15 2.ábra

Az ophthalmopathia autoimmun kórfolyamatára utaló tényezôk Bizonyított: A celluláris és humorális autoimmun folyamatok szerepe.

Az ophthalmopathia autoimmun kórfolyamatára utaló tényezôk Bizonyított: A celluláris és humorális autoimmun folyamatok szerepe. Az ophthalmopathia autoimmun kórfolyamatára utaló tényezôk Bizonyított: A celluláris és humorális autoimmun folyamatok szerepe. szemizom, retrobulbaris kötôszövet, könnymirigy elleni autoantitestek exophthalmogen


Újabb eredmények a pajzsmirigy kórtanában (TSH receptor) Balázs Csaba Budai Irgalmasrendi Kórház MTA 2005

Újabb eredmények a pajzsmirigy kórtanában (TSH receptor) Balázs Csaba Budai Irgalmasrendi Kórház MTA 2005 Újabb eredmények a pajzsmirigy kórtanában (TSH receptor) Balázs Csaba Budai Irgalmasrendi Kórház MTA 2005 A pajzsmirigy nem immun immun eredetű betegségei Basedow-Graves kór Struma Hyperthyreosis Infiltrativ


ció szerepe a pajzsmirigy peroxidáz elleni antitestek szintjében autoimmun pajzsmirigybetegségekben

ció szerepe a pajzsmirigy peroxidáz elleni antitestek szintjében autoimmun pajzsmirigybetegségekben Szója okozta allergiás szenzitizáci ció szerepe a pajzsmirigy peroxidáz elleni antitestek szintjében autoimmun pajzsmirigybetegségekben gekben Dr. Molnár r Ildikó Kenézy Kórház, III.Belgyógy gyászat, Debrecen


Mindennapi pajzsmirigy diagnosztika: antitestek, hormonszintek

Mindennapi pajzsmirigy diagnosztika: antitestek, hormonszintek Mindennapi pajzsmirigy diagnosztika: antitestek, hormonszintek Nagy V. Endre Endokrinológia Tanszék Debreceni Egyetem Orvos- és Egészségtudományi Centrum Belgyógyászati Intézet, I. Belklinika A pajzsmirigybetegségek


Pajzsmirigy specifikus Calcitonin Tg Tg-Ab? Általános

Pajzsmirigy specifikus Calcitonin Tg Tg-Ab? Általános 1 A pajzsmirigy carcinomák utánkövetésének laboratóriumi módszereiről, a thyreoglobulin meghatározás gondja Toldy Erzsébet, Szombathely Szeged, Orvostovábbképzés 2009. november Rutinban mérhető pajzsmirigy



neuro-ophthalmológiaiophthalmológiai A neuroendokrin-immunológia immunológia korszerű diagnosztikus és terápiás lehetőségei neuro-ophthalmológiaiophthalmológiai betegségekben (endokrin orbitopathia) NEUROOPHTHALMOLÓGIA A KLINIKAI GYAKORLATBAN


Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály

Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Prenatalis diagnosztika lehetőségei mikor, hogyan, miért? Dr. Almássy Zsuzsanna Heim Pál Kórház, Budapest Toxikológia és Anyagcsere Osztály Definíció A prenatális diagnosztika a klinikai genetika azon


A szervspecifikus autoimmun betegségek pathomechanizmusa. Dr. Bakó Gyula DE OEC III. Belklinika Ph.D. Kurzus, Debrecen, 2011.

A szervspecifikus autoimmun betegségek pathomechanizmusa. Dr. Bakó Gyula DE OEC III. Belklinika Ph.D. Kurzus, Debrecen, 2011. A szervspecifikus autoimmun betegségek pathomechanizmusa Dr. Bakó Gyula DE OEC III. Belklinika Ph.D. Kurzus, Debrecen, 2011. Centrális és perifériás tolerancia Az adaptív immunitás esetén a tolerantia



ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS ÖREGEDÉS ÉLETTARTAM, EGÉSZSÉGES ÖREGEDÉS Mi az öregedés? Egyrészről az idő múlásával definiálható, a születéstől eltelt idővel mérhető, kronológiai sajátosságú, Másrészről az idő múlásához köthető biológiai,





Szakmai Protokollok rövid összefoglalás. Dr Böcskei Gyöngyi laborvezető főorvos

Szakmai Protokollok rövid összefoglalás. Dr Böcskei Gyöngyi laborvezető főorvos Szakmai Protokollok rövid összefoglalás Dr Böcskei Gyöngyi laborvezető főorvos Az Egészségügyi Minisztérium érvényben lévő szakmai protokolljai a labordiagnosztikára vonatkozóan Protokollok célja: I. A


Zárójelentés. A) A cervix nyújthatóságának (rezisztencia) állatkísérletes meghatározása terhes és nem terhes patkányban.

Zárójelentés. A) A cervix nyújthatóságának (rezisztencia) állatkísérletes meghatározása terhes és nem terhes patkányban. Zárójelentés A kutatás fő célkitűzése a β 2 agonisták és altípus szelektív α 1 antagonisták hatásának vizsgálata a terhesség során a patkány cervix érésére összehasonlítva a corpusra gyakorolt hatásokkal.


Immunológiai vizsgálatok az endokrin rendszer betegségeiben. Dr Gergely Péter egyetemi tanár

Immunológiai vizsgálatok az endokrin rendszer betegségeiben. Dr Gergely Péter egyetemi tanár Immunológiai vizsgálatok az endokrin rendszer betegségeiben Dr Gergely Péter egyetemi tanár Autoimmun endokrin betegségek Önálló betegségek 1 típusú diabetes mellitus (T1DM) Autoimmun thyreoiditisek Graves-Basedow






HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS HUMAN IMMUNDEFICIENCIA VÍRUS (HIV) ÉS AIDS Dr. Mohamed Mahdi MD. MPH. Department of Infectology and Pediatric Immunology University of Debrecen (MHSC) 2012 Diagnózis HIV antitest teszt: A HIV ellen termel


Várandós nők Streptococcus agalactiaeszűrése

Várandós nők Streptococcus agalactiaeszűrése Várandós nők Streptococcus agalactiaeszűrése MALDI-TOF MS módszerrel Pappné Ábrók Marianna, Arcson Ágnes, Urbán Edit, Deák Judit Szegedi Tudományegyetem, Általános Orvostudományi Kar Klinikai Mikrobiológiai


A diabetes mellitus laboratóriumi diagnosztikája

A diabetes mellitus laboratóriumi diagnosztikája A diabetes mellitus laboratóriumi diagnosztikája Laborvizsgálatok célja diabetes mellitusban 1. Diagnózis 2. Monitorozás 3. Metabolikus komplikációk kimutatása és követése Laboratóriumi tesztek a diabetes


szerzett tapasztalataink

szerzett tapasztalataink Anti-CCP mérése során szerzett tapasztalataink Geider Viola,Piros Alfrédn dné Baranya Megyei KórhK rház z Klinikai és Mikrobiológiai Laboratórium rium MOLSZE Kongresszus Pécs 2009 Bevezetı A rheumatoid


Autoan'testek vizsgáló módszerei, HLA 'pizálás. Immunológiai és Biotechnológiai Intézet PTE- ÁOK

Autoan'testek vizsgáló módszerei, HLA 'pizálás. Immunológiai és Biotechnológiai Intézet PTE- ÁOK Autoan'testek vizsgáló módszerei, HLA 'pizálás Immunológiai és Biotechnológiai Intézet PTE- ÁOK Természetes autoan'testek Pathológiás autoan'testek Természetes autoan'testek IgM Alacsony affinitás Alacsony


DOWN-KÓR INTRAUTERIN SZŰRÉSI LEHETŐSÉGEI. 2013 szeptemberi MLDT-tagozati ülésen elhangzottak

DOWN-KÓR INTRAUTERIN SZŰRÉSI LEHETŐSÉGEI. 2013 szeptemberi MLDT-tagozati ülésen elhangzottak DOWN-KÓR INTRAUTERIN SZŰRÉSI LEHETŐSÉGEI 2013 szeptemberi MLDT-tagozati ülésen elhangzottak 21-es triszómia: Mi az a Down kór Down-kór gyakorisága: 0,13% Anya életkora (év) 20 25 30 35 40 45 49 Down-kór


Terhesgondozás, ultrahangvizsgálat Dr. Tekse István. www.szulesz-nogyogyaszt.hu

Terhesgondozás, ultrahangvizsgálat Dr. Tekse István. www.szulesz-nogyogyaszt.hu Terhesgondozás, ultrahangvizsgálat Dr. Tekse István www.szulesz-nogyogyaszt.hu 1. Fogamzás előtti ( praeconceptionalis ) tanácsadás, gondozás 2. Kismamák gondozása a szülésig 1. A kismama és fejlődő magzatának





Az Integrált-teszt. teszt összehasonlítása a jelenlegi terhesgondozás gyakorlatával

Az Integrált-teszt. teszt összehasonlítása a jelenlegi terhesgondozás gyakorlatával Az Integrált-teszt teszt összehasonlítása a jelenlegi terhesgondozás gyakorlatával Skriba Eszter /Állami Egészségügyi Központ/ Merhala Zoltán Timmermann Gábor /SE.II. Női Klinika/ Magzati Diagnosztikai


Gyógyszeres kezelések

Gyógyszeres kezelések Gyógyszeres kezelések Az osteogenesis imperfecta gyógyszeres kezelésében számos szert kipróbáltak az elmúlt évtizedekben, de átütő eredménnyel egyik se szolgált. A fluorid kezelés alkalmazása osteogenesis


Colorectalis carcinomában szenvedő betegek postoperatív öt éves követése

Colorectalis carcinomában szenvedő betegek postoperatív öt éves követése Colorectalis carcinomában szenvedő betegek postoperatív öt éves követése Kegyes Lászlóné 1, Némethné Lesó Zita 1, Varga Sándor Attiláné 1, Barna T. Katalin 1, Rombauer Edit 2 Dunaújvárosi Prodia Központi


Immunológiai módszerek a klinikai kutatásban

Immunológiai módszerek a klinikai kutatásban Immunológiai módszerek a klinikai kutatásban 7. előadás Immunizálás. Poliklonális és monoklonális ellenanyag előállítása, tisztítása, alkalmazása Az antigén (haptén + hordozó) sokféle specificitású ellenanyag



ANYAGCSERE ENDOKRINOLÓGIA THYREOIDITISEK. Definíció és alapvetõ megállapítások. I. Akut thyreoiditis TÜNETTAN DIAGNOSZTIKUS PROTOKOLL DEFINÍCIÓ THYREOIDITISEK Magyar Endokrinológiai és Anyagcsere Társaság Definíció és alapvetõ megállapítások Napjainkban a pajzsmirigy gyulladásos betegségeit a klinikai jelek alapján legegyszerûbben és elfogadottan



CSALÁDTERVEZ TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE. Dr. Erős s Erika CSALÁDTERVEZ DTERVEZÉS KÜLÖNÖS TEKINTETTEL A PSZICHIÁTRIAI BETEGSÉGEKRE GEKRE Dr. Erős s Erika A családtervez dtervezés s törtt rténete Magyarországon gon Veleszületett letett rendellenességek (CA) Jelenleg


Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon

Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Hibridspecifikus tápanyag-és vízhasznosítás kukoricánál csernozjom talajon Karancsi Lajos Gábor Debreceni Egyetem Agrár és Gazdálkodástudományok Centruma Mezőgazdaság-, Élelmiszertudományi és Környezetgazdálkodási


KAWASAKI?, YAMAHA? avagy Magas liquor-fehérje FUO hátterében

KAWASAKI?, YAMAHA? avagy Magas liquor-fehérje FUO hátterében KAWASAKI?, YAMAHA? avagy Magas liquor-fehérje FUO hátterében LIPTAI ZOLTÁN Varga Edit Constantin Tamás 14 é Komolyabb betegség Ø 2012.IX-2013.III.: 3 alkalommal láz, fejfájás, 6 kg fogyás 2013.III.8-tól:


20 éves a Mamma Klinika

20 éves a Mamma Klinika 20 éves a Mamma Klinika A sejtdiagnosztika modern eszközei a diagnosztikában és terápiában dr Járay Balázs, dr Székely Eszter Medserv Kft, Semmelweis Egyetem II. Patológiai Intézet Budapest 1 22196 betegből


A pajzsmirigybetegségek diagnosztikája

A pajzsmirigybetegségek diagnosztikája A pajzsmirigybetegségek diagnosztikája A pajzsmirigy szabályozása A pajzsmirigy élettana T 4 felezési idő: 1 hét T 3 felezési idő: 1 nap, csak 15 20% a pajzsmirigyben Dejodináz [T 4 T 3 (3,5,3 )] 1-es


OTKA Zárójelentés. I. Ösztrogén receptor α génpolimorfizmusok vizsgálata ischaemiás stroke-ban

OTKA Zárójelentés. I. Ösztrogén receptor α génpolimorfizmusok vizsgálata ischaemiás stroke-ban OTKA Zárójelentés A téma megnevezése: Az ösztrogén receptor gén polimorfizmus és a lipoproteinek, valamint egyes alvadási tényezők kapcsolata. Az ösztrogén receptor gén polimorfizmus szerepe a cardiovascularis





PrenaTest Újgenerációs szekvenálást és z-score

PrenaTest Újgenerációs szekvenálást és z-score PrenaTest Újgenerációs szekvenálást és z-score számítást alkalmazó, nem-invazív prenatális molekuláris genetikai teszt a magzati 21-es triszómia észlelésére, anyai vérből végzett DNS izolálást követően





A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban

A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban BEVEZETÉS ÉS A KUTATÁS CÉLJA A zsírszövet mellett az agyvelő lipidekben leggazdagabb szervünk. Pontosabban az agy igen gazdag hosszú szénláncú politelítetlen zsírsavakban (LCPUFA), mint az arachidonsav


Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén

Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Molekuláris biológiai eljárások alkalmazása a GMO analitikában és az élelmiszerbiztonság területén Dr. Dallmann Klára A molekuláris biológia célja az élőlények és sejtek működésének molekuláris szintű


OPPONENSI VÉLEMÉNY. Dr. Lakatos Péter László köztestületi azonosító: 15893 az MTA Doktora cím elnyerése érdekében benyújtott,

OPPONENSI VÉLEMÉNY. Dr. Lakatos Péter László köztestületi azonosító: 15893 az MTA Doktora cím elnyerése érdekében benyújtott, OPPONENSI VÉLEMÉNY Dr. Lakatos Péter László köztestületi azonosító: 15893 az MTA Doktora cím elnyerése érdekében benyújtott, GENETIKAI, SZEROLÓGIAI ÉS KLINIKAI TÉNYEZŐK SZEREPE A GYULLADÁSOS BÉLBETEGSÉGEK


Pajzsmirigy betegségek

Pajzsmirigy betegségek Pajzsmirigy betegségek 1. A pajzsmirigy élettana 2. Hypothyreosis 3. Hyperthyreosis 4. Pajzsmirigy tumorok 5. Esettanulmányok 1-5 A pajzsmirigy fejlődéstana Amennyiben nem fejlődik ki - congenitalis hypothyreosis


Minden leendő szülő számára a legfontosabb, hogy születendő gyermeke egészséges legyen. A súlyosan beteg gyermek komoly terheket ró a családra.

Minden leendő szülő számára a legfontosabb, hogy születendő gyermeke egészséges legyen. A súlyosan beteg gyermek komoly terheket ró a családra. Egészséges magzat, biztonságos jövő Minden leendő szülő számára a legfontosabb, hogy születendő gyermeke egészséges legyen. A súlyosan beteg gyermek komoly terheket ró a családra. A veleszületett fejlődési


Embriószelekció PGD-vel genetikai terheltség esetén. Kónya Márton Istenhegyi Géndiagnosztika

Embriószelekció PGD-vel genetikai terheltség esetén. Kónya Márton Istenhegyi Géndiagnosztika Embriószelekció PGD-vel genetikai terheltség esetén Kónya Márton Istenhegyi Géndiagnosztika A praeimplantatiós genetikai diagnosztika (PGD) a praenatalis diagnosztika legkorábbi formája, a beágyazódás


4.3 Ellenjavallatok A terhesség második és harmadik trimesztere (lásd 4.4 és 4.6 pont) (Megjegyzés: szoptatásban nem ellenjavallt, lásd: 4.3 pont.

4.3 Ellenjavallatok A terhesség második és harmadik trimesztere (lásd 4.4 és 4.6 pont) (Megjegyzés: szoptatásban nem ellenjavallt, lásd: 4.3 pont. ACE-gátlók és angiotenzin II antagonisták: alkalmazás terhességben és szoptatás alatt A PhVWP által 2008 októberben jóváhagyott alkalmazási előírás és betegtájékoztató szöveg ACE-gátlók Lisinopril, Fosinopril,





szerepe a pajzsmirigy betegségek gek diagnosztikájában

szerepe a pajzsmirigy betegségek gek diagnosztikájában Laboratóriumi riumi vizsgálatok szerepe a pajzsmirigy betegségek gek diagnosztikájában és gondozásában Lıcsei Zoltán Markusovszky Kórház, Szombathely A pajzsmirigy acinus Kolloid hormonok tárolása Vérerek


Rovarméreg (méh, darázs) - allergia

Rovarméreg (méh, darázs) - allergia Rovarméreg (méh, darázs) - allergia Herjavecz Irén Országos Korányi TBC és Pulmonológiai Intézet Epidemiológia I. Prevalencia: - nagy helyi reakció: felnőtt 10-15 % - szisztémás reakció: gyerek 0.4-0.8


a legérzékenyebb markerkombináció emlôdaganatoknál

a legérzékenyebb markerkombináció emlôdaganatoknál TPA és CA 15-3 a legérzékenyebb markerkombináció emlôdaganatoknál Bevezetés Az emlôrák a leggyakoribb rosszindulatú betegség nôknél. Elôfordulásának gyakorisága 100.000 személybôl átlagosan 60 eset (1)


40/2013. (II. 14.) Korm. rendelet az állatkísérletekről 2014.03.26 2016.12.31 4 40/2013. (II. 14.) Korm. rendelet az állatkísérletekről

40/2013. (II. 14.) Korm. rendelet az állatkísérletekről 2014.03.26 2016.12.31 4 40/2013. (II. 14.) Korm. rendelet az állatkísérletekről 40/2013. (II. 14.) Korm. rendelet az állatkísérletekről 2014.03.26 2016.12.31 4 40/2013. (II. 14.) Korm. rendelet az állatkísérletekről A Kormány az állatok védelméről és kíméletéről szóló 1998. évi XXVIII.


VI. Az iskolában. Mit csinálsz az iskolában? Írok, olvasok, rajzolok, tornázom és énekelek. Mettől meddig vagy az iskolában? 7 óra 20 perctől egyig.

VI. Az iskolában. Mit csinálsz az iskolában? Írok, olvasok, rajzolok, tornázom és énekelek. Mettől meddig vagy az iskolában? 7 óra 20 perctől egyig. VI. Az iskolában A. Mit csinálsz az iskolában? Írok, olvasok, rajzolok, tornázom és énekelek. Mettől meddig vagy az iskolában? 7 óra 20 perctől egyig. B. Zsuzsa: Reggel 7.35 perckor már az iskolában vagyok.


Zárójelentés. Állati rotavírusok összehasonlító genomvizsgálata. c. OTKA kutatási programról. Bányai Krisztián (MTA ATK ÁOTI)

Zárójelentés. Állati rotavírusok összehasonlító genomvizsgálata. c. OTKA kutatási programról. Bányai Krisztián (MTA ATK ÁOTI) Zárójelentés Állati rotavírusok összehasonlító genomvizsgálata c. OTKA kutatási programról Bányai Krisztián (MTA ATK ÁOTI) 2012 1 Az Állati rotavírusok összehasonlító genomvizsgálata c. programban azt



EPIDEMIOLÓGIAI ALAPFOGALMAK ÉS STANDARDIZÁLÁS EPIDEMIOLÓGIAI ALAPFOGALMAK ÉS STANDARDIZÁLÁS TANULJON EPIDEMIOLÓGIÁT! mert része a curriculumnak mert szüksége lesz rá a bármilyen tárgyú TDK munkában, szakdolgozat és rektori pályázat írásában mert szüksége


2 kultúra. Zétényi Tamás. www.nytud.hu/depts/tlp/quantification zetenyi@nytud.hu

2 kultúra. Zétényi Tamás. www.nytud.hu/depts/tlp/quantification zetenyi@nytud.hu 2 kultúra Zétényi Tamás www.nytud.hu/depts/tlp/quantification zetenyi@nytud.hu MTA Nyelvtudományi Intézet - 'Elmélet és kísérlet a nyelvészetben' Budapest, 2014. február 25 agenda: mit csinálunk? mit veszünk


Fenti előzmények alapján kutatásunk során alapvetően három témakört vizsgáltunk:

Fenti előzmények alapján kutatásunk során alapvetően három témakört vizsgáltunk: Szakami összefoglaló jelentés a T/F 037876 számú,,deiminált fehérjeantigének szerepének vizsgálata a rheumatoid arthritis patomechanizmusában és diagnosztikájában" kutatási terv 2002-2005 év során elért


Az AT 1A -angiotenzinreceptor G-fehérjétől független jelátvitelének vizsgálata C9 sejtekben. Doktori tézisek. Dr. Szidonya László

Az AT 1A -angiotenzinreceptor G-fehérjétől független jelátvitelének vizsgálata C9 sejtekben. Doktori tézisek. Dr. Szidonya László Az AT 1A -angiotenzinreceptor G-fehérjétől független jelátvitelének vizsgálata C9 sejtekben Doktori tézisek Dr. Szidonya László Semmelweis Egyetem Molekuláris Orvostudományok Doktori Iskola Témavezető:


A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon

A rosszindulatú daganatos halálozás változása 1975 és 2001 között Magyarországon A rosszindulatú daganatos halálozás változása és között Eredeti közlemény Gaudi István 1,2, Kásler Miklós 2 1 MTA Számítástechnikai és Automatizálási Kutató Intézete, Budapest 2 Országos Onkológiai Intézet,


Kibővült laboratóriumi diagnosztikai lehetőségek a férfi infertilitás kivizsgálásában. Dr. Németh Julianna Laboratórium KFT, Budapest

Kibővült laboratóriumi diagnosztikai lehetőségek a férfi infertilitás kivizsgálásában. Dr. Németh Julianna Laboratórium KFT, Budapest Kibővült laboratóriumi diagnosztikai lehetőségek a férfi infertilitás kivizsgálásában Dr. Németh Julianna Laboratórium KFT, Budapest Infertilitás/subfertilitás Férfi infertilitás esetek 90%-ban spermium


Terhesség és immunitás 2012.03.02. Immunhematológiai terhesgondozás ÚHB Újszülöttek transzfúziója

Terhesség és immunitás 2012.03.02. Immunhematológiai terhesgondozás ÚHB Újszülöttek transzfúziója Egészségügyi szakdolgozók transzfúziológiai továbbképzése 2012. március 5-9. Immunhematológiai terhesgondozás ÚHB Újszülöttek transzfúziója Dr. Nemes Nagy Zsuzsa Országos Vérellátó Szolgálat Terhesség


A magyar racka juh tejének beltartalmi változása a laktáció alatt

A magyar racka juh tejének beltartalmi változása a laktáció alatt A magyar racka juh tejének beltartalmi változása a laktáció alatt Nagy László Komlósi István Debreceni Egyetem Agrártudományi Centrum, Mezőgazdaságtudományi Kar, Állattenyésztés- és Takarmányozástani Tanszék,


Ellenanyagok kimutatása diagnosztikai/prognosztikai célból

Ellenanyagok kimutatása diagnosztikai/prognosztikai célból Ellenanyagok kimutatása diagnosztikai/prognosztikai célból Dr. Prohászka Zoltán Az MTA doktora Semmelweis Egyetem III. Sz. Belgyógyászati Klinika 2012-03-27 prohoz@kut.sote.hu Mennyiség Előfordulás (szekréció)


30 év tapasztalata a TTP-HUS kezelésében

30 év tapasztalata a TTP-HUS kezelésében 30 év tapasztalata a TTP-HUS kezelésében Dr.Réti Marienn Egyesített Szent István és Szent László Kórház Hematológia és Őssejt-transzplantációs Osztály Thrombotikus mikroangiopathiák ENDOTHEL INFEKCIÓK:


EXKLUZÍV AJÁNDÉKANYAGOD A Phrasal Verb hadsereg! 2. rész

EXKLUZÍV AJÁNDÉKANYAGOD A Phrasal Verb hadsereg! 2. rész A Phrasal Verb hadsereg! 2. rész FONTOS! Ha ennek az ajándékanyag sorozatnak nem láttad az 1. részét, akkor mindenképpen azzal kezdd! Fekete Gábor www.goangol.hu A sorozat 1. részét itt éred el: www.goangol.hu/ajandekok/phrasalverbs


A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin

A géntechnikák alkalmazási területei leltár. Géntechnika 3. Dr. Gruiz Katalin A géntechnikák alkalmazási területei leltár Géntechnika 3 Dr. Gruiz Katalin Kutatás Genetikai: genomok feltérképezése: HUGO, mikroorganizmusoké, ujjlenyomatok készítése, jellegzetes szekvenciák keresése


Coeliakia: A klinikus szemével. Dr. Arató András egyetemi tanár, az MTA doktora SE I. Gyermekklinika

Coeliakia: A klinikus szemével. Dr. Arató András egyetemi tanár, az MTA doktora SE I. Gyermekklinika Coeliakia: A klinikus szemével Dr. Arató András egyetemi tanár, az MTA doktora SE I. Gyermekklinika Őstörténet Emberszabásúak: ~ 3 millió éve Homo sapiens: ~ 100,000 éve vadászok, halászok, gyűjtögetők:


LUPUSZ KVÍZ. Kérdések, megoldások, ajándéksorsolás. 2012. december 1.

LUPUSZ KVÍZ. Kérdések, megoldások, ajándéksorsolás. 2012. december 1. LUPUSZ KVÍZ Kérdések, megoldások, ajándéksorsolás 2012. december 1. 1. kérdés: Mi történik egy lupuszos beteg immunrendszerében? A Az immunrendszer túl kevés antitestet termel. B Az immunrendszer antitesteket


Súlyos infekciók differenciálása a rendelőben. Dr. Fekete Ferenc Heim Pál Gyermekkórház Madarász utcai Gyermekkórháza

Súlyos infekciók differenciálása a rendelőben. Dr. Fekete Ferenc Heim Pál Gyermekkórház Madarász utcai Gyermekkórháza Súlyos infekciók differenciálása a rendelőben Dr. Fekete Ferenc Heim Pál Gyermekkórház Madarász utcai Gyermekkórháza Miért probléma a lázas gyermek a rendelőben? nem beteg - súlyos beteg otthon ellátható


Diagnosztikai irányelvek Paget-kórban

Diagnosztikai irányelvek Paget-kórban Diagnosztikai irányelvek Paget-kórban Dr. Donáth Judit Országos Reumatológiai és Fizioterápiás Intézet, Budapest HALADÁS A REUMATOLÓGIA, IMMUNOLÓGIA ÉS OSTEOLÓGIA TERÜLETÉN 2012-2014 2015. ÁPRILIS 17.


A szarvasmarhák vírusos hasmenése ( BVDV) Nemzetközi mentesítési tapasztalatok

A szarvasmarhák vírusos hasmenése ( BVDV) Nemzetközi mentesítési tapasztalatok A szarvasmarhák vírusos hasmenése ( BVDV) Nemzetközi mentesítési tapasztalatok Dr. Peter Franken Budapest 2013 BVD elleni védekezés a szarvasmarhaállományokban 1. Bevezetés és holland szarvasmarha-adatok





A jövedelem alakulásának vizsgálata az észak-alföldi régióban az 1997-99. évi adatok alapján

A jövedelem alakulásának vizsgálata az észak-alföldi régióban az 1997-99. évi adatok alapján A jövedelem alakulásának vizsgálata az észak-alföldi régióban az 1997-99. évi adatok alapján Rózsa Attila Debreceni Egyetem Agrártudományi Centrum, Agrárgazdasági és Vidékfejlesztési Intézet, Számviteli


A nemi különbségek vizsgálatáról lévén szó, elsődleges volt a nemi hormonok, mint belső környezetbeli különbségeket létrehozó tényezők szerepének

A nemi különbségek vizsgálatáról lévén szó, elsődleges volt a nemi hormonok, mint belső környezetbeli különbségeket létrehozó tényezők szerepének Kutatási beszámoló Pályázatunk célja annak kiderítése volt, hogy az agyi asztrociták mutatnak-e nemi különbségeket, akár struktura, akár területi megoszlás, akár reaktivitás tekintetében. Alkalmazott megközelítésünk


Hypothyreosis és s terhesség. Anya, magzat,újsz

Hypothyreosis és s terhesség. Anya, magzat,újsz Hypothyreosis és s terhesség. Anya, magzat,újsz jszülött. Dr. Molnár Ildikó Immunendokrinológia, EndoMed, Debrecen Hypothyreosishoz vezet okok Nknél l 7.5%, férfiaknf rfiaknál l 2.8% (> 10 miu/ml TSH)


IMMUNOLÓGIA VILÁGNAP 2012. április 26 Prof. Dr. Dankó Katalin DEOEC III. Belklinika Klinikai Immunológiai Tanszék

IMMUNOLÓGIA VILÁGNAP 2012. április 26 Prof. Dr. Dankó Katalin DEOEC III. Belklinika Klinikai Immunológiai Tanszék A reumatológiai/gyulladásos betegségek felismerése és szövődményei IMMUNOLÓGIA VILÁGNAP 2012. április 26 Prof. Dr. Dankó Katalin DEOEC III. Belklinika Klinikai Immunológiai Tanszék Gyulladásos betegségek


TestLine - Angol teszt Minta feladatsor

TestLine - Angol teszt Minta feladatsor Minta felaatsor venég Téma: Általános szintfelmérő Aláírás:... Dátum: 2016.05.29 08:18:49 Kérések száma: 25 kérés Kitöltési iő: 1:17:27 Nehézség: Összetett Pont egység: +6-2 Értékelés: Alaértelmezett értékelés


Dr. Szamosi Tamás egyetemi magántanár 2015/16 tanév



Animal welfare, etológia és tartástechnológia

Animal welfare, etológia és tartástechnológia Animal welfare, etológia és tartástechnológia Animal welfare, ethology and housing systems Volume 4 Issue 2 Különszám Gödöllı 2008 468 EGYEDAZONOSÍTÁS ÉS SZÁRMAZÁSELLENİRZÉS HIPERPOLIMORF MIKROSZATELLITA





A 0 64 éves férfiak és nők cerebrovascularis betegségek okozta halálozásának relatív kockázata Magyarországon az EU 15

A 0 64 éves férfiak és nők cerebrovascularis betegségek okozta halálozásának relatív kockázata Magyarországon az EU 15 A hipertónia, mint kiemelt kardiovaszkuláris rizikófaktor befolyásoló tényezőinek és ellátásának vizsgálata az alapellátásban Dr. Sándor János, Szabó Edit, Vincze Ferenc Debreceni Egyetem OEC Megelőző


Ez az alkalmazási előírás és a betegtájékoztató az előterjesztési eljárás eredménye alapján jött létre.

Ez az alkalmazási előírás és a betegtájékoztató az előterjesztési eljárás eredménye alapján jött létre. II. melléklet Az alkalmazási előírás és a betegtájékoztató módosítása az Európai Gyógyszerügynökség előterjesztésére Ez az alkalmazási előírás és a betegtájékoztató az előterjesztési eljárás eredménye


Regulációs zavarok kutatása az Egészséges utódokért program keretében

Regulációs zavarok kutatása az Egészséges utódokért program keretében Regulációs zavarok kutatása az Egészséges utódokért program keretében Scheuring N.(1); Danis I.(2); Németh T.(3); Papp E.(1); Czinner Antal Prof.(1) Heim Pál Gyermekkórház, Budapest, Belgyógyászat (1);


Méhnyakrák megelőzés - beszéljük meg!

Méhnyakrák megelőzés - beszéljük meg! Méhnyakrák megelőzés - beszéljük meg! Dr. Ács Nándor Semmelweis Egyetem II.sz. Szülészeti és Nőgyógyászati Klinika Az előadás a GlaxoSmithKline Kft. felkérésére készült A méhnyakrák gyakori betegség Világszerte:


CONFIRM anti-estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody

CONFIRM anti-estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody CONFIRM anti-estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody 790-4324 50 790-4325 250 FELHASZNÁLÁSI TERÜLET 1. ábra. CONFIRM anti-er (SP1) festés lobuláris emlőcarcinómában. Ez az antitest


Roma terhesek gondozásának speciális szempontjai

Roma terhesek gondozásának speciális szempontjai Roma terhesek gondozásának speciális szempontjai Dr. Timmermann Gábor Forrás: Dr. Papp- Dr. Rigó: A várandós nő gondozása Miért kell külön foglalkoznunk ezzel a kérdéssel? Rasszizmusból? Nem, hanem mert





A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán

A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán A stresszteli életesemények és a gyermekkori depresszió kapcsolatának vizsgálata populációs és klinikai mintán Doktori értekezés tézisei Dr. Mayer László Semmelweis Egyetem Mentális Egészségtudományok


Lövedékálló védőmellényekben alkalmazható ballisztikai kerámia megfelelőségének vizsgálata röntgendiffrakciós (XRD) módszerrel

Lövedékálló védőmellényekben alkalmazható ballisztikai kerámia megfelelőségének vizsgálata röntgendiffrakciós (XRD) módszerrel Lövedékálló védőmellényekben alkalmazható ballisztikai kerámia megfelelőségének vizsgálata röntgendiffrakciós (XRD) módszerrel XRD study on suitability of aluminium-oxide based ballistic ceramics used


VI. ENDOKRINOLÓGIAI TOVÁBBKÉPZŐ TANFOLYAM PROGRAM Budapest, Novotel Centrum Hotel 2010. november 26-27.

VI. ENDOKRINOLÓGIAI TOVÁBBKÉPZŐ TANFOLYAM PROGRAM Budapest, Novotel Centrum Hotel 2010. november 26-27. VI. ENDOKRINOLÓGIAI TOVÁBBKÉPZŐ TANFOLYAM PROGRAM Budapest, Novotel Centrum Hotel 2010. november 26-27. 2010. november 26., péntek 08.30 18.00 REGISZTRÁCIÓ 09.30-09.40 MEGNYITÓ Halász Béla egyetemi tanár,


A psoriasis kezelése kórházunkban: eredményeink, céljaink. Dr. Hortobágyi Judit

A psoriasis kezelése kórházunkban: eredményeink, céljaink. Dr. Hortobágyi Judit A psoriasis kezelése kórházunkban: eredményeink, céljaink Dr. Hortobágyi Judit Psoriasis vulgaris Öröklött hajlamon alapuló, krónikus, gyulladásos bőrbetegség Gyakorisága Európában 2-3% Magyarországon


T helper és T citotoxikus limfociták szerepének vizsgálata allergológiai és autoimmun bőrgyógyászati kórképekben

T helper és T citotoxikus limfociták szerepének vizsgálata allergológiai és autoimmun bőrgyógyászati kórképekben T helper és T citotoxikus limfociták szerepének vizsgálata allergológiai és autoimmun bőrgyógyászati kórképekben A most befejezett OTKA pályázat célkitűzése volt immunmediált bőrgyógyászati ill. bőrgyógyászati


BETEGTÁJÉKOZTATÓ Genetikai szűrés lehetőségei az Országos Onkológiai Intézetben

BETEGTÁJÉKOZTATÓ Genetikai szűrés lehetőségei az Országos Onkológiai Intézetben Norvég Finanszírozási Mechanizmus által támogatott projekt mus által támogatott projekt BETEGTÁJÉKOZTATÓ Genetikai szűrés lehetőségei az Országos Onkológiai Intézetben Kedves Betegeink! A daganatokról


A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei

A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A keringı tumor markerek klinikai alkalmazásának aktuális kérdései és irányelvei A TM vizsgálatok alapkérdései A vizsgálatok célja, információértéke? Az alkalmazás területei? Hogyan válasszuk ki az alkalmazott


A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék

A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások. Egyed Balázs ELTE Genetikai Tanszék A humán mitokondriális genom: Evolúció, mutációk, polimorfizmusok, populációs vonatkozások Egyed Balázs ELTE Genetikai Tanszék Endoszimbiotikus gén-transzfer (Timmis et al., 2004, Nat Rev Gen) Endoszimbiotikus


??? Milyen nagyságrendben kering a plazmában a hcg szint normál terhességben? 2009. november, továbbképzés Szeged.

??? Milyen nagyságrendben kering a plazmában a hcg szint normál terhességben? 2009. november, továbbképzés Szeged. ESETISMERTETÉS: BIOKÉMIAI HYPERTHYREOTIKUS KRÍZIS? Toldy Erzsébet,5, Kneffel Pál 2, Lőcsei Zoltán 3, Cooke Justin 4 Vs Megye és Szombthely MJV Mrkusovszky Kórház, Központi Lbortórium, Szülészeti és Nőgyógyászti


A Fusarium solani-val szembeni ellenállóképesség vizsgálata különböző zöldborsó fajtákon és nemesítési kombinációkon

A Fusarium solani-val szembeni ellenállóképesség vizsgálata különböző zöldborsó fajtákon és nemesítési kombinációkon A Fusarium solani-val szembeni ellenállóképesség vizsgálata különböző zöldborsó fajtákon és nemesítési kombinációkon Mendlerné Drienyovszki Nóra 1 Mándi Lajosné 2 Debreceni Egyetem Agrártudományi Centrum,


Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről

Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Opponensi Vélemény Dr. Nagy Bálint A valósidejű PCR alkalmazása a klinikai genetikai gyakorlatban ' című értekezéséről Dr. Nagy Bálint az MTA doktora fokozat megszerzéséhez a fenti címen nyújtott be a


Új könnyűlánc diagnosztika. Dr. Németh Julianna Országos Gyógyintézeti Központ Immundiagnosztikai Osztály MLDT-MIT Továbbképzés 2006

Új könnyűlánc diagnosztika. Dr. Németh Julianna Országos Gyógyintézeti Központ Immundiagnosztikai Osztály MLDT-MIT Továbbképzés 2006 Új könnyűlánc diagnosztika Dr. Németh Julianna Országos Gyógyintézeti Központ Immundiagnosztikai Osztály MLDT-MIT Továbbképzés 2006 1845 Bence Jones Protein vizelet fehérje 1922 BJP I-II típus 1956 BJP



HUMAN IMMUNODEFICIENCY VIRUS (HIV) ÉS AIDS HUMAN IMMUNODEFICIENCY VIRUS (HIV) ÉS AIDS Dr. Mohamed Mahdi MD. MPH. Department of Infectology and Pediatric Immunology University of Debrecen 2010 Történelmi tények a HIV-ről 1981: Első megjelenés San


Immunkomplexek kialakulása, immunkomplexek által okozott patológiás folyamatok

Immunkomplexek kialakulása, immunkomplexek által okozott patológiás folyamatok Immunkomplexek kialakulása, immunkomplexek által okozott patológiás folyamatok 2016. április 20. Bajtay Zsuzsa Az ellenanyag molekula felépítése antigénfelismerés Variábilis Konstans effektor-funkciók


Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben

Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben Genetikai polimorfizmus vizsgálatok 1-es típusú cukorbetegségben Dr. Hermann Csaba Doktori (Ph.D.) Értekezés Tézisfüzet Témavezetı: Prof. Dr. Madácsy László egyetemi tanár Programvezetı: Prof. Dr. Tulassay
